Microbial Pathogenesis 81 (2015) 16e21
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Short communication
Potential roles of laccases on virulence of Heterobasidion annosum s.s. try a, Jaeyoung Choi a, c, Yong-Hwan Lee a, b, c, * Hsiao-Che Kuo a, Nicolas De a
Department of Forest Sciences, University of Helsinki, Helsinki, Finland Department of Agricultural Sciences, University of Helsinki, Helsinki, Finland c Department of Agricultural Biotechnology, Centers for Fungal Pathogenesis and Fungal Genetic Resources, Seoul National University, Seoul, South Korea b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 November 2014 Received in revised form 5 March 2015 Accepted 6 March 2015 Available online 7 March 2015
Laccases, multi-copper-containing proteins, can catalyze the oxidation of phenolic substrates and have diverse functions such as a virulence factor in fungi. However, limited information can be found on the role of laccases in the interaction of Heterobasidion annosum s.s. to its host plant. Due to genome availability of the close-related species Heterobasidion irregulare, which contains 18 predicted laccaseencoding genes, phylogenetic analysis and gene expression profiling were performed. Eighteen laccase genes could be classified into 4 groups based on protein domains and phylogenetic analysis. However, there is no clear indication between phylogeny and domain compositions in laccases, and lifestyles of fungal species. The results of qRT-PCR showed that the expression of 8 laccase genes was highly upregulated in Scots pine seedlings at 1 wpi. These data suggested that they might be involved in early stage of host infection. In addition, up-regulation of gene expression under glucose condition as a sole carbon source suggests that those laccases are not under carbon catabolite repression. Higher activities of laccase were observed in culture media containing cellulose, sucrose, or glucose compared to that of cellobiose as a sole carbon source. The highest mortality of Scots pine seedlings was observed when infected by H. annosum s.s. on extra carbon source as glucose. This was supported by the facts that glucose plays significant roles on up-regulation of laccase genes in planta and higher activity of laccase in H. annosum s.s.. Taking all together, laccases in H. annosum s.s. have diverse functions and a group of laccases may play a role during interactions with Scots pine seedlings. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Laccase Multi-copper oxidase Heterobasidion Pathogenicity
1. Introduction Laccases (EC 1.10.3.2), multi-copper-containing proteins, are enzymes ubiquitously found in plants, animals, fungi, and bacteria [1,2]. They catalyze the oxidation of phenolic substrates (e.g. lignin) [3] and similar molecules with concomitant reduction of molecular oxygen to water [4]. Laccases have been reported to have diverse functions in fungal species. These include bioconvertion of lignin [5], protection from toxic phytoalexins [6], and virulence factors to human and plants [7]. Fungal laccases have been paying more attention on its peroxidase activity, dye decolorization [8] and polyaromatic hydrocarbon degradation [9], and biotechnological application [10]. Laccase production in fungi was affected by generally different sources of carbon, and by the ratio of carbon and
* Corresponding author. Department of Agricultural Biotechnology, Center for Fungal Genetic Resources, Seoul National University, Seoul 151-921, South Korea. E-mail address: [email protected] (Y.-H. Lee). http://dx.doi.org/10.1016/j.micpath.2015.03.004 0882-4010/© 2015 Elsevier Ltd. All rights reserved.
nitrogen (C/N). The excessive concentrations of sucrose or glucose reduced the laccase production [11,12]. However, in the cellulose containing medium, the laccase was produced more efficiently [13]. Several reports support the hypothesis that members of the laccase families may play different roles during the life cycle of the organism [14e17]. However, little information is available on the roles of laccases as virulence factor in wood rotting fungi, although they contain much more numbers of laccase-encoding genes compared to other group of fungi [2]. During invasive growth of pathogenic fungi in host plants, three main enzymes that can modify lignin structures either directly or indirectly are lignin peroxidases (LiPs), manganese peroxidases (MnPs) and laccases sensu stricto. In addition to lignin degradation, fungal laccases also play significant physiological roles on fungal morphogenesis [18], stress defense [19,20] and fungal virulence [18]. In chestnut blight fungus Cryphonectria parasitica, lac-1 (HaLCC3 in Heterobasidion irregulare) is the best characterized laccase encoding gene which expression is repressed by virulenceattenuating mycoviruses [21]. Another laccase gene (lac3)
H.-C. Kuo et al. / Microbial Pathogenesis 81 (2015) 16e21
(HaLCC4 in H. irregulare) was found to be induced by the presence of tannic acid present in the bark of chestnut trees. A series of elegant research indicated that the lac3 is a virulence determinant in this fungal pathogen [22,23]. Heterobasidion annosum (Fr.) Bref. sensu lato (s.l.) is a fungal species complex which consists of five species, H. parviporum, H. abietinum, H. occidentale, H. irregulare, and H. annosum (Fr.) Bref. sensu stricto (s.s.), and is a root rot fungus which infects conifer trees through fresh wounds (stump surfaces) and grows in living bark as a necrotroph [24]. It spreads via root to root contacts and infects through intact bark of roots and later decays the root and trunk of standing trees as a saprotroph [25]. It has been reported that laccase is one of highly secreted enzymes in H. annosum s.s. and has also been implicated in wood decaying capability in H. annosum s.l [26]. In the highly aggressive H. annosum s.s., it was found to produce more laccase (5e6 folds) than less aggressive H. parviporum [26,27]. The analysis of mutation frequencies in different types of H. annosum s.s. laccase genes suggests that the gene is under positive selection for host adaptation [27]. This raised the hypothesis that laccases may play as virulence factors in H. annosum s.s. [27] but yet, no experimental data can support this. Now, the genome of H. irregulare has been sequenced [28] and it became available to investigate potential roles of laccase gene families at genome scale of H. annosum s.l..
