Leukemia & Lymphoma, November 2014; 55(11): 2525–2531 © 2014 Informa UK, Ltd. ISSN: 1042-8194 print / 1029-2403 online DOI: 10.3109/10428194.2014.893307
ORIGINAL ARTICLE: CLINICAL
Polymorphisms in the human organic cation transporter and the multidrug resistance gene: correlation with imatinib levels and clinical course in patients with chronic myeloid leukemia Jacob Vine1, Sara Bar Cohen2, Rosa Ruchlemer2, Neta Goldschmidt2, Moshe Levin3, Diana Libster3, Alexander Gural2, Moshe E. Gatt2, David Lavie2, Dina Ben-Yehuda2 & Deborah Rund2 Leuk Lymphoma Downloaded from informahealthcare.com by University of Louisville on 01/09/15 For personal use only.
1Department of Medicine, Hebrew University-Hadassah Medical School, Jerusalem, Israel, 2Department of Hematology,
Hebrew University-Hadassah Medical Organization, Jerusalem, Israel and 3Department of Hematology Mt. Scopus, Shaare Zedek Medical Center, Jerusalem, Israel
to efficacy in successfully treating the disease, as well as the side effect profile, are all important considerations. Expert guidelines have been formulated for selection of the appropriate TKI based on the clinical parameters of the patient and on the side effect profile of each drug [1], but there is no clear-cut and easily implemented tool to predict which will be the preferential TKI for any individual patient. Drug metabolism and disposition genes have a substantial impact on the pharmacology of many medications. For CML, a number of genes have been studied regarding their effect on metabolism and disposition of the various TKIs. The multidrug resistance gene MDR1 (ABCB1) extrudes IM from cells, thus potentially compromising drug efficacy [2]. Furthermore, the human organic cation transporter (hOCT1, also known as Solute Carrier Family 22, SLC22A1) has been shown to have an important role in actively transporting IM into cells [3]. As such, the activity of these genes is important for the response to IM therapy. However, directly measuring IM influx and efflux by these transporters in primary leukemia cells is cumbersome, requiring radiolabeled substrates or laborious technical methods, and is not amenable to routine clinical use. A recent publication has reported direct measurement of intracellular IM levels, but the method is complex and has as yet only been reported for a small number of patients [4]. Furthermore, reverse transcription-polymerase chain reaction (RT-PCR) type assays for expression of these transporters may be inaccurate due to mixtures of different cell types in mononuclear cell preparations [5,6]. Therefore, a subject of active investigation has been which surrogate markers can be reproducibly used to predict the activity of these genes and their effect on various TKIs. A number of single nucleotide polymorphisms (SNPs) have been associated with the activity of these genes, and therefore pharmacogenetic parameters have been studied
Abstract The optimal tyrosine kinase inhibitor for any individual patient with chronic myeloid leukemia (CML) is not predictable. Pharmacogenetic parameters and trough levels of imatinib (IM) have each been independently correlated with response. We therefore studied the human organic cation transporter (hOCT1) and multidrug resistance (MDR1) single nucleotide polymorphisms (SNPs) and correlated these with IM levels and major molecular response (MMR) (3-log reduction) in 84 patients with CML, the first such study performed in Caucasians. We studied MDR1 G2677T and C3435T, and for hOCT1, C480G and A1222G. IM levels varied significantly with dose (⬍ or ⬎ 400 mg/day) (p ⴝ 0.038) and were significantly lower in 20 patients who lost MMR (p ⴝ 0.042). Adjusting for dose, trough IM levels were not significantly correlated with SNPs. Patients with MDR1 3435 TT had significantly longer times to MMR compared to CC/CT genotypes (p ⴝ 0.047). Genotypes did not predict treatment failure when controlling for IM levels. We conclude that IM levels, but not the SNPs studied here, determine IM failure. Keywords: Tyrosine kinase inhibitors, pharmacogenetics, ABCB1, prognosis, SLC22A1
Introduction Therapy of chronic myeloid leukemia (CML) has advanced a great deal in the last 15 years. The revolutionary advent of imatinib mesylate (IM) has given way to newer generation tyrosine kinase inhibitors (TKIs), allowing the clinician to select the drug which is most suitable for each individual patient. Optimal drug selection is important, since treatment duration is long, lasting one or more decades. Thus, ease of administration and ensuring strict compliance, in addition
Correspondence: Deborah Rund, Department of Hematology, Hebrew University-Hadassah Medical Organization, Jerusalem, Israel, IL91120. Tel: 972-26778712. Fax: 972-2-6423067. E-mail: [email protected] There is an accompanying commentary that discusses this paper. Please refer to the issue Table of Contents. Received 23 November 2013; revised 15 January 2014; accepted 6 February 2014
2525
Leuk Lymphoma Downloaded from informahealthcare.com by University of Louisville on 01/09/15 For personal use only.
2526
J. Vine et al.
for their influence on TKI treatment. MDR1 SNPs have been correlated with response to IM [7]. Furthermore, a recent study [8] has also found a correlation of hOCT1 and MDR1 SNPs with clinical response to IM in a study with relatively short-term follow-up (median: 29 months). That study was performed in the context of the TOPS (Tyrosine Kinase Inhibitor Optimization and Selectivity) clinical trial, and IM levels were not examined to correlate with treatment response and SNPs in the drug transporters. Long-term response to IM has been correlated with hOCT1 SNPs in two recent studies; however, these did not examine IM levels [9,10]. We therefore undertook to study hOCT1and MDR1 SNPs and correlate these with IM plasma levels and clinical response to IM over a long period of follow-up (mean 75.3 months of IM therapy). Our aim was to determine whether SNPs in either or both transporters had an impact on clinical response, and to correlate IM levels with SNPs in both transporters. Our patients were treated in a “real world” setting rather than a clinical trial, such that they had flexible IM dosing according to tolerability and treatment response. In addition, they were followed for long periods of time, such that long-term outcome was also assessed. Four SNPs were studied, two in hOCT1and two in MDR1. We selected the SNPs based on their prevalence and on their previous associations with variations in the activity of the respective genes [11]. For MDR1 we studied G2677T, also known as rs2032582, located in exon 21, which encodes an amino acid change (Ala to Ser), which is present in 10–32% of Caucasian populations [12]. In addition, we studied C3435T, in exon 26, also known as rs1045642, which is prevalent, with the C allele present in 34–90% of various populations [12]. This SNP is synonymous (does not encode an amino acid change), but has been reported to lead to significant functional changes based on codon usage and translational effects [13]. Both of these MDR1 SNPs have been widely studied in pharmacogenomics, including evaluation of the response of CML to IM therapy [8,14]. For hOCT1, we selected a SNP in exon 2 (480C⬎ G, Phe160Leu, rs683369), which, in the homozygous state (GG), has been associated with failure to respond and loss of remission in patients with CML on IM [15]. We also studied a SNP in exon 7 (1222A⬎ G, Met408Val, rs628031), which has been correlated with the achievement of MMR in patients with CML [16] and has recently been hypothesized as having increased activity in the homozygous state (GG) [9]. Both of these hOCT1 SNPs are prevalent; the exon 2 SNP was reported to be present in 22% of Caucasians and the exon 7 SNP in 60% of Caucasians [17].
Methods Patient characteristics and imatinib therapy details We studied 84 Caucasian patients with CML in chronic phase. Their demographic data are shown in Table I. There were no selection criteria other than willingness to be enrolled in the study at our hospital. Some 19% were diagnosed during or prior to the year 2000 when IM was not yet available; however, most were begun on IM expeditiously. Most patients were on the standard 400 mg a day dose. Deviations from the standard 400 mg a day dose were made due to either adverse effects (such as nausea or muscle cramps, leading to dose reductions) or due to suboptimal molecular genetics testing results, leading to increasing the dose. The number of patients on each dose level is seen in Table I. The following clinical variables were assessed from the patients’ charts: date of diagnosis; date of starting IM; date(s) of molecular testing and results; date of progression, molecular or hematological relapse; date and cause of death. Survivals were calculated in terms of initiation of IM therapy. Event-free survival (EFS) was determined as the time from first date of IM therapy to progression/relapse/death from any cause. Overall survival (OS) was determined as the time from the first day of IM therapy to death from any cause.
Imatinib trough levels Trough levels were determined in 81 patients using samples that were taken 24 h after the last dose during a period when the patient was on a stable dose. The dose at the time of trough level testing was considered the dose for the purposes of the study, although some patients had prior dose adjustments. Compliance was verified by a patient diary for 1 month during which trough drug levels were tested. High performance liquid chromatography/ mass spectrometry assay was used to quantitate plasma IM concentration [18]. IM levels were determined in the Analyst Research Laboratories, Rehovot, Israel (a Novartis Pharmaceutical facility).
Evaluation of imatinib response BCR/Abl transcript level was analyzed using RT-PCR from 1990 until 2001, with Abl expression as an internal standard. In 2001, real time PCR with Abl as a control gene was used. Since the end of 2011, we have used a highly sensitive real time quantitative (RQ) PCR, with Abl1 as an internal standard, graded on an international scale according to
Table I. Demographics, imatinib (IM) dose and IM trough levels. Age Sex Time from diagnosis to enrollment Time from diagnosis to IM therapy IM therapy duration IM dose, mean mg/day (⫾ SD) ⬍ 400 (283.3 ⫾ 35.4) 400 ⬎ 400 (621.4 ⫾ 80.2) SD, standard deviation.
