Curr Microbiol (2014) 69:824–831 DOI 10.1007/s00284-014-0662-0
Presence of fimH, mrkD, and irp2 Virulence Genes in KPC-2Producing Klebsiella pneumoniae Isolates in Recife-PE, Brazil Rita de Ca´ssia Andrade Melo • Emmily Margate Rodrigues de Barros Noel Guedes Loureiro • Heloı´sa Ramos Lacerda de Melo • Maria Ame´lia Vieira Maciel • Ana Catarina Souza Lopes
•
Received: 10 April 2014 / Accepted: 16 June 2014 / Published online: 2 August 2014 Ó Springer Science+Business Media New York 2014
Abstract Klebsiella pneumoniae strains can produce different virulence factors, such as fimbrial adhesins and siderophores, which are important in the colonization and development of the infection. The aims of this study were to determine the occurrence of fimH, mrkD, and irp2 virulence genes in 22 KPC-2-producing K. pneumoniae isolates as well as 22 not producing-KPC isolates, from patients from different hospitals in Recife-PE, Brazil, and also to analyze the clonal relationship of the isolates by enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR). The genes were detected by PCR and DNA sequencing. The blaKPC-2 gene was identified in 22 KPC-positive isolates. On analyzing the antimicrobial susceptibility profile of the isolates, it was detected that polymyxin and amikacin were the antimicrobials of best activity against K. pneumoniae. On the other hand, five isolates exhibited resistance to polymyxin. In the KPC-positive group, was observed a high rate of resistance to cephalosporins, followed by carbapenems. Molecular typing by ERIC-PCR detected 38 genetic profiles, demonstrating a multiclonal spread of the isolates analyzed. It was observed that the virulence genes irp2, mrkD, and fimH were seen to have together a higher
R. de Ca´ssia Andrade Melo (&) E. M. R. de Barros N. G. Loureiro M. A. V. Maciel A. C. Souza Lopes (&) Departamento de Medicina Tropical, Universidade Federal de Pernambuco, Av. Prof. Morais Rego, s/n., Recife, PE 50.732-970, Brazil e-mail: [email protected] A. C. Souza Lopes e-mail: [email protected] H. R. L. de Melo Departamento de Clı´nica Me´dica, Universidade Federal de Pernambuco, Recife, PE 50.732-970, Brazil
123
frequency in the KPC-positive group. The accumulation of virulence genes of KPC-positive K. pneumoniae isolates, observed in this study, along with the multi-resistance impose significant therapeutic limitations on the treatment of infections caused by K. pneumoniae.
Introduction Klebsiella pneumoniae is an opportunistic pathogen frequently associated with hospital infections of the respiratory tract and urinary tract of immune compromised individuals and neonates. Patients’ gastrointestinal tract and health professionals’ hands are the most important reservoirs for the transmission of K. pneumoniae [29]. This bacterium can produce different types of virulence factors, like capsule, siderophores, adhesins, and antimicrobial resistance determinants [15, 16, 25, 33] which are important in the development of the infection [33]. Sahly et al. [26] reported an association between extended-spectrum blactamase (ESBL) production and a greater expression of pathogenicity factors (cell invasion and fimbrial adhesins) and Bachman et al. [2] determined that yersiniabactin is a virulence factor prevalent in K. pneumoniae which produces KPC (K. pneumoniae carbapenemase). The increasing incidence of KPC-producing K. pneumoniae in Brazil [5, 19, 20], in severe infections, brings about the need to elucidate the virulence mechanisms of this pathogen. It has been shown that isolates of K. pneumoniae present greater adherence to human epithelial cells, probably due to the presence of fimbrial or non-fimbrial adhesins. Most clinical isolates of K. pneumoniae express type 1 (mannose-sensitive) and type 3 (mannose-resistant) fimbrial adhesins [23, 24, 26]. Type 3 fimbrial adhesins are able to mediate the binding of K. pneumoniae to various human
R. de Ca´ssia Andrade Melo et al.: Presence of fimH, mrkD and irp2 Virulence Genes
cells, such as endothelial cells, epithelial cells of the respiratory tract and urinary tract [24]. MrkD Protein is an important factor in binding of the microorganism to collagen molecules [15]. Isolates of K. pneumoniae can also produce siderophores in which, among enterobacteria, the three most prevalent systems are: aerobactin, enterobactin, and yersiniabactin [16]. Some bacteria, such as K. pneumoniae have developed siderophores, iron chelators, since, in mammals, this metal is bonded to proteins such as hemoglobin, ferritin, transferrin, and lactoferrin which leads to a low level of free iron [6]. In the pathogenic species of the genus Yersinia, a 36–43 kb fragment of chromosomal DNA corresponds to the so-called pathogenicity island, deemed an high-pathogenicity island, in which genes involved in the synthesis of yersiniabactin siderophore such as irp2 are present. In pathogenic Yersinia species, the presence of yersiniabactin is correlated to the phenotype of high pathogenicity, such as the ability to cause systemic infections and death in mice [6]. Yersiniabactin has been detected in some species of the Enterobacteriaceae family such as Escherichia coli, Klebsiella spp., Citrobacter spp. and Enterobacter cloacae [1, 30]. Outbreaks of infectious diseases are often the result of exposure to a causative agent of common origin, the descendants of which are genetically identical or closely related. In epidemiological terms, the organisms involved in outbreaks are clonally related [22]. K. pneumoniae infections may be clonal, indicating the transmission of a common strain, or a multiclonal one, showing the dissemination of genetically distinct strains [5, 28]. Due to the increasing incidence in Brazil of K. pneumoniae producing KPC in serious hospital infections, this study aims to determine the occurrence of genetic virulence factors associated with this bacterial species and also to analyze the clonal relationship of the isolates.
Materials and Methods Bacterial Isolates Were analyzed 44 K. pneumoniae isolates, including 22 blaKPC positive and 22 blaKPC negative isolates, selected from the Collection of Bacterial Culture of the Laboratory of Bacteriology and Molecular Biology (Departamento de Medicina Tropical, CCS, UFPE, Brazil), held in stock frozen in 20 % glycerol at -70 °C. For analysis, the strains were grown in BHI Broth for 18 h at 37 °C and seeded in agar nutrient or LB Agar. The K. pneumoniae isolates analyzed came from patients from 5 different hospitals in Recife-PE, including 4 public hospitals, in which the samples were taken in 2007, 2011, and 2012, and one private hospital, where the samples were obtained in 2008. All the isolates were identified
825
biochemically by an automated system Bactec 9120/PhoenixBD. Detection of the Susceptibility to Antimicrobials All isolates were analyzed for antimicrobial resistance by disk diffusion test on Mueller-Hinton agar [7], using the following antimicrobials: amikacin (AMI), amoxicillin, amoxicillin/clavulanate, aztreonam (ATM), cefepime, cefotaxime, cefoxitin, ceftazidime, ciprofloxacin, gentamicin (GEN), imipenem (IPM), meropenem (MPM) ertapenem (ERT), piperacillin/tazobactam, polymyxin B (POL), trimethoprim/sulfamethoxazole. After 18 h of incubation at 37 °C, the result was interpreted as sensitive, intermediate, or resistant. Total Extraction of DNA The total extraction of DNA was performed using a commercial kit ZR Fungal/Bacterial DNA Mini Prep (Zymo Research), and the procedure was conducted according to the manufacturer’s instructions. For the procedure, the K. pneumoniae isolates were first grown in LB (Luria Bertani) broth for 24 h at 37 °C. After extraction, the DNA was quantified by a NanoDrop 2000c UV–Vis Spectrophotometer. ERIC-PCR For the enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) method, the primers described in Table 1 were used. The amplification reactions were prepared in a total volume of 25 lL per tube, comprising a final concentration: 1.5 mM of MgCl2, 200 lM of dNTP, 1U of Taq DNA polymerase, 2 lM of each primer, 19 buffer, and 10 ng of DNA. A negative control was included in each round of amplification. The amplifications were carried out in cycles with an initial denaturation at 95 °C for 3 min followed by 40 cycles, each cycle lasting for 1 min at 92 °C for denaturation, 1 min at 36 °C for annealing the primer, and 8 min at 72 °C for elongation. After these cycles, one final elongation step of 16 min at 72 °C occurred. The analysis of the amplified fragments by ERIC-PCR, and constructing the dendrogram were performed using Darwin 5.0 Software. PCR Conditions for Detecting the fimH, mrkD, and irp2 Virulence Genes and blaKPC Gene For PCR amplification of the blaKPC, fimH, mrkD, and irp2 genes, the primers described in Table 1 were used. The amplification reactions were prepared in a total volume of 25 lL per tube, comprising a final concentration of: 1.5 mM of MgCl2, 200 lM of dNTP, 1U Taq DNA polymerase, 2 lM of each primer, 19 buffer, and 1 ng of DNA.
