J. Xol. Riol. (1992) 226, 623-635

Positive Regulation of the Expression of the Escherichia coli pts Operon Identification

of the Regulatory Regions

H. De Reuse’?, A. Kolb2 and A. Danchin’S ‘Unite

de Re’gulation

‘Unite’

Institut

de I’Expression

Ge’ne’tique

de Physicochimie des Macromole’cules Pasteur, 28, rue du Docteur Roux 75724 Paris Cedex 15. France

(Received 14 October 1991: accepted 1.3 ,4pril

1992)

The pts operon of Escherichia coli is composed of t’he ptsH, ptsl and err genes coding for three proteins central to the phosphoenolpyruvate dependent phosphotransferase system (PTS), the HPr, enzyme I and EIITG’” proteins, respectively. We previouslv showed that, transcription from the promoter region located upstream from the pts operon is regulated by two control circuits, which can occur independently from each other. Transcription of t8he pts operon is (1) stimulated by the CAP-cAMP complex and (2) enhanced during growth on glucose, a PTS substrate. The DNA regions involved in regulation of the expression of t!he pts operon have been identified. Two promoters, PO and Pl , separated by 100 bp are located upstream from the pts operon. In these promoter regions. we identified two sequences showing similarity with the consensus of CAP-binding sites. CAPa located near PO and CAPb located in the -35 region of Pl. In ciao experiments showed that binding of (‘AP-CAMP at the CAPa site stimulates t’ranscription from the PO promoter. The binding sites of CAP-CAMP and/or RNA-polymerase on a DNA fragtnent containing both PO and Pl promoters as well as both CAPa and CAPb sites were examined by the technique of DNase I footprinting. These in vitro experiments suggested that CAP-CAMP binding at the CAPb site might also play a role in regulation of the pts operon expression. In addition, we showed that the DNA region carrying the CAPa site is important for regulation by glucose. We finally propose that the expression of the pts operon is controlled by two alternat#ive positive regulatory mechanisms. which are designed t’o allow activation of the pts operon under a great variety of growth conditions.

Keywords: transcriptional PEP-dependent

regulation; E. coli: CAP; cA,MP; phosphotransferase syst’em

1. Introduction In a large number of bacteria, detection, uptake and phosphorylation of many glucose-related carbohydrates are catalysed by a complex enzymatic system: the phosphoenolpyruvate-depending phosphotransferastl system PTS§ (for reviews. see t Present address: Unit6 des Neisseria, Institut Pasteur. 2X. rur due Doctrur Roux 75724 Paris Cedes 1.5, France. $ Author t,o whom all correspondence should be addressed 5 Abbreviations used: PTS. phosphoenolpyruvatedependent phosphotransferase system; bp. base-pair(s): CAP. catabolite activator protein: RSA. bovine serum albumin: DTE. ditjhioerythritol.

Postma. 19X7; Meadow et al.. 1990). In Escherichia coli, two cytoplasmic phosphoproteins. common to almost all the PTS carbohydrates, cat’alyse the first two steps of this system. These proteins, HPr and enzytne I, encoded by the ptsH and ptsl genes, respectively, transfer the phosphoryl group of phosphoenolpyruvate to the sugar-specific enzymes, either enzymes II or enzyme II-enzyme TIT pairs. Transport of the PTS carbon sources occurs concowith mitantly its phosphorylation by the membrane-bound enzymes II. The ptaH. ptsl and err genes are clustered, forming the pts operon (De Reuse et aE., 1984) at 52 minutes on the E. coli chromosome. The err gene codes for the enzyme IIIGIC (EIIIGIC) which together with the constit,utes the glucoseenzyme IIG’” ( EIIG’“)

spwific

system. Located 3X0 bp upstream the qsh’ gem& coding for the. O-n~&ylserine sulphydrylase A was shown to const itutr a sepa,rate cistron (Byrne et al.. 1988). The nuclrotide sequence of a 4000 hp long DSA region including the cyst’. ptsJ1. ptsl and cry genes has been determined (SatTen et nl., 1987: De Keusc CYI I)anchin. 1988; Byrne rt nl., 1988: I&y & Danchin 198X). Analysis of the pts operon transcription revealed a complex organization. While a long polycist)ronic rnR,NA covt’rs the three genes. short transcripts specifically express the proximal gene l)tsf1 and the distal gene err of the operon. As muc+ as No,, of c~ expression is due to transcript.ion from promoters located within the ptsf open reading frame (De Reuse & Danchin. 1988). The t)ranscriptional regulation of the pt,taZ/-ptsf genes was investigat)ed and t,wo factors identified. bot)lr of which act) positively on the expression of t’he operon: extracellular glucose (one of t,he PTS aarbohydrates) and t’he int~racellular ciZM1’ concentration (De Reuse bz Danchin. 1988). U’hen complexed with it’s receptor protein, CAP (the catabolite activator protein, also known as CRP). cAMP activates transcription of many catabolic genes or operons (for a review. see llllmann B Danchin, 1983). Nost of the catabolic genes that are positiveIS (Iontrolled by the (‘AP-cL4MP complex are. in addtion, submit’ted to a second t)ype of transcriptional regulation. Although t’his regulation usualI) involves a repressor prot’ein. a small number of systems have been described that are subject to two positive controls. e.g. maltose or arabinose (for a review, see Adhya & Garges, 1990; Richet et al.. 1991). Regulation of the expression of the pts operon thus (Bonstitutes a further example of sucah a fiY~rrl

transport

ptsll

1

systwn.