17
The objective of this study is to understand the potential roles of laccases in H. annosum s.s. as virulence factor by 1) phylogenetic analysis of laccase gene families, 2) expression analysis of laccase gene families in H. annosum s.s. during host plant infection and under different carbon sources, and virulence tests. 2. Materials and methods 2.1. Identification and phylogenetic analysis of laccase-encoding genes Laccase-encoding genes were identified in H. irregulare genome by searching in JGI (http://genome.jgi-psf.org/Hetan2/Hetan2. home.html) and CFGP (http://cfgp.riceblast.snu.ac.kr/main.php) [29]. A total of 18 laccase genes (Table 1) from H. irregulare were identified and named as HaLCC1 to 21 (to be able to design primers and investigate the gene expression in H. annosum s.s.). The phylogenetic tree with 236 laccases (proteins with both multicopper oxidase and cupredoxin domains) from 26 species (Table S2; 2 animal pathogens, 3 ectomycorrhizal, 8 plant pathogens [1 brown rot, 3 white rot and 1 root rot fungi], 11 saprotrophs [including 3 brown rot, 3 white rot and 1 mycoparasite], and 2 symbiotants) of Basidiomycetes was constructed by NeighborJoining method [30] which is imbedded in the computer software MEGA6 [31]. The percentage of replicate trees (75%) in which the
Table 1 Primers used for qRT-PCR of laccase genes in this study. Name
Annotationa
Protein IDb
Primers
Sequences
Groupc
HaLCC1
Laccase sensu stricto
165789
Laccse sensu stricto
35202
HaLCC3
Laccase 3
165788
HaLCC4
Laccse sensu stricto
103190
HaLCC5
Laccse sensu stricto
103894
HaLCC6
Laccase sensu stricto, alternatively spliced
HaLCC8
Laccse sensu stricto
163392/ 482867 67601
HaLCC9
Fet3 ferroxidase
66247
HaLCC10
Laccase sensu stricto, alternatively spliced
HaLCC11
Laccase sensu stricto
172039/ 452867 181060
HaLCC12
Laccase sensu stricto
181063
HaLCC13
Laccase 13, alternatively spliced
127340
HaLCC14
MCOs, ferroxidase/laccase
119423
HaLCC15
Ferroxidase/laccase
157048
HaLCC16
MCOs
181064
HaLCC18
Laccase sensu stricto
181231
HaLCC20
Laccase 13, alternatively spliced
482870
HaLCC21
Laccase sensu stricto
gdh
Glyceraldehyde-3-phosphate dehydrogenase
416371/ 482876 419475
ACTGGTACCACTCGCATTATAG CAACAACTACTGGATTCGCTC CCCAAAGGCAGCATTTATGAA GAGAACGAGTGTCCATGAAGA ACCGTAGATTCATCATCCACA TGGTCTCAATCAAGGGCA GTGTCTTTGCTTTGTCGGT GAAATGGTCGCCCTTGTTAG TTTCTATCGACGGGCACAA TTGCTTCCAGGACAAGAGAA CTCCACCTTCTTATATCAATACCC CCGCCAACAAATCTACCA CACAGACCGACCTCCATC GAGCGTGAAGTTGAAGACAG CCGACGATACTGTCCGAG CGTGCAGATGGAAAGGATG CTTCAATTCACTGGCACGG CATACAGGAAAGAGTTGTTGGG TTCCACTGCCATATTGACTG ATGAACAGAGGGAGACGA GCTTCGACCCTGATAAATGG AGCATTGACAACGACGGA ACTCCCTTTGTGACGACAT ACGCTGAGTTGGGAATGATA CACCTCGTACACCAACTACAT CGAAGACAGCATTAGCAACA CACTGATTGTCCACTCTGTC CCACCGTTAATGAGCCTG CACATTCATGGGCAGCAC CCCGCGAAGATGTTGTTG AAACACTATCATCACACTGG AAGCGATATGTCTTTCCAC GGTATCATTCCCAACTCAG ACTCATCATCCACATCGT CGATGGAAGTAACACCGAG TGTTGTCCAGGAGCAGAG GGTTTGGTTCCTGTCCGT CGATGAAAGGGTCGTTCAC
I
HaLCC2
Lac18F Lac18R Lac10F Lac10R FiDiProRT-43F FiDiProRT-43R Lac14F Lac14R Lac15F Lac15R FiDiProRT-44F FiDiProRT-44R Lac13F Lac13R Lac12F Lac12R FiDiProRT-51F FiDiProRT-51R FiDiProRT-50F FiDiProRT-50R FiDiProRT-49F FiDiProRT-49R Lac17F Lac17R Lac16F Lac16R FiDiProRT-45F FiDiProRT-45R Lac20F Lac20R FiDiProRT-48F FiDiProRT-48R FiDiProRT-47F FiDiProRT-47R FiDiProRT-46F FiDiProRT-46R FiDiProRT-9F FiDiProRT-9R
I I I I II I III I I I II VI VI III I II I
a The annotation was based on the protein domains (IPR001117, Multicopper oxidase, type 1; IPR011706 Multicopper oxidase, type 2; IPR011707 Multicopper oxidase, type 3; IPR002355 Multicopper oxidase, copper-binding site) predicted by InterProScan (http://www.ebi.ac.uk/interpro/;jsessionid¼B4C7B594C6AC163E4AD8E5876E15FE38). b The Protein ID was obtained from DOE Joint Genome Institute (http://www.jgi.doe.gov/) of H. irregulare genome. c The classification for groups is based on phylogenetic analysis (Fig. 1 a,b).
18
H.-C. Kuo et al. / Microbial Pathogenesis 81 (2015) 16e21
H.-C. Kuo et al. / Microbial Pathogenesis 81 (2015) 16e21
associated laccases clustered together in the bootstrap test (1000 replicates) are shown next to the branches [32]. 2.2. Fungal culture conditions and inoculation experiments H. annosum s.s. (isolate 03012 from Finland) was kindly provided by Kari Korhonen, METLA, Finnish Forest Research Institute, Finland) and Scots pine (Pinus sylvestris L.) seeds were obtained from Svenska Skogsplantor (Saleby FP-45). H. annosum s.s. was maintained in MEG agar plates (0.5% Malt extract, 0.5% Glucose and 2% agar) and grown at 24 C. For all experiments, the synthetic medium, Vogel's medium [33] þ nicotinic acid 0.01%, was used as a basal medium. Scots pine seeds were sown on 2% water agar plates (or test tubes) or a € White 420-W peat for germination mixture of sterilized Kekkila and growth. All experiments were performed in a growth chamber with a 12-h light/12-h dark photoperiod at 24 C and 80% RH. The inoculation experiments were performed on water agar by placing a mycelial agar block (0.5 cm in diameter) on the roots of 2weeks-old Scots pine seedlings. The seedlings were then collected one week and two weeks post infection and RNA was extracted from roots for expression analyses using qRT-PCR. For measuring of laccase production in different carbon source containing media, the fungus was grew in 200 ml of sharking (100 rpm) at RT (22 C) for 2 weeks pH for all culture media is 6.5. For each experimental replicate in all experiments in this study, 9 Scots pine seedlings were used. 2.3. Laccase measurements Laccase (EC 1.10.3.2) in culture filtrates was detected by color changes by adding the final concentrations of 73 mM potassium phosphate, 0.02 mM syringaldazine (SigmaeAldrich Co., St. Louis, MO), and 10% methanol. Mixtures were incubated for 10 min at room temperature (22 C) and then measured at 530 nm absorption [34]. The laccase concentration was calculated by the linear function (y ¼ 0.448x þ 0.02) according to the OD 530 nm readings of 0.25 mg/ml (0.132) and 0.125 mg/ml (0.076) using laccase from Trametes versicolor (SigmaeAldrich Co., St. Louis, MO). 2.4. RNA extraction, cDNA synthesis, and qRT-PCR RNA extraction from the homogenized pine seedlings tissues were performed using TRIzol reagent (Invitrogen, Valencia, CA, USA) according to the manufacturer's protocol. Reverse transcription was performed with Moloney murine leukemia virus reverse transcriptase (M-MuLV RT) (Thermo Fisher Scientific Oy., Vantaa, Finland) according to the manufacturer's protocol. RNA and cDNA samples were quantified using a Nanodrop spectrophotometers (Thermo Fisher Scientific Oy., Vantaa, Finland). Total RNA extracted from H. annosum s. s. grown on sucrose containing Vogel's medium was used as a control. qRT-PCR was performed as described in our previous publication [35] which initial 95 C for 5 min, denaturation at 94 C for 10 s (4.8 C/s), annealing at 59 C for 10 s (2.5 C/s), extension at 72 C for 10 s (4.8 C/s), 40 cycles of amplification, and a final extension at 72 C for 3 min. Three technical repeats has been performed.