123
R. de Ca´ssia Andrade Melo et al.: Presence of fimH, mrkD and irp2 Virulence Genes
826 Table 1 Primers used for PCR and DNA sequencing
Gene
Primer
Sequence (50 –30 )
Temp.a
Reference
kpc
KPC-1a
TGTCACTGTATCGCCGTC
63 °C
Yigit et al. (2001)
KPC-1b
CTCAGTGCTCTACAGAAAACC
FIM-H F
TCCACAGTCGCCAACGCTTC
58 °C
Stahlhul et al. [32]
FIM-H R
GCTCAGAATCAACATCGGTAAC
MRKD-2 F
CCACCAACTATTCCCTCGAA
62 °C
Sahly et al. [26]
65 °C
Guilvout et al. [12]
36 °C
Duan et al. [9]
fimH mrkD irp2 NA not applicable a
Temp, annealing temperature of the primers
NA
MRKD-2 R
ATGGAACCCACATCGACATT
IRP2 F
ATTTCTGGCGCACCATCT
IRP2 R
GCGCCGGGTATTACGGACTTC
ERIC-1
ATGTAAGCTCCTGGGGATTAAC
ERIC-2
AAGTAAGTGACTGGGGTGAGCG
The amplifications of the blaKPC, fimH, and mrkD genes were performed in cycles with initial denaturing at 95 °C for 5 min followed by 33 cycles, each cycle consisting of 1 min at 94 °C for denaturation, 1 min for annealing of the primers (Table 1), and 2 min at 72 °C for elongation. After these cycles, the final elongation step was carried out at 68 °C for 2 min. Irp2 gene amplifications were performed with initial denaturing cycles at 95 °C for 2 min, followed by 30 cycles, each cycle consisting of 1 min at 95 °C for denaturation, 2 min at 65 °C for annealing of the primers, and 3 min at 72 °C for elongation. After these cycles, the final elongation step was carried out at 72 °C for 7 min. The PCR products were stained with Blue Green Loading Dye (LGC Biotechnology) and subjected to electrophoresis in 1.5 % agarose gel in TBE buffer at constant voltage of 100 V, and then were visualized and photographed by an ultra-violet transilluminator in the Vilber Lourmat Photocap photo documentation system. DNA Sequencing All KPC-positive isolates by PCR were sequenced. For DNA sequencing of the fimH, mrkD, and irp2 virulence genes, the isolate K32-A2 was selected because it is representative of the main clonal group. The PCR products that were positive for the genes investigated were purified by the Kit for purifying a product, WizardÒ SV Gel and PCR Clean-Up System (Promega) and sequenced by the deoxyribonucleotide chain termination method [27]. For sequencing, the primers described in Table 1 were used. The nucleotide sequences were analyzed using Basic Local Alignment Search Tool program (http://www.ncbi.nlm.nih. gov/) and Clustal W from the European Bioinformatics Institute (http://www.cbi.ac.uk/). The sequences quality was verified using the Staden Package (http://staden.sour ceforge.net/) and it was considered a Q-value above 20. The sequences were deposited in the GenBank Database under the following accession: KF562073, KF562074, KF562075, KF562076, KF585214, and KJ645920.
123
Results Susceptibility to the Antimicrobials On analyzing the antimicrobial susceptibility profile of the bacterial isolates, it was observed that AMI (n = 38/ 86.4 %) and POL (n = 40/91 %) were the antimicrobials of best activity to inhibit K. pneumoniae, both KPC-positive and KPC–negative ones. It was also found that 5 isolates showed resistance to polymyxin, 3 of which were in the KPC-positive group, and 2 in the KPC-negative group. Additionally, the carbapenems, IPM (n = 24/54.5 %), and MPM (n = 25/56.9 %) also showed good activity against K. pneumoniae. In the KPC-positive group, 21 isolates were resistant to ERT, while as to IPM and MPM there were 18 and 17 such isolates, respectively. In the KPCnegative group, 11 isolates were resistant to ERT, while no isolate showed resistance to IPM and MPM. A high resistance to the cephalosporins was observed in the KPCpositive group, where all isolates presented resistance or intermediate resistance to this group of antimicrobials. Detection of the blaKPC, fimH, irp2, and mrkD The blaKPC-2 gene was identified in the 22 KPC-positive isolates. When detecting virulence genes, it was observed that among the KPC-positive isolates, mrkD and fimH genes are more related to each other, as they were always seen to be positive in the same 15 isolates (Table 2). Of the 22 KPC-positive isolates studied, 7 were negative for all the genes investigated. In relation to KPC-negative isolates, this group was more heterogeneous regarding the presence of virulence genes, only 2 isolates (K36-A2, K2OC) did not show any of the inquired genes, and 2 others (K2-A2 and K2-MA) were negative for all genes (Table 3). In this group, the mrkD and fimH genes were shown to be in the same isolates, thus demonstrating a relationship between these two genes. The irp2 gene was observed in only 9 of the 44 isolates studied, there being 7 isolates in
R. de Ca´ssia Andrade Melo et al.: Presence of fimH, mrkD and irp2 Virulence Genes Table 2 Source of isolation, the presence of virulence genes, and ERIC-PCR profile of K. pneumoniae isolates carriers the gene blaKPC
Isolatesa
Date of isolation
Source of isolation
K3-A2
25.07.2011
K5-A2
25.07.2011
K7-A2
827
Presence of virulence genes
Profile of ERIC-PCR
Rectal swab
–
5E
Rectal swab
irp2, mrkD, fimH
7E
08.08.2011
Rectal swab
mrkD, fimH
8E
K8-A2
22.08.2011
Rectal swab
–
9E
K11-A2
22.08.2011
Rectal swab
mrkD, fimH
10E
K14-A2
19.09.2011
Rectal swab
–
12E
K16-A2
26.09.2011
Rectal swab
–
13E
K19-A2
17.10.2011
Rectal swab
mrkD, fimH
14E
K20-A2
17.10.2011
Rectal swab
mrkD, fimH
15E
K21-A2
25.10.2011
Rectal swab
–
5E
K24-A2
28.11.2011
Rectal swab
irp2, mrkD, fimH
17E
K25-A2
18.01.2012
Rectal swab
irp2, mrkD, fimH
18E
K26-A2
18.01.2012
Tracheal aspirate
mrkD, fimH
18E
K29-A2
18.01.2012
Rectal swab
irp2, mrkD, fimH
19E
K31-A2 K32-A2
06.02.2012 06.02.2012
Urine Rectal swab
irp2, mrkD, fimH irp2, mrkD, fimH
20E 19E
K33-A2
06.02.2012
Rectal swab
mrkD, fimH
19E
K34-A2
08.02.2012
Rectal swab
–
21E
K1-C2
22.09.2011
Rectal swab
mrkD, fimH
23E
K2-C2
16.08.2011
Rectal swab
mrkD, fimH
23E
Identification of bacterial isolates: A2, C2, and OC, Public Hospitals
K1-OC
02.12.2011
Rectal swab
–
25E
K3-OC
12.12.2011
Rectal swab
irp2, mrkD, fimH
27E
Table 3 Source of isolation, the presence of virulence genes, and ERIC-PCR profile of K. pneumoniae isolates non-carries the gene blaKPC
Isolates
Date of isolation
a
a
Identification of bacterial isolates: A, A2, OC, and DH, Public Hospitals; P Private Hospital
Source of isolation
Presence of virulence genes
ERIC-PCR profile
K2-A
04.05.2007
Urine
mrkD, fimH
1E
K4-A
11.05.2007
Tracheal aspirate
fimH
2E
K9-A
04.06.2007
Tracheal aspirate
mrkD, fimH
3E
K2-A2
30.06.2011