A genetic analysis of the glucose-mediated regulation revealed that this carbon sour(‘e act,s on the expression of the pts operon like an environmental signal. through a signal transducation mechanism. Stimulation of the @s operon expression by glucose tleprntls on t,he I)hosphor-lation state of the gluc&osr-specific3 prrmease of the PTS. EITG’“. When exogenous glucose is taken up (sin this transport systtAm, ETTG” is tlrphosphorvlatrd and WIMqnentl)-. either directly or indirectlq-. (‘auses stimulation of the expression of the pts opcron (De Reuse B Danchin, 1991). We also showed that) the two control circuits acting on the ptx operon expression can occur independently of each other (l)e Reuse & Danchin. 1991). LZ’e tested whether glucose could stimulate the expression of the pts operon in a strain deficient in adenylate cyclase, the enzyme catalysing cAMP synthews. Since expression of the gene encoding is itself dependent on CAP-cAMP, we used a multicxopy plasmid carrying the ptsrG gene, which produced enough EIIG” (ptsG) and then regulation by glucose could be observed in the absence of (‘AP-cA&IP. We also observed that CAP-cB;CIP can activate the pts operon in a strain deficient in EJTG”, the key element’ of glucose-mediated regula-

t ion.

In iltlt~iti011.

t,hta tht’t

t II:\1

gr0wi.h

011

gilll.c)Sc’

a dramatic de(arease of the int ra(*~~llular (.A;CZP c,orlc~c~nt.ration (thereby causing (‘at;1 ttc)littl repression) strongly suggests t,hat tticb 1\vo rnc)th5 01’ regulation of the pts operon (hy (‘A I’ -c,AM I’ and I)> exogenous glucose) are mediated by cliff’erent trilnsc~r~i~~t,iOtl implying separate mechanisms. signals. However. some observations indicate that t hest~ ilJY' also homehow tww regulatory functions connected. The expression of the gent’ rnc*c)dinp ETTG” (ptsU) depends on (‘ALcAMP (Rephac~li & Saier. 1980). In addition. adenylate c~yclasr itself is activated by the phosphorylat,cd form of Et 1I”‘” (Saier dz Feucht. 1975). The decrease in c.AMl’ (~)rlcentration observed during glucose upt a,ke 1)~ the EIIG’“-15TTTG” transport system is a c*onsequenc*c~ of F:TTTGICdt:phosphorvlatioll, The identification of hot,h glu~sr~ and ( ‘A I’ cAMP as “regulators” of t)he expression of the ptsllptsl genes thus raised the question of ho\v these two regulations were brought about at the molec~ular level. The aim of the present study was to define the DXA regions involved in the posttive regulat,iori of the ptsH-ptsl genes expression. ~)rot-lucrs

2. Materials and Methods Growth media were either ric*h medium l,K or syrrth&ic* medium M63 supplemented with a carbon SOUIW (U.~O~o), thiamine (10 pg,lml). thta required amino acids (100 ~~/ml) and 0.1 ‘:,, (\v/v) (‘asamino acids (Ifiller. 1972). (aAMP was added at 1 rn~ final concaentration and ampkillin at .iO @ml. Strain TP2006: FM .cy/, IncASil, Acya. g/pX.‘XM~ (Roy & Dan~hin. 1982) and strain TP21 10: Y. q/l. nrgH1, ills/l, lacAXi4. rocrl. srl :: TnlO (De Rrusr rl ~1.. 1986) were usrd for the /5galacstosidasr assays. The fi;. co/i strains used for mRNA preparations wew (1) strain TP2006 grown in minimal MOPS medium suIq~lrmt~ntrd as detailed abow with glywrol as c-a&on source and 1 mM-cAMP whrn indivatrtl and (2) strain TI’2110 grown

in M63 minimal rnrdiuru suppl~mentetl aith gluconato as c,arbon source. synthesize [I-galactosidase to

hlac(‘onkey

l)latrs c,orltaining

as indicated almvtb

Screening

for the abilit,~

was l)rrf’ormed on 1 I’,, (w/v) lac+ose. on 5163

lactose S-gal

(04”,,) platw. or 011 I,B plates containing 10 pg of (:i-brotno--C-~hlt~ro-:l-intlolyl) per ml. St,rain BMH7118: A(lnc-prod K). thi. supE:, (F’, proAB, h-l’. ItccZAM1.i) (J *anisch-Perron d r/l.. 198.5) was used for infection with phage Ml3 derivatives and

I)reparation of single-stranded DNA. Strain RZ1032: Hf’r KLl6, thi-1. wlAl, ,syoTI, d&-l. umg-I. zbd-27% :: TnlU, .suplW mutagenesis.

(Krmkrl sw

rt al.. 1987) was used for sitr-directtd srvtion

((1).

bt~low.

frsgmrllt f’rotn plasmid -4 Pru,TT Kpl restric~tion pDTA3204 (De Reuse rt (xl.. 19X4). which included 30 bp of the 3.rntl of the cysh pt~w. thra intrrcistronicb region separating cysK from pt.sH and 172 bp of the ;i’-end of t,hr p&H gene. to the KpnT sit,r. w-as cloned into ?vI13tg131 (Kieny et ~1.. 1983) to give pDTA3259. Vnidirt&onal deletions in th(b cbloned b:. roli I)IVA fragment were grner-

Regulatory

'YsK

Sites of the E. coli pts Operon

a25

Ddel-1

DILIF, TI IEIKI E ,L,Q,Q * 1 GRTCTCTTCR CTGRGRRAGR RTTGCRRCRG ~%JGccRGc

161 TTGRTGCGCG RRRTTRRTCG

TTRCRGGRRR RGCCRRRGCT

TTGTTRARRR

TGCGTAAAAA

GRRTCGRTTT

TRJGRJTGG.TTTTCTT

A8

AGCRCCTTTT

TRGGTGCTTT

80

CCTTTRGCGG 240

GTGCT

-10 241 MTMTGTTT

GRRRCGTCRG CGGTCRRCRC +l

321

TCTGTTRRRR

H7

(PI)