19
2.5. Statistical analysis Significance (p < 0.05) analysis for laccase gene expressions in different time points and conditions were performed by using oneway ANOVA method. 3. Results and discussion 3.1. Identification and phylogenetic analysis of genes encoding laccases All 18 HaLCCs contain three multi-copper oxidase domains and one signal peptide (Table S1; Fig. 1a), indicating all being secreted [36]. HaLCC16 has an additional L-ascorbate oxidase domain (Fig. 1a; Table S1). When 236 sequences (Table S2) encoding laccases from 26 fungal species belonging to Basidiomycota were subjected to phylogenetic analysis, laccase genes of H. irregulare were grouped largely into 4 groups (Fig. 1a,b). Laccases in group I are phylogenetically close-related (although HaLLC3 does not contain multicopper oxidase 3 which makes its domain structure slightly different from other protein members in group I) and members in group II and III are mainly identified by the domains structures. Although laccases in group IV and I have similar protein domains, they are not phylogenetically close-related (Fig. 1a,b). Most numbers of laccases were belonged to group I. Laccases in group I and II are grouped together with those laccases from other plant pathogens. Group II laccases have similar protein domains but grouped together with laccases either from saprotrophic or pathogenic fungi. Although there is no clear indication between phylogeny and domain compositions in laccases, and lifestyles of fungal species, laccases mainly preserved in saprotrophs and plant associated fungi. 3.2. Expression profiling of laccase genes both in planta and under different carbon sources As the first step to understand potential roles of laccase in the virulence of H. annosum s.s., in planta expression patterns of laccase genes was profiled by using qRT-PCR. Among 18 laccase genes tested, expression of 8 genes (HaLCC6, HaLCC9, HaLCC12, HaLCC15, HaLCC16, HaLCC18, HaLCC20 and HaLCC21) was highly up-regulated in Scots pine seedlings at 1 week post inoculation (wpi). Expression of more than half of genes was maintained up to 2 wpi. These results suggested that these laccases might be involved in early stage of host infection. However, two laccase genes (HaLCC8 and HaLCC10) were down-regulated in the host plant and four genes (HaLCC1, HaLCC2, HaLCC4 and HaLCC14) did not show any expression. Expression patterns of laccase genes were not correlated to those in phylogenetic groups (HaLCC1, HaLCC2 and HaLCC4 in group I, and HaLCC14 in group VI). HaLCC14 is worthy to notice. HaLCC14, containing transmembrane domain showed no expression (Fig. 2a). This may be due to that HaLCC14 may not play a role on the growth in the host plant. To further understand the expression patterns of laccase genes, we selected 6 representative laccase genes based on their phylogeny and expression patterns in host plant. Their expression patterns were further analyzed under different carbon sources. Expression of all tested genes showed up-regulation under glucose condition as a sole carbon source, followed by cellulose (Fig. 2b). This data
Fig. 1. Domains prediction for H. annosum s.l. laccases and their phylogenetic locations. a. There are 4 groups of H. annosum s.l. laccases which contain IPR001117 (Multicopper oxidase, type 1), IPR008972 (Cupredoxin), IPR011706 (Multicopper oxidase, type 2) and IPR011707 (Multicopper oxidase, type 3). b. Evolutionary relationships of laccases from 26 Basidiomycetes. The evolutionary history was inferred using the Neighbor-Joining method [30]. The bootstrap consensus tree inferred from 1000 replicates [32]. Only 75% bootstrap replicates are showed. The analysis involved 236 laccase-encoding sequences. Evolutionary analyses were conducted in MEGA6 [31].
20
H.-C. Kuo et al. / Microbial Pathogenesis 81 (2015) 16e21
Fig. 2. The expression patterns of H. annosum s.s. laccase genes under different treatments. a. Expression patterns during infection to Scots pine. T1, 1 wpi; T2, 2 wpi. Significantly different (p < 0.05) between the expression of laccase genes in T1 and T2 groups is shown in Table S3. *p < 0.05. b. Expression patterns under different carbon source-containing media. c. Laccase activity in different carbon source-containing media. Significantly different (p < 0.05) between the expression of laccase genes in glucose-, cellobiose- and cellulose-containing media is shown in Table S4. *p < 0.05. d. Mortality of Scots pines by infection of H. annosum s.s. under different carbon sources on the media. Mortality was measured 2 weeks post inoculation. The error bars indicate the standard deviations.
suggest that expressions of these laccases are not under carbon catabolite repression, not likely several cell wall degrading enzymes in other plant pathogenic fungi [37,38]. Inhibition and stimulation of laccase expression were reported in a basidiomycete I62 [16] and Cryptococcus neoformans [39] by higher and lower glucose levels, respectively. 3.3. Laccase activity under different carbon sources Since expression of laccase genes was highly induced under the condition of glucose as a sole carbon source, we measured laccase activity under different carbon sources. The laccase activity was determined in culture media with different carbon sources on a daily basis. Laccase activity was increased dramatically at 5e7 days post inoculation (dpi), peaked at 12 dpi, and then slightly decreased (Fig. 2c). Higher activities of laccase were observed in culture media containing cellulose, sucrose, or glucose compared to that of
cellobiose as a sole carbon source (Fig. 2c). Similar higher and lower activities of laccases by glucose and cellobiose, respectively, have been reported in a wood degrading basidiomycete, T. versicolor [40]. When compared to the laccase genes expression during infection to Scots pine seedlings (Fig. 2a) and saprotrophic growth on different carbon sources (Fig. 2b), HaLCC15 was found highly expressed during infection to host plant (Fig. 2a), but the expression was reduced during saprotrophic grow on cellobiose and cellulose containing media (Fig. 2b). HaLCC15 may play a role during interactions with the host plant, but additional experiments were needed to be considered as a true virulence factor. 3.4. Virulence of H. annosum s.s. under different carbon sources Since different carbon sources modulate differential expression of laccase genes and laccase activity, we tested virulence of H. annosum s.s. on host plant under different carbon sources. The
H.-C. Kuo et al. / Microbial Pathogenesis 81 (2015) 16e21
highest mortality of Scots pine seedlings was observed when infected by H. annosum s.s. on extra carbon source as glucose, followed by cellobiose (Fig. 2d). This data was supported by the facts that glucose plays significant roles on up-regulation of in planta induced laccase genes and higher activity of laccase in H. annosum s.s.. The nutrient and toxin in the environments (hosts) could be the key factor to determine the function of laccase [41,42].
[15]
[16]
[17]
4. Conclusions [18]
We presented the potential roles of laccase as a virulence factor in H. annosum s.s. by providing their expression patterns in host plant, enzymatic activity and virulence by different carbon sources. Since it is believed that functions of laccases in H. annosum s.s. are diverse, some laccase genes might be involved in early stage of host infection and the others may have other functions during its life cycle. Further gene knock-out analysis would clarify their roles during host interaction. Acknowledgments Thanks to Profs. Fred O. Asiegbu and Jari P. T. Valkonen for the suggestions on this work. This work was supported by the Finland Distinguished Professor Programme (FiDiPro # 138116) from Academy of Finland, and grants from the National Research Foundation of Korea (2014R1A2A1A10051434) to YHL.
[19] [20] [21]
[22]
[23]
[24] [25]
[26]
Appendix A. Supplementary data [27]
Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.micpath.2015.03.004.
