Article pubs.acs.org/molecularpharmaceutics
Polyspermine imine, a pH Responsive Polycationic siRNA Carrier Degradable to Endogenous Metabolites Zixiu Du,† Shengnan Xiang,‡ Yi Zang,† Yi Zhou,† Chuandong Wang,‡ Hailing Tang,† Tuo Jin,† and Xiaoling Zhang*,‡ †
Shanghai Jiao Tong University School of Pharmacy, 800 Dongchuan Road, Shanghai 200240, China The Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Jiao Tong University School of Medicine & Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200025, China
‡
S Supporting Information *
ABSTRACT: Cationic polymers readily degradable in response to cellular environment are especially favored as easy-formulating materials to pack siRNA into a nanoparticle and to release the cargo in the cytoplasm in time. In addition to the efficiency of cytosomal release, the degradation products should best be free of safety concerns, a typical challenge for cationic polymers. To satisfy the two criteria, we report a new cationic polymer, polyspermine imine, named as PSP-Imine, which is formed by condensing two endogenous molecules, spermine and glyoxal, through conjugated π linkage, NCCN (Schiff base reaction), a poly linkage structure sufficiently stable under neutral condition but dissociative under the endosomal pH. Cellular assays under a confocal microscope indicated that the polyplex formed of PSP-Imine readily released the loaded siRNA to the cytoplasm after being engulfed in the target cells and efficiently silenced the target genes in different cell lines and xenograft mouse model of human cervical carcinoma, as compared with nondegradable PEI 25 kDa. Cell viability assays confirmed that PSP-Imine showed no visible cytotoxicity within the concentration being tested. The present study suggests that PSP-Imine is an excellent siRNA condensing material for forming the core of a therapeutically feasible synthetic carrier system. KEYWORDS: polyspermine imine, suitable degradation rate, endogenous metabolites, gene silencing, therapeutic drug
■
INTRODUCTION
Many studies reported to date were focused on creating biodegradable cationic polymers for siRNA delivery, especially those responsive to endosomal environment. such as biodegradable polyesters,6 polyphosphoester,7,8 β-amino esters,9−12 cross-linked low molecular weight PEI,13−15 and biodegradable cationic polymers containing disulfide bonds.16,17 However, none of these responsive degradations leads to endogenous or at least proven-nontoxic products, a favorable property for a cationic polymer carrier for minimal safety concerns (i.e., task E). Polyspermine 4,5-imidyzolimine (PSI) reported by Duan at al. offered an example to accomplish the intracellular tasks including self-metabolizing.1 In PSI, the heterogenic cyclic conjugated imine linkage of the polymer played an important role to satisfy both prephagocytotic stability and postphagocy-
A therapeutically feasible synthetic carrier for siRNA must accomplish a series of tasks along its inter- and intracellular trafficking including (A) packaging siRNA into nanoparticle; (B) holding and targeting siRNA along intercellular trafficking; (C) facilitating endosomal escaping of siRNA; (D) releasing siRNA in the cytoplasm efficiently, and (E) metabolizing itself to nontoxic (best to be endogenous) species.1,2A rationally designed multifunctional cationic polymer may accomplish tasks A, C, D, and E of the above.1 The essential criteria for a cationic polymer to achieve the four objectives involve sufficient density of the cationic groups, degradable poly linkage in response to the endosomal environment, and endogenous (at least nontoxic) degradation products. As long as these criteria are satisfied, a rationally designed membrane may be assembled around the polyplex formed of the designed cationic polymer to prevent siRNA leaking due to in vivo polyelectrolytes, neutralize the extra positive charges for in vivo circulation, and facilitate target cell recognition.3,4 In addition to the above analysis, some intracellular mechanisms involving a role of cationic polymers or their fragments were discovered.5 © 2014 American Chemical Society
Special Issue: Recent Molecular Pharmaceutical Development in China Received: Revised: Accepted: Published: 3300
March 1, 2014 April 23, 2014 May 20, 2014 May 20, 2014 dx.doi.org/10.1021/mp500169p | Mol. Pharmaceutics 2014, 11, 3300−3306
Molecular Pharmaceutics
Article
purchased from Shanghai Experimental Animal Center of Chinese Academic of Sciences (Shanghai, China). Preparation of PSP-Imine and Polyplexes. The synthesis of PSP-Imine was reported previously.20 Briefly, equimolar amounts of spermine with glyoxal as aqueous solution were stirred in anhydrous ethanol at room temperature with p-toluenesulfonic acid and molecular sieve (3 Å) overnight, the product was dialyzed against dialysis membranes (MW cut off = 3500) in distilled water and subsequently lyophilized. The polyplexes formed by mixing PSP-Imine (1 mg/mL in RNase-free water) with siRNA plasmid at different weight ratios were then left to assemble for 30 min at room temperature. Cell Culture. Bone marrow was obtained from SD rats (150 to 200 g) and seeded in 10 mL dishes with Dulbecco’s modified Eagle’s medium (DMEM) F12 supplemented with 10% FBS. After 2 d, the culture medium was replaced with fresh DMEM/ F12 containing 10% FBS. The medium replacement was repeated to remove blood cells and other bone marrow substances every other day. Then, the adhesion cells which were mainly BMSCs were passaged. Passage 3 to passage 8 was used for our in vitro study. All other cells were cultured in DMEM (MediaTech, Herndon, VA, U. S. A.) with 10% fetal bovine serum (FBS, Hyclone, Logan, UT, U. S. A.) at 37 °C under a humidified atmosphere containing 5% CO2. Cell Viability Assay. MTT assay was performed to measure the cytotoxicity of PSP-Imine and PEI 25 kDa. Polymer solutions were separately prepared in phenol red-free DMEM at various concentrations from 5 to 150 μg/mL. BMSCs, GFPU2OS, and Hela cells were seeded into 96-well plates and incubated at 37 °C for 24 h. The culture medium was replaced with 200 μL of polycationic carrier solution with different concentrations, and the cells were incubated for 4 h. Then, fresh DMEM was added to each well. The cells were further incubated for 20 h. The medium was removed and replaced with 100 μL of fresh medium. Then, 20 μL of MTT solution (5 mg/mL in PBS buffer) was added to each well, and incubated for 4 h at 37 °C with 5% CO2. Viable cells were determined by measuring the absorbance of the samples at 490 nm using an ELISA reader (MK3 Thermo Lab System, Finland). The percentage of viable cells was obtained by comparing the absorbance of the samples with and without added cationic polymers. Cellular Uptake Assay. The polyplexes were prepared using PSP-Imine with FAM or Cy3 fluorescently labeled negative control siRNA at weight ratios of 12:1, 24:1, and 36:1, named as PSP-Imine (12:1), PSP-Imine (24:1), and PSP-Imine (36:1), respectively. PEI 25 kDa (N/P = 10:1) was used as positive control, and FAM fluorescently labeled negative control siRNA was used as negative control. The cells were transfected at 37 °C for 4 h. Fluorescent cells were observed under an inverted Leica DM IRB fluorescence microscope. After cell digestion using trypsin, BMSCs were suspended using 500 μL of PBS. The flow cytometric measurement was performed on a BD FACSAria instrument. Hela cells were seeded in the density of 1.5 × 105 cells per well in 6-well plate and incubated for 24 h prior to transfection. Then removed the culture medium and washed with PBS. A total of 2 mL of nanocomplexes solution containing 1.5 μg siRNA formed by PSP-Imine and cy3-labed at N/P ratios of 12:1, 24:1, and 36:1, respectively, in OptiMEM. PEI 25 kDa (N/P = 10:1) was used as positive control. After incubating for 4 h, the solution was replaced by 2 mL of 4% paraformaldehyde
totic responsibility. For the intracellular trafficking of nucleic acids, on another hand, the rate of the degradation, that is, the balance between cellular responsibility and polymer stability, may also need to be optimized.5 To increase the library for such optimization, the present study demonstrated a polymer through aliphatic conjugated imine linkage as another example of cationic polymers degradable to endogenous monomers. Spermine, an endogenous multiamino group-bearing monomer that condenses DNA in sperm, was generally used in the past as a building block to synthesize polycationic gene carriers.18,19 However, the linkers themselves were cleft after degradation of the cationic polymers, leaving their fragments bonded to spermine. The advantage of using endogenous molecules as the building blocks to form degradable polycationic nucleic acids carriers was compromised. In a previous study,20 we synthesized a series of cationic polymers which were formed from spermine and nontoxic small molecules that may be degraded to spermine and the original small molecules. Moreover, we mainly investigated the DNA transfection and cytotoxicity of these polymers in different cell lines. Polyspermine imine (PSP-Imine) (Scheme 1) is the best Scheme 1. Synthesis of PSP-Imine through Schiff Base Reaction
cationic polymer having the potential to become a therapeutic agent with both high delivery ability and least cytotoxicity among these three cationic polymers. In this study, PSP-Imine was chosen to further investigate the siRNA delivery efficiency in vitro using three different cells, the cytotoxicity was also determined. Furthermore, PSP-Imine was used for delivering targeting siRNA to silence BMI-1 gene of Hela cells in vitro and in vivo intratumoral administration.