401

RRGTTGGGGR RRTRCm

TGCGCTCTTC

GTGCGTCGCG 320

TTCCRCRRCR

CTRRRCCTRT

HI2

RCTGGCGCTR RCRRTRCRGG CTRRRGTCGR

IMI F

CCGCCRGCRR TGGRCTGTRT

,bT,

RCCGCCRGGC TRGRCTTTRG

ptsH 1 I T,A,PI

,Q,Q,E TCCRGCRRGR RGTTRCCRTT

N,G,Lt

400

HITIRIPI

AIAIQI RCCGCTCCGR RCGGTCTGCR CRCCCGCCCT GCTGCCCRGT 480

Ddel-2 481

FIVIKIE I TTGTRRRRGR RGC; 494

Figure 1. Sucleotide sequence of the regulatory region of the pts operon. The last IO codons of the cysh gene and the first 26 codons of the ptaH gene are also shown. The nucleotides corresponding to - 10 and - 35 regions of the PO and PI promoters are shown in bold italics. The start points of transcription from PO and PI promoters are indicat)ed with a box and an arrow as + 1 (PO) and + 1 (PI). respectively. The stop codon of the cysK gene and the start codon of the ptsH gene arc also boxed. The CAPa and CAPb sites are underlined. The boundary of the Al, A2. AR. A4. A5 deletions extending from within the cysK gene in direction of the ptsH gene are indicated by arrows. The mutations introduced by site-directed mutagenesis are also shown with the boundaries of the A6 and A8 deletions and the substituted bases at the CAPa and (‘Al’b sites. The nucleotide sequence complementary to oligonucleotide H7 and HI2 used in t,he primer extension experiments are underlined. Finally. the cleavage site of t’he DdcT-I. DdeI-2 and S’&I restri&ion enzymes are indicatJed.

ated by the c~yc~lonesystem (IBI) from the end proximal to t,he universal primer-binding site of tg131, which in pDTA3259 is near t,he 3’-end of the cysK gene. Only the Ml3 derivatives that had retained the ClaT restriction site loc>ated upstream from the -35 region of PI promoter were further examined hy detailed restriction mapping and finally. the nucleotide sequence of the complete insert was determined. Five deletions of increasing length. Al to A.5 (Fig. 1) were thus identified and used ft)r construction of operon fusions with the lactose opeton in vector pDTA3271. This vector ix a low copy number plasmid belonging to the incW incompatibility group and vvas constructed by insertion of a Hind111 restriction fragment containing the bla gene encoding fl-lactamase into plasmid pDIA3246 (De Rruse et al.. 1986). It was verified that, t,hr copy numher of these vectors was not, modified during growth on glucose as compared to glucose-6-P nor when rAMI’ was present irl the growth medium (l)e Reuse et al.. 1986). The PvuTI-DraI restriction fragments of the Ml3 derivatives carrying the Al to A5 deletions as well as the corresponding wild-type fragment of pDIA3259 were introduced int,o the SmoI site of plasmid pDIA3271 upstream from the Zac operon. The resulting fusion plasmids were pDIA3274, pD1.43278. pDIA3276. pDTA3277. pDIA3279 and pDIA3275 The Ml3 derivative. pDTA3304, which carried the smallest deletion Al (Fig. I). was used to produce the uracil-containing templates necessary in the site-directed mutagenesis experiments (St? section (c). below-).

Restriction fragments (PvuIII1~ruI) of the pDTA3304 derivatives containing site-directed mutations were introduced into vector pDIA3271 following the same procedure as described for the deletions. The DSA inserts of the fusion plasmids carrying these mutations namely pDIA3291. pDIA3282. pDIA3283. pDTA3302. pDIA3296 and pDIA3303 all have the satnr upstream and down stream boundaries. which are identical to those of plasmid pDIA3278. The molecular cloning techniques were as described by Sambrook et nl. (19X9).

The mutations were produced with synthetic oligonurleotides following the procedure described by Kunkel et al. (1987). In order to generate uracil-containing templates. M13tjg131 derivative pDIA3304 csarrying the ptsH regulatory region was transformed int,o strain RZ 1032. The 6 oligonucleotides used were approximately 36 nucleotides long and were crntrrd on the. position of the mutation. After each sit~e-direct,ed mutagenesis. t,he absence of any other mutation was controlled by determination of the entire sequence of the mutated fragment cloned in phage Ml3tg131 with the universal primer and with a I8 nucleotides-long oligonurleotide hybridizing to a DKA region located in the middle of the fragment. DXA sequencing was performed by the dideoxynucleotide chain-termination method of Sanger et al. (1977) with la-%Jthio-dATP.

I II ACG

3

2 T

AC

G

T

cb

b)

Figure 2. (a) Primer extension mapping wit’h 5’.end-labelled oligonucleotide H I2 on tot)al RN.4 rxtracts 01‘ strain TP2110 grown with gluconate (lane 3). Location of the transcription start points was deduced from the lengths of thr c.l>SA bands a and b. Their lengths were obt,ained by comparison with t,he sequencing reaction products of pl)TA3272. a M 13tg131 derivative carrying a (‘la1 -DmT restrirt’ion fragment including part of the ptsH gene and its regulatory region (originating from pDIA3204. I)e R,euse rf (I/.. 1984). The sequence reactions on single-stranded I)SA from pI)IA3272 were performed with the same 5’.end-labelled oligonucleotide H12 (A, (‘. (:, T reactions no. I) and with unlabrlled oligonucleotide H12 using [a-32S]thio-dATP (A, (‘, (:, T reactions no. 2). (1)) “Short” primer extension mapping on total RKA ext,racts of strain TPZOOB grown wit)h glycerol (lane K), with glycerol plus 1 m~~-(~A>lP (lane A). Lantl (’ is a caont,rol experiment without RNA. The primer was 5’.end-labelled oligonucleot,ide Hi and the primer extension reactions were performed with ddGTP instead of tlGT1’. Band a (*orresponds to a 33 nuclrotides-long (bl)r\‘A, which is reverse (*l)?jA. transcribed from the mRNAs expressed from the PO promoter. Band h corresponds to a 20 tlncleotidrs-lon# which is reverse transcribed from mR;1;As rxprrssrd from the 1’1 promoter.