[28]
References [29] [1] P. Giardina, V. Faraco, C. Pezzella, A. Piscitelli, S. Vanhulle, et al., Laccase: a neverending story, Cell. Mol. Life Sci. 67 (2010) 369e385. [2] M. Heinzkill, K. Messner, The ligninolytic system of fungi, in: T. Anke (Ed.), Fungal Biotechnology, Chapman & Hall, Weinheim, 1997, pp. 213e226. [3] R.T. Have, P.J.M. Teunissen, Oxidative mechanisms involved in lignin degradation by white rot fungi, Chem. Rev. 101 (2001) 3397e3413. [4] P. Kersten, D. Cullen, Extracellular oxidative systems of the lignin-degrading basidiomycete Phanerochaete chrysosporium, Fungal Genet. Biol. 44 (2007) 77e87. e, J. Garbaye, et al., [5] P.E. Courty, P.J. Hoegger, S. Kilaru, A. Kohler, M. Bue Phylogenetic analysis, genomic organization, and expression analysis of multicopper oxidases in the ectomycorrhizal basidiomycete Laccaria bicolor, New. Phytol. 182 (2009) 736e750. [6] R. Pezet, V. Pont, K. Hoang-Van, Enzymatic detoxication of stilbenes by Botrytis cinerea and inhibition by grape berries proanthrocyanidins, in: K. Verhoeff, N.E. Malathrakis, B. Williamson (Eds.), Recent Advances in Botrytis Research, Pudoc Scientific, Wageningen, 1992, pp. 87e92. [7] T.A. Missal, J.M. Moran, J.A. Corbett, J.K. Lodge, Distinct stress responses of two functional laccases in Cryptococcus neoformans are revealed in the absence of the thiol-specific antioxidant Tsa1, Eukaryot. Cell. 4 (2005) 202e208. [8] E. Rodriguez, M.A. Pickard, R. Vazquez-Duhalt, Industrial dye decolorization by laccases from ligninolytic fungi, Curr. Microbiol. 38 (1999) 27e32. [9] C. Johannes, A. Majcherczyk, Natural mediators in the oxidation of polycyclic aromatic hydrocarbons by laccase mediator system, Appl. Environ. Microbiol. 66 (2000) 524e528. [10] L. Levin, F. Forchiassin, A.M. Ramos, Copper induction of ligninmodifying enzymes in the white rot fungus Trametes trogii, Mycologia 94 (2002) 377e383. [11] C. Eggert, U. Temp, K.E.L. Eriksson, The ligninolytic system of the white rot fungus Pycnoporus cinnabarinus: purification and characterization of the laccase, Appl. Environ. Microbiol. 62 (1996) 1151e1158. [12] J.M. Bollag, A. Leonowicz, Comparative studies of extracellular fungal laccases, Appl. Environ. Microbiol. 48 (1984) 849e854. [13] C. Eggert, U. Temp, J.F.D. Dean, K.L. Eriksson, A fungal metabolite mediates degradation of non-lignin structures and synthetic lignin, FEBS Lett. 391 (1996) 144e148. , H. Kellner, S. Brock, F. Buscot, D. Schlosser, Extracellular laccase [14] M. Sole
[30] [31]
[32] [33] [34] [35] [36]
[37]
[38]
[39]
[40]
[41]
[42]
21
activity and transcript levels of putative laccase genes during removal of the xenoestrogen technical nonylphenol by the aquatic hyphomycete Clavariopsis aquatica, FEMS Microbiol. Lett. 288 (2008) 47e54. U. Temp, U. Zierold, C. Eggert, Cloning and characterization of a second laccase gene from the lignin-degrading basidiomycete Pycnoporus cinnabarinus, Gene 236 (1999) 169e177. rez, A.E. Gonza lez, Differential gene expression in the laccase M. Mansur, T. Sua gene family from basidiomycete I-62 (CECT 20197), Appl. Environ. Microbiol. 64 (1998) 771e774. P.J. Hoegger, S. Kilaru, T.Y. James, J.R. Thacker, U. Kües, Phylogenetic comparison and classification of laccase and related multicopper oxidase protein sequences, FEBS J. 273 (2006) 2308e2326. X. Zhu, P.R. Williamson, Role of laccase in the biology and virulence of Cryptococcus neoformans, FEMS Yeast Res. 5 (2004) 1e10. C.F. Thurston, The structure and function of fungal laccases, Microbiology 140 (1994) 19e26. L. Gianfreda, F. Xu, J.M. Bollag, Laccases: a useful group of oxidoreductive enzymes, Bioremediat J. 3 (1999) 1e26. P. Wang, D.L. Nuss, Identification of a Cryphonectria parasitica laccase gene promoter element involved in cycloheximide-inducible, hypovirus-repressible transcriptional activation, Gene 210 (1998) 79e84. H.J. Chung, B.R. Kwon, J.M. Kim, S.M. Park, J.K. Park, et al., A tannic acideinducible and hypoviral-regulated laccase3 contributes to the virulence of the chestnut blight fungus Cryphonectria parasitica, Mol. Plant Microbe Interact. 21 (2008) 1582e1590. J.M. Kim, S.M. Park, D.H. Kim, Heterologous expression of a tannic acidinducible laccase3 of Cryphonectria parasitica in Saccharomyces cerevisiae, BMC Biotechnol. 10 (2010) 18. M. Garbelotto, P. Gonthier, Biology, epidemiology, and control of Heterobasidion species worldwide, Annu Rev. Phytopathol. 51 (2013) 39e59. J.E. Pratt, C.G. Shaw III, G. Vollbrecht, Modelling disease development in forest stands, in: S. Woodward, J. Stenlid, R. Karjalainen, A. Hüttermann (Eds.), Heterobasidion Annosum: Biology, Ecology, Impact and Control, CAB International, Wallingford, UK, 1998, pp. 213e233. G. Daniel, F. Asiegbu, M. Johansson, The saprotrophic wood-degrading abilities of Heterobasidium annosum intersterility groups P and S, Mycol. Res. 102 (1998) 991e997. F.O. Asiegbu, S. Abu, J. Stenlid, M. Johansson, Sequence polymorphism and molecular characterization of laccase genes of the conifer pathogen Heterobasidion annosum, Mycol. Res. 108 (2004) 136e148. Aerts A. Olson Å, F. Asiegbu, L. Belbahri, O. Bouzid, et al., Insight into trade-off between wood decay and parasitism from the genome of a fungal forest pathogen, New. Phytol. 194 (2012) 1001e1013. J. Choi, K. Cheong, K. Jung, J. Jeon, G.W. Lee, et al., CFGP 2.0: a versatile webbased platform for supporting comparative and evolutionary genomics of fungi and oomycetes, Nucl. Acids Res. 41 (2013) D714eD719. N. Saitou, M. Nei, The neighbor-joining method: anew method for reconstructing phylogenetic trees, Mol. Biol. Evol. 4 (1987) 406e425. K. Tamura, G. Stecher, D. Peterson, A. Filipski, S. Kumar, MEGA6: molecular evolutionary genetics analysis version 6.0, Mol. Biol. Evol. 30 (2013) 2725e2729. J. Felsenstein, Confidence limits on phylogenies: an approach using the bootstrap, Evolution 39 (1985) 783e791. H.J. Vogel, A convenient growth medium for Neurospora crassa, Microb. Genet. Bull. 13 (1956) 42e43. J.P. Ride, The effect of induced lignification in the resistance of wheat cell walls to fungal degradation, Physiol. Plant Pathol. 16 (1980) 187e196. H.C. Kuo, H. Sun, J. Choi, F.O. Asiegbu, J.P.T. Valkonen, et al., Secret lifestyles of Neurospora crassa, Sci. Rep. 4 (2014) 5135. D. Floudas, M. Binder, R. Riley, K. Barry, R.A. Blanchette, et al., The paleozoic origin of enzymatic lignin decomposition reconstructed from 31 fungal genomes, Science 336 (2012) 1715e1719. N.J. Tonukari, J.S. Scott-Craig, J.D. Waltonb, The Cochliobolus carbonum SNF1 gene is required for cell walledegrading enzyme expression and virulence on maize, Plant Cell. 12 (2000) 237e247. N.J. Tonukari, J.S. Scott-Craig, J.D. Walton, Isolation of the carbon catabolite repressor (CREA) gene from the plant-pathogenic fungus Cochliobolus carbonum, DNA Seq. 14 (2003) 103e107. M.S. Lazera, F.D. Pires, L. Camillo-Coura, M.M. Nishikawa, C.C. Bezerra, et al., Natural habitat of Cryptococcus neoformans var. neoformans in decaying wood forming hollows in living trees, J. Med. Vet. Mycol. 34 (1996) 127e131. Y. Lee, C. Park, B. Lee, E.J. Han, T.H. Kim, et al., Effect of nutrients on the production of extracellular enzymes for decolorization of reactive blue 19 and reactive black 5, J. Microbiol. Biotechnol. 16 (2006) 226e231. R. Kannaiyan, N. Mahinpey, T. Mani, R.J. Martinuzzi, V. Kostenko, Enhancement of Dichomitus squalens tolerance to copper and copper-associated laccase activity by carbon and nitrogen sources, Biochem. Eng. J. 67 (2012) 140e147. J.M. Bollag, K.L. Shuttleworth, D.H. Anderson, Laccase-mediated detoxification of phenolic compounds, Appl. Environ. Microbiol. 54 (1998) 3086e3091.