Urine
–
4E
K4-A2
25.07.2011
Rectal swab
mrkD, fimH
6E
K13-A2
19.09.2011
Rectal swab
mrkD, fimH
11E
K22-A2
03.11.2011
Wound secretion
mrkD, fimH
16E
K35-A2
13.03.2012
Blood
mrkD, fimH
22E
K36-A2
21.03.2012
Urethral secretion
irp2, mrkD, fimH
21E
K2-DH
15.09.2011
Urine
mrkD
24E
K2-OC
12.12.2011
Blood
irp2, mrkD, fimH
26E
K2-P
10.03.2008
Urine
mrkD, fimH
28E
K3-P
10.03.2008
Bone fragment
mrkD, fimH
29E
K4-P
08.03.2008
Abscess secretion
mrkD
30E
K6-P K7-P
13.03.2008 23.03.2008
Blood Urine
mrkD, fimH mrkD
31E 32E
K11-P
15.04.2008
Urine
mrkD, fimH
33E
K14-P
22.04.2008
Blood
mrkD
34E
K17-P
04.05.2008
Urine
mrkD, fimH
35E
K18-P
01.05.2008
Urine
mrkD, fimH
36E
K19-P
29.04.2008
Urine
mrkD, fimH
37E
K21-P
03.05.2008
Peritoneal secretion
mrkD, fimH
38E
123
828
R. de Ca´ssia Andrade Melo et al.: Presence of fimH, mrkD and irp2 Virulence Genes
Fig. 1 Dendrogram generated by ERIC-PCR using the software Darwin 5.0, illustrating the relationship of profiles of ERIC-PCR KPC-positive group
the KPC-positive group, and only 2 in the KPC-negative group, and always accompanied by the other genes investigated in the study. For the sequencing of the PCR products of the virulence genes fimH, mrkD, and irp2, the isolate K32-A2 was selected because it is representative of the largest clonal group carrying the blaKPC-2 gene (Profile 19E using ERIC-PCR) that harboured all three of the virulence genes investigated. ERIC-PCR Using ERIC-PCR analysis, 38 genetic profiles (Figs. 1, 2) were found among the 44 isolates of K. pneumoniae analyzed. The 21E profile grouped 2 clonally related isolates. The 23E profile grouped 2 isolates, both being KPC-positive, and presenting identical resistance profiles as well as the presence of the same virulence genes investigated. The 18E profile presents two isolates, both KPC-positive, with an identical resistance profile, but they differ in the presence of the virulence genes. The 19E profile has 3 KPCpositive isolates, in which all have the same resistance profile and differ in the presentation of the virulence genes studied, where the K33-A2 isolate does not have the irp2 gene unlike the other strains of the group (K29-A2 and K32-A2). What can also be seen is the identical profile of
123
resistance and of virulence genes in isolates that did not present a clonal relationship such as isolates K3-P and K6P, both of which were KPC negative. No relationship between isolates from different hospitals was detected.
Discussion The ERIC-PCR grouped the isolates into 38 genetic profiles, demonstrating that isolates of K. pneumoniae from Recife, Brazil, present predominantly multiclonal origin and spread. This confirms previous studies in Recife [5, 31], which showed a high genetic heterogeneity of this bacterial species. On the other hand, five profiles of ERICPCR grouped more than one bacterial isolate with a clonal relationship, in which the strains of group 21E showed different resistance profiles, thus confirming the study by Ben-Hamouda et al. [3] and Cabral et al. [5], who found identical patterns of ERIC-PCR with different susceptibility profiles. The 4 other profiles presented clones with an identical susceptibility profile, corroborating the study by Ktari et al. [14] who found the same pattern of susceptibility in identical isolates of K. pneumoniae typed by PFGE analysis. According to Tosin et al. [34] when strains are genetically distinct, the resistance of one group of
R. de Ca´ssia Andrade Melo et al.: Presence of fimH, mrkD and irp2 Virulence Genes
829
Fig. 2 Dendrogram generated by ERIC-PCR using the software Darwin 5.0, illustrating the relationship of the profiles of ERIC-PCR KPCnegative group
microorganisms may be due to selective pressure, which favors resistance phenotypes within an independent group of strains, as in the case of the K3-P and K6-P isolates, which showed no clonal relationship. Yet they do have an identical resistance profile. Most clinical isolates of K. pneumoniae analyzed in this study, both KPC-positive and KPC-negative ones, were resistant to multiple antimicrobials, especially to b-lactams, including third-generation cephalosporins and to ATM. On the other hand, most of the isolates were sensitive to GEN, AMI, and POL. It should be noted that 5 isolates showed resistance to POL, 3 isolates from the KPC-positive group, and 2 from the KPC-negative group. This is the first ever report of isolates of K. pneumoniae resistant to POL in Brazilian north-east. Pereira et al. [21], showed polymyxin resistance in K. pneumoniae isolates from Brazilian south and south-east. Additionally, Mamina et al. [18] and Vaara et al. [35], in Italy, found in their studies, isolates of K. pneumoniae resistant to colistin, an antimicrobial polypeptide of the same group as polymyxin. Measures should be applied to contain selective pressure and the acquisition of resistance genes through horizontal transmission in order to avoid the spread of resistant strains, so that the latest treatment options may be preserved, such as polymyxin, in
combating severe infections caused by KPC-producing organisms. It is noteworthy that three polymyxin resistant KPC-positive isolates (K5-A2, K7-A2 and K20-A2) also had virulence genes for the production of type 1 and type 3 fimbrial adhesins and one of them (K5-A2) also had irp2 gene. The combination of the blaKPC gene with virulence genes in multidrug resistant K. pneumoniae isolates may further exacerbate infections caused by these bacteria and hamper treatment. A high resistance to the cephalosporins was also observed in the KPC-positive group, where the isolates presented resistance or intermediate resistance to this group of antimicrobials. These results corroborate the study by Han et al. [13], in China, where the rate of resistance to blactams reached 100 % in isolates of K. pneumoniae, except carbapenems. The emergence of the resistance to carbapenems in K. pneumoniae is mainly related to the production of carbapenemases such as KPC [17, 21, 38]. There was evidence that ERT was the best antimicrobial for detecting phenotypic resistance to the group of carbapenems. The false in vitro sensitivity to the carbapenems, IPM, and MPM, might well explain many episodes of unsuccessful treatment in the attempt to control many hospital infections [4, 36]. Therefore,
123
830
R. de Ca´ssia Andrade Melo et al.: Presence of fimH, mrkD and irp2 Virulence Genes