(d) Primer

extension

exprimfds

ItKA extractions were performed as described b? Hagen & Young (1978). Primer extensions with reverse transcriptase were as described by Pikielny & Rosbash (1985). A 20 nucleot’ides-long oligonucleotide named H 12 (Fig. 1) 5’ TACAGTCCATTGCTGGCGGG 3’5.labellrd with [y-“P]ATP was used as a primer in the experiments with mRPSA extracted from t,he cycr’ strain TP2110

(Fig. 2(a)). This same labellrd H Id primer was usrcl for the preparation of the sequencing reaction product,s (Fig. 2(a)) on single-stranded templates prepared from pDIA3272, a M13tg131 derivative carrying a (‘la1 D)rrcI fragment of the pts operon originating from plasmid pDTA3204 (De Reuse et al.. 1984). This Dru’A fragment includes part of the ptsH gene and t,he upstream regulatory region. Unlabelled H12 primer was also used to synthesize the sequencing reaction products of pDIA3272

Regulatory

Sites of the E. coli pts Opvron

in the presence of [cx-35S]thio-dATP (Fig. 2(a)). An 18 nuclrot,ides-long oligonucleotide named H7 (Fig. 1) 5’ C(‘G(ITCACGTTTCGTACG 3’ 5’.labelled with with [y-32P]ATP was used as a primer in the experiments mRXL4 extracted from the Acya strain TP2006 (Fig. 2(b)). These primer extension experiments were performed with ddGTP. instead of dGTP. resulting in “short“ transcription as described by Abovich &, Rosbash (1984).

presence of 0.2 m-w-r4MP ,I at room t)emperature (Fig. 5(a)). DNA fragment,s were incubated with 100 nM-Rh’A-polymerase for 3 min. 10 min. or 30 min at 37’C with 100 nM-CAP and 0.2 mM-CAMP or without CAP. in the same Tris-Mg-glutamate buffer containing ti.i mg BSA/ml (Fig. 5(b)). After complex formation. 5 ~1 of a DNase I solution (0.4 pg/rnl in 10 rnM-Tris-HCI (pH 8.0). 10 rnM-MgCl,, 10 mM-Ca(!l,. 125 mM-KCl. 0.1 mM-DTE) were added and incubated at 37°C’ for 25 s. Thr reaction was stopped by the addition of 200 ~1 of a solution containing 0.4 M-Sa acetate. 2.5 m&l-EDTB. 50 pg tRXA/ml. 5 pg USA/ml and put on ice. The samples were extracted wit,h phenol and precipitated with rt,hanol before analysis on a To, (w~;v) denaturing polyarr?lamide gel. Protected bands were identified by (hornparlson with t,he migration of thr same fragment treat’ed for A f(: sequencing react,ions (Maxam & Gilbert,. 1977).

Experiments of gel ret,ardation were performed as pr(Jviously described (Kolb et al.. 1983) with slight modifications. The (‘AP protein was purified from overproducing E. co/i strains by affinity chromatography on (#AMP-agarosr (Ghosaini et al.. 1988). Binding of CAP cAMP t,o the labelled Dh’A fragments was performed in Heprs-h’a glutamat’e buffer (25 rnN-Hepes. 50 rnM-Xa glutamate. pH X.0) medium containing 0.5 mg BSA/ml. .4fter dilution in the sarnf’ buffer. the CAP prot,ein was mixed, a,t room t’emperature, with the labelled DPI’A fragment in the presence of cAMP (0.2 mM). The loading buffer (1.5 ~1) composed of t,he same buffer with bromophenol blue. xylrnr cyanol and 50:/, (w/v) surrose was mixed with the samples (8 ~1). These samples were migrat,ed rapidly (1 h) on small polyacrylamide gels (7.5”,,) in 50 mM-TBE buffer, with 0.2 mu-rAMP in the top restirvoir. (f’) I~Smr

1 ,foolprinAng

627

(R) /CGalactosidasr

as.says

l(-Galartosidase was assayed by t#he method of Pardee rf 01. (1959). 1 IT was defined as the amount of enzyme that converted 1 nmol of substrate per min at 28°C. The values indicated in Tables 1 and 2 correspond to b-galacltosidasr rates of synthesis AZ/AB. Each rate of synthesis was caalculated from p-galactosidase assays on approximately 7 samples. These samples were withdrawn during rxponrntial growth at 37°C in synthetic medium M63 supplemented as indicated in the first paragraph of Materials and Methods and in Tables 1 and 2. Each experiment was reproduced at least 2 tirnes. LVe calculated the 95’)+, caonfidencr limits and indicate them for rach AZ/AB value in bracket,s on t,he Tables. These values were (Lalculated as 2 0 values where cr is the standard dt>viation. p-Galactosidase rates of synthesis are expressed in units per milligram (dry weight) of bacteria. deduced from the absorbance at 600 nm considering that 1 mg (tlr,v weight) per ml is estimated t’o be 3.7 absorbance unit,s at 600 nrn

experimrnt,u

Plasmidx pI)L43297. a pUC18 derivative, carries a .550 bp-long insert originating from plasmid pDIA3204. region with the which includes the pts operon regulatory PO and PI promoters as wrall as the CAPa and CAPb sites. A 280 bp-long D&I-l to &oRI restriction fragment was excised from the plasmid and labelled at t)he EcoRT site. which is present at the end of the pW18 polylinker. Binding of (‘Al’-cAMP to the labelled DXA was performed in Tris-Mg-glutamate buffer (40 m&f-Tris-HCl (pH 8.0). IO mM-MgCI,. 100 mM-K glutamate (pH 8.0)) c.ontaining 0.5 mg BSA/ml. CAP protein was dilut’ed into the same buffer and rnixetl with the labellrd DSrl in the

(h) h?eagents and ~vqpn~~s T4-DN\;rz ligase. T-1-DNA kinasr. T4-1)X.4 polymerase, R;\V%-reverse transcriptase. l)SA polymerasr I

Table 1 EJfect of CAMP

on fl-galactosidasP

vyrathpsis

of pt,sH-IacZ

fmiom

Medium F’lasmid

Krlevarlt~ genotype

(:Iyrerol

pDIA32i4

\Vild-type A1 deletion A:! deletion A3 deletion A4 deletion A5 deletion 6 bp substitution 1 bp subst,itution A6 d&&on AX deletion 3 bp substitution 4 bp substitution

