Research in Veterinary Science 96 (2014) 187–195

Contents lists available at ScienceDirect

Research in Veterinary Science journal homepage: www.elsevier.com/locate/rvsc

Porcine circovirus type 2 decreases the infection and replication of attenuated classical swine fever virus in porcine alveolar macrophages Yu-Liang Huang a, Victor Fei Pang b,c, Ming-Chung Deng a, Chia-Yi Chang a, Chian-Ren Jeng b,c,⇑ a

Division of Hog Cholera Research, Animal Health Research Institute, Council of Agriculture, No. 376, Chung-Cheng Rd., Tansui District, New Taipei City 251, Taiwan Graduate Institute of Veterinary Medicine, School of Veterinary Medicine, National Taiwan University, No. 1, Sec. 4, Roosevelt Rd., Taipei 106, Taiwan c Graduate Institute of Molecular and Comparative Pathobiology, School of Veterinary Medicine, National Taiwan University, No. 1, Sec. 4, Roosevelt Rd., Taipei 106, Taiwan b

a r t i c l e

i n f o

Article history: Received 11 September 2013 Accepted 30 November 2013

Keywords: Alveolar macrophage Classical swine fever virus Lapinized Philippines Coronel Porcine circovirus type 2

a b s t r a c t Recently, it has been noted that porcine circovirus type 2 (PCV2) infection adversely affects the protective efficacy of Lapinized Philippines Coronel (LPC) vaccine, an attenuated strain of classical swine fever virus (CSFV), in pigs. In order to investigate the possible mechanisms of the PCV2-derived interference, an in vitro model was established to study the interaction of LPC virus (LPCV) and PCV2 in porcine alveolar macrophages (AMs). The results showed that PCV2 reduced the LPCV infection in AMs and the levels of PCV2-derived interference were dose-dependent. The PCV2-derived interference also reduced the replication level of LPCV in AMs. The full-length PCV2 DNA and its fragment DNA C9 CpG-ODN were involved in the reduction of LPCV infection in AMs, whereas UV-inactivated PCV2 was not. In addition, a moderate negative correlation between the LPCV antigen-containing rate and IFN-c production was observed, and had a dose-dependent trend with the level of PCV2-inoculation. The results of the present study may partially explain how PCV2 infection interferes with the efficacy of LPC vaccine. Ó 2013 Elsevier Ltd. All rights reserved.

1. Introduction Usually, Lapinized Philippines Coronel (LPC) vaccine provides complete protection against classical swine fever virus (CSFV) infection in pigs (Graham et al., 2012; Suradhat et al., 2007; van Oirschot, 2003). In our previous study, the LPC-vaccinated pigs pre-inoculated with porcine circovirus type 2 (PCV2) showed transient fever, viremia, and viral shedding in the saliva and feces after CSFV experimental infection (Huang et al., 2011). This PCV2derived interference not only allows the invasion of wild-type CSFV into pig herds, but also increases the difficulty of CSF prevention and control in CSF-endemic areas. How PCV2 interferes with the efficacy of LPC vaccine is not understood. PCV2 is a non-enveloped, single-stranded, circular DNA virus which is a causative agent of PCV2-associated diseases (PCVAD). Postweaning multisystemic wasting syndrome (PMWS) is the most common PCVAD and usually results in severe economic loss in the swine industry worldwide (Allan and Ellis, 2000; Darwich et al., 2004). PMWS is mostly observed in pigs between 25 and 120 days of age, with the highest prevalence between 60 and 80 days of age (Allan and Ellis, 2000; Darwich et al., 2004). This stage could ⇑ Corresponding author at: Graduate Institute of Veterinary Medicine, School of Veterinary Medicine, National Taiwan University, No. 1, Sec. 4, Roosevelt Rd., Taipei 106, Taiwan. Tel.: +886 2 3366 3869; fax: +886 2 2362 1965. E-mail address: [email protected] (C.-R. Jeng). 0034-5288/$ - see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.rvsc.2013.11.020

overlap with the age of the CSFV vaccination program of pig farms and lead to the adverse impact of PCV2 on the efficacy of LPC vaccines (Huang et al., 2011). The characteristic features of PMWS-affected pigs are lymphocyte depletion and an increase of monocyte/macrophage lineage cells in lymphoid tissues and peripheral blood (Darwich et al., 2003, 2004). This situation often leads to immunosuppression, which is displayed in the cytokine deregulation in peripheral blood mononuclear cells (PBMCs) after antigen stimulation (Darwich et al., 2003, 2004). PBMCs from PMWS-affected pigs are not able to produce normal levels of IFN-c or IL-2 after mitogen stimulation (Darwich et al., 2003, 2004). In the in vitro experiments, PCV2 alone can induce abundant IL-10 secretion from CD172a+ monocytic cells and decrease pseudorabies virus (PRV)-specific IL-2, IFN-a, and IFN-c secretion of PBMCs (Kekarainen et al., 2008a,b). In addition, PCV2 components including CpG-ODNs, the full-length PCV2 genome, and UV-inactivated PCV2 can down-regulate cytokine production from immune cells by repressing the IFN-c production of PBMCs in a PRV recall antigen response (Kekarainen et al., 2008a,b). The clear suppression of IFN-a from natural interferonproducing cells has also been observed (Vincent et al., 2005, 2006). The above studies demonstrate that strong immunosuppression activity is apparently present in the PCV2 genome and the structural protein of the PCV2 virion. The infection and replication of LPCV in macrophages is crucial for inducing an immune response against CSFV; so that macrophages

188

Y.-L. Huang et al. / Research in Veterinary Science 96 (2014) 187–195

can bring LPCV into lymphoid tissues and expose LPCV antigen to stimulate immune cells (Belak et al., 2008). The present study used alveolar macrophages (AMs), a susceptible cell for both PCV2 and LPCV (Knoetig et al., 1999; Sipos et al., 2005), to evaluate whether PCV2 affects LPCV infection in AMs. The correlation of PCV2derived interference with the components of PCV2, including UVinactivated PCV2, full-length PCV2 genomic DNA, and CpG-ODNs of the PCV2 genome, and soluble factors including TNF-a, IFN-a, IFN-c, IL-8, IL-10, and TGF-b1, were investigated.

penicillin G, 100 lg/ml streptomycin, and 0.25 lg/ml amphotericin B. They were cultivated in a Teflon flask (Thermo Fisher Scientific) or 24-well culture plate. The fetal bovine serum used in the present study tested negative for pestivirus by RT-PCR and anti-pestivirus antibodies by IFA (Huang et al., 2011). The AMs of five pigs were all used in each experiment at subsection 2.3–2.6 and the measures in each group per pigs were duplicated.