Number of patients 9 61 14
21–88 years (mean 57.6) Males 42, females 42 16–241 months (median 83) ⬍ 1–108 months (median 1.3) 12–142 months (mean 75.3, median 76.5) IM trough level, mean ng/mL (⫾ SD) 909.0 (⫾ 425.3) 1145.4 (⫾ 468.0) 1422.9 (⫾ 473.8)
Polymorphisms and imatinib resistance log reduction. Therefore, achievement of major molecular response (MMR) was verified in all patients surviving to that date (83 out of 84) using the most stringent molecular method. Responses were defined according to European LeukemiaNet (ELN) criteria [19]. MMR was defined as ⱕ 0.1% BCR/Abl transcripts (3-log reduction) according to the International Scale [19]. Time to molecular remission was defined as the date of initiation of IM therapy until achieving either PCR negativity using the older methodology or until achieving MMR as per ELN guidelines. Treatment failure was defined as failure to achieve MMR, or persistent loss of MMR despite increased dose, or loss of cytogenetic or hematological remission.
Leuk Lymphoma Downloaded from informahealthcare.com by University of Louisville on 01/09/15 For personal use only.
Genotyping The study was performed in accordance with the Declaration of Helsinki and Good Clinical Practice Guidelines. Peripheral blood samples were used for DNA analysis after signed informed consent, in accordance with the guidelines of the Helsinki Committee of Hadassah Medical Organization (Study number: 13-29.10.04, ClinicalTrials.gov identifier NCT00159003). DNA was isolated from peripheral blood using standard methods. Genotyping for hOCT1and MDR1 SNPs was performed in all patients. hOCT1 exon 2 (480C⬎ G, Phe160Leu, rs683369) was detected by PCR using the following primers: • •
F- TCGTCCTCCTCTTGCCGTGGT and R- CTGTCTGCAAAGTAGCCAACACCGAGAGAGCCTAA which yields a 136 bp fragment.
Restriction enzyme analysis with DdeI (Biolabs) identifies the presence of the wild type (WT) (cut) and variant (uncut) alleles. hOCT1 exon 7 (1222 A⬎ G, Met408Val, rs628031) was detected by PCR using the following primers: • •
F- CTTTCTCCATCTGCGAGGGGC and R- GACGAGGCAGGCTGCCCCCGCCAACAAATTTGA CG, which yields a PCR fragment of 285 bp.
Restriction enzyme analysis using BmgB1 (Biolabs) demonstrates the presence of the WT allele (cut) and variant (uncut) alleles. MDR1 SNPs were analyzed as described by Cascorbi et al. [20].
Statistical methods Statistical analyses were performed using SAS® v9.3 (SAS Institute, Cary, NC). The required significance level of findings was equal to or lower than 5%. All statistical tests were two-sided. Nominal p-values are presented, as this was a preliminary study. Where confidence limits are appropriate, the confidence level is 95%. For comparison of means (continuous variables), the two-sample t-test or the Wilcoxon rank-sum test was used as appropriate. For comparison of proportions (categorical variables), the χ2 test or Fisher’s exact test was used as appropriate. For comparison of time to event data, the logrank test was used and respective Kaplan–Meier curves were generated. Cox regression modeling was performed to adjust survival estimates for covariates.
2527
Role of the funding source The study sponsor had no involvement in the study design, collection, analysis and interpretation of data, writing of the manuscript or submission for publication.
Results The mean IM trough level for all patients was 1167.9 (⫾ 477.0). IM trough levels varied by dose (Table I). The IM level was statistically significantly higher in patients who received higher IM daily doses (p ⫽ 0.038). We compared IM levels in patients who achieved a MMR with those who did not achieve a MMR. Although the levels were higher in patients achieving a MMR (achieved MMR: 1184.1 ⫾ 476.9, compared to those not achieving MMR: 1040 ⫾ 490.9), this difference was not statistically significantly (t-test, p ⫽ 0.39). It is notable that, of the nine patients who never achieved a MMR, three had low or even very low IM levels (267 ng/mL, 346 ng/mL and 758 ng/mL). For 72 of the patients achieving a MMR, sufficient time points were available to evaluate for loss of MMR. Of these, 20 lost MMR at some point. Five of these had IM levels ⬍ 1000 ng/mL (593 ng/mL, 655 ng/mL, 817 ng/mL, 933 ng/mL and 974 ng/mL). The IM levels were significantly lower in the patients losing MMR than in those not losing MMR (t-test, p ⫽ 0.042). Genotyping frequency data for the four SNPs are shown in Table II. We analyzed IM levels of the patients according to hOCT1 genotype and correlated the genotypes with clinical response to IM. hOCT1 exon 2 GG homozygotes had higher IM levels than CG/CC genotypes (1231.4 ⫾ 643.8 compared to 1161.8 ⫾ 463.3). This difference was not statistically significant when adjusted for daily doses (F1,74 ⫽ 0.04, p-value ⫽ 0.8452), as patients with hOCT1 GG were on slightly higher doses (mean 457.1 ⫾ 161.8 mg/day compared to 419. 3 ⫾ 94.0 mg/day for patients with CC/CG). hOCT1 exon 7 AA homozygotes had very slightly lower IM levels compared to patients with GG/AG (1148.1 ⫾ 495.1 for AA, 1167.7 ⫾ 483.9 for GG/AG). This difference was not statistically significant when adjusted for daily doses (F1,74 ⫽ 1.47, p-value ⫽ 0.230). AA homozygotes were on significantly higher doses of IM (510 ⫾ 137 mg for AA, 410 ⫾ 89.8 mg for GG/AG) than were patients with GG/AG (p ⫽ 0.003). Thus they might have been expected to have higher, rather than lower, levels, since overall, the IM level correlated well with the dose, as mentioned above. The relatively small number of patients with this genotype (12% of patients) may have reduced the significance of this finding. We also analyzed IM levels of the patients according to MDR1 genotype and correlated the genotypes with clinical response to IM. Patients with MDR1 2677 TT had lower than Table II. Genotype frequencies. hOCT1 rs683369 % (n) CC 60 (50) CG 32 (27) GG 8 (7)
MDR1 rs628031 % (n)
rs2032582 % (n)
rs1045642 % (n)
GG 40 (33) AG 48 (40) AA 12 (10)
GG 76 (62) GT 16 (13) TT 8 (7)
CC 32 (27) CT 37 (31) TT 31 (26)
Leuk Lymphoma Downloaded from informahealthcare.com by University of Louisville on 01/09/15 For personal use only.
2528
J. Vine et al.
average IM levels (964.3 ⫾ 556.5) on a daily dose averaging 414.3 ⫾ 90 mg. In comparison, patients with genotypes 2677GG/GT had IM levels of 1196.7 ⫾ 475.0 on a slightly higher dose of 425.3 ⫾ 102.4 mg. This difference was not statistically significant when adjusted for daily doses (F1,72 ⫽ 1.31, p-value ⫽ 0.2558). MDR1 3435 TT homozygotes had similar IM levels to patients with CC/CT (TT: 1127.0 ⫾ 433.9; CC/ CT: 1189.6 ⫾ 503.7). Patients with TT were on slightly lower IM doses (403.9 ⫾ 77.4 compared to 431.3 ⫾ 109.4 mg a day). This difference was not statistically significant when adjusted for daily doses (F1,74 ⫽ 0.12, p-value ⫽ 0.7273). Time to achieve MMR was available in 72 subjects, and only nine of the 84 patients (10.7%) did not reach remission during the study. The estimated median time from treatment start to MMR was 10.76 months (95% confidence interval [CI]: [7.06; 13.6]). It is of note that, during the time frame of the study, it was not common practice to check for MMR at very early time points (less than 6 months). Time to MMR for each genotype was calculated using the Kaplan–Meier method. Table III presents the estimated median time from initiation of IM treatment to MMR (and CIs) derived from these analyses for the different genotype groups. There was a trend toward a longer time to MMR with the hOCT1 exon 2 GG and exon 7 GG genotypes; however, these were not statistically significant (exon 2, log-rank p ⫽ 0.11, exon 7, log-rank p ⫽ 0.19). For the MDR1 genotypes, there was a longer time to MMR for the 2677 TT homozygotes, but this was not statistically significant (log-rank p ⫽ 0.25). For MDR1 3435 genotypes, there was a significantly longer time to MMR for TT homozygotes compared to CC/CT genotypes (log-rank p ⫽ 0.047) Figure 1. When further analyzed using Cox’s regression models, adjusted for the IM levels and the interval time between diagnosis and treatment start (ⱕ 1 year, ⬎ 1 year), there was no statistically significant difference in time to MMR observed between the various genotypes. This is despite extensive statistical analysis of all possible combinations of SNPs in both genes. Twenty patients lost molecular remission (LMR) at some point. Some of the patients who lost MMR were patients for whom IM was not given as frontline therapy (average 16.5, ⫾ 28.96 months till starting IM). Most of the LMR events occurred in the first 2 years of IM therapy, and only two patients experienced LMR later than 3 years after beginning IM. Half of these LMR events occurred when no secondgeneration TKIs were available and the patients were given an increased dose of IM and re-achieved MMR. The others were switched to a newer TKI. There were more LMR events in patients homozygous for the A allele (AA) in hOCT1 exon 7, compared to patients with AG/GG, but this was not statistically significant (AA, 40% LMR vs. 22% LMR in patients with
AG/GG, Fisher’s exact test p-value: 0.2113). The lack of statistical significance may in part be due to the relatively small number of patients who had LMR. For the other genotypes as well, there were no differences in the genotypes of patients losing remission compared to those not losing remission. Eighty-two/84 of the patients are still alive and 82% are still on IM. Fifteen patients stopped IM at some point (10 treatment failures, the rest due to intolerance). There was no difference in the genotype at hOCT1 exon 2 or MDR1 genotypes of patients failing IM therapy. For hOCT1 exon 7, 20% (2/10) of AA homozygotes failed IM, compared to 10.6% (7/66) of patients with GG/AG. However, this did not achieve statistical significance (Fisher’s exact test p-value: 0.1178), perhaps due to the small number of patients with this genotype, and the small number of patients failing therapy. There was no relationship between EFS and OS according to MDR1 or hOCT1 genotype (data not shown). Only two patients (2.4%) developed accelerated phase or blast crisis. In neither of these patients was there a demonstrable molecular etiology. In two additional patients, Abl kinase domain mutations were identified. One patient, who never achieved molecular remission, was found to have T315I, demonstrated after 11 years of IM therapy. This patient started IM therapy in 2001, 9 months after the diagnosis of CML. He currently remains in chronic phase, being treated with a third-generation TKI agent. In addition, one patient was found to have F486S, demonstrated at the time of hematological relapse, 2 years after initiating IM. This patient was treated with IM immediately upon diagnosis of CML, and had an excellent IM level (1329 ng/mL). Some months later, she was inadvertently given Hypericum perforatum (St. John’s wort), which is known to induce intestinal P-glycoprotein and reduces IM bioavailability and drug efficacy. Either the Hypericum or the Abl kinase mutation (or both) may have contributed to her hematological relapse. She currently remains in MMR 3 years later on a newergeneration TKI agent.