■
MATERIALS AND METHODS Materials. Polyethylenimine (25 kDa in molecular weight, PEI 25 kDa), spermine, and glyoxal solution (40%) were purchased from Sigma-Aldrich (U. S. A.). Carboxyfluorescein (FAM) fluorescently labeled negative control was obtained from Shanghai GenePharma (China). Fluorescent Cy3 labeling kit (Silencer siRNA Labeling Kit AM1632) was purchased from AMBION (U. S. A.). Green fluorescent protein (GFP) siRNA (sense: 5′-GGCUACGUCCAGGAGCGCACC-3′), luciferase siRNA (sense: 5′-CUUACGCUGAGUACUUCGATT-3′), BMI-1 siRNA (sequence: CAAGCAGAAATGCATCGAA), and real-time PCR universal reagents were obtained from GenePharma (Shanghai, China). The Hela cells stably expressing luciferase gene (Luc-Hela) was from Shanghai Medical Biotechnology CD., (Shanghai, China). The U2OS cells stably expressing GFP (GFP-U2OS cells) were friendly provided by Dawei Laboratory (School of Pharmacy, Shanghai Jiao Tong University). The Hela cells were obtained from Institute of Biochemistry and Cell Biology (Shanghai, China). MTT was purchased from Sigma-Aldrich (Milwaukee, WI, U. S. A.). All other solvents and reagents were analytical grade. 1BALB/c nude mice (female, 4 to 6 weeks old, and 20 g) were 3301
dx.doi.org/10.1021/mp500169p | Mol. Pharmaceutics 2014, 11, 3300−3306
Molecular Pharmaceutics
Article
Figure 1. Cytotoxicity of PSP-Imine at various concentrations in different cell lines after incubation for 24 h: (a) BMSCs, (b) GFP-U2OS cells, and (c) Hela cells.
and stored in 4 °C overnight. Then, the cells were washed twice with PBS and permeabilized with 0.1% triton in phosphatebuffered saline, blocked with 3% bovine serum albumin (BSA), stained for 2 h at room temperature with Alexafuor 488 phalloidin (1:50 dilution in 0.1% triton in phosphate-buffered saline, Invitrogen, U. S. A.), washed thrice with phosphatebuffered saline, and incubated for 30 min at room temperature DAPI (0.1 mg/mL, Sigma-Aldrich, U. S. A.). The cells were washed and sealed in mounting media (Invitrogen, U. S. A.) before visualizing on a Leica TCS SP8 laser scanning microscope system (Leica Microsystems, Germany). In Vitro Assay of Gene Silencing. Luc-Hela cells were seeded in 96-well plate at 2.5 × 104 cells per well and cultured for 24 h. Then the polyplexes formed by PSP-Imine and luciferase siRNA at different N/P ratios of 12:1, 24:1, and 36:1 were added to the cells in six replicates, and the total polyplex solution was 200 μL per well. In addition, the untreated group was incubated in Opti-MEM without carrier molecules and PEI 25 kDa to luciferase gene at 10 N/P ratio was used as the positive group. Then, the cells were incubated for 4 h at 37 °C under a humidified atmosphere with 5% CO2. The DMEM was removed, and 250 μL DMEM supplemented with 10% FBS was added every well. After incubation for 24 h at 37 °C, luciferase activity was determined by luminary intensity recorded (as RLU/mg) with a Sirius Luminometer (Berthold, Germany). GFP-U2OS cells were seeded at 2 × 104 cells per well in a 200 μL complete medium for 24 h prior to transfection. The polyplexes formed by PSP-Imine and GFP siRNA at different N/P ratios of 12:1, 24:1, and 36:1 were added to the cells in six replicates, and the total polyplex solution was 200 μL per well. In addition, PBS was used as the untreated group and PEI 25 kDa was used as the positive group. Then, the cells were incubated for 4 h at 37 °C under a humidified atmosphere with 5% CO2. The DMEM was removed, and 250 μL DMEM supplemented with 10% FBS was added per well. After incubation for 48 h at 37 °C, the cells were measured through flow cytometry on a BECKERMAN instrument. In addtion, Hela cells were seeded at 2 × 104 per well in a 96well plate 24 h prior to transfection. The culture media was replaced with 100 μL serum-free medium, and the polyplexes formed by PSP-Imine and BMI-1 siRNA at N/P ratio of 36:1 were added to the cells in six replicates. Additionally, two control groups were used: (1) PSP-Imine dissolved in OptiMEM and (2) polyplexes formed by PSP-Imine and negative control siRNA of random sequences at N/P ratio of 36:1. The total polyplex solution was 200 μL per well, and the cells were incubated for 4 h at 37 °C under a humidified atmosphere with
5% CO2 The solution was then replaced by DMEM supplemented with 10% FBS and incubated for 48 h after transfection at 37 °C under a humidified atmosphere with 5% CO2 for real-time PCR assay. Xenograft Mouse Model of Human Cervical Carcinoma. Balb/c nude mice were maintained in a pathogen-free environment and allowed to acclimatize for at least 1 week before tumor implantation. All studies were performed in accordance with the guidelines of the Committee on Animals of School of Pharmacy, Shanghai Jiao Tong University, Shanghai, China. The Balb/c nude mice were inoculated subcutaneously in the right axillaries with 1.2 × 106 Hela cells from the 150 μL culture medium to develop xenograft tumors. After about 2 weeks, the tumor volume reached about 50 mm3 at 100% tumor formulation rate. The mice were divided into three groups: (1) untreated group (6 mice), (2) negative group (6 mice), and (3) PSP-Imine (36:1) group (6 mice). Briefly, the untreated group received three doses (day 0, day 7, and day 12) of 150 μL PBS per mouse at the same time points. Correspondingly, the negative group was injected with the same amount of polyplex solution containing 3.5 mg/kg siRNA formed by PSP-Imine with random sequence siRNA at N/P ratio of 36:1, and the PSP-Imine (36:1) group was injected with 150 μL of polyplex solution containing 3.5 mg/kg target siRNA formed by PSP-Imine with BMI-1 siRNA at N/P ratio of 36:1. The volumes of the tumors were measured using a caliper each day at the same time. Tumor volume (V) was calculated as V = W2 × L/2 where W and L represent the shortest and longest diameters of the tumors, respectively.21 The tumor growth rate (R) was evaluated according to the following equation: [volume of the tumor at the point of measurement (Vt) − volume of the tumor on the first day of treatment (V0)]/ V0. The mice were culled 4 d after the last injection, and the tumor tissues were kept at −80 °C for real-time PCR measurements. Real-time PCR. Real-time PCR was performed using a SYBR green method and universal reagents (catalog no. GMRS-001, GenePharma, Shanghai). hGAPDH was utilized as an internal standard to determine the relative expression levels for each gene, and hBMI-1 was used to quantify hBMI-1 gene expression. The sequences used were as follows. hGAPDH: forward primer, CATGAGAAGTATGACAACAGCCT; reverse primer: AGTCCTTCCACGATACCAAAGT; with a product size of 113 bp. hBMI-1: forward primer, TGATGCTGCCAATGGCTCTAAT; reverse primer: CGATCCAATCTGTTCTGGTCAAAG; with a product size of 123 bp. The experimental procedures were as follows: (1) total RNA extraction; (2) reverse transcription reaction for 45 3302
dx.doi.org/10.1021/mp500169p | Mol. Pharmaceutics 2014, 11, 3300−3306
Molecular Pharmaceutics
Article
min at 42 °C followed by 10 min at 85 °C, where 0.2 μL of MMLV RTase (200 U/μL) and 5 μL of total RNA were used for the reverse transcription; and (3) real-time PCR. The realtime PCR conditions were as follows: 3 min denaturation at 95 °C, 40 cycles at 95 °C for 12 s, and 40 s at 62 °C. The RT-PCR assay was performed on MX3000P Real-time PCR Instrument (Stratagen, U. S. A.). Statistical Analysis. For all experiments, the date are represented as mean ± SD t tests were used for statistical analysis, and p < 0.05 was considered significant. All the analyses were done using GraphPad Instat (GraphPad software, San Diego, CA, U. S. A.).
■
RESULTS Cytotoxicity Assay. The cytotoxicity of cationic polymers is one of the key factors for nucleic acid delivery. PSP-Imine has a simple chemical structure and suitable hydrolysis rate, which may be important for PSP-Imine to decrease its cytotoxicity. In this study, PSP-Imine and PEI-25 kDa were incubated with BMSCs, GFP-U2OS, and Hela cells at 37 °C under a humidified atmosphere with 5% CO2 for 24 h. Polymer cytotoxicity was examined in the above-mentioned cell lines. Upon transfection with PSP-Imine, BMSCs showed that over 90% of its cells were viable within the range from 5 μg/mL to50 μg/mL. In addition, even at high PSP-Imine concentration (150 μg/mL), the cell viability remained at around 77%. In contrast, PEI 25 kDa showed high toxicity to BMSCs even at a low concentration of 15 μg/mL, where only 27% of the cells remained viable. Cell viability further decreased to 3% at a 50 μg/mL PEI 25 kDa (Figure 1A). In addition, the cell viability of GFP-U2OS and Hela cells was approximately 90% when transfected with PSP-Imine at concentrations ranging from 5 μg/mL to 25 μg/mL. When the concentrations of PSP-Imine increased, the viability of both cell lines rapidly decreased. In comparison, the cytotoxicity of PEI 25 kDa at 5 μg/mL was significantly higher than that of PSP-Imine with 5% of GFPU2OS and 20% Hela cells remaining viable using PEI. When the concentration of PEI 25 kDa increased to 25 μg/mL, the viability of GFP-U2OS was reduced to 10%, and the viability of Hela cells decreased to 3% (Figure 1B and C). Cellular Uptake of Polyplexes. To investigate the delivery efficiency of PSP-Imine in different cell lines, we performed a cellular uptake study using FAM-labeled siRNA in BMSCs and Cy3-labeled siRNA in Hela cells, respectively. The fluorescence intensities of the cells were observed through inverted fluorescence microscopy (Supporting Information Figure 1A). Naked siRNA was used as the control group with background fluorescence, and PEI 25 kDa was used as the positive group that exhibited slightly weak fluorescence. All the PSP-Imine groups had significantly higher fluorescence intensities. Cellular uptake was also quantitatively tested using flow cytometer. Over 90% of FAM-positive cells were observed in the PSPImine groups. By contrast, the naked siRNA group mostly showed negative cells, and the PEI 25 kDa group had 85% positive cells, as measured by a flow cytometer (Supporting Information Figure S1B). It indicated that the polyplexs of PSPImine/siRNA at different weight ratios of cationic polymer to nucleic acids could be easy endocytic in primary cells. On the other hand, the endocytosis efficiency of polyplexes of PSPImine/siRNA in Hela cells were lower than that in BMSCs and improved with the increase of weight ratios of PSP-Imine to siRNA, and still showed higher endocytosis efficiency compared to that of PEI 25 kDa in Hela cells (Figure 2).