2. Materials and methods

The PCV2 used in the present study was isolated from PMWSaffected pigs by a PCV1-free porcine kidney cell line (PK-15) and was identified as genotype PCV2b by sequencing (Huang et al., 2011). The PCV2 stock of the third passage was harvested and the virus titer of the stock was determined as 1  105 TCID50/ml. The LPCV was also cultivated in the PK-15 cell line and the virus titer was determined as 1  106 TCID50/ml (Huang et al., 2009).

2.1. Collection of swine AMs Five crossbred SPF pigs, aged 6–9 weeks, were used for collection of AMs. The SPF pigs were seronegative for PCV2, CSFV, porcine reproductive and respiratory virus (PRRSV), porcine parvovirus, PRV, swine influenza virus, and Mycoplasma hyopneumoniae by ELISA, and also tested negative to these pathogens by RT-PCR or PCR (Huang et al., 2011). The procedure of AMs isolation from SPF pigs was carried out as previously described (Chang et al., 2005). The purity level of the collected AMs was assayed by flow cytometry using the mouse anti-swine SWC3 monoclonal antibody (mAb) (AbD Serotec). The collected cells were first stained with 100-fold dilution of mouse anti-swine SWC3 mAb at 4 °C in the dark for 30 min, followed by washing twice with washing buffer (PBS buffer with 0.01% sodium azide and 1% fetal bovine serum). After being washed, the cells were stained with 100-fold dilution of FITC-conjugated rat antimouse IgG1 mAb (BD Biosciences) at 4 °C in the dark for 30 min. Following the staining, the cells were assayed by FACSCalibur cytometry (BD Biosciences). The percentage of SWC3-labeled cells in the collected cells was above 90% by flow cytometry (Fig. 1). The viability of AMs was above 95%, as measured by the trypan blue exclusion assay. After the purity and the viability assays, the AMs were adjusted to 1  106 cells/ml in culture medium, containing RPMI-1640 medium, 10% (v/v) heat-inactivated fetal bovine serum, 100 units/ml

2.2. Viruses

2.3. Effect of PCV2 on the LPCV infection in AMs To evaluate whether PCV2 can affect LPCV infection in AMs, the Teflon flasks with AMs seeded at 2  106 cells/flask were subdivided into mock, LPCV, PCV2/LPCV, PCV2-LPCV, and LPCV/PCV2 groups. The AMs in the mock group were mock-inoculated with RPMI-1640 medium. The AMs in the LPCV group were inoculated with 0.5 multiplicity of infection (MOI) of LPCV. The AMs in the PCV2/LPCV group were inoculated first with 0.1 MOI of PCV2, and then with 0.5 MOI of LPCV 18 h later. The AMs in the PCV2LPCV group were inoculated simultaneously with 0.1 MOI of PCV2 and 0.5 MOI of LPCV. The AMs in the LPCV/PCV2 group were inoculated first with 0.5 MOI of LPCV, and then with 0.1 MOI of PCV2 18 h later. Following PCV2 and/or LPCV inoculation, the LPCV antigen-containing rate was measured by flow cytometry using 100-fold dilution of mouse anti-CSFV mAb WH303 (Veterinary Laboratories Agency) and was taken as the percentage of LPCV infection at 72 h post second-virus inoculation (hpi). 2.4. Effect of various PCV2 dosages on the LPCV infection in AMs To evaluate whether the effect of PCV2 on LPCV infection is dose-dependent, Teflon flasks with AMs at 2  106 cells/flask were subdivided into mock, LPCV, PL1, PL2, PL3, PL4, and PL5 groups. The AMs in the mock group were mock-inoculated with RPMI-1640 medium. The AMs in the LPCV group were inoculated with 0.5 MOI of LPCV. The AMs in the PL1, PL2, PL3, PL4, and PL5 groups were inoculated first with 0.4, 0.1, 0.05, 0.01, or 0.001 MOI of PCV2, respectively, and then the AMs were each inoculated with 0.5 MOI of LPCV 18 h later. Following the LPCV inoculation, the AMs and supernatant were collected at 72 hpi. The LPCV antigencontaining rate was measured by flow cytometry using 100-fold dilution of mAb WH303 and was taken as the percentage of LPCV infection. The supernatant was stored at 20 °C and macrophage-associated cytokines within the supernatant were investigated. 2.5. Effect of PCV2 viral components on the LPCV infection in AMs

Fig. 1. Purification of alveolar macrophages from specific-pathogen-free pigs. Collected AMs were stained with mouse anti-swine SWC3 and FITC-conjugate rat anti-mouse IgG1 monoclonal antibodies. Following the staining, the AMs were assayed by FACSCalibur cytometry. Histograms showed staining (dotted line) and non-staining (filled black) patterns with SWC3 monoclonal antibody in AMs. Data are shown as mean ± standard deviation.