3400 4400 3500 3300 3100 3500 3900 3500 3400 1800 i650 6300

pDIX3278 pDlA3276

pDIA3277 pDIA3279

pDIA32iT, pDIA3291 pDIA3282 pDIA3283 pDIA330% pDIA3296 pD1A3303

at (JAPa at (‘APa

at CAPb at CAPb

(+ (f (+ (+ (f (f (f (f (* (* (* (*

(;Iycerol+ 400) X.3) MO) 300) “50) 300) 600) 500) 650) “00) S50) 500)

cAJlF’

I 1,400 ( * 700) I2.400 ( * 11001 4600 ( * 200) 3800 ( k 200) 3iO0 ( + 150) 4000 ( * 400) 4300 ( & 460) 4000 ( * 450) 4300 ( * 500) 1().,500 ( + 600) 1X.300 ( + 4000) 13.350 (*3000)

(:lyverol + CAM t’! plywolt 3 3 1 1 1 1 I I 6 2.5 2

l7ffec~t of CAMP on fl-galactosidase rate of synthesis of strain TPPOO6 varrying ptsH-LacZ operon f’usions expressed either from a wild type regulator? region or from mutated regulatory regions as indicated in the Table. p-(:alactosidase rates of synthesis (AZ/AR values) are expressed m I’ardee units per mg (dry weight) of bacteria (Pardee rt al , 1959). The number in brackets corresponds to the 95% confidence limit of each AZ/AR value. CAMP was added in the medium at 1 mM final concentration. Strain TP4OO6 is able to prow on glycerol because of the gl#306 mutation, which renders growth on glycerol independent of cAMP. t K.atio of b-galactosidase rate of synthesis in a medium containing glycerol plus cAMP to the p-galactosidase rate of synthesis in a medium containing glycerol without cAMP.

GATTTTATGVATTT’GGTTCAVATTCTTCCTTT AANTGTGANN~INNNTCANAT

CAPb CAP consensus

Figure 3. (‘omparison of the (:AE’a and ( ‘.-\I’~J sitrs with acwjrding to Berg & van Hippel (1988). I&~rs identical arrowheads indicate thr positions of bands hyperaenxitivr~ c,lravag.rr at positions - 157.5 and - 167.5 in t)hr (‘,Al’a sitr

the c*onsensus of the (‘i\I’ ?AICII’ binding s&r, ((‘i\I’ ~Y~IIH~~IISIIS) with thr (‘AP c~,nsensus arr intlic.atcbtl irr I)c)ltl ita1it.s. Thv to to I)h’ase I Lvithin t)hr (‘r\E’-l)intlinC; 1sites. bvhic.tl c~ol~rc~sl~oml and cleavage at positions - Z!t.T,and --B!+s it1 tht, (‘AI’I) sit(,

“Klrnon~“ fragmtwt. alkaline phosphatase and restriction rnzymrs wrrr used as rrcornmendrd hy the supplirrs T’harmaria. Amersham and (RorhriIlgrr-~~annhrinl. I1pplig+ne). Agarose and acrylamidr warp from KK I,. wmpic.illin itnd o-nitro~~h~:n~i-~-~~-~ala(~to~J~r~~Ilosidrwere f’rom Sigma and Rorhringrr-,llannht~im. rcspc~c+irc~l>~. arrtl other cxhemicals uvry f’rorn Merck. [a-“‘Sjt’hio-d;~TI’. [;J-~*I’]ATI’. lr-32P]dATP were ohtainrd from ,4mrrsham (;\mrrshanr. I’.K.).

Fig. 1) were produced w drwribrd ill Materials anal Methods. DNA fragments wntaining thrw dc~letions ware ent>irely sequenced and introdncwl int.0 a lo\\ copy number vector (1)~ Kcusc rt cl/.. 1986) to produce @s/l-Lac% operon fusions. The follo\ving plasmids \vere thus generated. pl)IA327X (Al). pDIA3276 (Aa). ~~l)TA32i’i (A3), pl)IA3279 (Ah). pTITA3275 (AS). Vsing the same cloning prowdurr> plasmid ~~l)TA3274. carrying a fusion with t hv cwrresponding wild-tppr 11X.4 fragment. was also construct.rd. These plasmids containing ptsff-/ac% operon fusions were introduced into a Ac~(I (TPB006) strain and expression of t hr, fitsions. during growth in the prewnw of glycerol as c:arlJon sourcae with or wit)hout I nl\r-cAMP. was I~~~~;~s~IIYv~. As shown in Table I, only tlw plasmid will1 t hv shortest deletion Al plasmid pI)IA3278 (Pig. 1). was still stimulated by (‘.4~‘--cAMP like t hr fusiorl carrying thr wild-type region pDIA31i-t. Pl;~smitls carrying t)he ot hrr four drlet,ions A%. A3. A4, A5 had complet~ely lost regulation by (‘,4P(~AMP (‘Table 1 ). ;\s sho\vn in Figure I 1 tllrl A2 delrtio~l partialI) rvnioves a I)KA seyuericsct showing similarity with thr wnsensus srquenw of t hr. (‘.4P cL4>I 1’ binding site (consensus (‘AT’-binding site. dt, (‘rorr~l~rugghr rt cd., 1984: Krrg $ van Hippel. 19X8).

3. Results

Our origina~l S,-mapping experiment~s designed to identify the 5’.end of the transcript expressing t)hr ptsff gene (1)~ Reuse ut nl.. 19%) were prrformed with a preparation of mRN;\ ext*racted from a Acyc~ st.rain and locat)ed the Pl promot~er. Since thrn. WY have shown t,hat transcription of the ptsff-ptsl genes is positively controlled by (‘AP+AMP (De R,eusr & I)anc~hin. 1988). It was thus important to analyw with a pwparation of mR8NA the ptsfl transcripts rstrwtetl from i\ c!/ui strain (strain TWIlO). ‘1 primrr rstension experiment with rwww2 traw scviptase was performed with a PO nnc~lrotitirs-loIIK oligonucleotide H 11 (Fig. 1 ) 5’.end labrll~d. wmpkmrnt.ary to a l)NA region t~xtending from position + 27 to position + 46. Positions are clrfined relati\-c, to thrl + 1 of thr transcript ~sprwwd from tIw 1’1 promotrr~ (Fig. 1). A sec~~nd Send (Fig. 2(a)) (+orrv spending to position ~ 100. i.rh. lovatrd 100 l)p upstream from the 5’.end of the transc.ript of 1’1 Iwomotrr was identified (SW Fig. 1). The 5’.rntl of this swond transwipt is prwrdr~d Kay TTGA’I’T 17 ~~J~TATTTA seq~~enc~rs showing similarit?w-it h t hv (wnsensus - 35 and - 10 regions of promoters (Hark); cY- Iteynolds. 19X7). Howrlvcr. t hr -X5 region IS signitivanfly tnore similar to t hr c’onsensuh than thr - 10 region. This promoter \v:ts named PO.