Discussion It would be optimal to be able to predict treatment response in CML using an easily measurable parameter, since several treatment options currently exist. DNA analysis is well suited for this purpose, since it is easily prepared and stable during storage, and somatic SNPs are readily analyzed. Therefore, we studied SNPs in the two transporters which have previously been suggested to have the greatest effect on IM disposition, to attempt to find a simple clinical tool, verified using IM levels and long-term clinical data. To our knowledge, ours is the first study that combines IM levels with pharmacogenetic data and clinical outcome in a Caucasian population.
Table III. Median time from initiation of IM to MMR according to genotype (months)*. hOCT1 rs683369 (exon 2) CC: 11.4 [7.0; 15.7] GC: 8.5 [6.7; 14.7] GG: 7.1 [5.5; 13.0]
hOCT1 rs628031 (exon 7)
MDR1 rs2032582 (G2677T)
MDR1 rs1045642 (C3435T)
AA: 9.3 [5.5; 15.7] AG: 7.9 [6.1; 13.0] GG: 10.9 [6.8; 29.0]
GG: 10.7 [6.8; 13.8] GT: 10.8 [5.6; 15.4] TT: 40.2 [6.0; NE]
CC: 10.0 [6.7; 13.0] CT: 7.0 [5.6; 13.8] TT: 13.6 [7.9; 42.9]
IM, imatinib; MMR, major molecular response; NE, not estimable. *Confidence intervals are in square brackets. p-Values are as follows: rs683369: p ⫽ 0.114, rs628031: p ⫽ 0.186, rs2032582: p ⫽ 0.253, rs1045642: p ⫽ 0.047.
Leuk Lymphoma Downloaded from informahealthcare.com by University of Louisville on 01/09/15 For personal use only.
Polymorphisms and imatinib resistance
Figure 1. Time to achieve major molecular remission (MMR) according to MDR1 3435 genotype. Using the Kaplan–Meier method, the time to achieving MMR was plotted by genotype (CC, CT, TT) for 84 patients. The curve shows the number of patients not yet achieving MMR during the follow-up period. Over time, significantly more patients with the TT genotype had not yet achieved MMR, compared to patients with CC and CT (p ⫽ 0.047).
A previous study correlating these three parameters was performed in Japanese patients [16]. We undertook our study following a recent study performed in Israel (using a different patient cohort) which found a correlation between IM levels and clinical response [21], but which did not analyze pharmacogenetic data. Our study has a number of strengths and also some weaknesses. Its main strengths are the testing of IM levels and genotypes in one group of patients to allow direct comparison of which was the more significant parameter. The main weakness is the small number of patients, which could have resulted in missing the effects of SNP genotypes that were less common. The small number of patients also made it impossible to evaluate the effect of SNPs on uncommon events such as failure to achieve MMR (which occurred in only nine [10.7%] patients) or progression to blast crisis, which occurred in only two patients (2.3%). Another possible weakness is the variable time until the patients were started on IM. However, the median time to IM intiation was short (1.3 months), and the inclusion of patients who started IM at various time points following diagnosis enabled including patients with very long follow-up times (median 83 months). Another possible weakness is the variable IM doses, for which compensation was made using statistical analysis. For a satisfactory therapeutic response in CML, IM levels should be ⱖ 1002 ng/mL, which was found to be the threshold for achievement of MMR [22,23]. The mean level found in our patients was 1167.9, which is above this threshold, and is expected to be correlated with a good clinical response, as was seen in our patients. We found a significantly greater chance of losing MMR if IM levels were low. Although measurement of drug levels was found to be predictive of response to IM in several prior studies [16,21–23], their measurement is not routinely available and it is not likely that this testing will be more accessible. Several TKIs are currently in clinical use, including newer-generation drugs, such that the demand for specific IM drug level testing is reduced. Furthermore, a recent small study suggested that intracytoplasmic drug
2529
determination in leukemic cells may be more reliable than plasma levels, raising further challenging issues regarding monitoring TKI therapy in the future [4]. Our study did not demonstrate a relationship between IM levels and genotype, perhaps in part since dosing was flexible according to patient needs. Similar results were found in a study of 67 Japanese patients, which reported no significant correlation between IM levels and SNPs in hOCT1 and MDR1 in patients on varying IM doses [16]. It is of note that in our study, hOCT1 exon 7 Met408Val AA homozygotes, who were on a significantly higher IM dose, had slightly lower levels, in contrast to the overall significant relationship of dose and IM levels. hOCT1 is expressed in liver and intestine, and various drugs are thought to be absorbed and eliminated by hOCT1 [24]. IM plasma levels may thus reflect the activity of transporters which, in addition to influencing IM influx into CML cells, also affect absorption and elimination [25]. Pharmacokinetic resistance due to multiple mechanisms affecting plasma levels, in addition to inadequate drug influx into CML cells, may both affect treatment response [26]. The complex interplay between multiple transporters and their influence on IM levels has recently been demonstrated by a study on intracellular TKI levels. This study, performed in drug sensitive and drug resistant K562 cells (derived from a patient with blast crisis CML), used different specific inhibitors of hOCT1, MDR1 and BCRP2, either individually or in combination [4]. This study demonstrated the importance of these transporters for intracellular levels of IM (though not of nilotinib, which is largely independent of the effects of these transporters). Such studies would be enlightening if analyzed together with plasma levels and pharmacogenetic data in patients. When we undertook our study, there was no conclusive data on hOCT1 SNPs and outcome with the exception of the exon 7 M420 deletion, which was known to have an adverse effect. Since then, several recent studies have addressed this issue. Angelini et al. [8] studied 189 IM treated patients and found that a combination of SNPs in hOCT1 influenced treatment response, with the C allele in exon 2 being considered as favorable (and G being unfavorable) [8]. Our results are concordant with this, as our patients with GG at the exon 2 SNP had a longer time to achievement of MMR. However Angelini’s group did not study the exon 7 Met408Val SNP. Takahashi et al. studied the exon 7 Met408Val SNP and found a greater likelihood of achieving MMR in patients with the exon 7 GG genotype compared to individuals carrying an A allele. This was statistically significant for patients on doses of ⬍ 400 mg a day [16], for whom more active drug influx would be expected to be essential. In addition, a recent comprehensive study (Giannoudis et al. [9]) analyzed, using pyrosequencing, 23 hOCT1 SNPs in 336 patients with CML treated with IM, and their effect on outcome (evaluable in 195 patients), without data on IM levels or other transporters. Giannoudis et al. confirmed the adverse effect of M420 del, which has decreased transporter activity; however, this could be mitigated by the presence of the variant G allele at exon 7 position 408. This study also demonstrated, using an in vitro model, that the valine (G) allele had greater IM uptake and, as such, might be expected to improve prognosis. We found
Leuk Lymphoma Downloaded from informahealthcare.com by University of Louisville on 01/09/15 For personal use only.