it is recommended always to include ERT in phenotypic tests for detecting resistance to carbapenems. According to Dienstmann et al. [8], resistance to carbapenems may occur due to the combination of the impaired outermembrane permeability (porin changes) along with chromosomal (AmpC) or ESBLs. This may explain the fact that some isolates did not have the blaKPC gene but presented resistance to carbapenems. Therefore, it was not possible to establish a relationship between the presence of the blaKPC gene and multiresistance. Bachman et al. [2] reported that yersiniabactin siderophore is a virulence factor prevalent in K. pneumoniae that produces KPC. In the present study, 30.4 % of the isolates of the KPC-positive group had the irp2 gene. The fact that some bacterial isolates analyzed herein were clonally related isolates by ERIC-PCR (19E) but only one of them did not carry the irp2 gene is an evidence that a transference mechanism is responsible for the spread of irp2 gene in K. pneumoniae. In the KPC-positive group, it was observed that the irp2, mrkD, and fimH virulence genes taken together had a higher frequency than in the KPC-negative group. The accumulation of virulence genes responsible for the production of type 1 and type 3 fimbrial adhesins and yersiniabactin, observed in this study, show that the KPC-positive isolates analyzed can produce important virulence factors such that the infection becomes established. Ejrnaes [10] related that type 1 fimbriae, in E. coli, are considered to be one of the most important virulence factor involved in the establishment of a urinary tract infection mediating extracellular binding to the host urothelium and invasion. Wilson et al. [37], have stated that the expression of adhesins is important during the colonization stage when diverse mechanical forces such as peristalsis and salivary secretion all act to hamper bacterial invasion within the host. Additionally, yersiniabactin could act as invasiveness enhancers in K. pneumonia [11]. Thus, the type 1 and type 3 fimbrial adhesins detected concomitantly in some isolates with yersiniabactin constitute a threat for vulnerable populations, even more if they are associated with antibiotic resistance. The accumulation of virulence genes responsible for the synthesis of fimbrial adhesins and yersiniabactin siderophore in positive KPC isolates, together with the antimicrobial multiresistance observed in this study, impose significant therapeutic limitations on the treatment of infections caused by K. pneumoniae in Recife-PE, Brazil.
References 1. Bach S, De Almeida A, Carniel E (2000) The Yersinia highpathogenicity island is present in different members of the family Enterobacteriaceae. FEMS Microbiol Lett 183:289–294
123
2. Bachman MA, Oyler JE, Burns SH et al (2011) Klebsiella pneumoniae yersiniabactin promotes respiratory tract infection through evasion of lipocalin 2. Infect Immun 79:3309–3316 3. Ben-Hamouda T, Foulon T, Ben-Cheikh-Masmoudi A et al (2003) Molecular epidemiology of an outbreak of multiresistant Klebsiella pneumoniae in a Tunisian neonatal ward. J Med Microbiol 52:427–433 4. Bratu S, Landman D, Haag R et al (2005) Rapid spread of carbapenem-resistant Klebsiella pneumoniae in New York City. Arch Intern Med 165:1430–1435 5. Cabral AB, Melo RCA, Maciel MAV et al (2012) Multidrug resistance genes, including blaKPC and blaCTX-M-2, among Klebsiella pneumoniae isolated in Recife, Brazil. Rev Soc Bras Med Trop 45:572–578 6. Carniel E (2001) The Yersinia high-pathogenicity island: an ironuptake island. Microbes Infect 3:561–569 7. Clinical and Laboratory Standards Institute (CLSI) (2011) Performance standards for antimicrobial susceptibility testing; Twenty-first informational supplement. CLSI document M100S21, Wayne, PA: CLSI 8. Dienstmann R, Picoli SU, Meyer G et al (2010) Avaliac¸a˜o fenotı´pica da enzima Klebsiella pneumoniae carbapenemase (KPC) em Enterobacteriaceae de ambiente hospitalar. J Bras Patol Med Lab 46:23–27 9. Duan H, Chai T, Liu J et al (2009) Source identification of airborne Escherichia coli of swine house surroundings using ERICPCR and REP-PCR. Environ Res 109:511–517 10. Ejrnæs K (2011) Bacterial characteristics of importance for recurrent urinary tract infections caused by Escherichia coli. Dan Med Bull 58:1–22 11. El Fertas-Aissani R, Messai Y, Alouache S et al (2013) Virulence profiles and antibiotic susceptibility patterns of Klebsiella pneumoniae strains isolated from different clinical specimens. Pathol Biol (Paris) 61:209–216 12. Guilvout I, Mercereau-Puijalon O, Bonnefoy S et al (1993) Highmolecular-weight protein 2 of Yersinia enterocolitica is homologous to AngR of Vibrio anguillarum and belongs to a family of proteins involved in nonribosomal peptide synthesis. J Bacteriol 175:5488–5504 13. Han HL, Huang Y, Zhang MM et al (2012) Clinical analysis of early postoperative pulmonary infection in children after living donor liver transplantation. Zhonghua Er Ke Za Zhi 50:612–616 14. Ktari S, Arlet G, Mnif B et al (2006) Emergence of multidrugresistant Klebsiella pneumoniae isolates producing VIM-4 metallo-b-lactamase, CTX-M-15 extended-spectrum b-lactamase, and CMY-4 AmpC b-lactamase in a Tunisian University Hospital. Antimicrob Agents Chemother 50:4198–4201 15. Langstraat J, Bohse M, Clegg S (2001) Type 3 Fimbrial (mrkA) of Klebsiella pneumoniae, but not the fimbrial adhesin (mrkD), facilitates biofilm formation. Infect Immun 69:5805–5812 16. Lawlor MS, O’Connor C, Miller VL (2007) Yersiniabactin is a virulence factor for Klebsiella pneumoniae during pulmonary infections. Infect Immun 75:1463–1472 17. Leavitt A, Chmelnitsky I, Colodner R et al (2009) Ertapenem resistance among extended-spectrum-b-lactamase-producing Klebsiella pneumoniae isolates. J Clin Microbiol 47:969–974 18. Mamina C, Bonura C, Di Bernardo F et al (2012) Ongoing spread of colistin-resistant Klebsiella pneumoniae in different wards of an acute general hospital, Italy, June to December 2001. Euro Surveill 17:20248 19. Monteiro J, Santos AF, Asensi MD et al (2009) First report of KPC-2-producing Klebsiella pneumoniae strains in Brazil. Antimicrob Agents Chemother 53:333–334 20. Peirano G, Seki L, Passos VLV et al (2009) Carbapenem-hydrolysing beta-lactamase KPC-2 in Klebsiella pneumoniae
R. de Ca´ssia Andrade Melo et al.: Presence of fimH, mrkD and irp2 Virulence Genes
21.