The I)NA regions involved in the transc~riptional rrgulat,ion of the ptsff grnr were most prohabl) contained in the 383 hp long region separating thtl stop codon of the cysK gene from the start codon of thr function the ptsH gene (Fig. 1). We investigated of this DNA region with a series of defined deletions extending from within thr qsK gene in the dire~ rtyiorr deletions suggested that the (‘APa sitr was involvc~d in thv (‘AP-c*AM P-mediated regulation. To c*onfirm this idea and investigat)r the possible role of t hv (‘A Ph c~onstructetl hi sitcsite. different mutations into t hr directed mutagenesis wt‘rc introduwd C’APa and (3Pb sites of’ the bion plasmid pDTA3278 (which carries an int’ac+t rvgulator~~ region).

Regulatory

Sites

of the E. coli pts Operon

The first mut,ation, cloned in plasmid pDIA3291. was a 6 bp substitution TGTGGC -+ CCCCAT in the left half of the CAPa site (Fig. 1). The second mutation. cloned in plasmid pDIA3282, was a single base-pair substitution TTCAAA + TTC:AAA in the right half of (‘APa (Fig. 1). Roth these mutat,ions reklted in loss of activation hy CAP~cAMT’ (Table 1). These results show that modifications of the (‘APa site prevents (‘AP-CAMP-mediated reyulation of the pt.~lI gene expression. Two mutations were introduced into plasmid pDlA327X in order t’o investigate t,he potential role of the (‘AT’b site in thf, CAP-cAMP regulation of the ruts operon. The first, mutat,ion carried by plasmitl pDTA3296 was a 3 bp substitution in the left half of the C4Ph s&e: ATGATT -+ AACACT -and the second. carried by plasmid pDIA3303, was a -i bp substitution in the right half of t,he CAPb sit,e: (XlTW‘TT (Fig. 1). Substitutions were chosen in order to conserve a --35 region compatible with - 35 promoter region (Harley & the consensus Rr~nolds. 1987). Expression of the fusions carried by plasmids pDIA3296 and pDlA3303 was measured during growth on glycerol with or without cAMP (Table I). \Ye observed that CA&cAMP still stimulated expression of the mutated fusions. Tt seemed, however. that. the mutations introduced in the (‘APh-PI region itnproved t,he I’1 promoter eficienc:~ sincae thr expression of the corresponding fusions. during growth on glycerol, was enhanced as compared t,o the expression of the wild-type fusion of ptasmid p13IA3278. (d) Kelatirx con,tribution. of the PO and 1’1 promokrs i,n thr r.rprrs,sion of the pts operon and in the CAP1*.-1MI-‘-medintrd regulation

It is generally believed that positive regulation h? (‘AI’~cAMP ih t.tte consequence of activation of transcript.ion initiation. This activation necessitates inkraction bc+wec,tt. on the one hand. t’he CXPc~AnlP c~omples bound to its recognition site, the CAP site, and on t,he other hand RSA polymerasr at t,he promoter. lrr order to identify t,he promot,er whose transc.ription was st.imulatetl by CAP-cAMF’ binding at t,he (‘AT’s sit?. inactivation of the PO promot’er was performed by site-directed mutagenesis. A 5 bp deletion (A6) removing the putative - IO region of the PO promoter (Fig. 1) was int’roduced on the fusion plasmitl pl)TA3278. The resulting plasmid was named pDI.43283. As shown in Table 1, the fusion caarrird by ptasmid pDIA3283 was no longer regulat,ed by (‘AT’--CAME’. This showed that, the PO promoter is thr t,argrt for the regulation mediated by the (‘APa site. Expression of the ptsfl gene is dependent on two promoters PO and Pl. To gain information on the resprctivc cont.ribut’ion of each of these, in conditions where VAMP is present or absent, a deletion of 1’1 promot)er was introduced in plasmid pDIA3278 by site-direeM mutagenesis. The resulting plasmid. pl)TX3302. carried a 38 bp deletion (AS) including

629

the -35. - 10, + 1 regions of I’1 promoter as well as the CAPb site (Fig. 1) As can be seen in Table 1. expression of the operon fusion carried by plasmid pI)IA3302. which is now exclusiveI?- dependent on the T’O promoter, is stimulated sisfold by (:A& c~XMT’. Xote that. in the absence of (aAMP. the expression level of the fusion of plasmid pDTA3302. which is only dependent on PO. is lower than that of the fusion of plasmid pDIA3283, which is exclusively dependent on Pl promoter (Tahle 1). (e) PO regulation by CA I’+.4 .W I’ dtr conditions whew both thr PO and PI promotrrs carp nctil’p