2530
J. Vine et al.
a trend toward fewer IM treatment failures with the GG/AG genotypes compared to AA: 20.0% of patients with AA failed IM compared to 10.6% of patients with GG/AG (Fisher’s exact test p-value: 0.1178). In addition, as mentioned above, the patients with AA had a significantly higher dose requirement to maintain a satisfactory response to IM. These findings are in agreement with the published in vitro studies [9]. Furthermore, another very recent study of 167 patients with CML also found that the A allele at exon 7 Met408Val conferred a worse prognosis as measured by a number of different clinical parameters [10]. Our findings are in agreement with these published genotyping studies, although ours did not reach statistical significance, perhaps due to the smaller number of patients studied. Although we did not find hOCT1 SNPs to have statistically significant prognostic value in patients with CML treated with IM, we did find that IM levels significantly predicted response to IM therapy. That, together with the multivariate analysis as mentioned above, suggests that IM levels have greater prognostic significance than hOCT1 genotyping. This is despite exhaustive statistical analysis of all possible SNP combinations. Our study demonstrated a significantly longer time to MMR for patients homozygous for the T variant at MDR1 3435. Maffioli et al., who studied 65 IM treated patients, found that the CC genotype at 3435 was associated with primary treatment failure [14], which is in contrast to the findings of our study in which the TT genotype appeared unfavorable in that patients with TT required a longer time to achieve MMR. However there were very few patients with primary failure in Maffioli’s study. Another, larger study by Angelini et al. [8] reported results similar to ours. This study found that, for the Caucasian subgroup of patients, the 3435 CC genotype had a more favorable prognosis, with more complete molecular responses (CMRs) in patients with the CC genotype as compared to TT [8]. However, this study failed to find a difference in IM treatment response when considering an aggregate haplotype of three MDR1 SNPs [8]. Two-thirds of the patients in Angelini’s study were treated with 800 mg a day of IM. Although that group did not find an effect of drug dose in their study, there is evidence that the response to IM is different when given in high doses [26]. Thus in Angelini’s study, the contribution of MDR1 may have been less significant than in the present study since our patients were treated with lower IM doses. We conclude that IM levels are correlated with clinical response in CML. Low levels correlate with treatment failure. However, as levels are not available on a routine clinical basis, treatment failures may inadvertently be caused by suboptimal dosing. The use of alternative tyrosine kinase inhibitors which are not influenced by transporters may overcome this problem. Unfortunately, our data do not simplify optimal drug selection for each patient on the basis of easily available pharmacogenetic parameters. The data are still at present inconclusive, and further studies are required to clarify many issues [25]. Such studies would require very large groups of patients to determine which genotypes of multiple transporters are predictive of treatment failure and for whom newer-generation TKI treatment is advisable.
Acknowledgements We are grateful to Novartis Corporation for their generous support of this project and for performance of the analysis of imatinib levels, which was done without knowledge of genotypes or patient clinical information. Jacob Vine carried out this study in partial fulfillment of the requirements for an MD degree at the Hebrew UniversityHadassah Medical School. We thank Dr. Svetlana Krichevsky, Elena Slyusarevsky and Galina Pogrebijski for excellent technical assistance. Lisa Deutsch provided excellent statistical analysis. Potential conflict of interest: Disclosure forms provided by the authors are available with the full text of this article at www.informahealthcare.com/lal.
References [1] O’Brien S, Berman E, Moore JO, et al. NCCN Task Force report: tyrosine kinase inhibitor therapy selection in the management of patients with chronic myelogenous leukemia. J Natl Compr Canc Netw 2011;9(Suppl. 2): S1–S25. [2] Thomas J, Wang L, Clark RE, et al. Active transport of imatinib into and out of cells: implications for drug resistance. Blood 2004;104: 3739–3745. [3] White DL, Saunders VA , Dang P, et al. OCT-1-mediated influx is a key determinant of the intracellular uptake of imatinib but not nilotinib (AMN107): reduced OCT-1 activity is the cause of low in vitro sensitivity to imatinib. Blood 2006;108:697–704. [4] Bouchet S, Dulucq S, Pasquet JM, et al. From in vitro to in vivo: intracellular determination of imatinib and nilotinib may be related with clinical outcome. Leukemia 2013;27:1757–1759. [5] Racil Z, Razga F, Buresova L, et al. The assessment of human organic cation transporter 1 (hOCT1) mRNA expression in patients with chronic myelogenous leukemia is affected by the proportion of different cells types in the analyzed cell population. Am J Hematol 2010;85:525–528. [6] Razga F, Racil Z, Machova Polakova K , et al. The predictive value of human organic cation transporter 1 and ABCB1 expression levels in different cell populations of patients with de novo chronic myelogenous leukemia. Int J Hematol 2011;94:303–306. [7] Dulucq S, Bouchet S, Turcq B, et al. Multidrug resistance gene (MDR1) polymorphisms are associated with major molecular responses to standard-dose imatinib in chronic myeloid leukemia. Blood 2008;112:2024–2027. [8] Angelini S, Soverini S, Ravegnini G, et al. Association between imatinib transporters and metabolizing enzymes genotype and response in newly diagnosed chronic myeloid leukemia patients receiving imatinib therapy. Haematologica 2013;98:193–200. [9] Giannoudis A , Wang L, Jorgensen AL, et al. The hOCT1 SNPs M420del and M408V alter imatinib uptake and M420del modifies clinical outcome in imatinib-treated chronic myeloid leukemia. Blood 2013;121:628–637. [10] Koren-Michowitz M, Buzaglo Z, Ribakovsky E, et al. OCT1 genetic variants are associated with long term outcomes in imatinib treated chronic myeloid leukemia patients. Eur J Haematol 2014;92: 283–288. [11] Eechoute K, Sparreboom A , Burger H, et al. Drug transporters and imatinib treatment: implications for clinical practice. Clin Cancer Res 2011;17:406–415. [12] Hodges LM, Markova SM, Chinn LW, et al. Very important pharmacogene summary: ABCB1 (MDR1, P-glycoprotein). Pharmacogenet Genomics 2011;21:152–161. [13] Kimchi-Sarfaty C, Oh JM, Kim IW, et al. A “silent” polymorphism in the MDR1gene changes substrate specificity. Science 2007;315: 525–528. [14] Maffioli M, Camós M, Gaya A , et al. Correlation between genetic polymorphisms of the hOCT1 and MDR1genes and the response to imatinib in patients newly diagnosed with chronic-phase chronic myeloid leukemia. Leuk Res 2011;35:1014–1019.
Leuk Lymphoma Downloaded from informahealthcare.com by University of Louisville on 01/09/15 For personal use only.
Polymorphisms and imatinib resistance [15] Kim DH, Sriharsha L, Xu W, et al. Clinical relevance of a pharmacogenetic approach using multiple candidate genes to predict response and resistance to imatinib therapy in chronic myeloid leukemia. Clin Cancer Res 2009;15:4750–4758. [16] Takahashi N, Miura M, Scott SA , et al. Influence of CYP3A5 and drug transporter polymorphisms on imatinib trough concentration and clinical response among patients with chronic phase chronic myeloid leukemia. J Hum Genet 2010;55:731–737. [17] Kerb R. Implications of genetic polymorphisms in drug transporters for pharmacotherapy. Cancer Lett 2006;234:4–33. [18] Parise RA , Ramanathan RK , Hayes MJ, et al. Liquid chromatographic-mass spectrometric assay for quantitation of imatinib and its main metabolite (CGP 74588) in plasma. J Chromatogr B Analyt Technol Biomed Life Sci 2003;791:39–44. [19] Baccarani M, Castagnetti F, Gugliotta G, et al.; European LeukemiaNet. Response definitions and European LeukemiaNet Management recommendations. Best Pract Res Clin Haematol 2009;22:331–341. [20] Cascorbi I, Gerloff T, Johne A , et al. Frequency of single nucleotide polymorphisms in the P-glycoprotein drug transporter MDR1 gene in white subjects. Clin Pharmacol Ther 200;69:169–174. [21] Koren-Michowitz M, Volchek Y, Naparstek E, et al. Imatinib plasma trough levels in chronic myeloid leukaemia: results of a multicentre study CSTI571AIL11TGLIVEC. Hematol Oncol 2012;30:200–205.
2531
[22] Picard S, Titier K , Etienne G, et al. Trough imatinib plasma levels are associated with both cytogenetic and molecular responses to standard-dose imatinib in chronic myeloid leukemia. Blood 2007;109:3496–3499. [23] Bouchet S, Titier K , Moore N, et al. Therapeutic drug monitoring of imatinib in chronic myeloid leukemia: experience from 1216 patients at a centralized laboratory. Fundam Clin Pharmacol 2013:27: 690–697. [24] Bourdet DL , Pritchard JB, Thakker DR. Differential substrate and inhibitory activities of ranitidine and famotidine toward human organic cation transporter 1 (hOCT1; SLC22A1), hOCT2 (SLC22A2), and hOCT3 (SLC22A3). J Pharmacol Exp Ther 2005; 315:1288–1297. [25] Deenik W, van der Holt B, Janssen JJ, et al. Polymorphisms in the multidrug resistance gene MDR1 (ABCB1) predict for molecular resistance in patients with newly diagnosed chronic myeloid leukemia receiving high-dose imatinib. Blood 2010;116:6144–6145; author reply 6145–6146. [26] Petzer AL, Wolf D, Fong D, et al. High-dose imatinib improves cytogenetic and molecular remissions in patients with pretreated Philadelphia-positive, BCR-ABL-positive chronic phase chronic myeloid leukemia: first results from the randomized CELSG phase III CML 11 “ISTAHIT” study. Haematologica 2010;95: 908–913.