To evaluate whether PCV2 viral components can affect LPCV infection in AMs, PCV2 components, including UV-inactivated PCV2, full-length PCV2 DNA, and CpG-ODNs of the PCV2 genome, were tested. To inactivate PCV2, the virus suspension with 1  105 TCID50/ml was exposed to GL-15 UV at a distance of 15 cm for 20 min. The full-length PCV2 DNA was amplified by PCR using a primer pair (forward: 50 -ATTTCCATATGAAATAAATTA-30 ; reverse: 50 -ACCATTACGAAGTGATAAAAAAG-30 ) and the PCR product was cloned into yT&AÒ vector (Yestern Biotech). The

189

Y.-L. Huang et al. / Research in Veterinary Science 96 (2014) 187–195

full-length PCV2 DNA was obtained by BamHI and XhoI restriction digests (Roche), separated by agarose gel electrophoresis, and purified by Qiaquick Gel Extraction kit (Qiagen). The sequences of the CpG-ODNs in the PCV2 genome were adopted from Kekarainen et al. (2008a,b) and included C1 to C16 CpG-ODNs. The C17 CpGODN was the positive control for the CpG-ODNs and was adopted from Guzylack-Piriou et al. (2004) (Table 1). Teflon flasks containing AMs at 2  106 cells/flask were subdivided into mock, LPCV, PCV2/LPCV, UV-PL, C1 to C17, and PCV2DNA groups. The procedures of the mock, LPCV, and PCV2/LPCV groups were as described above. The AMs in the UV-PL group were inoculated first with 0.1 MOI of UV-inactivated PCV2, and then with 0.5 MOI of LPCV 18 h later. The AMs among C1 to C17 groups were transfected with 3 nmol/ml of C1 to C17 CpG-ODN respectively by FullGene HD (Roche) according to the manufacturer’s instructions. Following the transfection, the AMs were each inoculated with 0.5 MOI of LPCV 18 h later. The AMs in PCV2-DNA group were transfected with 2 lg of full-length PCV2 DNA by FullGene HD, and then inoculated with 0.5 MOI of LPCV 18 h later. The AMs were collected at 72 hpi, and the LPCV antigen-containing rate was measured by flow cytometry using 100-fold dilution of mAb WH303. The LPCV antigen-containing rate was taken as the percentage of LPCV infection. 2.6. Effect of PCV2 on the LPCV replication in AMs To evaluate whether PCV2 can affect LPCV replication in AMs, a 24-well plate with 1  105 AMs/well was subdivided into LPCV and PCV2/LPCV groups. The AMs in the LPCV group were inoculated with 0.5 MOI of LPCV. The AMs in the PCV2/LPCV group were inoculated first with 0.1 MOI of PCV2 and then with 0.5 MOI of LPCV 18 h later. Two hours after LPCV inoculation, the AMs in the two groups were washed three times with RPMI-1640, and then 2 ml fresh culture medium was added. The AMs were collected at 18, 72, and 120 hpi. The total RNA of the AMs was extracted by TRIzolÒ reagent (Invitrogen), and the amount of LPCV RNA was measured by reverse-transcription real-time PCR (Huang et al., 2009).

AMs from each group were suspended and washed twice with the washing buffer. After being washed, the AMs were treated with 4% paraformaldehyde at 4 °C in the dark for 20 min, and then fixed and permeabilized by BD Cytofix/Cytoperm™ Fixation/Permeabilization Kit (BD Biosciences) according to the manufacturer’s instructions. The fixed cells were stained with the 100-fold dilution of mAb WH303 for 30 min at 4 °C in the dark and washed twice with the washing buffer. After being washed, the cells were further stained with 100-fold dilution of FITC-conjugate rat anti-mouse IgG1 mAb for 30 min at 4 °C in the dark and washed twice with the washing buffer. Finally, the cells were suspended in the washing buffer and assayed by FACSCalibur cytometry (BD Biosciences). 2.8. Quantification of LPCV by reverse-transcription real-time PCR To measure the LPCV replication in treated AMs, the amount of LPCV RNA in the AMs was assayed by the relative quantification of reverse-transcription real-time PCR. Each RNA sample from AMs was reverse transcribed to cDNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche) according to the manufacturer’s instructions. The amounts of LPCV and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in each cDNA sample were detected by the iQ™ 5 multicolor Real-Time PCR Detection System (Bio-Rad) using the FastStart Universal Probe Master (Roche) according to the manufacturer’s instructions and were duplicate. The TaqMan probes and primers of LPCV and GAPDH were adopted from Huang et al. (2009) and Sipos et al. (2005), respectively (Table 2). Relative quantification of LPCV was calculated using the 44Ct formula (Schmittgen and Livak, 2008): Ct

2DD ¼ ½ðCt LPC of AMs  Ct GAPDH of AMsÞ sample A  ðCt LPC of AMs  Ct GAPDH of AMsÞ sample B Sample A included the LPCV group at 72 and 120 hpi and PCV2/ LPCV group at 18, 72, and 120 hpi. Sample B was LPCV group at 18 hpi. 2.9. Measurement of macrophage-associated cytokines

2.7. Measurement of LPCV antigen-containing rate The LPCV antigen-containing rate of the AMs was measured by flow cytometry using the 100-fold dilution of mAb WH303. Briefly,

Table 1 The sequence of CpG-ODNs.a

a

CpG-ODN

Sequence (50 –30 )

C1 C2 C3 C4 C5 C6 C7 C8 C9 C10 C11 C12 C13 C14 C15 C16 C17

TGCGCTGTAAGTATTACCGGCGC GGGTGTTCACGCTGAATAAT CTTCCGAAGACGAGCGCAAG AGAAAATACGGGAGCTTCC GGGGTTCGCTAATTTTGTGA TCGAGAAAGCGAAAGGAACT CAGGGACAACGGAGTGACCT CTGTGTGATCGGTATCCATT GGGGCCAGTTCGTCACCCTTTCC GTTTTCGAAGGCAGTGCCGA GGGTAAAGTACCGGGAGTGGTAG CCAGGAGGGCGTTCTGACTG GGTGCGGGAGAGGCGGGTG CAGCGGTAACGGTGGCGGGG AGATGGCTGCGGGGGCGGTG CGTCTGCGGAAACGCCTCCT GTGCGTCGACGCAGGGGGG

The sequences of the C1 to C16 CpG-ODNs of the porcine circovirus type 2 genome were adopted from Kekarainen et al. (2008a). The C17 CpG-ODN was the positive control, and was adopted from Guzylack-Piriou et al. (2004).