Figure 2. Cellular uptake of PSP-Imine (12:1), PSP-Imine (24:1), and PSP-Imine (36:1) in Hela cells. Both the untreated group (in OptiMEM) and PEI 25 kDa (N/P = 10:1) are control groups. (***p < 0.001).
Confocal images of fluorescent polyplex treated cell lines indicated and the release of Cy3-labeled siRNA (red) of nanocomplexes in Hela cells. Transfections were performed for 4 h. It could be found that most of polyplexes located in the cytoplasmic in all samples (Figure 3A1−D1). Hela cells
Figure 3. Confocal microscopy of the location of siRNA after Hela cells were transfected for 4h with PSP-Imine (12:1), PSP-Imine (24:1), and PSP-Imine (36:1). PEI 25 kDa (N/P = 10:1) as the positive control group. The siRNA was labeled with Cy3 (Red). The cells were stained with Alexafuor 488 phalloidin for cytoplasmic skeleton (Green), and DAPI for the nucleus (blue). Scale bar =10 μm.
transfected with PEI 25 kDa showed many red nanoparticles outside of the nucleus (Figure 3A), which indicated most of siRNAs still were wrapped by PEI 25 kDa and few of which were released in the cytoplasmic. However, Hela cells transfected with PSP-Imine (12:1) showed many cloudy missions outside the nucleus, some of which were too weak to be observed clearly (Figure 3B2−B3). Compared with PSPImine (12:1), more and more bright cloudy missions appeared in Hela cytoplasmic for PSP-Imine (24:1) and some nanoparticles could be observed accompanied by many cloudy missions in PSP-Imine (36:1). The confocal results employed with the flow cytometry measurement (Figure 3) showed that PSP-Imine had high ability to carry siRNA to escape endosome and release siRNA into cytoplasmic immediately. PEI 25 kDa 3303
dx.doi.org/10.1021/mp500169p | Mol. Pharmaceutics 2014, 11, 3300−3306
Molecular Pharmaceutics
Article
57% of the GFP expression was silenced in the PSP-Imine (12:1), which was incubated with the polyplexes formed by PSP-Imine and GFP siRNA at N/P ratio of 12:1 (PSP-Imine concentration = 5.2 μg/mL). Accordingly, as the weight ratio increased, the silencing efficiency improved. When N/P ratio of PSP-Imine to siRNA reached 24:1 (PSP-Imine concentration=10.4 μg/mL), approximately 68% of the GFP expression was reduced, and 77% of the GFP expression was silenced at 36:1 N/P ratio of PSP-Imine to siRNA (PSP-Imine concentration=15.6 μg/mL). The cell viability was more than 90% in the GFP-U2OS cells at all of the PSP-Imine concentrations used for the GFP siRNA transfer. Thus, PSPImine has a high ability to deliver siRNA in GFP-U2OS cells at all N/P ratios tested (from 12:1 to 36:1). Real-time PCR was used to further determine the efficacy of siRNA in Hela cells complexed with PSP-Imine. As shown in Figure 6, PSP-Imine without siRNA did not silence the BMI-1
could deliver siRNA effectively while it had lower ability to release siRNA in the cytoplasmic. Gene Silencing Efficiency. As shown in Figure 4, the results of luciferase gene knockdown showed siRNA delivery
Figure 4. Knockdown of luciferase expression transfected with or without carrier molecules in Luc-Hela cells for 24 h. Luciferase siRNA was used to silence the luciferase gene. Untreated group (Incubated in Opti-MEM); PEI 25 kDa was used as the positive control group. PSPImine (12:1) (PSP-Imine at the concentration of 5.2 μg/mL); PSPImine (24:1) (PSP-Imine at the concentration of 10.4 μg/mL); PSPImine (36:1) (PSP-Imine at the concentration of 15.6 μg/mL). (*p < 0.05).
efficiency improved with the increase of N/P ratios of PSPImine to siRNA, where an average of 61% luciferase gene was expressed in PSP-Imine (12:1) group, and which dropped to 52% and 26% in PSP-Imine (24:1) and PSP-Imine (36:1), respectively. However, PEI25 kDa showed lower siRNA delivery and release ability compared to PSP-Imine, in which about 65% luciferase gene was expressed. Similarly, as shown in Figure 5, the cells transfected with the polyplexes of PEI 25 kDa formed with GFP siRNA at the optimal weight ratio silenced 28% of the GFP expression compared with the untreated group. By contrast, approximately
Figure 6. Relative gene expression of BMI-1 in Hela cells after transfection for 48 h with or without carrier molecules. The mRNA level of BMI-1 was determined by real-time PCR and relative to that in the untreated cells. “PSP-Imine” represents only PSP-Imine; “Negative group” represents the polyplex of PSP-Imine and negative siRNA at P/ N ratio of 36:1; “PSP-Imine (36:1)” represents the polyplex of PSPImine and BMI-1 siRNA at P/N ratio of 36:1 (**p < 0.01). The concentration of PSP-Imine in all of the carrier molecules was about 15.6 μg/mL.
gene expression compared with the untreated cells (untreated group). However, the cells treated with the polyplex formed by PSP-Imine and negative siRNA (Negative group) slightly increased BMI-1 gene expression compared with the untreated group. By contrast, BMI-1 gene expression was significantly reduced to 53% when Hela cells were transfected with PSPImine (36:1). Antitumor Efficacy in Xenograft Mouse Model of Human Cervical Carcinoma. Based on the above experimental results, PSP-Imine was found to have low cytotoxicity and high siRNA delivery ability in different cell lines in vitro. To further investigate the in vivo siRNA transfection efficiency of PSP-Imine, we established a human cervical carcinoma xenograft model and tested the cytotoxicity and siRNA delivery of PSP-Imine using the largest N/P ratio of polymer to siRNA (PSP-Imine (36:1)). The tumor growth rates were tested in the three groups of mice. The trend lines of the tumor growth were significantly restrained in the PSP-Imine (36:1) group compared with the other two groups (Figure 7). The tumor growth rates at the follow-up study of the untreated group and the negative group
Figure 5. Knockdown of GFP expression transfected with or without carrier molecules in GFP-U2OS cells for 48 h. Untreated group represents incubated in Opti-MEM without carrier molecules; PEI 25 kDa represents the polyplex of PEI 25 kDa to siRNA at N/P ratio of 10:1. PSP-Imine (12:1) (PSP-Imine at the concentration of 5.2 μg/ mL); PSP-Imine (24:1) (PSP-Imine at the concentration of 10.4 μg/ mL); PSP-Imine (36:1) (PSP-Imine at the concentration of 15.6 μg/ mL). (***p < 0.001; ****p < 0.0001). 3304
dx.doi.org/10.1021/mp500169p | Mol. Pharmaceutics 2014, 11, 3300−3306
Molecular Pharmaceutics
Article
design of a cationic polymer for siRNA delivery in vitro and in vivo simultaneously. The most unique feature of PSP-Imine, as a siRNA packing polycation, is its responsive degradation to spermine and glyoxalin time20 and that the continuous release of spermine in the process of degradation exhibited the “proton-sponging” effect that facilitated endosomal rupturing in the intracellular delivery of the polyplexes.25 Due to this degradation, which was examined by incubating the polymers at 37 °C in aqueous buffers simulating the pH of various cellular environments (pH = 7.4 for the body fluid, 5.8 for endosomes, and 5.0 for lysosomes) in the previous study,20 induced by the endosomal pH, multiple objectives such as endosomal escaping and cytosol releasing of siRNA as well as self-metabolizing to avoid toxicity may be achieved at once. In the present work, the intersupportive results of low toxicity (Figure 1), cytosol spreading of fluorescent labeled siRNA (Supporting Information Figure S1, Figure 2), cloudy missions of cy3-labeled siRNA wrapped by PSP-Imine at different N/P ratios appeared in Hela cytoplasm found in the confocal image (Figure 3) and superior (than PEI 25KDa) silencing efficiency (Figures 4−6) suggest that the designed multitask mechanism is feasible. For in vivo efficacy, the site injection of polyplexes formed of PSP-Imine and BMI-1 siRNA resulted in significant size reduction of the tumors developed by implanting Hela cells to Balb/C nude mice. Although site injection is not a practical dosage regime to treat tumors developed in organs and bare polyplex is not a feasible dosage form, the in vivo result confirmed that PSP-Imine may be used as a feasible siRNA condensing material for the core of a comprehensive delivery system. Compared with prepolyplexing conjugating of functional groups such as targeting molecules or steric stabilization agents,26,27 postpolyplexing assembly of a functional membrame around the polyplex28 is more flexible and convenient, especially in the case that the population surface of the cell targeting agent need to be optimized.
Figure 7. Tumor relative increase rates in the three groups with continuous injection of different aqueous solutions. Untreated group represents the mice injected with PBS; negative group represents the mice injected with polyplexes of PSP-Imine and negative siRNA at P/ N ratio of 36:1; PSP-Imine (36:1) represents the mice injected with polyplexes of PSP-Imine and BMI-1 siRNA at P/N ratio of 36:1 at 0, 7, and 12 days.
on the 14th day were 2.05 and 1.97, respectively. However, the tumor growth rate was 1.12 in PSP-Imine (36:1) group, which was significantly lower than the two other groups. The mRNA expression of BMI-1 in the tumor tissues was also examined using RT-PCR (Figure 8). About 45% of BMI-1
■
ASSOCIATED CONTENT
S Supporting Information *
Figure 8. Relative gene expression of BMI-1 in tumor tissue. Negative group represents the mice injected with polyplexes of PSP-Imine and negative siRNA at P/N ratio of 36:1. PSP-Imine (36:1) represents the mice injected with polyplexes of PSP-Imine and BMI-1 siRNA at P/N ratio of 36:1 (** p < 0.01).
Detail informations on siRNA uptake by BMSCs and the characterization of the synthesis PSP-Imine. This material is available free of charge via the Internet at http://pubs.acs.org.