22.
23.
24.
25.
26.
27.
28.
isolated in Rio de Janeiro, Brazil. J Antimicrob Chemother 63:265–268 Pereira PS, Arau´jo CFM, Seki LM et al (2012) Update of the molecular epidemiology of KPC-2-producing Klebsiella pneumoniae in Brazil: spread of clonal complex 11(ST11, ST437 and ST340). J Antimicrob Chemother 68:312–316 Pfaller MA, Acar J, Jones RN et al (2001) Integration of molecular characterization of microorganisms in a global antimicrobial resistance surveillance program. Clin Infect Dis 32:156–167 Podschun R, Fischer A, Ullman U (2000) Characterization of Klebsiella terrigena strains from humans: haemagglutinins, serum resistance, siderophore synthesis, and serotypes. Epidemiol Infect 125:71–78 Podschun R, Fischer A, Ullman U (2000) Expression of putative virulence factors by clinical isolates of Klebsiella planticola. J Med Microbiol 49:115–119 Ramos PIV, Pica˜o RC, Almeida LGP et al (2014) Comparative analysis of the complete genome of KPC-2-producing Klebsiella pneumoniae Kp13 reveals remarkable genome plasticity and a wide repertoire of virulence and resistance mechanisms. BMC Genomics 15:54 Sahly H, Navon-Venezia S, Roesler L et al (2008) Extendedspectrum b-lactamase production is associated with an increase in cell invasion and expression of fimbrial adhesins in Klebsiella pneumoniae. Antimicrob Agents Chemother 52:3029–3034 Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A 74:5463–5467 Santos DF, Pimenta FC, Alves R et al (2008) Extended-spectrum b-lactamases producing Klebsiella pneumoniae isolated in two hospitals in Goiaˆnia/Brazil: detection, prevalence, antimicrobial susceptibility and molecular typing. Braz J Microbiol 39:608–612
831
29. Schjørring S, Struve C, Krogfelt KA (2008) Transfer of antimicrobial resistance plasmids from Klebsiella pneumoniae to Escherichia coli in the mouse intestine. J Antimicrob Chemother 62:1086–1093 30. Schubert S, Cuenca S, Fisher D et al (2000) High-pathogenicity island of Yersinia pestis in Enterobacteriaceae isolated from blood cultures and urine samples: prevalence and functional expression. J Infect Dis 182:1268–1271 31. Souza Lopes AC, Rodrigues JF, Morais Ju´nior MA (2005) Molecular typing of Klebsiella pneumoniae isolates from public hospitals in Recife, Brazil. Microbiol Res 160:37–46 32. Stahlhut SG, Chattopadhyay S, Struve C et al (2009) Population variability of the fimH type 1 fimbrial adhesin in Klebsiella pneumoniae. J Bacteriol 191:1941–1950 33. Struve C, Bojer M, Krogfelt KA (2009) Identification of a conserved chromosomal region encoding Klebsiella pneumoniae type 1 and type 3 fimbriae and assessment of the role of fimbriae in pathogenicity. Infect Immun 77:5016–5024 34. Tosin I, Silbert S, Sader HS (2003) The use of molecular typing to evaluate the dissemination of antimicrobial resistance among Gramnegative rods in Brazilian Hospitals. Braz J Infect Dis 7:360–369 35. Vaara M, Sader HS, Rhomberg PR et al (2012) Antimicrobial activity of the novel polymyxin derivative NAB739 tested against Gram-negative pathogens. J Antimicrob Chemother 68:636–639 36. Wallace KMP, Bethel CR, Destler AM et al (2010) Inhibitor resistance in the KPC-2 b-lactamases, a preeminent property of this class A b-lactamases. Antimicrob Agents Chemother 54:890–897 37. Wilson JW, Schurr MJ, LeBlanc CL et al (2002) Mechanisms of bacterial pathogenicity. Postgrad Med J 78:216–224 38. Woodford N, Dallow JW, Hill RL et al (2007) Ertapenem resistance among Klebsiella and Enterobacter submitted in the UK to a reference laboratory. Int J Antimicrob Agents 29:456–459
123
Presence of fimH, mrkD, and irp2 Virulence Genes in KPC-2Producing Klebsiella pneumoniae Isolates in Recife-PE, Brazil Rita de Ca´ssia Andrade Melo • Emmily Margate Rodrigues de Barros Noel Guedes Loureiro • Heloı´sa Ramos Lacerda de Melo • Maria Ame´lia Vieira Maciel • Ana Catarina Souza Lopes
•
Received: 10 April 2014 / Accepted: 16 June 2014 / Published online: 2 August 2014 Ó Springer Science+Business Media New York 2014
Abstract Klebsiella pneumoniae strains can produce different virulence factors, such as fimbrial adhesins and siderophores, which are important in the colonization and development of the infection. The aims of this study were to determine the occurrence of fimH, mrkD, and irp2 virulence genes in 22 KPC-2-producing K. pneumoniae isolates as well as 22 not producing-KPC isolates, from patients from different hospitals in Recife-PE, Brazil, and also to analyze the clonal relationship of the isolates by enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR). The genes were detected by PCR and DNA sequencing. The blaKPC-2 gene was identified in 22 KPC-positive isolates. On analyzing the antimicrobial susceptibility profile of the isolates, it was detected that polymyxin and amikacin were the antimicrobials of best activity against K. pneumoniae. On the other hand, five isolates exhibited resistance to polymyxin. In the KPC-positive group, was observed a high rate of resistance to cephalosporins, followed by carbapenems. Molecular typing by ERIC-PCR detected 38 genetic profiles, demonstrating a multiclonal spread of the isolates analyzed. It was observed that the virulence genes irp2, mrkD, and fimH were seen to have together a higher
R. de Ca´ssia Andrade Melo (&) E. M. R. de Barros N. G. Loureiro M. A. V. Maciel A. C. Souza Lopes (&) Departamento de Medicina Tropical, Universidade Federal de Pernambuco, Av. Prof. Morais Rego, s/n., Recife, PE 50.732-970, Brazil e-mail: [email protected] A. C. Souza Lopes e-mail: [email protected] H. R. L. de Melo Departamento de Clı´nica Me´dica, Universidade Federal de Pernambuco, Recife, PE 50.732-970, Brazil
123
frequency in the KPC-positive group. The accumulation of virulence genes of KPC-positive K. pneumoniae isolates, observed in this study, along with the multi-resistance impose significant therapeutic limitations on the treatment of infections caused by K. pneumoniae.