In order to understand the possible role of cytokines in PCV2derived interference, the concentration of TNF-a, IFN-a, IFN-c, IL10, IL-8, and TGF-b1 were measured in two supernatant samples of each group at subsection 2.4. IFN-a was measured in triplicate by bioassay as previously described (Chang et al., 2005). The concentration of TNF-a, IFN-c, IL-10, IL-8, and TGF-b1 was measured in single by swine TNF-a, IFN-c, IL-10, IL-8, and TGF-b1 ELISA kits (Invitrogen) according to the manufacturer’s instructions. 2.10. The effect of IFN-c on LPCV replication in the PK-15 cell line To evaluate if the IFN-c present in the supernatant of AM culture could affect the LPCV replication and whether the impact was dose dependent, the various concentrations of IFN-c were Table 2 The sequence of TaqMan probes and primers used in reverse-transcription real-time PCR. Name

Sequence (50 –30 )

References

Cp5 Cp6 LPCV-probe

GTAGCAAGACTGGRAAYAGGTA AAAGTGCTGTTAAAAATGAGTG FAM-ACCCGCCAGTAGGACCCTATTGTAGBBQ ACATGGCCTCCAAGGAGTAAGA GATCGAGTTGGGGCTGTGACT FAM-CCACCAACCCCAGCAAGAGCACGCBBQ

Huang et al. (2009)

GAPDH-F GAPDH-R GAPDHProbe

Sipos et al. (2005)

190

Y.-L. Huang et al. / Research in Veterinary Science 96 (2014) 187–195

tested in the PK-15 cell line. The monolayer PK-15 cells in six-well cell microplates were treated separately with 1 lg, 0.1 lg, 0.01 lg, 1 ng, 0.1 ng or 0 ng/ml of IFN-c (R&D system) at 18 h; following which, the cells in all groups were inoculated with 105.67 TCID50/ well of LPCV. The supernatant was collected at 24, 48, and 72 hpi. Each concentration was tested in triplicate wells. The LPCV titer in supernatant was examined by viral culture according to Huang et al. (2009). 2.11. Statistical analysis Comparisons between two groups and among various groups were analyzed by Student’s t-test and one-way analysis of variance (ANOVA), respectively. ANOVA was combined with Duncan’s multiple range tests. The correlation between the LPCV antigen-containing rate and cytokine levels was also analyzed by simple correlation and calculated the correlation coefficient (r). The correlation was classified by r values into five levels. The 0–0.3 (0 to 0.3), 0.3–0.5 (0.3 to 0.5), 0.5–0.7 (0.5 to 0.7), 0.7–0.9 (0.7 to 0.9), and 0.9–1.0 (0.9 to 1.0) of r value indicated the negligible, low, moderate, high, and very high positive (negative) linear relationship, respectively (Mukaka, 2012). The statistical analyses of the data were carried out with Statistical Analysis System (SAS for Windows 6.12; SAS Institute Inc.). A p-value of less than 0.05 was considered to be statistically significant. 3. Results 3.1. PCV2 decreased LPCV infection in AMs To examine if PCV2-derived interference affected the LPCV infection in AMs, the LPCV antigen-containing rates of AMs in the PCV2/LPCV, PCV2-LPCV, and LPCV/PCV2 groups were investigated and measured by flow cytometry. The LPCV antigen-containing rate in AMs infected with LPCV only was much higher than AMs also infected with PCV2. The LPCV antigen-containing rate in the simple LPCV-infected group was 80.99 ± 9.58%, but the LPCV antigen-containing rate was reduced to 20.73 ± 9.65% in the group pre-infected with PCV2 (PCV2/LPCV) (Fig. 2). In addition, the LPCV antigen-containing rates of the PCV2/LPCV and PCV2-LPCV groups were 20.73 ± 9.65% and 30.36 ± 6.23%, respectively, which was

significantly lower (52.65 ± 14.76%).

than

that

of

the

LPCV/PCV2

group

3.2. The PCV2-derived interference on LPCV infection in AMs was dosedependent To investigate the dose–response of the PCV2-derived interference against the LPCV infection in AMs, various MOIs of PCV2 were inoculated before LPCV infection. The LPCV antigen-containing rate in AMs inoculated with LPCV alone was 92.01 ± 2.57% (Fig. 3). Inoculation with a MOI lower than 0.01 of PCV2 (0.01 MOI in PL4, and 0.001 MOI in PL5) did not significantly reduce the LPCV antigencontaining rate in LPCV-infected AMs (86.09 ± 12.35% in PL4, and 92.70 ± 2.29% in PL5). After the MOI of PCV2 inoculation was increased to more than a 0.05 MOI, the LPCV antigen-containing rates decreased significantly (Fig. 3). The LPCV antigen-containing rates in AMs pre-inoculated with 0.4 or 0.1 MOI of PCV2 (in PL1 and PL2) were 4.83 ± 1.70% and 11.31 ± 6.30%, respectively, which were significantly lower than that of AMs inoculated with 0.05 MOI of PCV2 (47.29 ± 23.37% in PL3). 3.3. The PCV2-derived interference on LPCV infection in AMs was partially affected by CpG-ODNs and the PCV2 genome The UV-inactivated PCV2, full-length PCV2 DNA, and CpG-ODNs were tested for adverse effects on the LPCV infection in AMs. The LPCV antigen-containing rate in the LPCV group was 87.13 ± 3.83% (Fig. 4). Pre-transfection with C9 or C17 CpG-ODN or full-length PCV2 DNA significantly reduced the LPCV antigencontaining rates to 70.41 ± 4.56%, 60.95 ± 26.28%, and 54.73 ± 14.45%, respectively, but the UV-inactivated PCV2 and the other CpG-ODNs did not have significant adverse effects on LPCV infection in AMs (Fig. 4). 3.4. The PCV2-derived interference was involved in the level of LPCV replication in AMs The effect of PCV2 on LPCV replication in AMs was investigated using relative quantification of reverse-transcription real-time PCR to compare the amount of LPCV to the housekeeping gene GAPDH in each cDNA sample. The genome of LPCV in AMs was detectable