■
genes were silenced in the PSP-Imine (36:1) group compared with the untreated group. However, the mice of the negative group, which were injected with the polyplexes formed by PSPImine and negative siRNA with random sequences, could not reduce the mRNA expression of BMI-1.
AUTHOR INFORMATION
Corresponding Author
*E-mail: [email protected]. Phone: +86-21-63855434. Fax: +86-21-63855434. Address: Institute of Health Sciences, No. 225, South Chongqing Road, Shanghai, 200025, China.
■
Notes
DISCUSSION PSP-Imine, which is synthesized by spermine and glyoxal through Schiff base reaction,1 has a simple linear structure with π−π conjugated carbon−nitrogen double bonds (NC CN) on the backbone chain (Scheme 1), which is relatively more stable compared to polyimine. As one of in vivo immediate metabolites with low toxicity, glyoxal is generally used as a cross-linking reagent to prepare biological and medical hydrogel to improve the mechanical properties of chitosan fiber through Schiff base reaction between the glyoxal group and the amino group.22−24 In our study, it is the first time that glyoxal was investigated as a linking agent for the
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This work was supported by National Natural Science Foundation of China (No. 30901881), the Chinese Academy of Sciences (No. XDA01030502), Science and Technology Commission of Shanghai Municipality (No. 13430710700), and Shanghai Municipal Commission of Health and FamilyPlanning (No. 2013ZYJB0501). The authors thank the Analytical Center of Shanghai Jiaotong University for 1 HNMR and IR. 3305
dx.doi.org/10.1021/mp500169p | Mol. Pharmaceutics 2014, 11, 3300−3306
Molecular Pharmaceutics
■
Article
triacrylate-spermine-mediated delivery of shAkt1. Int. J. Nanomed. 2012, 7, 2293−306. (20) Du, Z. X.; Chen, M. Y.; He, Q. Q.; Zhou, Y.; Jin, T. Polymerized spermine as a novel polycationic nucleic acid carrier system. Int. J. Pharm. 2012, 434 (1−2), 437−443. (21) Han, K.; Chen, S.; Chen, W. H.; Lei, Q.; Liu, Y.; Zhuo, R. X.; Zhang, X. Z. Synergistic gene and drug tumor therapy using a chimeric peptide. Biomaterials 2013, 34 (19), 4680−4689. (22) Hoemann, C. D.; Chenite, A.; Sun, J.; Hurtig, M.; Serreqi, A.; Lu, Z.; Rossomacha, E.; Buschmann, M. D. Cytocompatible gel formation of chitosan-glycerol phosphate solutions supplemented with hydroxyl ethyl cellulose is due to the presence of glyoxal. J. Biomed. Mater. Res., Part A 2007, 83 (2), 521−9. (23) Noble, L.; Gray, A. I.; Sadiq, L.; Uchegbu, I. F. A non-covalently cross-linked chitosan based hydrogel. Int. J. Pharm. 1999, 192 (2), 173−82. (24) Wang, L.; Rao, R. R.; Stegemann, J. P. Delivery of mesenchymal stem cells in chitosan/collagen microbeads for orthopedic tissue repair. Cells Tissues Organs 2013, 197 (5), 333−43. (25) Akinc, A.; Lynn, D. M.; Anderson, D. G.; Langer, R. Parallel synthesis and biophysical characterization of a degradable polymer library for gene delivery. J. Am. Chem. Soc. 2003, 125 (18), 5316−23. (26) Luo, X.; Pan, S.; Feng, M.; Wen, Y.; Zhang, W. Stability of poly(ethylene glycol)-graft-polyethylenimine copolymer/DNA complexes: influences of PEG molecular weight and PEGylation degree. J. Biomed. Mater. Res., Part A 2010, 21 (2), 597−607. (27) Kim, J. S.; Oh, M. H.; Park, J. Y.; Park, T. G.; Nam, Y. S. Protein-resistant, reductively dissociable polyplexes for in vivo systemic delivery and tumor-targeting of siRNA. Biomaterials 2013, 34 (9), 2370−9. (28) Jin, Y.; Liu, S.; Yu, B.; Golan, S.; Koh, C. G.; Yang, J.; Huynh, L.; Yang, X.; Pang, J.; MuthU. S. A.my, N.; Chan, K. K.; Byrd, J. C.; Talmon, Y.; Lee, L. J.; Lee, R. J.; Marcucci, G. Targeted delivery of antisense oligodeoxynucleotide by transferrin conjugated pH-sensitive lipopolyplex nanoparticles: a novel oligonucleotide-based therapeutic strategy in acute myeloid leukemia. Mol. Pharm. 2010, 7 (1), 196−206.
REFERENCES
(1) Duan, S. Y.; Yuan, W. E.; Wu, F.; Jin, T. Polyspermine Imidazole4,5-imine, a Chemically Dynamic and Biologically Responsive Carrier System for Intracellular Delivery of siRNA. Angew. Chem., Int. Ed. 2012, 51 (32), 7938−7941. (2) Gao, Y.; Liu, X. L.; Li, X. R. Research progress on siRNA delivery with nonviral carriers. Int. J. Nanomed. 2011, 6, 1017−1025. (3) Wang, Y.; Li, Z. G.; Han, Y.; Liang, L. H.; Ji, A. M. NanoparticleBased Delivery System for Application of siRNA In Vivo. Curr. Drug Metab. 2010, 11 (2), 182−196. (4) Aigner, A. Cellular Delivery In Vivo of siRNA-Based Therapeutics. Curr. Pharm. Des. 2008, 14 (34), 3603−3619. (5) Kwon, Y. J. Before and after Endosomal Escape: Roles of StimuliConverting siRNA/Polymer Interactions in Determining Gene Silencing Efficiency. Acc. Chem. Res. 2012, 45 (7), 1077−1088. (6) Nguyen, J.; Steele, T. W. J.; Merkel, O.; Reul, R.; Kissel, T. Fast degrading polyesters as siRNA nano-carriers for pulmonary gene therapy. J. Controlled Release 2008, 132 (3), 243−251. (7) Nakanishi, M.; Patil, R.; Ren, Y.; Shyam, R.; Wong, P.; Mao, H. Q. Enhanced stability and knockdown efficiency of poly(ethylene glycol)-b-polyphosphoramidate/siRNA micellar nanoparticles by cocondensation with sodium triphosphate. Pharm. Res. 2011, 28 (7), 1723−32. (8) Wang, J.; Mao, H. Q.; Leong, K. W. A novel biodegradable gene carrier based on polyphosphoester. J. Am. Chem. Soc. 2001, 123 (38), 9480−9481. (9) Guk, K.; Lim, H.; Kim, B.; Hong, M.; Khang, G.; Lee, D. Acidcleavable ketal containing poly (beta-amino ester) for enhanced siRNA delivery. Int. J. Pharm. 2013, 453 (2), 541−550. (10) Kim, J.; Sunshine, J. C.; Green, J. J. Differential Polymer Structure Tunes Mechanism of Cellular Uptake and Transfection Routes of Poly (beta-amino ester) Polyplexes in Human Breast Cancer Cells. Bioconjugate Chem. 2014, 25 (1), 43−51. (11) Lim, Y. B.; Han, S. O.; Kong, H. U.; Lee, Y.; Park, J. S.; Jeong, B.; Kim, S. W. Biodegradable polyester, poly[alpha-(4 aminobutyl)-Lglycolic acid], as a non-toxic gene carrier. Pharm. Res. 2000, 17 (7), 811−816. (12) Akinc, A.; Lynn, D. M.; Anderson, D. G.; Langer, R. Parallel synthesis and biophysical characterization of a degradable polymer library for gene delivery. J. Am. Chem. Soc. 2003, 125 (18), 5316− 5323. (13) Liu, H. M.; Wang, H.; Yang, W. J.; Cheng, Y. Y. Disulfide CrossLinked Low Generation Dendrimers with High Gene Transfection Efficacy, Low Cytotoxicity, and Low Cost. J. Am. Chem. Soc. 2012, 134 (42), 17680−17687. (14) Li, J. M.; Wang, Y. Y.; Zhang, W.; Su, H.; Ji, L. N.; Mao, Z. W. Low-weight polyethylenimine cross-linked 2-hydroxypopyl-beta-cyclodextrin and folic acid as an efficient and nontoxic siRNA carrier for gene silencing and tumor inhibition by VEGF siRNA. Int. J. Nanomed. 2013, 8, 2101−2117. (15) Chen, Z.; Jiang, Y. B.; Dunphy, D. R.; Adams, D. P.; Hodges, C.; Liu, N. G.; Zhang, N.; Xomeritakis, G.; Jin, X. Z.; Aluru, N. R.; Gaik, S. J.; Hillhouse, H. W.; Brinker, C. J. DNA translocation through an array of kinked nanopores. Nat. Mater. 2010, 9 (8), 667−675. (16) Kim, S. H.; Ou, M.; Bull, D. A.; Kim, S. W. Reductive Degradation Behavior of Bioreducible Poly (disulfide amine) for Enhancing SiRNA Efficiency. Macromol. Biosci. 2010, 10 (8), 898− 905. (17) Boyer, C.; Teo, J.; Phillips, P.; Erlich, R. B.; Sagnella, S.; Sharbeen, G.; Dwarte, T.; Duong, H. T. T.; Goldstein, D.; Davis, T. P.; Kavallaris, M.; McCarroll, J. Effective Delivery of siRNA into Cancer Cells and Tumors Using Well-Defined Biodegradable Cationic Star Polymers. Mol. Pharmaceutics 2013, 10 (6), 2435−2444. (18) Shim, M. S.; Kwon, Y. J. Dual mode polyspermine with tunable degradability for plasmid DNA and siRNA delivery. Biomaterials 2011, 32 (16), 4009−4020. (19) Hong, S. H.; Kim, J. E.; Kim, Y. K.; Minai-Tehrani, A.; Shin, J. Y.; Kang, B.; Kim, H. J.; Cho, C. S.; Chae, C.; Jiang, H. L.; Cho, M. H. Suppression of lung cancer progression by biocompatible glycerol 3306
dx.doi.org/10.1021/mp500169p | Mol. Pharmaceutics 2014, 11, 3300−3306
Polyspermine imine, a pH Responsive Polycationic siRNA Carrier Degradable to Endogenous Metabolites Zixiu Du,† Shengnan Xiang,‡ Yi Zang,† Yi Zhou,† Chuandong Wang,‡ Hailing Tang,† Tuo Jin,† and Xiaoling Zhang*,‡ †
Shanghai Jiao Tong University School of Pharmacy, 800 Dongchuan Road, Shanghai 200240, China The Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Jiao Tong University School of Medicine & Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200025, China
‡
S Supporting Information *