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Short communication
Potential roles of laccases on virulence of Heterobasidion annosum s.s. try a, Jaeyoung Choi a, c, Yong-Hwan Lee a, b, c, * Hsiao-Che Kuo a, Nicolas De a
Department of Forest Sciences, University of Helsinki, Helsinki, Finland Department of Agricultural Sciences, University of Helsinki, Helsinki, Finland c Department of Agricultural Biotechnology, Centers for Fungal Pathogenesis and Fungal Genetic Resources, Seoul National University, Seoul, South Korea b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 November 2014 Received in revised form 5 March 2015 Accepted 6 March 2015 Available online 7 March 2015
Laccases, multi-copper-containing proteins, can catalyze the oxidation of phenolic substrates and have diverse functions such as a virulence factor in fungi. However, limited information can be found on the role of laccases in the interaction of Heterobasidion annosum s.s. to its host plant. Due to genome availability of the close-related species Heterobasidion irregulare, which contains 18 predicted laccaseencoding genes, phylogenetic analysis and gene expression profiling were performed. Eighteen laccase genes could be classified into 4 groups based on protein domains and phylogenetic analysis. However, there is no clear indication between phylogeny and domain compositions in laccases, and lifestyles of fungal species. The results of qRT-PCR showed that the expression of 8 laccase genes was highly upregulated in Scots pine seedlings at 1 wpi. These data suggested that they might be involved in early stage of host infection. In addition, up-regulation of gene expression under glucose condition as a sole carbon source suggests that those laccases are not under carbon catabolite repression. Higher activities of laccase were observed in culture media containing cellulose, sucrose, or glucose compared to that of cellobiose as a sole carbon source. The highest mortality of Scots pine seedlings was observed when infected by H. annosum s.s. on extra carbon source as glucose. This was supported by the facts that glucose plays significant roles on up-regulation of laccase genes in planta and higher activity of laccase in H. annosum s.s.. Taking all together, laccases in H. annosum s.s. have diverse functions and a group of laccases may play a role during interactions with Scots pine seedlings. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Laccase Multi-copper oxidase Heterobasidion Pathogenicity
1. Introduction Laccases (EC 1.10.3.2), multi-copper-containing proteins, are enzymes ubiquitously found in plants, animals, fungi, and bacteria [1,2]. They catalyze the oxidation of phenolic substrates (e.g. lignin) [3] and similar molecules with concomitant reduction of molecular oxygen to water [4]. Laccases have been reported to have diverse functions in fungal species. These include bioconvertion of lignin [5], protection from toxic phytoalexins [6], and virulence factors to human and plants [7]. Fungal laccases have been paying more attention on its peroxidase activity, dye decolorization [8] and polyaromatic hydrocarbon degradation [9], and biotechnological application [10]. Laccase production in fungi was affected by generally different sources of carbon, and by the ratio of carbon and
* Corresponding author. Department of Agricultural Biotechnology, Center for Fungal Genetic Resources, Seoul National University, Seoul 151-921, South Korea. E-mail address: [email protected] (Y.-H. Lee). http://dx.doi.org/10.1016/j.micpath.2015.03.004 0882-4010/© 2015 Elsevier Ltd. All rights reserved.
nitrogen (C/N). The excessive concentrations of sucrose or glucose reduced the laccase production [11,12]. However, in the cellulose containing medium, the laccase was produced more efficiently [13]. Several reports support the hypothesis that members of the laccase families may play different roles during the life cycle of the organism [14e17]. However, little information is available on the roles of laccases as virulence factor in wood rotting fungi, although they contain much more numbers of laccase-encoding genes compared to other group of fungi [2]. During invasive growth of pathogenic fungi in host plants, three main enzymes that can modify lignin structures either directly or indirectly are lignin peroxidases (LiPs), manganese peroxidases (MnPs) and laccases sensu stricto. In addition to lignin degradation, fungal laccases also play significant physiological roles on fungal morphogenesis [18], stress defense [19,20] and fungal virulence [18]. In chestnut blight fungus Cryphonectria parasitica, lac-1 (HaLCC3 in Heterobasidion irregulare) is the best characterized laccase encoding gene which expression is repressed by virulenceattenuating mycoviruses [21]. Another laccase gene (lac3)
H.-C. Kuo et al. / Microbial Pathogenesis 81 (2015) 16e21
(HaLCC4 in H. irregulare) was found to be induced by the presence of tannic acid present in the bark of chestnut trees. A series of elegant research indicated that the lac3 is a virulence determinant in this fungal pathogen [22,23]. Heterobasidion annosum (Fr.) Bref. sensu lato (s.l.) is a fungal species complex which consists of five species, H. parviporum, H. abietinum, H. occidentale, H. irregulare, and H. annosum (Fr.) Bref. sensu stricto (s.s.), and is a root rot fungus which infects conifer trees through fresh wounds (stump surfaces) and grows in living bark as a necrotroph [24]. It spreads via root to root contacts and infects through intact bark of roots and later decays the root and trunk of standing trees as a saprotroph [25]. It has been reported that laccase is one of highly secreted enzymes in H. annosum s.s. and has also been implicated in wood decaying capability in H. annosum s.l [26]. In the highly aggressive H. annosum s.s., it was found to produce more laccase (5e6 folds) than less aggressive H. parviporum [26,27]. The analysis of mutation frequencies in different types of H. annosum s.s. laccase genes suggests that the gene is under positive selection for host adaptation [27]. This raised the hypothesis that laccases may play as virulence factors in H. annosum s.s. [27] but yet, no experimental data can support this. Now, the genome of H. irregulare has been sequenced [28] and it became available to investigate potential roles of laccase gene families at genome scale of H. annosum s.l..