Fig. 2. The effect of PCV2 inoculation order on LPCV infection in alveolar macrophages. Various PCV2 inoculation orders were tested in PCV2/LPCV, PCV2-LPCV, and LPCV/ PCV2 groups. The AMs in the PCV2/LPCV group were pre-inoculated with 0.1 MOI of PCV2, followed by inoculation with 0.5 MOI of LPCV 18 h later. The AMs in the PCV2-LPCV group were inoculated simultaneously with 0.1 MOI of PCV2 and 0.5 MOI of LPCV. The AMs in the LPCV/PCV2 group were inoculated first with 0.5 MOI of LPCV, and then with 0.1 MOI of PCV2 18 h later. The AMs inoculated with only 0.5 MOI of LPCV were the control group. The LPCV antigen-containing rate was measured by flow cytometry using mouse anti-classical swine fever virus monoclonal antibody WH303. Data are shown as mean ± standard deviation. a–cValues with different superscripts indicate that the differences among groups were statistically significant (p < 0.05).

Y.-L. Huang et al. / Research in Veterinary Science 96 (2014) 187–195

191

Fig. 3. The effects of various doses of PCV2 and UV-inactivated PCV2 on LPCV infection in alveolar macrophages. The AMs in the PL1, PL2, PL3, PL4, PL5 and UV-PL groups were pre-inoculated with 0.4, 0.1, 0.05, 0.01 or 0.001 MOI of PCV2 or 0.1 MOI of UV-inactivated PCV2, respectively, and then with 0.5 MOI of LPCV. The LPCV antigen-containing rate was measured by flow cytometry using mouse anti-classical swine fever virus monoclonal antibody WH303. Data are shown as mean ± standard deviation. a–cValues with different superscripts indicate that the differences among groups were statistically significant (p < 0.05).

Fig. 4. The effect of PCV2 components on LPCV infection in alveolar macrophages. The sequences of C1 to C16 CpG-ODNs located in the PCV2 genome were adopted from Kekarainen et al. (2008a,b). The C17 CpG-ODN positive control was adopted from Guzylack-Piriou et al. (2004). PCV2 DNA is the double-stranded, full-length PCV2 genome. The AMs were pre-transfected with C1 to C17 CpG-ODNs or PCV2 DNA, and then inoculated with 0.5 MOI of LPCV. The LPCV antigen-containing rate was measured by flow cytometry using mouse anti-classical swine fever virus WH303 monoclonal antibody. Data are shown as mean ± standard deviation. a–dValues with different superscripts indicate that the differences among groups were statistically significant (p < 0.05).

at 18 hpi and peaked at 120 hpi (11.90 ± 2.80 log2-folds) (Fig. 5). Pre-infection of PCV2 significantly reduced the level of LPCV replication to 7.24 ± 1.39 and 10.92 ± 2.39 log2-folds at 72 and 120 hpi, respectively, which were significantly lower than the group infected with LPCV alone (8.25 ± 0.97 and 11.90 ± 2.80 log2-folds at 72 and 120).

3.5. The macrophage-associated cytokines in the supernatant of AM cultures Since soluble factors secreted by PCV2 infected AMs may be involved in the interference of LPCV infection and replication, cytokine levels in the culture supernatants of different set-ups were

192

Y.-L. Huang et al. / Research in Veterinary Science 96 (2014) 187–195

not significantly different among the LPCV and PL1 to PL5 groups (Fig. 6D). Neither IL-10 nor IFN-a were detected in any supernatant samples (data not shown). In addition, the correlation between the LPCV antigen-containing rate and the level of cytokines was investigated. A low and high positive correlation was shown for TNF-a and TGF-b1, respectively. The r value of TNF-a and TGF-b1 were 0.32 and 0.78, respectively. However, the correlation between the LPCV antigen-containing rate and the level of IFN-c was moderate negative (r = 0.54). 3.6. IFN-c interfered with LPCV replication in PK-15 cells

Fig. 5. The effect of PCV2 inoculation on LPCV replication in alveolar macrophages. The AMs were classified into LPCV and PCV2/LPCV groups. The AMs in the LPCV group were only inoculated with 0.5 MOI of LPCV. The AMs in PCV2/LPCV group were pre-inoculated with 0.1 MOI of PCV2, and then inoculated with 0.5 MOI of LPCV 18 h later. After LPCV inoculation, the AMs were washed three times and cultivated in fresh culture medium. The AMs in the LPCV and PCV2/LPCV groups were collected at 18, 72, and 120 h post-inoculation, and LPCV titer was quantified by reverse transcription real-time PCR. Data are shown as mean ± standard deviation. ⁄Indicates that the differences between LPCV and PCV2/LPCV groups were statistically significant (p < 0.05).

investigated. The levels of TNF-a and TGF-b1 were gradually decreased by the increase of PCV2 inoculation doses. The TNF-a and TGF-b1 production of group PL4 and PL5 were significantly higher than the cytokine levels of group PL1 and PL2 (Fig. 6A and B). An adverse pattern was shown in the IFN-c. The IFN-c level of groups PL1 was significantly higher than groups PL4 and PL5 (Fig. 6C). The levels of IL-8 in the supernatant of AM cultures were

Since the levels of IFN-c in the supernatants of different set-ups were significantly different and were negatively correlated with the LPCV antigen-containing rate (Fig. 6), the impact of various IFN-c concentrations on LPCV replication was investigated. The dose-dependent effect of IFN-c was apparent at 48 and 72 hpi (Fig. 7). At 48 hpi, a significant effect on LPCV replication was noted at more than 0.01 lg/ml of IFN-c. However, the cut point of the significant effect on LPCV replication decreased to 1 ng/ml of IFN-c at 72 hpi.