ABSTRACT: Cationic polymers readily degradable in response to cellular environment are especially favored as easy-formulating materials to pack siRNA into a nanoparticle and to release the cargo in the cytoplasm in time. In addition to the efficiency of cytosomal release, the degradation products should best be free of safety concerns, a typical challenge for cationic polymers. To satisfy the two criteria, we report a new cationic polymer, polyspermine imine, named as PSP-Imine, which is formed by condensing two endogenous molecules, spermine and glyoxal, through conjugated π linkage, NCCN (Schiff base reaction), a poly linkage structure sufficiently stable under neutral condition but dissociative under the endosomal pH. Cellular assays under a confocal microscope indicated that the polyplex formed of PSP-Imine readily released the loaded siRNA to the cytoplasm after being engulfed in the target cells and efficiently silenced the target genes in different cell lines and xenograft mouse model of human cervical carcinoma, as compared with nondegradable PEI 25 kDa. Cell viability assays confirmed that PSP-Imine showed no visible cytotoxicity within the concentration being tested. The present study suggests that PSP-Imine is an excellent siRNA condensing material for forming the core of a therapeutically feasible synthetic carrier system. KEYWORDS: polyspermine imine, suitable degradation rate, endogenous metabolites, gene silencing, therapeutic drug
■
INTRODUCTION
Many studies reported to date were focused on creating biodegradable cationic polymers for siRNA delivery, especially those responsive to endosomal environment. such as biodegradable polyesters,6 polyphosphoester,7,8 β-amino esters,9−12 cross-linked low molecular weight PEI,13−15 and biodegradable cationic polymers containing disulfide bonds.16,17 However, none of these responsive degradations leads to endogenous or at least proven-nontoxic products, a favorable property for a cationic polymer carrier for minimal safety concerns (i.e., task E). Polyspermine 4,5-imidyzolimine (PSI) reported by Duan at al. offered an example to accomplish the intracellular tasks including self-metabolizing.1 In PSI, the heterogenic cyclic conjugated imine linkage of the polymer played an important role to satisfy both prephagocytotic stability and postphagocy-
A therapeutically feasible synthetic carrier for siRNA must accomplish a series of tasks along its inter- and intracellular trafficking including (A) packaging siRNA into nanoparticle; (B) holding and targeting siRNA along intercellular trafficking; (C) facilitating endosomal escaping of siRNA; (D) releasing siRNA in the cytoplasm efficiently, and (E) metabolizing itself to nontoxic (best to be endogenous) species.1,2A rationally designed multifunctional cationic polymer may accomplish tasks A, C, D, and E of the above.1 The essential criteria for a cationic polymer to achieve the four objectives involve sufficient density of the cationic groups, degradable poly linkage in response to the endosomal environment, and endogenous (at least nontoxic) degradation products. As long as these criteria are satisfied, a rationally designed membrane may be assembled around the polyplex formed of the designed cationic polymer to prevent siRNA leaking due to in vivo polyelectrolytes, neutralize the extra positive charges for in vivo circulation, and facilitate target cell recognition.3,4 In addition to the above analysis, some intracellular mechanisms involving a role of cationic polymers or their fragments were discovered.5 © 2014 American Chemical Society
Special Issue: Recent Molecular Pharmaceutical Development in China Received: Revised: Accepted: Published: 3300
March 1, 2014 April 23, 2014 May 20, 2014 May 20, 2014 dx.doi.org/10.1021/mp500169p | Mol. Pharmaceutics 2014, 11, 3300−3306
Molecular Pharmaceutics
Article
purchased from Shanghai Experimental Animal Center of Chinese Academic of Sciences (Shanghai, China). Preparation of PSP-Imine and Polyplexes. The synthesis of PSP-Imine was reported previously.20 Briefly, equimolar amounts of spermine with glyoxal as aqueous solution were stirred in anhydrous ethanol at room temperature with p-toluenesulfonic acid and molecular sieve (3 Å) overnight, the product was dialyzed against dialysis membranes (MW cut off = 3500) in distilled water and subsequently lyophilized. The polyplexes formed by mixing PSP-Imine (1 mg/mL in RNase-free water) with siRNA plasmid at different weight ratios were then left to assemble for 30 min at room temperature. Cell Culture. Bone marrow was obtained from SD rats (150 to 200 g) and seeded in 10 mL dishes with Dulbecco’s modified Eagle’s medium (DMEM) F12 supplemented with 10% FBS. After 2 d, the culture medium was replaced with fresh DMEM/ F12 containing 10% FBS. The medium replacement was repeated to remove blood cells and other bone marrow substances every other day. Then, the adhesion cells which were mainly BMSCs were passaged. Passage 3 to passage 8 was used for our in vitro study. All other cells were cultured in DMEM (MediaTech, Herndon, VA, U. S. A.) with 10% fetal bovine serum (FBS, Hyclone, Logan, UT, U. S. A.) at 37 °C under a humidified atmosphere containing 5% CO2. Cell Viability Assay. MTT assay was performed to measure the cytotoxicity of PSP-Imine and PEI 25 kDa. Polymer solutions were separately prepared in phenol red-free DMEM at various concentrations from 5 to 150 μg/mL. BMSCs, GFPU2OS, and Hela cells were seeded into 96-well plates and incubated at 37 °C for 24 h. The culture medium was replaced with 200 μL of polycationic carrier solution with different concentrations, and the cells were incubated for 4 h. Then, fresh DMEM was added to each well. The cells were further incubated for 20 h. The medium was removed and replaced with 100 μL of fresh medium. Then, 20 μL of MTT solution (5 mg/mL in PBS buffer) was added to each well, and incubated for 4 h at 37 °C with 5% CO2. Viable cells were determined by measuring the absorbance of the samples at 490 nm using an ELISA reader (MK3 Thermo Lab System, Finland). The percentage of viable cells was obtained by comparing the absorbance of the samples with and without added cationic polymers. Cellular Uptake Assay. The polyplexes were prepared using PSP-Imine with FAM or Cy3 fluorescently labeled negative control siRNA at weight ratios of 12:1, 24:1, and 36:1, named as PSP-Imine (12:1), PSP-Imine (24:1), and PSP-Imine (36:1), respectively. PEI 25 kDa (N/P = 10:1) was used as positive control, and FAM fluorescently labeled negative control siRNA was used as negative control. The cells were transfected at 37 °C for 4 h. Fluorescent cells were observed under an inverted Leica DM IRB fluorescence microscope. After cell digestion using trypsin, BMSCs were suspended using 500 μL of PBS. The flow cytometric measurement was performed on a BD FACSAria instrument. Hela cells were seeded in the density of 1.5 × 105 cells per well in 6-well plate and incubated for 24 h prior to transfection. Then removed the culture medium and washed with PBS. A total of 2 mL of nanocomplexes solution containing 1.5 μg siRNA formed by PSP-Imine and cy3-labed at N/P ratios of 12:1, 24:1, and 36:1, respectively, in OptiMEM. PEI 25 kDa (N/P = 10:1) was used as positive control. After incubating for 4 h, the solution was replaced by 2 mL of 4% paraformaldehyde
totic responsibility. For the intracellular trafficking of nucleic acids, on another hand, the rate of the degradation, that is, the balance between cellular responsibility and polymer stability, may also need to be optimized.5 To increase the library for such optimization, the present study demonstrated a polymer through aliphatic conjugated imine linkage as another example of cationic polymers degradable to endogenous monomers. Spermine, an endogenous multiamino group-bearing monomer that condenses DNA in sperm, was generally used in the past as a building block to synthesize polycationic gene carriers.18,19 However, the linkers themselves were cleft after degradation of the cationic polymers, leaving their fragments bonded to spermine. The advantage of using endogenous molecules as the building blocks to form degradable polycationic nucleic acids carriers was compromised. In a previous study,20 we synthesized a series of cationic polymers which were formed from spermine and nontoxic small molecules that may be degraded to spermine and the original small molecules. Moreover, we mainly investigated the DNA transfection and cytotoxicity of these polymers in different cell lines. Polyspermine imine (PSP-Imine) (Scheme 1) is the best Scheme 1. Synthesis of PSP-Imine through Schiff Base Reaction
cationic polymer having the potential to become a therapeutic agent with both high delivery ability and least cytotoxicity among these three cationic polymers. In this study, PSP-Imine was chosen to further investigate the siRNA delivery efficiency in vitro using three different cells, the cytotoxicity was also determined. Furthermore, PSP-Imine was used for delivering targeting siRNA to silence BMI-1 gene of Hela cells in vitro and in vivo intratumoral administration.