Introduction Klebsiella pneumoniae is an opportunistic pathogen frequently associated with hospital infections of the respiratory tract and urinary tract of immune compromised individuals and neonates. Patients’ gastrointestinal tract and health professionals’ hands are the most important reservoirs for the transmission of K. pneumoniae [29]. This bacterium can produce different types of virulence factors, like capsule, siderophores, adhesins, and antimicrobial resistance determinants [15, 16, 25, 33] which are important in the development of the infection [33]. Sahly et al. [26] reported an association between extended-spectrum blactamase (ESBL) production and a greater expression of pathogenicity factors (cell invasion and fimbrial adhesins) and Bachman et al. [2] determined that yersiniabactin is a virulence factor prevalent in K. pneumoniae which produces KPC (K. pneumoniae carbapenemase). The increasing incidence of KPC-producing K. pneumoniae in Brazil [5, 19, 20], in severe infections, brings about the need to elucidate the virulence mechanisms of this pathogen. It has been shown that isolates of K. pneumoniae present greater adherence to human epithelial cells, probably due to the presence of fimbrial or non-fimbrial adhesins. Most clinical isolates of K. pneumoniae express type 1 (mannose-sensitive) and type 3 (mannose-resistant) fimbrial adhesins [23, 24, 26]. Type 3 fimbrial adhesins are able to mediate the binding of K. pneumoniae to various human
R. de Ca´ssia Andrade Melo et al.: Presence of fimH, mrkD and irp2 Virulence Genes
cells, such as endothelial cells, epithelial cells of the respiratory tract and urinary tract [24]. MrkD Protein is an important factor in binding of the microorganism to collagen molecules [15]. Isolates of K. pneumoniae can also produce siderophores in which, among enterobacteria, the three most prevalent systems are: aerobactin, enterobactin, and yersiniabactin [16]. Some bacteria, such as K. pneumoniae have developed siderophores, iron chelators, since, in mammals, this metal is bonded to proteins such as hemoglobin, ferritin, transferrin, and lactoferrin which leads to a low level of free iron [6]. In the pathogenic species of the genus Yersinia, a 36–43 kb fragment of chromosomal DNA corresponds to the so-called pathogenicity island, deemed an high-pathogenicity island, in which genes involved in the synthesis of yersiniabactin siderophore such as irp2 are present. In pathogenic Yersinia species, the presence of yersiniabactin is correlated to the phenotype of high pathogenicity, such as the ability to cause systemic infections and death in mice [6]. Yersiniabactin has been detected in some species of the Enterobacteriaceae family such as Escherichia coli, Klebsiella spp., Citrobacter spp. and Enterobacter cloacae [1, 30]. Outbreaks of infectious diseases are often the result of exposure to a causative agent of common origin, the descendants of which are genetically identical or closely related. In epidemiological terms, the organisms involved in outbreaks are clonally related [22]. K. pneumoniae infections may be clonal, indicating the transmission of a common strain, or a multiclonal one, showing the dissemination of genetically distinct strains [5, 28]. Due to the increasing incidence in Brazil of K. pneumoniae producing KPC in serious hospital infections, this study aims to determine the occurrence of genetic virulence factors associated with this bacterial species and also to analyze the clonal relationship of the isolates.
Materials and Methods Bacterial Isolates Were analyzed 44 K. pneumoniae isolates, including 22 blaKPC positive and 22 blaKPC negative isolates, selected from the Collection of Bacterial Culture of the Laboratory of Bacteriology and Molecular Biology (Departamento de Medicina Tropical, CCS, UFPE, Brazil), held in stock frozen in 20 % glycerol at -70 °C. For analysis, the strains were grown in BHI Broth for 18 h at 37 °C and seeded in agar nutrient or LB Agar. The K. pneumoniae isolates analyzed came from patients from 5 different hospitals in Recife-PE, including 4 public hospitals, in which the samples were taken in 2007, 2011, and 2012, and one private hospital, where the samples were obtained in 2008. All the isolates were identified
825
biochemically by an automated system Bactec 9120/PhoenixBD. Detection of the Susceptibility to Antimicrobials All isolates were analyzed for antimicrobial resistance by disk diffusion test on Mueller-Hinton agar [7], using the following antimicrobials: amikacin (AMI), amoxicillin, amoxicillin/clavulanate, aztreonam (ATM), cefepime, cefotaxime, cefoxitin, ceftazidime, ciprofloxacin, gentamicin (GEN), imipenem (IPM), meropenem (MPM) ertapenem (ERT), piperacillin/tazobactam, polymyxin B (POL), trimethoprim/sulfamethoxazole. After 18 h of incubation at 37 °C, the result was interpreted as sensitive, intermediate, or resistant. Total Extraction of DNA The total extraction of DNA was performed using a commercial kit ZR Fungal/Bacterial DNA Mini Prep (Zymo Research), and the procedure was conducted according to the manufacturer’s instructions. For the procedure, the K. pneumoniae isolates were first grown in LB (Luria Bertani) broth for 24 h at 37 °C. After extraction, the DNA was quantified by a NanoDrop 2000c UV–Vis Spectrophotometer. ERIC-PCR For the enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) method, the primers described in Table 1 were used. The amplification reactions were prepared in a total volume of 25 lL per tube, comprising a final concentration: 1.5 mM of MgCl2, 200 lM of dNTP, 1U of Taq DNA polymerase, 2 lM of each primer, 19 buffer, and 10 ng of DNA. A negative control was included in each round of amplification. The amplifications were carried out in cycles with an initial denaturation at 95 °C for 3 min followed by 40 cycles, each cycle lasting for 1 min at 92 °C for denaturation, 1 min at 36 °C for annealing the primer, and 8 min at 72 °C for elongation. After these cycles, one final elongation step of 16 min at 72 °C occurred. The analysis of the amplified fragments by ERIC-PCR, and constructing the dendrogram were performed using Darwin 5.0 Software. PCR Conditions for Detecting the fimH, mrkD, and irp2 Virulence Genes and blaKPC Gene For PCR amplification of the blaKPC, fimH, mrkD, and irp2 genes, the primers described in Table 1 were used. The amplification reactions were prepared in a total volume of 25 lL per tube, comprising a final concentration of: 1.5 mM of MgCl2, 200 lM of dNTP, 1U Taq DNA polymerase, 2 lM of each primer, 19 buffer, and 1 ng of DNA.