4. Discussion and conclusions That PCV2 infection adversely affects the protective efficacy of the LPC vaccine has been demonstrated in a previous study (Huang et al., 2011). In order to investigate the possible mechanisms of PCV2-derived interference, the present study focused on how PCV2 interferes with LPCV infection in AMs, which is one of the major target cells for both viruses. This in vitro model demonstrated that PCV2 infection reduced the level of infection and replication of LPCV in AMs, regardless of the infection order of the two viruses. In addition, the PCV2-derived interference was dosedependent, and was mediated by PCV2 genomic DNA and IFN-c. These results could partially explain the mechanism of PCV2derived interference on the efficacy of the LPC vaccine.

Fig. 6. The cytokines in the supernatant of AM culture. TNF-a (A), TGF-b1 (B), IFN-c (C), and IL-8 (D) in the supernatant of AM culture were examined by ELISA. Data are shown as mean ± standard deviation. a–dValues with different superscripts indicate that the differences among groups were statistically significant (p < 0.05).

Y.-L. Huang et al. / Research in Veterinary Science 96 (2014) 187–195

193

Fig. 7. The effect of IFN-c on LPCV replication. The adverse effect of various IFN-c concentrations were tested. Monolayer PK-15 cells in six-well cell microplates were treated separately with 1 lg, 0.1 lg, 0.01 lg, 1 ng, 0.1 ng or 0 ng/ml of IFN-c at 18 h; following which, the cells in all groups were inoculated with 105.67 TCID50/well of LPCV. The supernatant was collected at 24, 48, and 72 h post-inoculation and LPCV titer was detected by viral culture. Data are shown as mean ± standard deviation. a–cValues with different superscripts indicate that the differences among groups were statistically significant (p < 0.05).

In the present study, the levels of LPCV infection and replication in AMs were reduced by PCV2. The interference in the group with PCV2 infection prior to LPCV infection suggests that the inhibition may be caused either by reduced LPCV entry or by interference with LPCV replication in the AMs, or both. On the other hand, interference in the group of cells infected by PCV2 after LPCV inoculation reflected that, even when macrophages were first infected with LPCV, the production of progeny LPCV could be significantly reduced by subsequent PCV2 infection. Several studies have demonstrated that an insufficient dosage of vaccine antigen cannot induce the complete immune response and protection in pigs. Piglets have more than 32-fold maternalderived anti-CSFV neutralizing antibodies which could block LPCV infection and replication, and lead to incomplete protection in LPCvaccinated pigs (Suradhat et al., 2007; van Oirschot, 2003). In addition, the pigs vaccinated with lower than 1/100 dose of the LPC vaccine display incomplete protection after virulent CSFV challenge (Pan et al., 2008). Therefore, insufficient LPCV infection or replication may result in an inadequate level of vaccine antigens, which may partially explain the mechanism of how PCV2 infection reduces the efficacy of the LPC vaccine. The level of PCV2-derived inhibition on LPCV infection was correlated with the order and dosage of PCV2 infection. Chronologically, PCV2 pre-infection has a stronger interference than postinfected PCV2 on LPCV infection of AMs. These findings were also observed in the PCV2-derived reduction of PRRSV infection in AMs (Chang, 2006). These results suggested that the order of PCV2 infection was correlated with the level of PCV2-derived interference, and that the degree of reduced efficacy of the LPCV vaccine may vary in different pig farms. Therefore, using the LPC vaccine in advance of PCV2 infection in the herd may be a possible way to avoid interference with the efficacy of the LPC vaccine. Another finding of this study is that the level of PCV2-derived interference of LPCV infection is dose-dependent. It is known that the level of the PCV2 viral load is correlated with the occurrence of PMWS in pigs (Darwich et al., 2004). The situation also reflects the fact that the vaccination failure of LPC vaccine predominantly occurs on pig farms that suffer endemic PMWS. A previous study had demonstrated that PCV2 viral components modulate immune response (Kekarainen et al., 2008a,b). The PCV2derived immunomodulation in the present study is different from that in the previous study. Our results show that live PCV2, but not

UV-inactivated PCV2, interfered with LPCV infection in AMs. However, both live and UV-inactivated PCV2 was able to down-regulate the immune response of PBMCs with PRV recall antigens (Kekarainen et al., 2008a,b). The results of the present study suggest that the interference with LPCV infection and replication might be inherent to the PCV2 genome or intermediate products of PCV2 replication, or both. The PCV2 capsid proteins were not involved in the interference of LPCV replication. The PCV2 genome or its intermediates were correlated with PCV2-derived interference. The transfection of either the fulllength PCV2 genome or a short PCV2 genomic sequence, especially CpG-ODN C9, reduced LPCV infection in AMs. This reduction supports the role of the PCV2 genome in the inhibition of LPCV replication. The CpG-ODN segments in the PCV2 genome downregulated the immune responses of immune cells, as also demonstrated in in vitro models of PRV. These segments reduce the level of PRV-induced IFN-c and IL-2 in PBMCs and the level of PRV-induced IL-12 in bone marrow-derived dendritic cells (BMDCs) (Kekarainen et al., 2008b). These results indicated that the CpGODNs in the PCV2 genome were able to down-regulate the activation of immune cells stimulated by other pathogens. In addition, CpG-ODNs in PCV2 could interfere with vaccine efficacy by reduced protection of vaccine antigen in the cells. Among the factors which affect viral infection and replication are the cytokines, the previous studies have shown that IFN-a, IFN-c, and TGF-b1 can either inhibit or enhance virus infection and replication (Bensaude et al., 2004; Chang et al., 2005; Graham et al., 2012; Presser et al., 2013; Reed, 1999). In the present study, there was a moderate negative correlation between the LPCV antigen-containing rate and IFN-c production and this interference was demonstrated in PK-15 cells: IFN-c can reduce LPCV replication. This IFN-c interference of LPCV infection and replication was also found in the Graham et al. study (2012) that IFN-c reduced LPCV infection and replication in monocytes. In addition, IFN-c production was positively correlated with the protection of pigs against CSFV challenge (Graham et al., 2012; Suradhat et al., 2007). Their results support the role of IFN-c involvement in the PCV2-derived interference in the efficacy of the LPC vaccine. IFN-a is an inhibitor of CSFV infection and replication and can be induced or inhibited in PBMC by PCV2 (Bensaude et al., 2004; Chen, 2007; Hasslung et al., 2003). In the present study, IFN-a was not detected in any of the PCV2/LPCV groups. This result is dif-