■
MATERIALS AND METHODS Materials. Polyethylenimine (25 kDa in molecular weight, PEI 25 kDa), spermine, and glyoxal solution (40%) were purchased from Sigma-Aldrich (U. S. A.). Carboxyfluorescein (FAM) fluorescently labeled negative control was obtained from Shanghai GenePharma (China). Fluorescent Cy3 labeling kit (Silencer siRNA Labeling Kit AM1632) was purchased from AMBION (U. S. A.). Green fluorescent protein (GFP) siRNA (sense: 5′-GGCUACGUCCAGGAGCGCACC-3′), luciferase siRNA (sense: 5′-CUUACGCUGAGUACUUCGATT-3′), BMI-1 siRNA (sequence: CAAGCAGAAATGCATCGAA), and real-time PCR universal reagents were obtained from GenePharma (Shanghai, China). The Hela cells stably expressing luciferase gene (Luc-Hela) was from Shanghai Medical Biotechnology CD., (Shanghai, China). The U2OS cells stably expressing GFP (GFP-U2OS cells) were friendly provided by Dawei Laboratory (School of Pharmacy, Shanghai Jiao Tong University). The Hela cells were obtained from Institute of Biochemistry and Cell Biology (Shanghai, China). MTT was purchased from Sigma-Aldrich (Milwaukee, WI, U. S. A.). All other solvents and reagents were analytical grade. 1BALB/c nude mice (female, 4 to 6 weeks old, and 20 g) were 3301
dx.doi.org/10.1021/mp500169p | Mol. Pharmaceutics 2014, 11, 3300−3306
Molecular Pharmaceutics
Article
Figure 1. Cytotoxicity of PSP-Imine at various concentrations in different cell lines after incubation for 24 h: (a) BMSCs, (b) GFP-U2OS cells, and (c) Hela cells.
and stored in 4 °C overnight. Then, the cells were washed twice with PBS and permeabilized with 0.1% triton in phosphatebuffered saline, blocked with 3% bovine serum albumin (BSA), stained for 2 h at room temperature with Alexafuor 488 phalloidin (1:50 dilution in 0.1% triton in phosphate-buffered saline, Invitrogen, U. S. A.), washed thrice with phosphatebuffered saline, and incubated for 30 min at room temperature DAPI (0.1 mg/mL, Sigma-Aldrich, U. S. A.). The cells were washed and sealed in mounting media (Invitrogen, U. S. A.) before visualizing on a Leica TCS SP8 laser scanning microscope system (Leica Microsystems, Germany). In Vitro Assay of Gene Silencing. Luc-Hela cells were seeded in 96-well plate at 2.5 × 104 cells per well and cultured for 24 h. Then the polyplexes formed by PSP-Imine and luciferase siRNA at different N/P ratios of 12:1, 24:1, and 36:1 were added to the cells in six replicates, and the total polyplex solution was 200 μL per well. In addition, the untreated group was incubated in Opti-MEM without carrier molecules and PEI 25 kDa to luciferase gene at 10 N/P ratio was used as the positive group. Then, the cells were incubated for 4 h at 37 °C under a humidified atmosphere with 5% CO2. The DMEM was removed, and 250 μL DMEM supplemented with 10% FBS was added every well. After incubation for 24 h at 37 °C, luciferase activity was determined by luminary intensity recorded (as RLU/mg) with a Sirius Luminometer (Berthold, Germany). GFP-U2OS cells were seeded at 2 × 104 cells per well in a 200 μL complete medium for 24 h prior to transfection. The polyplexes formed by PSP-Imine and GFP siRNA at different N/P ratios of 12:1, 24:1, and 36:1 were added to the cells in six replicates, and the total polyplex solution was 200 μL per well. In addition, PBS was used as the untreated group and PEI 25 kDa was used as the positive group. Then, the cells were incubated for 4 h at 37 °C under a humidified atmosphere with 5% CO2. The DMEM was removed, and 250 μL DMEM supplemented with 10% FBS was added per well. After incubation for 48 h at 37 °C, the cells were measured through flow cytometry on a BECKERMAN instrument. In addtion, Hela cells were seeded at 2 × 104 per well in a 96well plate 24 h prior to transfection. The culture media was replaced with 100 μL serum-free medium, and the polyplexes formed by PSP-Imine and BMI-1 siRNA at N/P ratio of 36:1 were added to the cells in six replicates. Additionally, two control groups were used: (1) PSP-Imine dissolved in OptiMEM and (2) polyplexes formed by PSP-Imine and negative control siRNA of random sequences at N/P ratio of 36:1. The total polyplex solution was 200 μL per well, and the cells were incubated for 4 h at 37 °C under a humidified atmosphere with
5% CO2 The solution was then replaced by DMEM supplemented with 10% FBS and incubated for 48 h after transfection at 37 °C under a humidified atmosphere with 5% CO2 for real-time PCR assay. Xenograft Mouse Model of Human Cervical Carcinoma. Balb/c nude mice were maintained in a pathogen-free environment and allowed to acclimatize for at least 1 week before tumor implantation. All studies were performed in accordance with the guidelines of the Committee on Animals of School of Pharmacy, Shanghai Jiao Tong University, Shanghai, China. The Balb/c nude mice were inoculated subcutaneously in the right axillaries with 1.2 × 106 Hela cells from the 150 μL culture medium to develop xenograft tumors. After about 2 weeks, the tumor volume reached about 50 mm3 at 100% tumor formulation rate. The mice were divided into three groups: (1) untreated group (6 mice), (2) negative group (6 mice), and (3) PSP-Imine (36:1) group (6 mice). Briefly, the untreated group received three doses (day 0, day 7, and day 12) of 150 μL PBS per mouse at the same time points. Correspondingly, the negative group was injected with the same amount of polyplex solution containing 3.5 mg/kg siRNA formed by PSP-Imine with random sequence siRNA at N/P ratio of 36:1, and the PSP-Imine (36:1) group was injected with 150 μL of polyplex solution containing 3.5 mg/kg target siRNA formed by PSP-Imine with BMI-1 siRNA at N/P ratio of 36:1. The volumes of the tumors were measured using a caliper each day at the same time. Tumor volume (V) was calculated as V = W2 × L/2 where W and L represent the shortest and longest diameters of the tumors, respectively.21 The tumor growth rate (R) was evaluated according to the following equation: [volume of the tumor at the point of measurement (Vt) − volume of the tumor on the first day of treatment (V0)]/ V0. The mice were culled 4 d after the last injection, and the tumor tissues were kept at −80 °C for real-time PCR measurements. Real-time PCR. Real-time PCR was performed using a SYBR green method and universal reagents (catalog no. GMRS-001, GenePharma, Shanghai). hGAPDH was utilized as an internal standard to determine the relative expression levels for each gene, and hBMI-1 was used to quantify hBMI-1 gene expression. The sequences used were as follows. hGAPDH: forward primer, CATGAGAAGTATGACAACAGCCT; reverse primer: AGTCCTTCCACGATACCAAAGT; with a product size of 113 bp. hBMI-1: forward primer, TGATGCTGCCAATGGCTCTAAT; reverse primer: CGATCCAATCTGTTCTGGTCAAAG; with a product size of 123 bp. The experimental procedures were as follows: (1) total RNA extraction; (2) reverse transcription reaction for 45 3302
dx.doi.org/10.1021/mp500169p | Mol. Pharmaceutics 2014, 11, 3300−3306
Molecular Pharmaceutics
Article
min at 42 °C followed by 10 min at 85 °C, where 0.2 μL of MMLV RTase (200 U/μL) and 5 μL of total RNA were used for the reverse transcription; and (3) real-time PCR. The realtime PCR conditions were as follows: 3 min denaturation at 95 °C, 40 cycles at 95 °C for 12 s, and 40 s at 62 °C. The RT-PCR assay was performed on MX3000P Real-time PCR Instrument (Stratagen, U. S. A.). Statistical Analysis. For all experiments, the date are represented as mean ± SD t tests were used for statistical analysis, and p < 0.05 was considered significant. All the analyses were done using GraphPad Instat (GraphPad software, San Diego, CA, U. S. A.).
■
RESULTS Cytotoxicity Assay. The cytotoxicity of cationic polymers is one of the key factors for nucleic acid delivery. PSP-Imine has a simple chemical structure and suitable hydrolysis rate, which may be important for PSP-Imine to decrease its cytotoxicity. In this study, PSP-Imine and PEI-25 kDa were incubated with BMSCs, GFP-U2OS, and Hela cells at 37 °C under a humidified atmosphere with 5% CO2 for 24 h. Polymer cytotoxicity was examined in the above-mentioned cell lines. Upon transfection with PSP-Imine, BMSCs showed that over 90% of its cells were viable within the range from 5 μg/mL to50 μg/mL. In addition, even at high PSP-Imine concentration (150 μg/mL), the cell viability remained at around 77%. In contrast, PEI 25 kDa showed high toxicity to BMSCs even at a low concentration of 15 μg/mL, where only 27% of the cells remained viable. Cell viability further decreased to 3% at a 50 μg/mL PEI 25 kDa (Figure 1A). In addition, the cell viability of GFP-U2OS and Hela cells was approximately 90% when transfected with PSP-Imine at concentrations ranging from 5 μg/mL to 25 μg/mL. When the concentrations of PSP-Imine increased, the viability of both cell lines rapidly decreased. In comparison, the cytotoxicity of PEI 25 kDa at 5 μg/mL was significantly higher than that of PSP-Imine with 5% of GFPU2OS and 20% Hela cells remaining viable using PEI. When the concentration of PEI 25 kDa increased to 25 μg/mL, the viability of GFP-U2OS was reduced to 10%, and the viability of Hela cells decreased to 3% (Figure 1B and C). Cellular Uptake of Polyplexes. To investigate the delivery efficiency of PSP-Imine in different cell lines, we performed a cellular uptake study using FAM-labeled siRNA in BMSCs and Cy3-labeled siRNA in Hela cells, respectively. The fluorescence intensities of the cells were observed through inverted fluorescence microscopy (Supporting Information Figure 1A). Naked siRNA was used as the control group with background fluorescence, and PEI 25 kDa was used as the positive group that exhibited slightly weak fluorescence. All the PSP-Imine groups had significantly higher fluorescence intensities. Cellular uptake was also quantitatively tested using flow cytometer. Over 90% of FAM-positive cells were observed in the PSPImine groups. By contrast, the naked siRNA group mostly showed negative cells, and the PEI 25 kDa group had 85% positive cells, as measured by a flow cytometer (Supporting Information Figure S1B). It indicated that the polyplexs of PSPImine/siRNA at different weight ratios of cationic polymer to nucleic acids could be easy endocytic in primary cells. On the other hand, the endocytosis efficiency of polyplexes of PSPImine/siRNA in Hela cells were lower than that in BMSCs and improved with the increase of weight ratios of PSP-Imine to siRNA, and still showed higher endocytosis efficiency compared to that of PEI 25 kDa in Hela cells (Figure 2).