To eraluat,e the contribution of each promoter in conditions where both PO and PI promoters were present and active, another approach was followed. Experiments of primer ext’ension using the “short”transc*ript.ion trchniqur (Xbovich Kr Koshash. 1984) have been shown to allow a more quantitative evaluation of t ranscrip&. Primer t>st.rnsion experirnents with a 5’.end-labelled 1X nllcteotides-lc,ng (H7) oligonucleotide corresponding to a DNA region extending from a position + 3 to + 20 (Fig. 1) were performed in the presence of dtl(:TT’ inskad of d(ZTT’. Tao mRlr;A preparations were used. one was rxtra~~ted from the Acya st.ra.in. TP2006. grown on a medium containing glycerol as c.arbon source (Fig:. L>(b). lane R) and the ot,her. from the same Acya strain grown in a medium containing #I!-cerol plus I tnM-(~A?vlT (Fig. 2(b). lane .4). Two cI)SA bands (bands a and b) of 20 nucteotides and 33 nucleotides w?l;A (band a) is producrd by reverse transcariptase transcription. in the presence of tl(l(:TP. on a transcript originating from the I’0 promoter. Reverse t.ranscriptase stops at the first (~’ Iocaatrd upstream from oliyonuclectt isle Hi in the c*orrespottdittg rnRX,A of PO and thus ~)rodu~s a short transcript of 33 nucleotidrs. Thrl experitnents c~orrespondinp to Iambs r\ and 13 \vt’re perforrnetl with equal amounts of total tnRSA. The intet1sit.v of band b cannot be easily estimated since it.s pokition is too close to that of t.he Hi pritnrr. which is only two nucleotides shorter and which is very strongly labelled. Hou-evrr. it is clearly visible (Fig. 2(b)) t,hat the amount of the 33 nuc*le,.)tides-tong &DNB (hand a) ( site-tlirwtrd mutagenesis. \Ve ot~srrved that these mutations did not. alter the (‘AI’~c..~~~T’-tir~)endent stimulation of pts&ZacZ fusion exprrssion. How ever. some addit ional observations suggest that the (‘AI’b site might play a regulatory role in thr tranwription ot’ the pts operon. Foot printing experiments conduc*trtl in the simnlilrltl

f iLnwus presence of’ RNA polymerasc iI.nd (‘A I’c~j\MT-‘. exhibit a prot,ection pattern in t)hr (‘r\T’h-J’I modified when which is considerahl~ region. c,ompared to the protection profile with K’NA J)olymerase atone ur wit,h (‘AT’-VAMP alonf~. The J)rotec+ion is stronger, more extensive and t hc kinetics of RKA polymerase recognition is signif? cantly ac*celerat,ed. A precise comparison of the J>?;ase I J)rotection profile. mainl!, 1.b hyper~ sensitive hands, of this DNA fragment in the prrsence of RSA-potymrrase with or without (‘AT c~;\SIP revealed that. when the (‘AI’--c*AhlP c~mplrx was hound at the CAT% site. the RSA polynerase binding at this I)NA region was modified The npst~ream boundary of the prolec~trd region is displaced from position - 4 1..‘i t)o position - 63.5 and the different hypersensit.ive hands are located 6 hp downstream from their position in the absence of (‘AP-cAMP (Fig. 5(b)). This type of modification of the I)Nasr T protection profile is strikingly analogous t.o that ohserved at t,he galsctose operon in the presewr~ of RSA polymerase and (Spassky et al.. 1984). Tn that case. c~learly demonstrated t)hst binding of (lisplaces the transcription start point c~orresponding promoters yalP:! arid identified (Irani rt nl.. 1989). Further are needed to test whether (‘AP-cAM 1’ such a switch at the PI promoter region of the ptn operon. in the presence of R?;A polymcrasc and C~‘XP-(.ASlI’, the protect.ion pattern of the pts regulator> region revealed a series of four hypersensitive bands separated by IO or 1P hp. These hypersensitive hands. spaced by approximately one DNA4 helix turn. probably c*orrespond t)o the wrapping of this I)NA region around the RNA polymerase. The c.entres of symmetry of (IAPa and C’APh urfx srpamtetl 1,~ 128 hp. which corresponds to approximatjely I2 turns of’ the I>K;A helix. These t,wo (‘AP sites are in phase with each other and wit.h t.he series of hypersensitive hands seen on the I)T\‘ase 1 foot Jjrint (Figs 1 and .5(h)). It is known. in addition. that hindinp of (‘AT’ induces a strong Ir~etd at its recogntion site (Gartenberg & (“rothers. 19X8). Therefore. of of (‘AP---VAM 1’ and t,1w preswice in RNA polymerase. the DNA fragment carrying the (‘A\T’a-PO and (‘XPb-PI sites should present a \-rrJ’ particular conformation with strong induced beds of its helix axis. Interestingly, n-e notta that’ the 1)NA fragment used in the footprinting experiments already present,s an intrinsic curvature. Indeed. its migration in a non-denaturing polyarrylarnide gel is retarded. the relative length of that fragment being I.18 (data, not shown). Local bending of a, I)SA regulatory region has already been shown, in some cases. to be associated with changes in t.ranscription efficiency (Travers. 1990). The result,s presented here indicate that the regallation of t,he pts operon expression by exogenous glucose is dependent on the DK.4 region containing the (‘AT% site. \Ye do not know whether the target of the glucose-mediat’ed regulation is the CAPa site itself or if it. corresponds to a regulatory site over-

lapping t.he (‘APa site. Further clxJ)erinrtants area thft prot,ein(s) rrredint~irly t Iii,< needed to identify regula.t.ion and such a stutl!, should sul+quvntl? allow prt)tGc localizat,ion of the sites irrvolvfvl in 1tits gtuc,ose-rrlediatet1 rrgulat.ion. (lo-exist,encr of the two posit,ive regulations of the pts operon transcsriJ)tion (by (‘&AT’--cX;\ilP and during growth on glucose) c*ould at first sight he conhidered that as cont.radictory. Indeed. it is well kr1o~~11 growth on glucose leads to a large dec*rrase in c,.AMl’ sw 1711rnati~~ 8 concentration (for a rf+rw. 1)anchin. 1983). We propose that these two positivt regulations might in fat+ IW a way of maintzaining during growth on activation of the central pts genes various PTS carboh\-dratcs including glu~sr anrl PTS c,arhon sourc& that do not (‘ause st rang catabotitrb repression. suc*lr as mannose. f’ruc.tosts or glucosaminc~. Jt swms likely that, these two regulatory rnecbnisms are designed to be alternat ivv ant1 probably never’ occur simuJt)arieousty in natural growth c*ondit.ions. The results presrnt,e:tl ht?rch iridrating that the two regulations involve o\-rrlapping and ma-he identical I)SA rryions itht~ (‘Al% in agrremrnt with such alterregion) are perfectly nat,ivr mf34ianisms. LZ’r thank .J. Plumhridgr for Hal, kind and c~r.itic.alhrlp in thr ~weparation of this manuscript. I’. tlr (‘r6c.y. S. Iivy anal Ci.-I). Zeng for hrlpful discussions and H f(uc, for his c.onstant intrwst. \\‘tx also thank PC\;. Sassoon and I’ Roux for preI)aratiou of’ (‘RI’ and RNA polymrrase. Financi;rl support (*ame front thr (‘entrr tlr la Kv(*hvrc*hr Scirntifiqur (I’ A. I I?!?).