194

Y.-L. Huang et al. / Research in Veterinary Science 96 (2014) 187–195

ferent from Chang et al. (2005), wherein PCV2 reduced PRRSV infection in AMs by IFN-a. The differences between Chang et al. (2005) and the present study could be related to three factors, including the genomic sequence, inoculation dosage, and inoculation time of PCV2 (Chen, 2007; Hasslung et al., 2003). The genome sequence of PCV2 used in this study included two DNA elements capable of inducing IFN-a production, and no inhibitory element (Hasslung et al., 2003). However, both elements have lower ability to induce IFN-a production in PBMCs (Hasslung et al., 2003). These results suggest that the PCV2 strain used in this study was less capable of inducing IFN-a production. In addition, unlike the previous study, the inoculation dosage of PCV2 used to induce IFN-a production in the present study was the minimal dosage (Chen, 2007). In another study, the highest level of PCV2-induced IFN-a was 24 hpi, and the level gradually decreased over time (Chen, 2007). The supernatant collected in this study was at 3 days post-PCV2 inoculation, and this may have led to the undetectable level of IFN-a in the samples examined. The related quantization of real-time PCR is widely used to quantify the gene expression in the cells and tissues by the normalization of reference gene (Schmittgen and Livak, 2008). This method has been applied to quantify the expression of LPCV gene in the present study and the comparison among the PCR efficiency of expression of GAPDH, cyclophilin, and B-action in these samples was carried out. The results indicated that the expressions of three genes in the various treatments were similar. However, only the PCR efficiency of GAPDH was closed to the PCR efficiency of LPCV gene (data not shown). Therefore, the GAPDH is a more appropriate reference for the quantization of LPCV gene. It possess with several important conditions of reference gene, including (1) it is stable expression among the different treatments, (2) the PCR efficiency of reference gene is closed to the target gene, (3) the expression of reference gene is ranged from 17 to 30 threshold cycles (Bustin and Penning, 2012; Dheda et al., 2005; Radonic et al., 2004; Wan et al., 2010). Moreover, this gene is widely used in the gene quantization of many viral studies such CSFV, PRRSV, and influenza virus (Feng et al., 2012; Kuchipudi et al., 2012; Suradhat et al., 2003). Therefore, the present study used only the GAPDH as the reference gene and calculated the expression of LPCV gene. In conclusion, PCV2 infection reduces LPCV infection and replication in AMs. Infectious PCV2 particles, the full-length PCV2 genome, the C9 CpG-ODN, and IFN-c are involved in this interference. These findings partially explain the mechanism of how PCV2 reduces the efficacy of LPC vaccine. Acknowledgements This research was supported in part by Grants 96AS-14.2.4-HIH2 and 101-2313-B-002-026-MY3 from the Council of Agriculture and the National Science Council, respectively. We especially thank our colleagues in the Division of Hog Cholera Research for their assistance during these experiments. References Allan, G.M., Ellis, J.A., 2000. Porcine circoviruses: a review. Journal of Veterinary Diagnostic Investigation 12, 3–14. Belak, K., Koenen, F., Vanderhallen, H., Mittelholzer, C., Feliziani, F., Mia, G.M.D., Belak, S., 2008. Comparative studies on the pathogenicity and tissue distribution of three virulence variants of classical swine fever virus, two field isolates and one vaccine strain, with special regard to immunohistochemical investigations. Acta Veterinaria Scandinavica 50, 1–13. Bensaude, E., Turner, J.L., Wakeley, P.R., Sweetman, D.A., Pardieu, C., Drew, T.W., Wileman, T., Powell, P.P., 2004. Classical swine fever virus induces proinflammatory cytokines and tissue factor expression and inhibits apoptosis and interferon synthesis during the establishment of long-term infection of porcine vascular endothelial cells. Journal of General Virology 85, 1029–1037.