Figure 2. Cellular uptake of PSP-Imine (12:1), PSP-Imine (24:1), and PSP-Imine (36:1) in Hela cells. Both the untreated group (in OptiMEM) and PEI 25 kDa (N/P = 10:1) are control groups. (***p < 0.001).
Confocal images of fluorescent polyplex treated cell lines indicated and the release of Cy3-labeled siRNA (red) of nanocomplexes in Hela cells. Transfections were performed for 4 h. It could be found that most of polyplexes located in the cytoplasmic in all samples (Figure 3A1−D1). Hela cells
Figure 3. Confocal microscopy of the location of siRNA after Hela cells were transfected for 4h with PSP-Imine (12:1), PSP-Imine (24:1), and PSP-Imine (36:1). PEI 25 kDa (N/P = 10:1) as the positive control group. The siRNA was labeled with Cy3 (Red). The cells were stained with Alexafuor 488 phalloidin for cytoplasmic skeleton (Green), and DAPI for the nucleus (blue). Scale bar =10 μm.
transfected with PEI 25 kDa showed many red nanoparticles outside of the nucleus (Figure 3A), which indicated most of siRNAs still were wrapped by PEI 25 kDa and few of which were released in the cytoplasmic. However, Hela cells transfected with PSP-Imine (12:1) showed many cloudy missions outside the nucleus, some of which were too weak to be observed clearly (Figure 3B2−B3). Compared with PSPImine (12:1), more and more bright cloudy missions appeared in Hela cytoplasmic for PSP-Imine (24:1) and some nanoparticles could be observed accompanied by many cloudy missions in PSP-Imine (36:1). The confocal results employed with the flow cytometry measurement (Figure 3) showed that PSP-Imine had high ability to carry siRNA to escape endosome and release siRNA into cytoplasmic immediately. PEI 25 kDa 3303
dx.doi.org/10.1021/mp500169p | Mol. Pharmaceutics 2014, 11, 3300−3306
Molecular Pharmaceutics
Article
57% of the GFP expression was silenced in the PSP-Imine (12:1), which was incubated with the polyplexes formed by PSP-Imine and GFP siRNA at N/P ratio of 12:1 (PSP-Imine concentration = 5.2 μg/mL). Accordingly, as the weight ratio increased, the silencing efficiency improved. When N/P ratio of PSP-Imine to siRNA reached 24:1 (PSP-Imine concentration=10.4 μg/mL), approximately 68% of the GFP expression was reduced, and 77% of the GFP expression was silenced at 36:1 N/P ratio of PSP-Imine to siRNA (PSP-Imine concentration=15.6 μg/mL). The cell viability was more than 90% in the GFP-U2OS cells at all of the PSP-Imine concentrations used for the GFP siRNA transfer. Thus, PSPImine has a high ability to deliver siRNA in GFP-U2OS cells at all N/P ratios tested (from 12:1 to 36:1). Real-time PCR was used to further determine the efficacy of siRNA in Hela cells complexed with PSP-Imine. As shown in Figure 6, PSP-Imine without siRNA did not silence the BMI-1
could deliver siRNA effectively while it had lower ability to release siRNA in the cytoplasmic. Gene Silencing Efficiency. As shown in Figure 4, the results of luciferase gene knockdown showed siRNA delivery
Figure 4. Knockdown of luciferase expression transfected with or without carrier molecules in Luc-Hela cells for 24 h. Luciferase siRNA was used to silence the luciferase gene. Untreated group (Incubated in Opti-MEM); PEI 25 kDa was used as the positive control group. PSPImine (12:1) (PSP-Imine at the concentration of 5.2 μg/mL); PSPImine (24:1) (PSP-Imine at the concentration of 10.4 μg/mL); PSPImine (36:1) (PSP-Imine at the concentration of 15.6 μg/mL). (*p < 0.05).
efficiency improved with the increase of N/P ratios of PSPImine to siRNA, where an average of 61% luciferase gene was expressed in PSP-Imine (12:1) group, and which dropped to 52% and 26% in PSP-Imine (24:1) and PSP-Imine (36:1), respectively. However, PEI25 kDa showed lower siRNA delivery and release ability compared to PSP-Imine, in which about 65% luciferase gene was expressed. Similarly, as shown in Figure 5, the cells transfected with the polyplexes of PEI 25 kDa formed with GFP siRNA at the optimal weight ratio silenced 28% of the GFP expression compared with the untreated group. By contrast, approximately
Figure 6. Relative gene expression of BMI-1 in Hela cells after transfection for 48 h with or without carrier molecules. The mRNA level of BMI-1 was determined by real-time PCR and relative to that in the untreated cells. “PSP-Imine” represents only PSP-Imine; “Negative group” represents the polyplex of PSP-Imine and negative siRNA at P/ N ratio of 36:1; “PSP-Imine (36:1)” represents the polyplex of PSPImine and BMI-1 siRNA at P/N ratio of 36:1 (**p < 0.01). The concentration of PSP-Imine in all of the carrier molecules was about 15.6 μg/mL.
gene expression compared with the untreated cells (untreated group). However, the cells treated with the polyplex formed by PSP-Imine and negative siRNA (Negative group) slightly increased BMI-1 gene expression compared with the untreated group. By contrast, BMI-1 gene expression was significantly reduced to 53% when Hela cells were transfected with PSPImine (36:1). Antitumor Efficacy in Xenograft Mouse Model of Human Cervical Carcinoma. Based on the above experimental results, PSP-Imine was found to have low cytotoxicity and high siRNA delivery ability in different cell lines in vitro. To further investigate the in vivo siRNA transfection efficiency of PSP-Imine, we established a human cervical carcinoma xenograft model and tested the cytotoxicity and siRNA delivery of PSP-Imine using the largest N/P ratio of polymer to siRNA (PSP-Imine (36:1)). The tumor growth rates were tested in the three groups of mice. The trend lines of the tumor growth were significantly restrained in the PSP-Imine (36:1) group compared with the other two groups (Figure 7). The tumor growth rates at the follow-up study of the untreated group and the negative group
Figure 5. Knockdown of GFP expression transfected with or without carrier molecules in GFP-U2OS cells for 48 h. Untreated group represents incubated in Opti-MEM without carrier molecules; PEI 25 kDa represents the polyplex of PEI 25 kDa to siRNA at N/P ratio of 10:1. PSP-Imine (12:1) (PSP-Imine at the concentration of 5.2 μg/ mL); PSP-Imine (24:1) (PSP-Imine at the concentration of 10.4 μg/ mL); PSP-Imine (36:1) (PSP-Imine at the concentration of 15.6 μg/ mL). (***p < 0.001; ****p < 0.0001). 3304
dx.doi.org/10.1021/mp500169p | Mol. Pharmaceutics 2014, 11, 3300−3306
Molecular Pharmaceutics
Article
design of a cationic polymer for siRNA delivery in vitro and in vivo simultaneously. The most unique feature of PSP-Imine, as a siRNA packing polycation, is its responsive degradation to spermine and glyoxalin time20 and that the continuous release of spermine in the process of degradation exhibited the “proton-sponging” effect that facilitated endosomal rupturing in the intracellular delivery of the polyplexes.25 Due to this degradation, which was examined by incubating the polymers at 37 °C in aqueous buffers simulating the pH of various cellular environments (pH = 7.4 for the body fluid, 5.8 for endosomes, and 5.0 for lysosomes) in the previous study,20 induced by the endosomal pH, multiple objectives such as endosomal escaping and cytosol releasing of siRNA as well as self-metabolizing to avoid toxicity may be achieved at once. In the present work, the intersupportive results of low toxicity (Figure 1), cytosol spreading of fluorescent labeled siRNA (Supporting Information Figure S1, Figure 2), cloudy missions of cy3-labeled siRNA wrapped by PSP-Imine at different N/P ratios appeared in Hela cytoplasm found in the confocal image (Figure 3) and superior (than PEI 25KDa) silencing efficiency (Figures 4−6) suggest that the designed multitask mechanism is feasible. For in vivo efficacy, the site injection of polyplexes formed of PSP-Imine and BMI-1 siRNA resulted in significant size reduction of the tumors developed by implanting Hela cells to Balb/C nude mice. Although site injection is not a practical dosage regime to treat tumors developed in organs and bare polyplex is not a feasible dosage form, the in vivo result confirmed that PSP-Imine may be used as a feasible siRNA condensing material for the core of a comprehensive delivery system. Compared with prepolyplexing conjugating of functional groups such as targeting molecules or steric stabilization agents,26,27 postpolyplexing assembly of a functional membrame around the polyplex28 is more flexible and convenient, especially in the case that the population surface of the cell targeting agent need to be optimized.
Figure 7. Tumor relative increase rates in the three groups with continuous injection of different aqueous solutions. Untreated group represents the mice injected with PBS; negative group represents the mice injected with polyplexes of PSP-Imine and negative siRNA at P/ N ratio of 36:1; PSP-Imine (36:1) represents the mice injected with polyplexes of PSP-Imine and BMI-1 siRNA at P/N ratio of 36:1 at 0, 7, and 12 days.
on the 14th day were 2.05 and 1.97, respectively. However, the tumor growth rate was 1.12 in PSP-Imine (36:1) group, which was significantly lower than the two other groups. The mRNA expression of BMI-1 in the tumor tissues was also examined using RT-PCR (Figure 8). About 45% of BMI-1
■
ASSOCIATED CONTENT
S Supporting Information *
Figure 8. Relative gene expression of BMI-1 in tumor tissue. Negative group represents the mice injected with polyplexes of PSP-Imine and negative siRNA at P/N ratio of 36:1. PSP-Imine (36:1) represents the mice injected with polyplexes of PSP-Imine and BMI-1 siRNA at P/N ratio of 36:1 (** p < 0.01).
Detail informations on siRNA uptake by BMSCs and the characterization of the synthesis PSP-Imine. This material is available free of charge via the Internet at http://pubs.acs.org.
■
genes were silenced in the PSP-Imine (36:1) group compared with the untreated group. However, the mice of the negative group, which were injected with the polyplexes formed by PSPImine and negative siRNA with random sequences, could not reduce the mRNA expression of BMI-1.