References Abovich. S. & K&ash. 31. (198-L). The two genes f’o~ yeast ribosamal protein 51 complement and contribute to the ribosomrs. Viol. (‘~11. Bid. 4. 1871 187!). Adhya. S. & Garges, S, (1990). Positive control. J. Rid. f’h.rn/. 265. 10797. 10800. A4dhjx. S. & Got,tesrnan, 11. (1982). Promoter owlusion: transcription through a promot,rr may inhibit its activity. (‘rll, 29. 939~-944. Berg. 0. (:. K: van Hippel. T’. H. (198X). Selecation ot’ I)SA binding sites by rrgulat,org proteins. II. Thr hiding spec4ivity of the cyclic AMP receptor protein to rrc*ognition sites. ./. :Vol. Rio2. 200, 709 763. Hyrnr. C’. K.. Mont-w. I~. S.. Ll’arcl. K. A. & Kretlid~. K. hl. (1988). 11X.4 srquvnws of the cyst’ wgions of Suln~~nrlla

typhimurium

and

Escherichia roli Nnrtvriol.

linkage of the cyst’ regions t,o ptsH. ./. 3150 3157.

and

170.

I)r Rruw, H. OzIIanchin, A. (1991). I’ositivr regulation of thr pts operon of 1’3.roli: genetic rvidencar for a signal transtluc%ion mwhanism. .J. Rackrid. 173. 727 733. De RPUW, H., Huttncr. E. & IJanchin, ;I. (1984). Anaiysis of the ptsH-ptal-err region in kkcherichin cdi K 12: rviclrnw for the rsist,rnw of B single tranwriptional unit. (kn,p. 32. X--CO. De Reuse. H.. Roy. A. & 1)anchin. A. (1985). Analysis of t,he ptsH-ptsf-rrr region of Escherichia coli: nucleot,idr sryuenc~ of thr p&H penr. Gmr. 35. 199~-207

Regulatory

Sites of the E. coli pt’s Operon

De Reuse, H.. Touati. E., Glaser. P. & Danchin, A. (1986). Low copy number plasmid vectors for gene cloning and for monitoring gene expression. FEMS Microbial. Lettrrs, 37, 193-197. de (‘rombrugghe, B.. Busby. S. & But, H. (1984). Cyclic AMP receptor protein: role in transcription activation. S&WY, 224. 831.-838. Ebright,. R. H ._ (‘ossart, I’.. Gicqurl-Sanzry, B. & Beckwith. .J. (1984). Mutations that alter the DPI’A sequence specificity of the cataholite gene act)ivator protein of E. wli. Xature (London). 311. 232-235. (:artrnbrrg. M. R. & Crot,hers. D. M. (1988). DXA sequence determinants of CAP-induced bending and pro&in binding affinity Sature (London). 333. 824~ W!). (:ast,on. K.. Bell. A.. Kolb, A.. But. H. & Busby, S. (I 990). Stringent spacing requirements for t’ranscriptional activation by CRP. Cell, 62. 733-743. (ihosaini. L. R., J,.

265.

A.

B

6993-2996.

Danchin, A. (198%). coli K12: organization

Ewherichin Mol. em.

The r’l/u and grnr

locus of J)roducts

188. 46.547 1

Genet.

Saffen. 1). FV.. Prrsper, K. A.. Doering. T. 1,. & Roseman, S. (1987). Sugar transport by the bacterial phosphotransferase sj,strm. Molecular cloning and structural analysis of‘ the Esfherichia coli JksH. ptsl and err germs. .J. Riol. (‘hem. 262. 6241 m~62XI. Sairr. $2. H.. ,Jr (1989). Protein phosphorylation and allosteric c.ontrol of inducer exclusion and catabolite rrJ!rrssion by the bacterial J)hosl)hoenolJ)~ru~~ate: sugar phosphotransferase spst,rm. Nicrobiol. Rev. 53. IO!)

Sairr.

1”O.

>I. H.. *Jr B Feucht, K. I’. (1975). (‘oordinate regulation of adenylate cyclase and carbohydrate Jjermrases by the phosphoenolpyruvat8r: sugar phostyphimuriam. photransferase system in Salmonrlln .J. Hiol.

Sambrclok. Molec

Ch,em.

250.

*J.. Fritsch. alar

7078-7080.

E. F. & Maniatis. T. (1989). A Labomtory Nan ual, Cold Laboratory Press. (‘old Spring

(,‘lon ing:

Spring Harbor Harbor. NY. Sanger. F.. Xicklen. srquencsing with

S. & Coulson. A. R. (1977). DXA chain-terminating inhibitors. Pror. 74, Fi463Si467. .l’ot. 3cad. Sci., U.8.A Spassky. A.. Busby, 8. & But, H. (1984). On the action of the ryclic AMP-cyclic AMP recept,or prot,ein complex coli lactose and galartose promoter at the Escherichia regions. E&fHO J. 3. 43-N. Travers. A. A. (1990). Why bend DNA! (‘ell, 60. 177-180. Vllmann. A. & Danchin, A. (1983). Role of cyclic AMP in balteria. .1&an. Cyclic ~Vucl. RPS. 15, I67 171. Yanish-Perron. (‘.. Vieira . .J. & Messing. .J. (1985). Improved Ml3 phage cloning vectors and host strains: nucleotide sequence of Ml3mplX and pUCl9 vcl+ors. Gene. 33. 103. 119. Cottesnw~