ORIGINAL ARTICLE: CLINICAL
Polymorphisms in the human organic cation transporter and the multidrug resistance gene: correlation with imatinib levels and clinical course in patients with chronic myeloid leukemia Jacob Vine1, Sara Bar Cohen2, Rosa Ruchlemer2, Neta Goldschmidt2, Moshe Levin3, Diana Libster3, Alexander Gural2, Moshe E. Gatt2, David Lavie2, Dina Ben-Yehuda2 & Deborah Rund2 Leuk Lymphoma Downloaded from informahealthcare.com by University of Louisville on 01/09/15 For personal use only.
1Department of Medicine, Hebrew University-Hadassah Medical School, Jerusalem, Israel, 2Department of Hematology,
Hebrew University-Hadassah Medical Organization, Jerusalem, Israel and 3Department of Hematology Mt. Scopus, Shaare Zedek Medical Center, Jerusalem, Israel
to efficacy in successfully treating the disease, as well as the side effect profile, are all important considerations. Expert guidelines have been formulated for selection of the appropriate TKI based on the clinical parameters of the patient and on the side effect profile of each drug [1], but there is no clear-cut and easily implemented tool to predict which will be the preferential TKI for any individual patient. Drug metabolism and disposition genes have a substantial impact on the pharmacology of many medications. For CML, a number of genes have been studied regarding their effect on metabolism and disposition of the various TKIs. The multidrug resistance gene MDR1 (ABCB1) extrudes IM from cells, thus potentially compromising drug efficacy [2]. Furthermore, the human organic cation transporter (hOCT1, also known as Solute Carrier Family 22, SLC22A1) has been shown to have an important role in actively transporting IM into cells [3]. As such, the activity of these genes is important for the response to IM therapy. However, directly measuring IM influx and efflux by these transporters in primary leukemia cells is cumbersome, requiring radiolabeled substrates or laborious technical methods, and is not amenable to routine clinical use. A recent publication has reported direct measurement of intracellular IM levels, but the method is complex and has as yet only been reported for a small number of patients [4]. Furthermore, reverse transcription-polymerase chain reaction (RT-PCR) type assays for expression of these transporters may be inaccurate due to mixtures of different cell types in mononuclear cell preparations [5,6]. Therefore, a subject of active investigation has been which surrogate markers can be reproducibly used to predict the activity of these genes and their effect on various TKIs. A number of single nucleotide polymorphisms (SNPs) have been associated with the activity of these genes, and therefore pharmacogenetic parameters have been studied
Abstract The optimal tyrosine kinase inhibitor for any individual patient with chronic myeloid leukemia (CML) is not predictable. Pharmacogenetic parameters and trough levels of imatinib (IM) have each been independently correlated with response. We therefore studied the human organic cation transporter (hOCT1) and multidrug resistance (MDR1) single nucleotide polymorphisms (SNPs) and correlated these with IM levels and major molecular response (MMR) (3-log reduction) in 84 patients with CML, the first such study performed in Caucasians. We studied MDR1 G2677T and C3435T, and for hOCT1, C480G and A1222G. IM levels varied significantly with dose (⬍ or ⬎ 400 mg/day) (p ⴝ 0.038) and were significantly lower in 20 patients who lost MMR (p ⴝ 0.042). Adjusting for dose, trough IM levels were not significantly correlated with SNPs. Patients with MDR1 3435 TT had significantly longer times to MMR compared to CC/CT genotypes (p ⴝ 0.047). Genotypes did not predict treatment failure when controlling for IM levels. We conclude that IM levels, but not the SNPs studied here, determine IM failure. Keywords: Tyrosine kinase inhibitors, pharmacogenetics, ABCB1, prognosis, SLC22A1
Introduction Therapy of chronic myeloid leukemia (CML) has advanced a great deal in the last 15 years. The revolutionary advent of imatinib mesylate (IM) has given way to newer generation tyrosine kinase inhibitors (TKIs), allowing the clinician to select the drug which is most suitable for each individual patient. Optimal drug selection is important, since treatment duration is long, lasting one or more decades. Thus, ease of administration and ensuring strict compliance, in addition
Correspondence: Deborah Rund, Department of Hematology, Hebrew University-Hadassah Medical Organization, Jerusalem, Israel, IL91120. Tel: 972-26778712. Fax: 972-2-6423067. E-mail: [email protected] There is an accompanying commentary that discusses this paper. Please refer to the issue Table of Contents. Received 23 November 2013; revised 15 January 2014; accepted 6 February 2014
2525
Leuk Lymphoma Downloaded from informahealthcare.com by University of Louisville on 01/09/15 For personal use only.
2526
J. Vine et al.
for their influence on TKI treatment. MDR1 SNPs have been correlated with response to IM [7]. Furthermore, a recent study [8] has also found a correlation of hOCT1 and MDR1 SNPs with clinical response to IM in a study with relatively short-term follow-up (median: 29 months). That study was performed in the context of the TOPS (Tyrosine Kinase Inhibitor Optimization and Selectivity) clinical trial, and IM levels were not examined to correlate with treatment response and SNPs in the drug transporters. Long-term response to IM has been correlated with hOCT1 SNPs in two recent studies; however, these did not examine IM levels [9,10]. We therefore undertook to study hOCT1and MDR1 SNPs and correlate these with IM plasma levels and clinical response to IM over a long period of follow-up (mean 75.3 months of IM therapy). Our aim was to determine whether SNPs in either or both transporters had an impact on clinical response, and to correlate IM levels with SNPs in both transporters. Our patients were treated in a “real world” setting rather than a clinical trial, such that they had flexible IM dosing according to tolerability and treatment response. In addition, they were followed for long periods of time, such that long-term outcome was also assessed. Four SNPs were studied, two in hOCT1and two in MDR1. We selected the SNPs based on their prevalence and on their previous associations with variations in the activity of the respective genes [11]. For MDR1 we studied G2677T, also known as rs2032582, located in exon 21, which encodes an amino acid change (Ala to Ser), which is present in 10–32% of Caucasian populations [12]. In addition, we studied C3435T, in exon 26, also known as rs1045642, which is prevalent, with the C allele present in 34–90% of various populations [12]. This SNP is synonymous (does not encode an amino acid change), but has been reported to lead to significant functional changes based on codon usage and translational effects [13]. Both of these MDR1 SNPs have been widely studied in pharmacogenomics, including evaluation of the response of CML to IM therapy [8,14]. For hOCT1, we selected a SNP in exon 2 (480C⬎ G, Phe160Leu, rs683369), which, in the homozygous state (GG), has been associated with failure to respond and loss of remission in patients with CML on IM [15]. We also studied a SNP in exon 7 (1222A⬎ G, Met408Val, rs628031), which has been correlated with the achievement of MMR in patients with CML [16] and has recently been hypothesized as having increased activity in the homozygous state (GG) [9]. Both of these hOCT1 SNPs are prevalent; the exon 2 SNP was reported to be present in 22% of Caucasians and the exon 7 SNP in 60% of Caucasians [17].
Methods Patient characteristics and imatinib therapy details We studied 84 Caucasian patients with CML in chronic phase. Their demographic data are shown in Table I. There were no selection criteria other than willingness to be enrolled in the study at our hospital. Some 19% were diagnosed during or prior to the year 2000 when IM was not yet available; however, most were begun on IM expeditiously. Most patients were on the standard 400 mg a day dose. Deviations from the standard 400 mg a day dose were made due to either adverse effects (such as nausea or muscle cramps, leading to dose reductions) or due to suboptimal molecular genetics testing results, leading to increasing the dose. The number of patients on each dose level is seen in Table I. The following clinical variables were assessed from the patients’ charts: date of diagnosis; date of starting IM; date(s) of molecular testing and results; date of progression, molecular or hematological relapse; date and cause of death. Survivals were calculated in terms of initiation of IM therapy. Event-free survival (EFS) was determined as the time from first date of IM therapy to progression/relapse/death from any cause. Overall survival (OS) was determined as the time from the first day of IM therapy to death from any cause.
Imatinib trough levels Trough levels were determined in 81 patients using samples that were taken 24 h after the last dose during a period when the patient was on a stable dose. The dose at the time of trough level testing was considered the dose for the purposes of the study, although some patients had prior dose adjustments. Compliance was verified by a patient diary for 1 month during which trough drug levels were tested. High performance liquid chromatography/ mass spectrometry assay was used to quantitate plasma IM concentration [18]. IM levels were determined in the Analyst Research Laboratories, Rehovot, Israel (a Novartis Pharmaceutical facility).
Evaluation of imatinib response BCR/Abl transcript level was analyzed using RT-PCR from 1990 until 2001, with Abl expression as an internal standard. In 2001, real time PCR with Abl as a control gene was used. Since the end of 2011, we have used a highly sensitive real time quantitative (RQ) PCR, with Abl1 as an internal standard, graded on an international scale according to
Table I. Demographics, imatinib (IM) dose and IM trough levels. Age Sex Time from diagnosis to enrollment Time from diagnosis to IM therapy IM therapy duration IM dose, mean mg/day (⫾ SD) ⬍ 400 (283.3 ⫾ 35.4) 400 ⬎ 400 (621.4 ⫾ 80.2) SD, standard deviation.