AUTHOR INFORMATION
Corresponding Author
*E-mail: [email protected]. Phone: +86-21-63855434. Fax: +86-21-63855434. Address: Institute of Health Sciences, No. 225, South Chongqing Road, Shanghai, 200025, China.
■
Notes
DISCUSSION PSP-Imine, which is synthesized by spermine and glyoxal through Schiff base reaction,1 has a simple linear structure with π−π conjugated carbon−nitrogen double bonds (NC CN) on the backbone chain (Scheme 1), which is relatively more stable compared to polyimine. As one of in vivo immediate metabolites with low toxicity, glyoxal is generally used as a cross-linking reagent to prepare biological and medical hydrogel to improve the mechanical properties of chitosan fiber through Schiff base reaction between the glyoxal group and the amino group.22−24 In our study, it is the first time that glyoxal was investigated as a linking agent for the
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This work was supported by National Natural Science Foundation of China (No. 30901881), the Chinese Academy of Sciences (No. XDA01030502), Science and Technology Commission of Shanghai Municipality (No. 13430710700), and Shanghai Municipal Commission of Health and FamilyPlanning (No. 2013ZYJB0501). The authors thank the Analytical Center of Shanghai Jiaotong University for 1 HNMR and IR. 3305
dx.doi.org/10.1021/mp500169p | Mol. Pharmaceutics 2014, 11, 3300−3306
Molecular Pharmaceutics
■
Article
triacrylate-spermine-mediated delivery of shAkt1. Int. J. Nanomed. 2012, 7, 2293−306. (20) Du, Z. X.; Chen, M. Y.; He, Q. Q.; Zhou, Y.; Jin, T. Polymerized spermine as a novel polycationic nucleic acid carrier system. Int. J. Pharm. 2012, 434 (1−2), 437−443. (21) Han, K.; Chen, S.; Chen, W. H.; Lei, Q.; Liu, Y.; Zhuo, R. X.; Zhang, X. Z. Synergistic gene and drug tumor therapy using a chimeric peptide. Biomaterials 2013, 34 (19), 4680−4689. (22) Hoemann, C. D.; Chenite, A.; Sun, J.; Hurtig, M.; Serreqi, A.; Lu, Z.; Rossomacha, E.; Buschmann, M. D. Cytocompatible gel formation of chitosan-glycerol phosphate solutions supplemented with hydroxyl ethyl cellulose is due to the presence of glyoxal. J. Biomed. Mater. Res., Part A 2007, 83 (2), 521−9. (23) Noble, L.; Gray, A. I.; Sadiq, L.; Uchegbu, I. F. A non-covalently cross-linked chitosan based hydrogel. Int. J. Pharm. 1999, 192 (2), 173−82. (24) Wang, L.; Rao, R. R.; Stegemann, J. P. Delivery of mesenchymal stem cells in chitosan/collagen microbeads for orthopedic tissue repair. Cells Tissues Organs 2013, 197 (5), 333−43. (25) Akinc, A.; Lynn, D. M.; Anderson, D. G.; Langer, R. Parallel synthesis and biophysical characterization of a degradable polymer library for gene delivery. J. Am. Chem. Soc. 2003, 125 (18), 5316−23. (26) Luo, X.; Pan, S.; Feng, M.; Wen, Y.; Zhang, W. Stability of poly(ethylene glycol)-graft-polyethylenimine copolymer/DNA complexes: influences of PEG molecular weight and PEGylation degree. J. Biomed. Mater. Res., Part A 2010, 21 (2), 597−607. (27) Kim, J. S.; Oh, M. H.; Park, J. Y.; Park, T. G.; Nam, Y. S. Protein-resistant, reductively dissociable polyplexes for in vivo systemic delivery and tumor-targeting of siRNA. Biomaterials 2013, 34 (9), 2370−9. (28) Jin, Y.; Liu, S.; Yu, B.; Golan, S.; Koh, C. G.; Yang, J.; Huynh, L.; Yang, X.; Pang, J.; MuthU. S. A.my, N.; Chan, K. K.; Byrd, J. C.; Talmon, Y.; Lee, L. J.; Lee, R. J.; Marcucci, G. Targeted delivery of antisense oligodeoxynucleotide by transferrin conjugated pH-sensitive lipopolyplex nanoparticles: a novel oligonucleotide-based therapeutic strategy in acute myeloid leukemia. Mol. Pharm. 2010, 7 (1), 196−206.
REFERENCES
(1) Duan, S. Y.; Yuan, W. E.; Wu, F.; Jin, T. Polyspermine Imidazole4,5-imine, a Chemically Dynamic and Biologically Responsive Carrier System for Intracellular Delivery of siRNA. Angew. Chem., Int. Ed. 2012, 51 (32), 7938−7941. (2) Gao, Y.; Liu, X. L.; Li, X. R. Research progress on siRNA delivery with nonviral carriers. Int. J. Nanomed. 2011, 6, 1017−1025. (3) Wang, Y.; Li, Z. G.; Han, Y.; Liang, L. H.; Ji, A. M. NanoparticleBased Delivery System for Application of siRNA In Vivo. Curr. Drug Metab. 2010, 11 (2), 182−196. (4) Aigner, A. Cellular Delivery In Vivo of siRNA-Based Therapeutics. Curr. Pharm. Des. 2008, 14 (34), 3603−3619. (5) Kwon, Y. J. Before and after Endosomal Escape: Roles of StimuliConverting siRNA/Polymer Interactions in Determining Gene Silencing Efficiency. Acc. Chem. Res. 2012, 45 (7), 1077−1088. (6) Nguyen, J.; Steele, T. W. J.; Merkel, O.; Reul, R.; Kissel, T. Fast degrading polyesters as siRNA nano-carriers for pulmonary gene therapy. J. Controlled Release 2008, 132 (3), 243−251. (7) Nakanishi, M.; Patil, R.; Ren, Y.; Shyam, R.; Wong, P.; Mao, H. Q. Enhanced stability and knockdown efficiency of poly(ethylene glycol)-b-polyphosphoramidate/siRNA micellar nanoparticles by cocondensation with sodium triphosphate. Pharm. Res. 2011, 28 (7), 1723−32. (8) Wang, J.; Mao, H. Q.; Leong, K. W. A novel biodegradable gene carrier based on polyphosphoester. J. Am. Chem. Soc. 2001, 123 (38), 9480−9481. (9) Guk, K.; Lim, H.; Kim, B.; Hong, M.; Khang, G.; Lee, D. Acidcleavable ketal containing poly (beta-amino ester) for enhanced siRNA delivery. Int. J. Pharm. 2013, 453 (2), 541−550. (10) Kim, J.; Sunshine, J. C.; Green, J. J. Differential Polymer Structure Tunes Mechanism of Cellular Uptake and Transfection Routes of Poly (beta-amino ester) Polyplexes in Human Breast Cancer Cells. Bioconjugate Chem. 2014, 25 (1), 43−51. (11) Lim, Y. B.; Han, S. O.; Kong, H. U.; Lee, Y.; Park, J. S.; Jeong, B.; Kim, S. W. Biodegradable polyester, poly[alpha-(4 aminobutyl)-Lglycolic acid], as a non-toxic gene carrier. Pharm. Res. 2000, 17 (7), 811−816. (12) Akinc, A.; Lynn, D. M.; Anderson, D. G.; Langer, R. Parallel synthesis and biophysical characterization of a degradable polymer library for gene delivery. J. Am. Chem. Soc. 2003, 125 (18), 5316− 5323. (13) Liu, H. M.; Wang, H.; Yang, W. J.; Cheng, Y. Y. Disulfide CrossLinked Low Generation Dendrimers with High Gene Transfection Efficacy, Low Cytotoxicity, and Low Cost. J. Am. Chem. Soc. 2012, 134 (42), 17680−17687. (14) Li, J. M.; Wang, Y. Y.; Zhang, W.; Su, H.; Ji, L. N.; Mao, Z. W. Low-weight polyethylenimine cross-linked 2-hydroxypopyl-beta-cyclodextrin and folic acid as an efficient and nontoxic siRNA carrier for gene silencing and tumor inhibition by VEGF siRNA. Int. J. Nanomed. 2013, 8, 2101−2117. (15) Chen, Z.; Jiang, Y. B.; Dunphy, D. R.; Adams, D. P.; Hodges, C.; Liu, N. G.; Zhang, N.; Xomeritakis, G.; Jin, X. Z.; Aluru, N. R.; Gaik, S. J.; Hillhouse, H. W.; Brinker, C. J. DNA translocation through an array of kinked nanopores. Nat. Mater. 2010, 9 (8), 667−675. (16) Kim, S. H.; Ou, M.; Bull, D. A.; Kim, S. W. Reductive Degradation Behavior of Bioreducible Poly (disulfide amine) for Enhancing SiRNA Efficiency. Macromol. Biosci. 2010, 10 (8), 898− 905. (17) Boyer, C.; Teo, J.; Phillips, P.; Erlich, R. B.; Sagnella, S.; Sharbeen, G.; Dwarte, T.; Duong, H. T. T.; Goldstein, D.; Davis, T. P.; Kavallaris, M.; McCarroll, J. Effective Delivery of siRNA into Cancer Cells and Tumors Using Well-Defined Biodegradable Cationic Star Polymers. Mol. Pharmaceutics 2013, 10 (6), 2435−2444. (18) Shim, M. S.; Kwon, Y. J. Dual mode polyspermine with tunable degradability for plasmid DNA and siRNA delivery. Biomaterials 2011, 32 (16), 4009−4020. (19) Hong, S. H.; Kim, J. E.; Kim, Y. K.; Minai-Tehrani, A.; Shin, J. Y.; Kang, B.; Kim, H. J.; Cho, C. S.; Chae, C.; Jiang, H. L.; Cho, M. H. Suppression of lung cancer progression by biocompatible glycerol 3306
dx.doi.org/10.1021/mp500169p | Mol. Pharmaceutics 2014, 11, 3300−3306