17
The objective of this study is to understand the potential roles of laccases in H. annosum s.s. as virulence factor by 1) phylogenetic analysis of laccase gene families, 2) expression analysis of laccase gene families in H. annosum s.s. during host plant infection and under different carbon sources, and virulence tests. 2. Materials and methods 2.1. Identification and phylogenetic analysis of laccase-encoding genes Laccase-encoding genes were identified in H. irregulare genome by searching in JGI (http://genome.jgi-psf.org/Hetan2/Hetan2. home.html) and CFGP (http://cfgp.riceblast.snu.ac.kr/main.php) [29]. A total of 18 laccase genes (Table 1) from H. irregulare were identified and named as HaLCC1 to 21 (to be able to design primers and investigate the gene expression in H. annosum s.s.). The phylogenetic tree with 236 laccases (proteins with both multicopper oxidase and cupredoxin domains) from 26 species (Table S2; 2 animal pathogens, 3 ectomycorrhizal, 8 plant pathogens [1 brown rot, 3 white rot and 1 root rot fungi], 11 saprotrophs [including 3 brown rot, 3 white rot and 1 mycoparasite], and 2 symbiotants) of Basidiomycetes was constructed by NeighborJoining method [30] which is imbedded in the computer software MEGA6 [31]. The percentage of replicate trees (75%) in which the
Table 1 Primers used for qRT-PCR of laccase genes in this study. Name
Annotationa
Protein IDb
Primers
Sequences
Groupc
HaLCC1
Laccase sensu stricto
165789
Laccse sensu stricto
35202
HaLCC3
Laccase 3
165788
HaLCC4
Laccse sensu stricto
103190
HaLCC5
Laccse sensu stricto
103894
HaLCC6
Laccase sensu stricto, alternatively spliced
HaLCC8
Laccse sensu stricto
163392/ 482867 67601
HaLCC9
Fet3 ferroxidase
66247
HaLCC10
Laccase sensu stricto, alternatively spliced
HaLCC11
Laccase sensu stricto
172039/ 452867 181060
HaLCC12
Laccase sensu stricto
181063
HaLCC13
Laccase 13, alternatively spliced
127340
HaLCC14
MCOs, ferroxidase/laccase
119423
HaLCC15
Ferroxidase/laccase
157048
HaLCC16
MCOs
181064
HaLCC18
Laccase sensu stricto
181231
HaLCC20
Laccase 13, alternatively spliced
482870
HaLCC21
Laccase sensu stricto
gdh
Glyceraldehyde-3-phosphate dehydrogenase
416371/ 482876 419475
ACTGGTACCACTCGCATTATAG CAACAACTACTGGATTCGCTC CCCAAAGGCAGCATTTATGAA GAGAACGAGTGTCCATGAAGA ACCGTAGATTCATCATCCACA TGGTCTCAATCAAGGGCA GTGTCTTTGCTTTGTCGGT GAAATGGTCGCCCTTGTTAG TTTCTATCGACGGGCACAA TTGCTTCCAGGACAAGAGAA CTCCACCTTCTTATATCAATACCC CCGCCAACAAATCTACCA CACAGACCGACCTCCATC GAGCGTGAAGTTGAAGACAG CCGACGATACTGTCCGAG CGTGCAGATGGAAAGGATG CTTCAATTCACTGGCACGG CATACAGGAAAGAGTTGTTGGG TTCCACTGCCATATTGACTG ATGAACAGAGGGAGACGA GCTTCGACCCTGATAAATGG AGCATTGACAACGACGGA ACTCCCTTTGTGACGACAT ACGCTGAGTTGGGAATGATA CACCTCGTACACCAACTACAT CGAAGACAGCATTAGCAACA CACTGATTGTCCACTCTGTC CCACCGTTAATGAGCCTG CACATTCATGGGCAGCAC CCCGCGAAGATGTTGTTG AAACACTATCATCACACTGG AAGCGATATGTCTTTCCAC GGTATCATTCCCAACTCAG ACTCATCATCCACATCGT CGATGGAAGTAACACCGAG TGTTGTCCAGGAGCAGAG GGTTTGGTTCCTGTCCGT CGATGAAAGGGTCGTTCAC
I
HaLCC2
Lac18F Lac18R Lac10F Lac10R FiDiProRT-43F FiDiProRT-43R Lac14F Lac14R Lac15F Lac15R FiDiProRT-44F FiDiProRT-44R Lac13F Lac13R Lac12F Lac12R FiDiProRT-51F FiDiProRT-51R FiDiProRT-50F FiDiProRT-50R FiDiProRT-49F FiDiProRT-49R Lac17F Lac17R Lac16F Lac16R FiDiProRT-45F FiDiProRT-45R Lac20F Lac20R FiDiProRT-48F FiDiProRT-48R FiDiProRT-47F FiDiProRT-47R FiDiProRT-46F FiDiProRT-46R FiDiProRT-9F FiDiProRT-9R
I I I I II I III I I I II VI VI III I II I
a The annotation was based on the protein domains (IPR001117, Multicopper oxidase, type 1; IPR011706 Multicopper oxidase, type 2; IPR011707 Multicopper oxidase, type 3; IPR002355 Multicopper oxidase, copper-binding site) predicted by InterProScan (http://www.ebi.ac.uk/interpro/;jsessionid¼B4C7B594C6AC163E4AD8E5876E15FE38). b The Protein ID was obtained from DOE Joint Genome Institute (http://www.jgi.doe.gov/) of H. irregulare genome. c The classification for groups is based on phylogenetic analysis (Fig. 1 a,b).
18
H.-C. Kuo et al. / Microbial Pathogenesis 81 (2015) 16e21
H.-C. Kuo et al. / Microbial Pathogenesis 81 (2015) 16e21
associated laccases clustered together in the bootstrap test (1000 replicates) are shown next to the branches [32]. 2.2. Fungal culture conditions and inoculation experiments H. annosum s.s. (isolate 03012 from Finland) was kindly provided by Kari Korhonen, METLA, Finnish Forest Research Institute, Finland) and Scots pine (Pinus sylvestris L.) seeds were obtained from Svenska Skogsplantor (Saleby FP-45). H. annosum s.s. was maintained in MEG agar plates (0.5% Malt extract, 0.5% Glucose and 2% agar) and grown at 24 C. For all experiments, the synthetic medium, Vogel's medium [33] þ nicotinic acid 0.01%, was used as a basal medium. Scots pine seeds were sown on 2% water agar plates (or test tubes) or a € White 420-W peat for germination mixture of sterilized Kekkila and growth. All experiments were performed in a growth chamber with a 12-h light/12-h dark photoperiod at 24 C and 80% RH. The inoculation experiments were performed on water agar by placing a mycelial agar block (0.5 cm in diameter) on the roots of 2weeks-old Scots pine seedlings. The seedlings were then collected one week and two weeks post infection and RNA was extracted from roots for expression analyses using qRT-PCR. For measuring of laccase production in different carbon source containing media, the fungus was grew in 200 ml of sharking (100 rpm) at RT (22 C) for 2 weeks pH for all culture media is 6.5. For each experimental replicate in all experiments in this study, 9 Scots pine seedlings were used. 2.3. Laccase measurements Laccase (EC 1.10.3.2) in culture filtrates was detected by color changes by adding the final concentrations of 73 mM potassium phosphate, 0.02 mM syringaldazine (SigmaeAldrich Co., St. Louis, MO), and 10% methanol. Mixtures were incubated for 10 min at room temperature (22 C) and then measured at 530 nm absorption [34]. The laccase concentration was calculated by the linear function (y ¼ 0.448x þ 0.02) according to the OD 530 nm readings of 0.25 mg/ml (0.132) and 0.125 mg/ml (0.076) using laccase from Trametes versicolor (SigmaeAldrich Co., St. Louis, MO). 2.4. RNA extraction, cDNA synthesis, and qRT-PCR RNA extraction from the homogenized pine seedlings tissues were performed using TRIzol reagent (Invitrogen, Valencia, CA, USA) according to the manufacturer's protocol. Reverse transcription was performed with Moloney murine leukemia virus reverse transcriptase (M-MuLV RT) (Thermo Fisher Scientific Oy., Vantaa, Finland) according to the manufacturer's protocol. RNA and cDNA samples were quantified using a Nanodrop spectrophotometers (Thermo Fisher Scientific Oy., Vantaa, Finland). Total RNA extracted from H. annosum s. s. grown on sucrose containing Vogel's medium was used as a control. qRT-PCR was performed as described in our previous publication [35] which initial 95 C for 5 min, denaturation at 94 C for 10 s (4.8 C/s), annealing at 59 C for 10 s (2.5 C/s), extension at 72 C for 10 s (4.8 C/s), 40 cycles of amplification, and a final extension at 72 C for 3 min. Three technical repeats has been performed.