Number of patients 9 61 14
21–88 years (mean 57.6) Males 42, females 42 16–241 months (median 83) ⬍ 1–108 months (median 1.3) 12–142 months (mean 75.3, median 76.5) IM trough level, mean ng/mL (⫾ SD) 909.0 (⫾ 425.3) 1145.4 (⫾ 468.0) 1422.9 (⫾ 473.8)
Polymorphisms and imatinib resistance log reduction. Therefore, achievement of major molecular response (MMR) was verified in all patients surviving to that date (83 out of 84) using the most stringent molecular method. Responses were defined according to European LeukemiaNet (ELN) criteria [19]. MMR was defined as ⱕ 0.1% BCR/Abl transcripts (3-log reduction) according to the International Scale [19]. Time to molecular remission was defined as the date of initiation of IM therapy until achieving either PCR negativity using the older methodology or until achieving MMR as per ELN guidelines. Treatment failure was defined as failure to achieve MMR, or persistent loss of MMR despite increased dose, or loss of cytogenetic or hematological remission.
Leuk Lymphoma Downloaded from informahealthcare.com by University of Louisville on 01/09/15 For personal use only.
Genotyping The study was performed in accordance with the Declaration of Helsinki and Good Clinical Practice Guidelines. Peripheral blood samples were used for DNA analysis after signed informed consent, in accordance with the guidelines of the Helsinki Committee of Hadassah Medical Organization (Study number: 13-29.10.04, ClinicalTrials.gov identifier NCT00159003). DNA was isolated from peripheral blood using standard methods. Genotyping for hOCT1and MDR1 SNPs was performed in all patients. hOCT1 exon 2 (480C⬎ G, Phe160Leu, rs683369) was detected by PCR using the following primers: • •
F- TCGTCCTCCTCTTGCCGTGGT and R- CTGTCTGCAAAGTAGCCAACACCGAGAGAGCCTAA which yields a 136 bp fragment.
Restriction enzyme analysis with DdeI (Biolabs) identifies the presence of the wild type (WT) (cut) and variant (uncut) alleles. hOCT1 exon 7 (1222 A⬎ G, Met408Val, rs628031) was detected by PCR using the following primers: • •
F- CTTTCTCCATCTGCGAGGGGC and R- GACGAGGCAGGCTGCCCCCGCCAACAAATTTGA CG, which yields a PCR fragment of 285 bp.
Restriction enzyme analysis using BmgB1 (Biolabs) demonstrates the presence of the WT allele (cut) and variant (uncut) alleles. MDR1 SNPs were analyzed as described by Cascorbi et al. [20].
Statistical methods Statistical analyses were performed using SAS® v9.3 (SAS Institute, Cary, NC). The required significance level of findings was equal to or lower than 5%. All statistical tests were two-sided. Nominal p-values are presented, as this was a preliminary study. Where confidence limits are appropriate, the confidence level is 95%. For comparison of means (continuous variables), the two-sample t-test or the Wilcoxon rank-sum test was used as appropriate. For comparison of proportions (categorical variables), the χ2 test or Fisher’s exact test was used as appropriate. For comparison of time to event data, the logrank test was used and respective Kaplan–Meier curves were generated. Cox regression modeling was performed to adjust survival estimates for covariates.
2527
Role of the funding source The study sponsor had no involvement in the study design, collection, analysis and interpretation of data, writing of the manuscript or submission for publication.
Results The mean IM trough level for all patients was 1167.9 (⫾ 477.0). IM trough levels varied by dose (Table I). The IM level was statistically significantly higher in patients who received higher IM daily doses (p ⫽ 0.038). We compared IM levels in patients who achieved a MMR with those who did not achieve a MMR. Although the levels were higher in patients achieving a MMR (achieved MMR: 1184.1 ⫾ 476.9, compared to those not achieving MMR: 1040 ⫾ 490.9), this difference was not statistically significantly (t-test, p ⫽ 0.39). It is notable that, of the nine patients who never achieved a MMR, three had low or even very low IM levels (267 ng/mL, 346 ng/mL and 758 ng/mL). For 72 of the patients achieving a MMR, sufficient time points were available to evaluate for loss of MMR. Of these, 20 lost MMR at some point. Five of these had IM levels ⬍ 1000 ng/mL (593 ng/mL, 655 ng/mL, 817 ng/mL, 933 ng/mL and 974 ng/mL). The IM levels were significantly lower in the patients losing MMR than in those not losing MMR (t-test, p ⫽ 0.042). Genotyping frequency data for the four SNPs are shown in Table II. We analyzed IM levels of the patients according to hOCT1 genotype and correlated the genotypes with clinical response to IM. hOCT1 exon 2 GG homozygotes had higher IM levels than CG/CC genotypes (1231.4 ⫾ 643.8 compared to 1161.8 ⫾ 463.3). This difference was not statistically significant when adjusted for daily doses (F1,74 ⫽ 0.04, p-value ⫽ 0.8452), as patients with hOCT1 GG were on slightly higher doses (mean 457.1 ⫾ 161.8 mg/day compared to 419. 3 ⫾ 94.0 mg/day for patients with CC/CG). hOCT1 exon 7 AA homozygotes had very slightly lower IM levels compared to patients with GG/AG (1148.1 ⫾ 495.1 for AA, 1167.7 ⫾ 483.9 for GG/AG). This difference was not statistically significant when adjusted for daily doses (F1,74 ⫽ 1.47, p-value ⫽ 0.230). AA homozygotes were on significantly higher doses of IM (510 ⫾ 137 mg for AA, 410 ⫾ 89.8 mg for GG/AG) than were patients with GG/AG (p ⫽ 0.003). Thus they might have been expected to have higher, rather than lower, levels, since overall, the IM level correlated well with the dose, as mentioned above. The relatively small number of patients with this genotype (12% of patients) may have reduced the significance of this finding. We also analyzed IM levels of the patients according to MDR1 genotype and correlated the genotypes with clinical response to IM. Patients with MDR1 2677 TT had lower than Table II. Genotype frequencies. hOCT1 rs683369 % (n) CC 60 (50) CG 32 (27) GG 8 (7)
MDR1 rs628031 % (n)
rs2032582 % (n)
rs1045642 % (n)
GG 40 (33) AG 48 (40) AA 12 (10)
GG 76 (62) GT 16 (13) TT 8 (7)
CC 32 (27) CT 37 (31) TT 31 (26)
Leuk Lymphoma Downloaded from informahealthcare.com by University of Louisville on 01/09/15 For personal use only.
2528
J. Vine et al.
average IM levels (964.3 ⫾ 556.5) on a daily dose averaging 414.3 ⫾ 90 mg. In comparison, patients with genotypes 2677GG/GT had IM levels of 1196.7 ⫾ 475.0 on a slightly higher dose of 425.3 ⫾ 102.4 mg. This difference was not statistically significant when adjusted for daily doses (F1,72 ⫽ 1.31, p-value ⫽ 0.2558). MDR1 3435 TT homozygotes had similar IM levels to patients with CC/CT (TT: 1127.0 ⫾ 433.9; CC/ CT: 1189.6 ⫾ 503.7). Patients with TT were on slightly lower IM doses (403.9 ⫾ 77.4 compared to 431.3 ⫾ 109.4 mg a day). This difference was not statistically significant when adjusted for daily doses (F1,74 ⫽ 0.12, p-value ⫽ 0.7273). Time to achieve MMR was available in 72 subjects, and only nine of the 84 patients (10.7%) did not reach remission during the study. The estimated median time from treatment start to MMR was 10.76 months (95% confidence interval [CI]: [7.06; 13.6]). It is of note that, during the time frame of the study, it was not common practice to check for MMR at very early time points (less than 6 months). Time to MMR for each genotype was calculated using the Kaplan–Meier method. Table III presents the estimated median time from initiation of IM treatment to MMR (and CIs) derived from these analyses for the different genotype groups. There was a trend toward a longer time to MMR with the hOCT1 exon 2 GG and exon 7 GG genotypes; however, these were not statistically significant (exon 2, log-rank p ⫽ 0.11, exon 7, log-rank p ⫽ 0.19). For the MDR1 genotypes, there was a longer time to MMR for the 2677 TT homozygotes, but this was not statistically significant (log-rank p ⫽ 0.25). For MDR1 3435 genotypes, there was a significantly longer time to MMR for TT homozygotes compared to CC/CT genotypes (log-rank p ⫽ 0.047) Figure 1. When further analyzed using Cox’s regression models, adjusted for the IM levels and the interval time between diagnosis and treatment start (ⱕ 1 year, ⬎ 1 year), there was no statistically significant difference in time to MMR observed between the various genotypes. This is despite extensive statistical analysis of all possible combinations of SNPs in both genes. Twenty patients lost molecular remission (LMR) at some point. Some of the patients who lost MMR were patients for whom IM was not given as frontline therapy (average 16.5, ⫾ 28.96 months till starting IM). Most of the LMR events occurred in the first 2 years of IM therapy, and only two patients experienced LMR later than 3 years after beginning IM. Half of these LMR events occurred when no secondgeneration TKIs were available and the patients were given an increased dose of IM and re-achieved MMR. The others were switched to a newer TKI. There were more LMR events in patients homozygous for the A allele (AA) in hOCT1 exon 7, compared to patients with AG/GG, but this was not statistically significant (AA, 40% LMR vs. 22% LMR in patients with
AG/GG, Fisher’s exact test p-value: 0.2113). The lack of statistical significance may in part be due to the relatively small number of patients who had LMR. For the other genotypes as well, there were no differences in the genotypes of patients losing remission compared to those not losing remission. Eighty-two/84 of the patients are still alive and 82% are still on IM. Fifteen patients stopped IM at some point (10 treatment failures, the rest due to intolerance). There was no difference in the genotype at hOCT1 exon 2 or MDR1 genotypes of patients failing IM therapy. For hOCT1 exon 7, 20% (2/10) of AA homozygotes failed IM, compared to 10.6% (7/66) of patients with GG/AG. However, this did not achieve statistical significance (Fisher’s exact test p-value: 0.1178), perhaps due to the small number of patients with this genotype, and the small number of patients failing therapy. There was no relationship between EFS and OS according to MDR1 or hOCT1 genotype (data not shown). Only two patients (2.4%) developed accelerated phase or blast crisis. In neither of these patients was there a demonstrable molecular etiology. In two additional patients, Abl kinase domain mutations were identified. One patient, who never achieved molecular remission, was found to have T315I, demonstrated after 11 years of IM therapy. This patient started IM therapy in 2001, 9 months after the diagnosis of CML. He currently remains in chronic phase, being treated with a third-generation TKI agent. In addition, one patient was found to have F486S, demonstrated at the time of hematological relapse, 2 years after initiating IM. This patient was treated with IM immediately upon diagnosis of CML, and had an excellent IM level (1329 ng/mL). Some months later, she was inadvertently given Hypericum perforatum (St. John’s wort), which is known to induce intestinal P-glycoprotein and reduces IM bioavailability and drug efficacy. Either the Hypericum or the Abl kinase mutation (or both) may have contributed to her hematological relapse. She currently remains in MMR 3 years later on a newergeneration TKI agent.