123
R. de Ca´ssia Andrade Melo et al.: Presence of fimH, mrkD and irp2 Virulence Genes
826 Table 1 Primers used for PCR and DNA sequencing
Gene
Primer
Sequence (50 –30 )
Temp.a
Reference
kpc
KPC-1a
TGTCACTGTATCGCCGTC
63 °C
Yigit et al. (2001)
KPC-1b
CTCAGTGCTCTACAGAAAACC
FIM-H F
TCCACAGTCGCCAACGCTTC
58 °C
Stahlhul et al. [32]
FIM-H R
GCTCAGAATCAACATCGGTAAC
MRKD-2 F
CCACCAACTATTCCCTCGAA
62 °C
Sahly et al. [26]
65 °C
Guilvout et al. [12]
36 °C
Duan et al. [9]
fimH mrkD irp2 NA not applicable a
Temp, annealing temperature of the primers
NA
MRKD-2 R
ATGGAACCCACATCGACATT
IRP2 F
ATTTCTGGCGCACCATCT
IRP2 R
GCGCCGGGTATTACGGACTTC
ERIC-1
ATGTAAGCTCCTGGGGATTAAC
ERIC-2
AAGTAAGTGACTGGGGTGAGCG
The amplifications of the blaKPC, fimH, and mrkD genes were performed in cycles with initial denaturing at 95 °C for 5 min followed by 33 cycles, each cycle consisting of 1 min at 94 °C for denaturation, 1 min for annealing of the primers (Table 1), and 2 min at 72 °C for elongation. After these cycles, the final elongation step was carried out at 68 °C for 2 min. Irp2 gene amplifications were performed with initial denaturing cycles at 95 °C for 2 min, followed by 30 cycles, each cycle consisting of 1 min at 95 °C for denaturation, 2 min at 65 °C for annealing of the primers, and 3 min at 72 °C for elongation. After these cycles, the final elongation step was carried out at 72 °C for 7 min. The PCR products were stained with Blue Green Loading Dye (LGC Biotechnology) and subjected to electrophoresis in 1.5 % agarose gel in TBE buffer at constant voltage of 100 V, and then were visualized and photographed by an ultra-violet transilluminator in the Vilber Lourmat Photocap photo documentation system. DNA Sequencing All KPC-positive isolates by PCR were sequenced. For DNA sequencing of the fimH, mrkD, and irp2 virulence genes, the isolate K32-A2 was selected because it is representative of the main clonal group. The PCR products that were positive for the genes investigated were purified by the Kit for purifying a product, WizardÒ SV Gel and PCR Clean-Up System (Promega) and sequenced by the deoxyribonucleotide chain termination method [27]. For sequencing, the primers described in Table 1 were used. The nucleotide sequences were analyzed using Basic Local Alignment Search Tool program (http://www.ncbi.nlm.nih. gov/) and Clustal W from the European Bioinformatics Institute (http://www.cbi.ac.uk/). The sequences quality was verified using the Staden Package (http://staden.sour ceforge.net/) and it was considered a Q-value above 20. The sequences were deposited in the GenBank Database under the following accession: KF562073, KF562074, KF562075, KF562076, KF585214, and KJ645920.
123
Results Susceptibility to the Antimicrobials On analyzing the antimicrobial susceptibility profile of the bacterial isolates, it was observed that AMI (n = 38/ 86.4 %) and POL (n = 40/91 %) were the antimicrobials of best activity to inhibit K. pneumoniae, both KPC-positive and KPC–negative ones. It was also found that 5 isolates showed resistance to polymyxin, 3 of which were in the KPC-positive group, and 2 in the KPC-negative group. Additionally, the carbapenems, IPM (n = 24/54.5 %), and MPM (n = 25/56.9 %) also showed good activity against K. pneumoniae. In the KPC-positive group, 21 isolates were resistant to ERT, while as to IPM and MPM there were 18 and 17 such isolates, respectively. In the KPCnegative group, 11 isolates were resistant to ERT, while no isolate showed resistance to IPM and MPM. A high resistance to the cephalosporins was observed in the KPCpositive group, where all isolates presented resistance or intermediate resistance to this group of antimicrobials. Detection of the blaKPC, fimH, irp2, and mrkD The blaKPC-2 gene was identified in the 22 KPC-positive isolates. When detecting virulence genes, it was observed that among the KPC-positive isolates, mrkD and fimH genes are more related to each other, as they were always seen to be positive in the same 15 isolates (Table 2). Of the 22 KPC-positive isolates studied, 7 were negative for all the genes investigated. In relation to KPC-negative isolates, this group was more heterogeneous regarding the presence of virulence genes, only 2 isolates (K36-A2, K2OC) did not show any of the inquired genes, and 2 others (K2-A2 and K2-MA) were negative for all genes (Table 3). In this group, the mrkD and fimH genes were shown to be in the same isolates, thus demonstrating a relationship between these two genes. The irp2 gene was observed in only 9 of the 44 isolates studied, there being 7 isolates in
R. de Ca´ssia Andrade Melo et al.: Presence of fimH, mrkD and irp2 Virulence Genes Table 2 Source of isolation, the presence of virulence genes, and ERIC-PCR profile of K. pneumoniae isolates carriers the gene blaKPC
Isolatesa
Date of isolation
Source of isolation
K3-A2
25.07.2011
K5-A2
25.07.2011
K7-A2
827
Presence of virulence genes
Profile of ERIC-PCR
Rectal swab
–
5E
Rectal swab
irp2, mrkD, fimH
7E
08.08.2011
Rectal swab
mrkD, fimH
8E
K8-A2
22.08.2011
Rectal swab
–
9E
K11-A2
22.08.2011
Rectal swab
mrkD, fimH
10E
K14-A2
19.09.2011
Rectal swab
–
12E
K16-A2
26.09.2011
Rectal swab
–
13E
K19-A2
17.10.2011
Rectal swab
mrkD, fimH
14E
K20-A2
17.10.2011
Rectal swab
mrkD, fimH
15E
K21-A2
25.10.2011
Rectal swab
–
5E
K24-A2
28.11.2011
Rectal swab
irp2, mrkD, fimH
17E
K25-A2
18.01.2012
Rectal swab
irp2, mrkD, fimH
18E
K26-A2
18.01.2012
Tracheal aspirate
mrkD, fimH
18E
K29-A2
18.01.2012
Rectal swab
irp2, mrkD, fimH
19E
K31-A2 K32-A2
06.02.2012 06.02.2012
Urine Rectal swab
irp2, mrkD, fimH irp2, mrkD, fimH
20E 19E
K33-A2
06.02.2012
Rectal swab
mrkD, fimH
19E
K34-A2
08.02.2012
Rectal swab
–
21E
K1-C2
22.09.2011
Rectal swab
mrkD, fimH
23E
K2-C2
16.08.2011
Rectal swab
mrkD, fimH
23E
Identification of bacterial isolates: A2, C2, and OC, Public Hospitals
K1-OC
02.12.2011
Rectal swab
–
25E
K3-OC
12.12.2011
Rectal swab
irp2, mrkD, fimH
27E
Table 3 Source of isolation, the presence of virulence genes, and ERIC-PCR profile of K. pneumoniae isolates non-carries the gene blaKPC
Isolates
Date of isolation
a
a
Identification of bacterial isolates: A, A2, OC, and DH, Public Hospitals; P Private Hospital
Source of isolation
Presence of virulence genes
ERIC-PCR profile
K2-A
04.05.2007
Urine
mrkD, fimH
1E
K4-A
11.05.2007
Tracheal aspirate
fimH
2E
K9-A
04.06.2007
Tracheal aspirate
mrkD, fimH
3E
K2-A2
30.06.2011
Urine
–
4E
K4-A2
25.07.2011
Rectal swab
mrkD, fimH
6E
K13-A2
19.09.2011
Rectal swab
mrkD, fimH
11E
K22-A2
03.11.2011
Wound secretion
mrkD, fimH
16E
K35-A2
13.03.2012
Blood
mrkD, fimH
22E
K36-A2
21.03.2012
Urethral secretion
irp2, mrkD, fimH
21E
K2-DH
15.09.2011
Urine
mrkD
24E
K2-OC
12.12.2011
Blood
irp2, mrkD, fimH
26E
K2-P
10.03.2008
Urine
mrkD, fimH
28E
K3-P
10.03.2008
Bone fragment
mrkD, fimH
29E
K4-P
08.03.2008
Abscess secretion
mrkD
30E
K6-P K7-P
13.03.2008 23.03.2008
Blood Urine
mrkD, fimH mrkD
31E 32E
K11-P
15.04.2008
Urine
mrkD, fimH
33E
K14-P
22.04.2008
Blood
mrkD
34E
K17-P
04.05.2008
Urine
mrkD, fimH
35E
K18-P
01.05.2008
Urine
mrkD, fimH
36E
K19-P
29.04.2008
Urine
mrkD, fimH
37E
K21-P
03.05.2008
Peritoneal secretion
mrkD, fimH
38E
123
828
R. de Ca´ssia Andrade Melo et al.: Presence of fimH, mrkD and irp2 Virulence Genes
Fig. 1 Dendrogram generated by ERIC-PCR using the software Darwin 5.0, illustrating the relationship of profiles of ERIC-PCR KPC-positive group
the KPC-positive group, and only 2 in the KPC-negative group, and always accompanied by the other genes investigated in the study. For the sequencing of the PCR products of the virulence genes fimH, mrkD, and irp2, the isolate K32-A2 was selected because it is representative of the largest clonal group carrying the blaKPC-2 gene (Profile 19E using ERIC-PCR) that harboured all three of the virulence genes investigated. ERIC-PCR Using ERIC-PCR analysis, 38 genetic profiles (Figs. 1, 2) were found among the 44 isolates of K. pneumoniae analyzed. The 21E profile grouped 2 clonally related isolates. The 23E profile grouped 2 isolates, both being KPC-positive, and presenting identical resistance profiles as well as the presence of the same virulence genes investigated. The 18E profile presents two isolates, both KPC-positive, with an identical resistance profile, but they differ in the presence of the virulence genes. The 19E profile has 3 KPCpositive isolates, in which all have the same resistance profile and differ in the presentation of the virulence genes studied, where the K33-A2 isolate does not have the irp2 gene unlike the other strains of the group (K29-A2 and K32-A2). What can also be seen is the identical profile of
123
resistance and of virulence genes in isolates that did not present a clonal relationship such as isolates K3-P and K6P, both of which were KPC negative. No relationship between isolates from different hospitals was detected.