19
2.5. Statistical analysis Significance (p < 0.05) analysis for laccase gene expressions in different time points and conditions were performed by using oneway ANOVA method. 3. Results and discussion 3.1. Identification and phylogenetic analysis of genes encoding laccases All 18 HaLCCs contain three multi-copper oxidase domains and one signal peptide (Table S1; Fig. 1a), indicating all being secreted [36]. HaLCC16 has an additional L-ascorbate oxidase domain (Fig. 1a; Table S1). When 236 sequences (Table S2) encoding laccases from 26 fungal species belonging to Basidiomycota were subjected to phylogenetic analysis, laccase genes of H. irregulare were grouped largely into 4 groups (Fig. 1a,b). Laccases in group I are phylogenetically close-related (although HaLLC3 does not contain multicopper oxidase 3 which makes its domain structure slightly different from other protein members in group I) and members in group II and III are mainly identified by the domains structures. Although laccases in group IV and I have similar protein domains, they are not phylogenetically close-related (Fig. 1a,b). Most numbers of laccases were belonged to group I. Laccases in group I and II are grouped together with those laccases from other plant pathogens. Group II laccases have similar protein domains but grouped together with laccases either from saprotrophic or pathogenic fungi. Although there is no clear indication between phylogeny and domain compositions in laccases, and lifestyles of fungal species, laccases mainly preserved in saprotrophs and plant associated fungi. 3.2. Expression profiling of laccase genes both in planta and under different carbon sources As the first step to understand potential roles of laccase in the virulence of H. annosum s.s., in planta expression patterns of laccase genes was profiled by using qRT-PCR. Among 18 laccase genes tested, expression of 8 genes (HaLCC6, HaLCC9, HaLCC12, HaLCC15, HaLCC16, HaLCC18, HaLCC20 and HaLCC21) was highly up-regulated in Scots pine seedlings at 1 week post inoculation (wpi). Expression of more than half of genes was maintained up to 2 wpi. These results suggested that these laccases might be involved in early stage of host infection. However, two laccase genes (HaLCC8 and HaLCC10) were down-regulated in the host plant and four genes (HaLCC1, HaLCC2, HaLCC4 and HaLCC14) did not show any expression. Expression patterns of laccase genes were not correlated to those in phylogenetic groups (HaLCC1, HaLCC2 and HaLCC4 in group I, and HaLCC14 in group VI). HaLCC14 is worthy to notice. HaLCC14, containing transmembrane domain showed no expression (Fig. 2a). This may be due to that HaLCC14 may not play a role on the growth in the host plant. To further understand the expression patterns of laccase genes, we selected 6 representative laccase genes based on their phylogeny and expression patterns in host plant. Their expression patterns were further analyzed under different carbon sources. Expression of all tested genes showed up-regulation under glucose condition as a sole carbon source, followed by cellulose (Fig. 2b). This data
Fig. 1. Domains prediction for H. annosum s.l. laccases and their phylogenetic locations. a. There are 4 groups of H. annosum s.l. laccases which contain IPR001117 (Multicopper oxidase, type 1), IPR008972 (Cupredoxin), IPR011706 (Multicopper oxidase, type 2) and IPR011707 (Multicopper oxidase, type 3). b. Evolutionary relationships of laccases from 26 Basidiomycetes. The evolutionary history was inferred using the Neighbor-Joining method [30]. The bootstrap consensus tree inferred from 1000 replicates [32]. Only 75% bootstrap replicates are showed. The analysis involved 236 laccase-encoding sequences. Evolutionary analyses were conducted in MEGA6 [31].
20
H.-C. Kuo et al. / Microbial Pathogenesis 81 (2015) 16e21
Fig. 2. The expression patterns of H. annosum s.s. laccase genes under different treatments. a. Expression patterns during infection to Scots pine. T1, 1 wpi; T2, 2 wpi. Significantly different (p < 0.05) between the expression of laccase genes in T1 and T2 groups is shown in Table S3. *p < 0.05. b. Expression patterns under different carbon source-containing media. c. Laccase activity in different carbon source-containing media. Significantly different (p < 0.05) between the expression of laccase genes in glucose-, cellobiose- and cellulose-containing media is shown in Table S4. *p < 0.05. d. Mortality of Scots pines by infection of H. annosum s.s. under different carbon sources on the media. Mortality was measured 2 weeks post inoculation. The error bars indicate the standard deviations.
suggest that expressions of these laccases are not under carbon catabolite repression, not likely several cell wall degrading enzymes in other plant pathogenic fungi [37,38]. Inhibition and stimulation of laccase expression were reported in a basidiomycete I62 [16] and Cryptococcus neoformans [39] by higher and lower glucose levels, respectively. 3.3. Laccase activity under different carbon sources Since expression of laccase genes was highly induced under the condition of glucose as a sole carbon source, we measured laccase activity under different carbon sources. The laccase activity was determined in culture media with different carbon sources on a daily basis. Laccase activity was increased dramatically at 5e7 days post inoculation (dpi), peaked at 12 dpi, and then slightly decreased (Fig. 2c). Higher activities of laccase were observed in culture media containing cellulose, sucrose, or glucose compared to that of
cellobiose as a sole carbon source (Fig. 2c). Similar higher and lower activities of laccases by glucose and cellobiose, respectively, have been reported in a wood degrading basidiomycete, T. versicolor [40]. When compared to the laccase genes expression during infection to Scots pine seedlings (Fig. 2a) and saprotrophic growth on different carbon sources (Fig. 2b), HaLCC15 was found highly expressed during infection to host plant (Fig. 2a), but the expression was reduced during saprotrophic grow on cellobiose and cellulose containing media (Fig. 2b). HaLCC15 may play a role during interactions with the host plant, but additional experiments were needed to be considered as a true virulence factor. 3.4. Virulence of H. annosum s.s. under different carbon sources Since different carbon sources modulate differential expression of laccase genes and laccase activity, we tested virulence of H. annosum s.s. on host plant under different carbon sources. The
H.-C. Kuo et al. / Microbial Pathogenesis 81 (2015) 16e21
highest mortality of Scots pine seedlings was observed when infected by H. annosum s.s. on extra carbon source as glucose, followed by cellobiose (Fig. 2d). This data was supported by the facts that glucose plays significant roles on up-regulation of in planta induced laccase genes and higher activity of laccase in H. annosum s.s.. The nutrient and toxin in the environments (hosts) could be the key factor to determine the function of laccase [41,42].
[15]
[16]
[17]
4. Conclusions [18]
We presented the potential roles of laccase as a virulence factor in H. annosum s.s. by providing their expression patterns in host plant, enzymatic activity and virulence by different carbon sources. Since it is believed that functions of laccases in H. annosum s.s. are diverse, some laccase genes might be involved in early stage of host infection and the others may have other functions during its life cycle. Further gene knock-out analysis would clarify their roles during host interaction. Acknowledgments Thanks to Profs. Fred O. Asiegbu and Jari P. T. Valkonen for the suggestions on this work. This work was supported by the Finland Distinguished Professor Programme (FiDiPro # 138116) from Academy of Finland, and grants from the National Research Foundation of Korea (2014R1A2A1A10051434) to YHL.
[19] [20] [21]
[22]
[23]
[24] [25]
[26]
Appendix A. Supplementary data [27]
Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.micpath.2015.03.004.