Bustin, S., Penning, L.C., 2012. Improving the analysis of quantitative PCR data in veterinary research. The Veterinary Journal 191, 279–281. Chang, H.W., 2006. The pathogenesis of PMWS by evaluating the effect and interaction of PCV2 and/or other possible co-factors, PRRSV or immune stimulator, on porcine immune cells in vitro. Thesis, Doctor of Veterinary Medicine, National Taiwan University, Taipei. Chang, H.W., Jeng, C.R., Liu, J.J., Lin, T.L., Chang, C.C., Chia, M.Y., Tsai, Y.C., Pang, V.F., 2005. Reduction of porcine reproductive and respiratory syndrome virus (PRRSV) infection in swine alveolar macrophages by porcine circovirus 2 (PCV2)-induced interferon-alpha. Veterinary Microbiology 108, 167–177. Chen, W.J., 2007. Comparison on the potential of IFN-a induction and genetic difference among different PCV2 field isolates. Thesis, Master of Veterinary Medicine, National Taiwan University, Taipei. Darwich, L., Balasch, M., Plana-Duran, J., Segales, J., Domingo, M., Mateu, E., 2003. Cytokine profiles of peripheral blood mononuclear cells from pigs with postweaning multisystemic wasting syndrome in response to mitogen, superantigen or recall viral antigens. Journal of General Virology 84, 3453– 3457. Darwich, L., Segales, J., Mateu, E., 2004. Pathogenesis of postweaning multisystemic wasting syndrome caused by porcine circovirus 2: an immune riddle. Archives of Virology 149, 857–874. Dheda, K., Huggett, J.F., Chang, J.S., Kim, L.U., Bustin, S.A., Johnson, M.A., Rook, G.A.W., Zumla, A., 2005. The implications of using an inappropriate reference gene for real-time reverse transcription PCR data normalization. Analytical Biochemistry 344, 141–143. Feng, L., Li, X.Q., Li, X.N., Li, J., Meng, X.M., Zhang, H.Y., Liang, J.J., Li, H., Sun, S.K., Cai, X.B., Su, L.J., Yin, S., Li, Y.S., Luo, T.R., 2012. In vitro infection with classical swine fever virus inhibits the transcription of immune response genes. Virology Journal 9, 175. Graham, S.P., Haines, F.J., Johns, H.L., Sosan, O., La Rocca, S.A., Lamp, B., Rumenapf, T., Everett, H.E., Crooke, H.R., 2012. Characterization of vaccine-induced, broadly cross-reactive IFN-c secreting T-cell responses that correlate with rapid protection against classical swine fever virus. Vaccine 30, 2742–2748. Guzylack-Piriou, L., Balmelli, C., McCullough, K.C., Summerfield, A., 2004. Type-A CpG oligonucleotides activate exclusively porcine natural interferon-producing cells to secrete interferon-a, tumor necrosis factor-a and interleukin-12. Immunology 112, 28–37. Hasslung, F.C., Berg, M., Allan, G.M., Meehan, B.M., McNeilly, F., Fossum, C., 2003. Identification of a sequence from the genome of porcine circovirus type 2 with an inhibitory effect on IFN-a production by porcine PBMCs. Journal of General Virology 84, 2937–2945. Huang, Y.L., Pang, V.F., Lin, C.M., Tsai, Y.C., Chia, M.Y., Deng, M.C., Chang, C.Y., Jeng, C.R., 2011. Porcine circovirus type 2 (PCV2) infection decreases the efficacy of an attenuated classical swine fever virus (CSFV) vaccine. Veterinary Research 42, 115. Huang, Y.L., Pang, V.F., Pan, C.H., Chen, T.H., Jong, M.H., Huang, T.S., Jeng, C.R., 2009. Development of a reverse transcription multiplex real-time PCR for the detection and genotyping of classical swine fever virus. Journal of Virological Methods 160, 111–118. Kekarainen, T., Montoya, M., Dominguez, J., Mateu, E., Segales, J., 2008a. Porcine circovirus type 2 (PCV2) viral components immunomodulate recall antigen responses. Veterinary Immunology and Immunopathology 124, 41–49. Kekarainen, T., Montoya, M., Mateu, E., Segales, J., 2008b. Porcine circovirus type 2induced interleukin-10 modulates recall antigen responses. Journal of General Virology 89, 760–765. Knoetig, S.M., Summerfield, A., Spagnuolo-Weaver, M., Tschudin, R., McCullough, K.C., 1999. Immunopathogenesis of classical swine fever: role of monocytic cells. Immunology 97, 359–366. Kuchipudi, S.V., Tellabati, M., Nelli, R.K., White, G.A., Perez, B.B., Sebastian, S., Slomka, M.J., Brookes, S.M., Brown, I.H., Dunham, S.P., Chang, K.C., 2012. 18S rRNA is a reliable normalisation gene for real time PCR based on influenza virus infected cells. Virology Journal 9, 230. Mukaka, M.M., 2012. Statistics corner: a guide to appropriate use of correlation coefficient in medical research. Malawi Medical Journal 24, 69–71. Pan, C.H., Wang, C., Huang, T.S., Jong, M.H., Chao, P.H., Lai, S.S., 2008. Protective efficacy of LPC vaccine in pigs against two invaded virus strains of classical swine fever virus. In: Spring Congress of Chinese Society of Veterinary Science, Ping Tung, Taiwan, p. 15. Presser, L.D., McRae, S., Waris, G., 2013. Activation of TGF-b1 promoter by hepatitis C virus-induced AP-1 and Sp1: role of TGF-b1 in hepatic stellate cell activation and invasion. PLoS One 8, e56367. Radonic, A., Thulke, S., Mackay, I.M., Landt, O., Siegert, W., Nitsche, A., 2004. Guideline to reference gene selection for quantitative real-time PCR. Biochemical and Biophysical Research Communications 313, 856–862. Reed, S.G., 1999. TGF-b in infections and infectious diseases. Microbes and Infection 1, 1313–1325. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative CT method. Nature Protocols 3, 1101–1108. Sipos, W., Duvigneau, J.C., Pietschmann, P., Schilcher, F., Hofbauer, G., Hartl, R.T., Schmoll, F., 2005. Porcine dermatitis and nephropathy syndrome (PDNS) is associated with a systemic cytokine expression profile indicative of proinflammation and a Th1 bias. Veterinary Immunology and Immunopathology 107, 303–313. Suradhat, S., Damrongwatanapokin, S., Thanawongnuwech, R., 2007. Factors critical for successful vaccination against classical swine fever in endemic areas. Veterinary Microbiology 119, 1–9.

Y.-L. Huang et al. / Research in Veterinary Science 96 (2014) 187–195 Suradhat, S., Thanawongnuwech, R., Poovorawan, Y., 2003. Upregulation of IL-10 gene expression in porcine peripheral blood mononuclear cells by porcine reproductive and respiratory syndrome virus. The Journal of General Virology 84, 453–459. van Oirschot, J.T., 2003. Vaccinology of classical swine fever: from lab to field. Veterinary Microbiology 96, 367–384. Vincent, I.E., Balmelli, C., Meehan, B., Allan, G., Summerfield, A., McCullough, K.C., 2006. Silencing of natural interferon producing cell activation by porcine circovirus type 2 DNA. Immunology 120, 47–56.

195

Vincent, I.E., Carrasco, C.P., Guzylack-Piriou, L., Herrmann, B., McNeilly, F., Allan, G., Summerfield, A., McCullough, K.C., 2005. Subset-dependent modulation of dendritic cell activity by circovirus type 2. Immunology 115, 388–398. Wan, H., Zhao, Z., Qian, C., Sui, Y., Malik, A.A., Chen, J., 2010. Selection of appropriate reference genes for gene expression studies by quantitative real-time polymerase chain reaction in cucumber. Analytical Biochemistry 399, 257–261.