Discussion It would be optimal to be able to predict treatment response in CML using an easily measurable parameter, since several treatment options currently exist. DNA analysis is well suited for this purpose, since it is easily prepared and stable during storage, and somatic SNPs are readily analyzed. Therefore, we studied SNPs in the two transporters which have previously been suggested to have the greatest effect on IM disposition, to attempt to find a simple clinical tool, verified using IM levels and long-term clinical data. To our knowledge, ours is the first study that combines IM levels with pharmacogenetic data and clinical outcome in a Caucasian population.
Table III. Median time from initiation of IM to MMR according to genotype (months)*. hOCT1 rs683369 (exon 2) CC: 11.4 [7.0; 15.7] GC: 8.5 [6.7; 14.7] GG: 7.1 [5.5; 13.0]
hOCT1 rs628031 (exon 7)
MDR1 rs2032582 (G2677T)
MDR1 rs1045642 (C3435T)
AA: 9.3 [5.5; 15.7] AG: 7.9 [6.1; 13.0] GG: 10.9 [6.8; 29.0]
GG: 10.7 [6.8; 13.8] GT: 10.8 [5.6; 15.4] TT: 40.2 [6.0; NE]
CC: 10.0 [6.7; 13.0] CT: 7.0 [5.6; 13.8] TT: 13.6 [7.9; 42.9]
IM, imatinib; MMR, major molecular response; NE, not estimable. *Confidence intervals are in square brackets. p-Values are as follows: rs683369: p ⫽ 0.114, rs628031: p ⫽ 0.186, rs2032582: p ⫽ 0.253, rs1045642: p ⫽ 0.047.
Leuk Lymphoma Downloaded from informahealthcare.com by University of Louisville on 01/09/15 For personal use only.
Polymorphisms and imatinib resistance
Figure 1. Time to achieve major molecular remission (MMR) according to MDR1 3435 genotype. Using the Kaplan–Meier method, the time to achieving MMR was plotted by genotype (CC, CT, TT) for 84 patients. The curve shows the number of patients not yet achieving MMR during the follow-up period. Over time, significantly more patients with the TT genotype had not yet achieved MMR, compared to patients with CC and CT (p ⫽ 0.047).
A previous study correlating these three parameters was performed in Japanese patients [16]. We undertook our study following a recent study performed in Israel (using a different patient cohort) which found a correlation between IM levels and clinical response [21], but which did not analyze pharmacogenetic data. Our study has a number of strengths and also some weaknesses. Its main strengths are the testing of IM levels and genotypes in one group of patients to allow direct comparison of which was the more significant parameter. The main weakness is the small number of patients, which could have resulted in missing the effects of SNP genotypes that were less common. The small number of patients also made it impossible to evaluate the effect of SNPs on uncommon events such as failure to achieve MMR (which occurred in only nine [10.7%] patients) or progression to blast crisis, which occurred in only two patients (2.3%). Another possible weakness is the variable time until the patients were started on IM. However, the median time to IM intiation was short (1.3 months), and the inclusion of patients who started IM at various time points following diagnosis enabled including patients with very long follow-up times (median 83 months). Another possible weakness is the variable IM doses, for which compensation was made using statistical analysis. For a satisfactory therapeutic response in CML, IM levels should be ⱖ 1002 ng/mL, which was found to be the threshold for achievement of MMR [22,23]. The mean level found in our patients was 1167.9, which is above this threshold, and is expected to be correlated with a good clinical response, as was seen in our patients. We found a significantly greater chance of losing MMR if IM levels were low. Although measurement of drug levels was found to be predictive of response to IM in several prior studies [16,21–23], their measurement is not routinely available and it is not likely that this testing will be more accessible. Several TKIs are currently in clinical use, including newer-generation drugs, such that the demand for specific IM drug level testing is reduced. Furthermore, a recent small study suggested that intracytoplasmic drug
2529
determination in leukemic cells may be more reliable than plasma levels, raising further challenging issues regarding monitoring TKI therapy in the future [4]. Our study did not demonstrate a relationship between IM levels and genotype, perhaps in part since dosing was flexible according to patient needs. Similar results were found in a study of 67 Japanese patients, which reported no significant correlation between IM levels and SNPs in hOCT1 and MDR1 in patients on varying IM doses [16]. It is of note that in our study, hOCT1 exon 7 Met408Val AA homozygotes, who were on a significantly higher IM dose, had slightly lower levels, in contrast to the overall significant relationship of dose and IM levels. hOCT1 is expressed in liver and intestine, and various drugs are thought to be absorbed and eliminated by hOCT1 [24]. IM plasma levels may thus reflect the activity of transporters which, in addition to influencing IM influx into CML cells, also affect absorption and elimination [25]. Pharmacokinetic resistance due to multiple mechanisms affecting plasma levels, in addition to inadequate drug influx into CML cells, may both affect treatment response [26]. The complex interplay between multiple transporters and their influence on IM levels has recently been demonstrated by a study on intracellular TKI levels. This study, performed in drug sensitive and drug resistant K562 cells (derived from a patient with blast crisis CML), used different specific inhibitors of hOCT1, MDR1 and BCRP2, either individually or in combination [4]. This study demonstrated the importance of these transporters for intracellular levels of IM (though not of nilotinib, which is largely independent of the effects of these transporters). Such studies would be enlightening if analyzed together with plasma levels and pharmacogenetic data in patients. When we undertook our study, there was no conclusive data on hOCT1 SNPs and outcome with the exception of the exon 7 M420 deletion, which was known to have an adverse effect. Since then, several recent studies have addressed this issue. Angelini et al. [8] studied 189 IM treated patients and found that a combination of SNPs in hOCT1 influenced treatment response, with the C allele in exon 2 being considered as favorable (and G being unfavorable) [8]. Our results are concordant with this, as our patients with GG at the exon 2 SNP had a longer time to achievement of MMR. However Angelini’s group did not study the exon 7 Met408Val SNP. Takahashi et al. studied the exon 7 Met408Val SNP and found a greater likelihood of achieving MMR in patients with the exon 7 GG genotype compared to individuals carrying an A allele. This was statistically significant for patients on doses of ⬍ 400 mg a day [16], for whom more active drug influx would be expected to be essential. In addition, a recent comprehensive study (Giannoudis et al. [9]) analyzed, using pyrosequencing, 23 hOCT1 SNPs in 336 patients with CML treated with IM, and their effect on outcome (evaluable in 195 patients), without data on IM levels or other transporters. Giannoudis et al. confirmed the adverse effect of M420 del, which has decreased transporter activity; however, this could be mitigated by the presence of the variant G allele at exon 7 position 408. This study also demonstrated, using an in vitro model, that the valine (G) allele had greater IM uptake and, as such, might be expected to improve prognosis. We found
Leuk Lymphoma Downloaded from informahealthcare.com by University of Louisville on 01/09/15 For personal use only.