[28]
References [29] [1] P. Giardina, V. Faraco, C. Pezzella, A. Piscitelli, S. Vanhulle, et al., Laccase: a neverending story, Cell. Mol. Life Sci. 67 (2010) 369e385. [2] M. Heinzkill, K. Messner, The ligninolytic system of fungi, in: T. Anke (Ed.), Fungal Biotechnology, Chapman & Hall, Weinheim, 1997, pp. 213e226. [3] R.T. Have, P.J.M. Teunissen, Oxidative mechanisms involved in lignin degradation by white rot fungi, Chem. Rev. 101 (2001) 3397e3413. [4] P. Kersten, D. Cullen, Extracellular oxidative systems of the lignin-degrading basidiomycete Phanerochaete chrysosporium, Fungal Genet. Biol. 44 (2007) 77e87. e, J. Garbaye, et al., [5] P.E. Courty, P.J. Hoegger, S. Kilaru, A. Kohler, M. Bue Phylogenetic analysis, genomic organization, and expression analysis of multicopper oxidases in the ectomycorrhizal basidiomycete Laccaria bicolor, New. Phytol. 182 (2009) 736e750. [6] R. Pezet, V. Pont, K. Hoang-Van, Enzymatic detoxication of stilbenes by Botrytis cinerea and inhibition by grape berries proanthrocyanidins, in: K. Verhoeff, N.E. Malathrakis, B. Williamson (Eds.), Recent Advances in Botrytis Research, Pudoc Scientific, Wageningen, 1992, pp. 87e92. [7] T.A. Missal, J.M. Moran, J.A. Corbett, J.K. Lodge, Distinct stress responses of two functional laccases in Cryptococcus neoformans are revealed in the absence of the thiol-specific antioxidant Tsa1, Eukaryot. Cell. 4 (2005) 202e208. [8] E. Rodriguez, M.A. Pickard, R. Vazquez-Duhalt, Industrial dye decolorization by laccases from ligninolytic fungi, Curr. Microbiol. 38 (1999) 27e32. [9] C. Johannes, A. Majcherczyk, Natural mediators in the oxidation of polycyclic aromatic hydrocarbons by laccase mediator system, Appl. Environ. Microbiol. 66 (2000) 524e528. [10] L. Levin, F. Forchiassin, A.M. Ramos, Copper induction of ligninmodifying enzymes in the white rot fungus Trametes trogii, Mycologia 94 (2002) 377e383. [11] C. Eggert, U. Temp, K.E.L. Eriksson, The ligninolytic system of the white rot fungus Pycnoporus cinnabarinus: purification and characterization of the laccase, Appl. Environ. Microbiol. 62 (1996) 1151e1158. [12] J.M. Bollag, A. Leonowicz, Comparative studies of extracellular fungal laccases, Appl. Environ. Microbiol. 48 (1984) 849e854. [13] C. Eggert, U. Temp, J.F.D. Dean, K.L. Eriksson, A fungal metabolite mediates degradation of non-lignin structures and synthetic lignin, FEBS Lett. 391 (1996) 144e148. , H. Kellner, S. Brock, F. Buscot, D. Schlosser, Extracellular laccase [14] M. Sole
[30] [31]
[32] [33] [34] [35] [36]
[37]
[38]
[39]
[40]
[41]
[42]
21
activity and transcript levels of putative laccase genes during removal of the xenoestrogen technical nonylphenol by the aquatic hyphomycete Clavariopsis aquatica, FEMS Microbiol. Lett. 288 (2008) 47e54. U. Temp, U. Zierold, C. Eggert, Cloning and characterization of a second laccase gene from the lignin-degrading basidiomycete Pycnoporus cinnabarinus, Gene 236 (1999) 169e177. rez, A.E. Gonza lez, Differential gene expression in the laccase M. Mansur, T. Sua gene family from basidiomycete I-62 (CECT 20197), Appl. Environ. Microbiol. 64 (1998) 771e774. P.J. Hoegger, S. Kilaru, T.Y. James, J.R. Thacker, U. Kües, Phylogenetic comparison and classification of laccase and related multicopper oxidase protein sequences, FEBS J. 273 (2006) 2308e2326. X. Zhu, P.R. Williamson, Role of laccase in the biology and virulence of Cryptococcus neoformans, FEMS Yeast Res. 5 (2004) 1e10. C.F. Thurston, The structure and function of fungal laccases, Microbiology 140 (1994) 19e26. L. Gianfreda, F. Xu, J.M. Bollag, Laccases: a useful group of oxidoreductive enzymes, Bioremediat J. 3 (1999) 1e26. P. Wang, D.L. Nuss, Identification of a Cryphonectria parasitica laccase gene promoter element involved in cycloheximide-inducible, hypovirus-repressible transcriptional activation, Gene 210 (1998) 79e84. H.J. Chung, B.R. Kwon, J.M. Kim, S.M. Park, J.K. Park, et al., A tannic acideinducible and hypoviral-regulated laccase3 contributes to the virulence of the chestnut blight fungus Cryphonectria parasitica, Mol. Plant Microbe Interact. 21 (2008) 1582e1590. J.M. Kim, S.M. Park, D.H. Kim, Heterologous expression of a tannic acidinducible laccase3 of Cryphonectria parasitica in Saccharomyces cerevisiae, BMC Biotechnol. 10 (2010) 18. M. Garbelotto, P. Gonthier, Biology, epidemiology, and control of Heterobasidion species worldwide, Annu Rev. Phytopathol. 51 (2013) 39e59. J.E. Pratt, C.G. Shaw III, G. Vollbrecht, Modelling disease development in forest stands, in: S. Woodward, J. Stenlid, R. Karjalainen, A. Hüttermann (Eds.), Heterobasidion Annosum: Biology, Ecology, Impact and Control, CAB International, Wallingford, UK, 1998, pp. 213e233. G. Daniel, F. Asiegbu, M. Johansson, The saprotrophic wood-degrading abilities of Heterobasidium annosum intersterility groups P and S, Mycol. Res. 102 (1998) 991e997. F.O. Asiegbu, S. Abu, J. Stenlid, M. Johansson, Sequence polymorphism and molecular characterization of laccase genes of the conifer pathogen Heterobasidion annosum, Mycol. Res. 108 (2004) 136e148. Aerts A. Olson Å, F. Asiegbu, L. Belbahri, O. Bouzid, et al., Insight into trade-off between wood decay and parasitism from the genome of a fungal forest pathogen, New. Phytol. 194 (2012) 1001e1013. J. Choi, K. Cheong, K. Jung, J. Jeon, G.W. Lee, et al., CFGP 2.0: a versatile webbased platform for supporting comparative and evolutionary genomics of fungi and oomycetes, Nucl. Acids Res. 41 (2013) D714eD719. N. Saitou, M. Nei, The neighbor-joining method: anew method for reconstructing phylogenetic trees, Mol. Biol. Evol. 4 (1987) 406e425. K. Tamura, G. Stecher, D. Peterson, A. Filipski, S. Kumar, MEGA6: molecular evolutionary genetics analysis version 6.0, Mol. Biol. Evol. 30 (2013) 2725e2729. J. Felsenstein, Confidence limits on phylogenies: an approach using the bootstrap, Evolution 39 (1985) 783e791. H.J. Vogel, A convenient growth medium for Neurospora crassa, Microb. Genet. Bull. 13 (1956) 42e43. J.P. Ride, The effect of induced lignification in the resistance of wheat cell walls to fungal degradation, Physiol. Plant Pathol. 16 (1980) 187e196. H.C. Kuo, H. Sun, J. Choi, F.O. Asiegbu, J.P.T. Valkonen, et al., Secret lifestyles of Neurospora crassa, Sci. Rep. 4 (2014) 5135. D. Floudas, M. Binder, R. Riley, K. Barry, R.A. Blanchette, et al., The paleozoic origin of enzymatic lignin decomposition reconstructed from 31 fungal genomes, Science 336 (2012) 1715e1719. N.J. Tonukari, J.S. Scott-Craig, J.D. Waltonb, The Cochliobolus carbonum SNF1 gene is required for cell walledegrading enzyme expression and virulence on maize, Plant Cell. 12 (2000) 237e247. N.J. Tonukari, J.S. Scott-Craig, J.D. Walton, Isolation of the carbon catabolite repressor (CREA) gene from the plant-pathogenic fungus Cochliobolus carbonum, DNA Seq. 14 (2003) 103e107. M.S. Lazera, F.D. Pires, L. Camillo-Coura, M.M. Nishikawa, C.C. Bezerra, et al., Natural habitat of Cryptococcus neoformans var. neoformans in decaying wood forming hollows in living trees, J. Med. Vet. Mycol. 34 (1996) 127e131. Y. Lee, C. Park, B. Lee, E.J. Han, T.H. Kim, et al., Effect of nutrients on the production of extracellular enzymes for decolorization of reactive blue 19 and reactive black 5, J. Microbiol. Biotechnol. 16 (2006) 226e231. R. Kannaiyan, N. Mahinpey, T. Mani, R.J. Martinuzzi, V. Kostenko, Enhancement of Dichomitus squalens tolerance to copper and copper-associated laccase activity by carbon and nitrogen sources, Biochem. Eng. J. 67 (2012) 140e147. J.M. Bollag, K.L. Shuttleworth, D.H. Anderson, Laccase-mediated detoxification of phenolic compounds, Appl. Environ. Microbiol. 54 (1998) 3086e3091.