2530
J. Vine et al.
a trend toward fewer IM treatment failures with the GG/AG genotypes compared to AA: 20.0% of patients with AA failed IM compared to 10.6% of patients with GG/AG (Fisher’s exact test p-value: 0.1178). In addition, as mentioned above, the patients with AA had a significantly higher dose requirement to maintain a satisfactory response to IM. These findings are in agreement with the published in vitro studies [9]. Furthermore, another very recent study of 167 patients with CML also found that the A allele at exon 7 Met408Val conferred a worse prognosis as measured by a number of different clinical parameters [10]. Our findings are in agreement with these published genotyping studies, although ours did not reach statistical significance, perhaps due to the smaller number of patients studied. Although we did not find hOCT1 SNPs to have statistically significant prognostic value in patients with CML treated with IM, we did find that IM levels significantly predicted response to IM therapy. That, together with the multivariate analysis as mentioned above, suggests that IM levels have greater prognostic significance than hOCT1 genotyping. This is despite exhaustive statistical analysis of all possible SNP combinations. Our study demonstrated a significantly longer time to MMR for patients homozygous for the T variant at MDR1 3435. Maffioli et al., who studied 65 IM treated patients, found that the CC genotype at 3435 was associated with primary treatment failure [14], which is in contrast to the findings of our study in which the TT genotype appeared unfavorable in that patients with TT required a longer time to achieve MMR. However there were very few patients with primary failure in Maffioli’s study. Another, larger study by Angelini et al. [8] reported results similar to ours. This study found that, for the Caucasian subgroup of patients, the 3435 CC genotype had a more favorable prognosis, with more complete molecular responses (CMRs) in patients with the CC genotype as compared to TT [8]. However, this study failed to find a difference in IM treatment response when considering an aggregate haplotype of three MDR1 SNPs [8]. Two-thirds of the patients in Angelini’s study were treated with 800 mg a day of IM. Although that group did not find an effect of drug dose in their study, there is evidence that the response to IM is different when given in high doses [26]. Thus in Angelini’s study, the contribution of MDR1 may have been less significant than in the present study since our patients were treated with lower IM doses. We conclude that IM levels are correlated with clinical response in CML. Low levels correlate with treatment failure. However, as levels are not available on a routine clinical basis, treatment failures may inadvertently be caused by suboptimal dosing. The use of alternative tyrosine kinase inhibitors which are not influenced by transporters may overcome this problem. Unfortunately, our data do not simplify optimal drug selection for each patient on the basis of easily available pharmacogenetic parameters. The data are still at present inconclusive, and further studies are required to clarify many issues [25]. Such studies would require very large groups of patients to determine which genotypes of multiple transporters are predictive of treatment failure and for whom newer-generation TKI treatment is advisable.
Acknowledgements We are grateful to Novartis Corporation for their generous support of this project and for performance of the analysis of imatinib levels, which was done without knowledge of genotypes or patient clinical information. Jacob Vine carried out this study in partial fulfillment of the requirements for an MD degree at the Hebrew UniversityHadassah Medical School. We thank Dr. Svetlana Krichevsky, Elena Slyusarevsky and Galina Pogrebijski for excellent technical assistance. Lisa Deutsch provided excellent statistical analysis. Potential conflict of interest: Disclosure forms provided by the authors are available with the full text of this article at www.informahealthcare.com/lal.
References [1] O’Brien S, Berman E, Moore JO, et al. NCCN Task Force report: tyrosine kinase inhibitor therapy selection in the management of patients with chronic myelogenous leukemia. J Natl Compr Canc Netw 2011;9(Suppl. 2): S1–S25. [2] Thomas J, Wang L, Clark RE, et al. Active transport of imatinib into and out of cells: implications for drug resistance. Blood 2004;104: 3739–3745. [3] White DL, Saunders VA , Dang P, et al. OCT-1-mediated influx is a key determinant of the intracellular uptake of imatinib but not nilotinib (AMN107): reduced OCT-1 activity is the cause of low in vitro sensitivity to imatinib. Blood 2006;108:697–704. [4] Bouchet S, Dulucq S, Pasquet JM, et al. From in vitro to in vivo: intracellular determination of imatinib and nilotinib may be related with clinical outcome. Leukemia 2013;27:1757–1759. [5] Racil Z, Razga F, Buresova L, et al. The assessment of human organic cation transporter 1 (hOCT1) mRNA expression in patients with chronic myelogenous leukemia is affected by the proportion of different cells types in the analyzed cell population. Am J Hematol 2010;85:525–528. [6] Razga F, Racil Z, Machova Polakova K , et al. The predictive value of human organic cation transporter 1 and ABCB1 expression levels in different cell populations of patients with de novo chronic myelogenous leukemia. Int J Hematol 2011;94:303–306. [7] Dulucq S, Bouchet S, Turcq B, et al. Multidrug resistance gene (MDR1) polymorphisms are associated with major molecular responses to standard-dose imatinib in chronic myeloid leukemia. Blood 2008;112:2024–2027. [8] Angelini S, Soverini S, Ravegnini G, et al. Association between imatinib transporters and metabolizing enzymes genotype and response in newly diagnosed chronic myeloid leukemia patients receiving imatinib therapy. Haematologica 2013;98:193–200. [9] Giannoudis A , Wang L, Jorgensen AL, et al. The hOCT1 SNPs M420del and M408V alter imatinib uptake and M420del modifies clinical outcome in imatinib-treated chronic myeloid leukemia. Blood 2013;121:628–637. [10] Koren-Michowitz M, Buzaglo Z, Ribakovsky E, et al. OCT1 genetic variants are associated with long term outcomes in imatinib treated chronic myeloid leukemia patients. Eur J Haematol 2014;92: 283–288. [11] Eechoute K, Sparreboom A , Burger H, et al. Drug transporters and imatinib treatment: implications for clinical practice. Clin Cancer Res 2011;17:406–415. [12] Hodges LM, Markova SM, Chinn LW, et al. Very important pharmacogene summary: ABCB1 (MDR1, P-glycoprotein). Pharmacogenet Genomics 2011;21:152–161. [13] Kimchi-Sarfaty C, Oh JM, Kim IW, et al. A “silent” polymorphism in the MDR1gene changes substrate specificity. Science 2007;315: 525–528. [14] Maffioli M, Camós M, Gaya A , et al. Correlation between genetic polymorphisms of the hOCT1 and MDR1genes and the response to imatinib in patients newly diagnosed with chronic-phase chronic myeloid leukemia. Leuk Res 2011;35:1014–1019.
Leuk Lymphoma Downloaded from informahealthcare.com by University of Louisville on 01/09/15 For personal use only.
Polymorphisms and imatinib resistance [15] Kim DH, Sriharsha L, Xu W, et al. Clinical relevance of a pharmacogenetic approach using multiple candidate genes to predict response and resistance to imatinib therapy in chronic myeloid leukemia. Clin Cancer Res 2009;15:4750–4758. [16] Takahashi N, Miura M, Scott SA , et al. Influence of CYP3A5 and drug transporter polymorphisms on imatinib trough concentration and clinical response among patients with chronic phase chronic myeloid leukemia. J Hum Genet 2010;55:731–737. [17] Kerb R. Implications of genetic polymorphisms in drug transporters for pharmacotherapy. Cancer Lett 2006;234:4–33. [18] Parise RA , Ramanathan RK , Hayes MJ, et al. Liquid chromatographic-mass spectrometric assay for quantitation of imatinib and its main metabolite (CGP 74588) in plasma. J Chromatogr B Analyt Technol Biomed Life Sci 2003;791:39–44. [19] Baccarani M, Castagnetti F, Gugliotta G, et al.; European LeukemiaNet. Response definitions and European LeukemiaNet Management recommendations. Best Pract Res Clin Haematol 2009;22:331–341. [20] Cascorbi I, Gerloff T, Johne A , et al. Frequency of single nucleotide polymorphisms in the P-glycoprotein drug transporter MDR1 gene in white subjects. Clin Pharmacol Ther 200;69:169–174. [21] Koren-Michowitz M, Volchek Y, Naparstek E, et al. Imatinib plasma trough levels in chronic myeloid leukaemia: results of a multicentre study CSTI571AIL11TGLIVEC. Hematol Oncol 2012;30:200–205.
2531
[22] Picard S, Titier K , Etienne G, et al. Trough imatinib plasma levels are associated with both cytogenetic and molecular responses to standard-dose imatinib in chronic myeloid leukemia. Blood 2007;109:3496–3499. [23] Bouchet S, Titier K , Moore N, et al. Therapeutic drug monitoring of imatinib in chronic myeloid leukemia: experience from 1216 patients at a centralized laboratory. Fundam Clin Pharmacol 2013:27: 690–697. [24] Bourdet DL , Pritchard JB, Thakker DR. Differential substrate and inhibitory activities of ranitidine and famotidine toward human organic cation transporter 1 (hOCT1; SLC22A1), hOCT2 (SLC22A2), and hOCT3 (SLC22A3). J Pharmacol Exp Ther 2005; 315:1288–1297. [25] Deenik W, van der Holt B, Janssen JJ, et al. Polymorphisms in the multidrug resistance gene MDR1 (ABCB1) predict for molecular resistance in patients with newly diagnosed chronic myeloid leukemia receiving high-dose imatinib. Blood 2010;116:6144–6145; author reply 6145–6146. [26] Petzer AL, Wolf D, Fong D, et al. High-dose imatinib improves cytogenetic and molecular remissions in patients with pretreated Philadelphia-positive, BCR-ABL-positive chronic phase chronic myeloid leukemia: first results from the randomized CELSG phase III CML 11 “ISTAHIT” study. Haematologica 2010;95: 908–913.