Discussion The ERIC-PCR grouped the isolates into 38 genetic profiles, demonstrating that isolates of K. pneumoniae from Recife, Brazil, present predominantly multiclonal origin and spread. This confirms previous studies in Recife [5, 31], which showed a high genetic heterogeneity of this bacterial species. On the other hand, five profiles of ERICPCR grouped more than one bacterial isolate with a clonal relationship, in which the strains of group 21E showed different resistance profiles, thus confirming the study by Ben-Hamouda et al. [3] and Cabral et al. [5], who found identical patterns of ERIC-PCR with different susceptibility profiles. The 4 other profiles presented clones with an identical susceptibility profile, corroborating the study by Ktari et al. [14] who found the same pattern of susceptibility in identical isolates of K. pneumoniae typed by PFGE analysis. According to Tosin et al. [34] when strains are genetically distinct, the resistance of one group of
R. de Ca´ssia Andrade Melo et al.: Presence of fimH, mrkD and irp2 Virulence Genes
829
Fig. 2 Dendrogram generated by ERIC-PCR using the software Darwin 5.0, illustrating the relationship of the profiles of ERIC-PCR KPCnegative group
microorganisms may be due to selective pressure, which favors resistance phenotypes within an independent group of strains, as in the case of the K3-P and K6-P isolates, which showed no clonal relationship. Yet they do have an identical resistance profile. Most clinical isolates of K. pneumoniae analyzed in this study, both KPC-positive and KPC-negative ones, were resistant to multiple antimicrobials, especially to b-lactams, including third-generation cephalosporins and to ATM. On the other hand, most of the isolates were sensitive to GEN, AMI, and POL. It should be noted that 5 isolates showed resistance to POL, 3 isolates from the KPC-positive group, and 2 from the KPC-negative group. This is the first ever report of isolates of K. pneumoniae resistant to POL in Brazilian north-east. Pereira et al. [21], showed polymyxin resistance in K. pneumoniae isolates from Brazilian south and south-east. Additionally, Mamina et al. [18] and Vaara et al. [35], in Italy, found in their studies, isolates of K. pneumoniae resistant to colistin, an antimicrobial polypeptide of the same group as polymyxin. Measures should be applied to contain selective pressure and the acquisition of resistance genes through horizontal transmission in order to avoid the spread of resistant strains, so that the latest treatment options may be preserved, such as polymyxin, in
combating severe infections caused by KPC-producing organisms. It is noteworthy that three polymyxin resistant KPC-positive isolates (K5-A2, K7-A2 and K20-A2) also had virulence genes for the production of type 1 and type 3 fimbrial adhesins and one of them (K5-A2) also had irp2 gene. The combination of the blaKPC gene with virulence genes in multidrug resistant K. pneumoniae isolates may further exacerbate infections caused by these bacteria and hamper treatment. A high resistance to the cephalosporins was also observed in the KPC-positive group, where the isolates presented resistance or intermediate resistance to this group of antimicrobials. These results corroborate the study by Han et al. [13], in China, where the rate of resistance to blactams reached 100 % in isolates of K. pneumoniae, except carbapenems. The emergence of the resistance to carbapenems in K. pneumoniae is mainly related to the production of carbapenemases such as KPC [17, 21, 38]. There was evidence that ERT was the best antimicrobial for detecting phenotypic resistance to the group of carbapenems. The false in vitro sensitivity to the carbapenems, IPM, and MPM, might well explain many episodes of unsuccessful treatment in the attempt to control many hospital infections [4, 36]. Therefore,
123
830
R. de Ca´ssia Andrade Melo et al.: Presence of fimH, mrkD and irp2 Virulence Genes
it is recommended always to include ERT in phenotypic tests for detecting resistance to carbapenems. According to Dienstmann et al. [8], resistance to carbapenems may occur due to the combination of the impaired outermembrane permeability (porin changes) along with chromosomal (AmpC) or ESBLs. This may explain the fact that some isolates did not have the blaKPC gene but presented resistance to carbapenems. Therefore, it was not possible to establish a relationship between the presence of the blaKPC gene and multiresistance. Bachman et al. [2] reported that yersiniabactin siderophore is a virulence factor prevalent in K. pneumoniae that produces KPC. In the present study, 30.4 % of the isolates of the KPC-positive group had the irp2 gene. The fact that some bacterial isolates analyzed herein were clonally related isolates by ERIC-PCR (19E) but only one of them did not carry the irp2 gene is an evidence that a transference mechanism is responsible for the spread of irp2 gene in K. pneumoniae. In the KPC-positive group, it was observed that the irp2, mrkD, and fimH virulence genes taken together had a higher frequency than in the KPC-negative group. The accumulation of virulence genes responsible for the production of type 1 and type 3 fimbrial adhesins and yersiniabactin, observed in this study, show that the KPC-positive isolates analyzed can produce important virulence factors such that the infection becomes established. Ejrnaes [10] related that type 1 fimbriae, in E. coli, are considered to be one of the most important virulence factor involved in the establishment of a urinary tract infection mediating extracellular binding to the host urothelium and invasion. Wilson et al. [37], have stated that the expression of adhesins is important during the colonization stage when diverse mechanical forces such as peristalsis and salivary secretion all act to hamper bacterial invasion within the host. Additionally, yersiniabactin could act as invasiveness enhancers in K. pneumonia [11]. Thus, the type 1 and type 3 fimbrial adhesins detected concomitantly in some isolates with yersiniabactin constitute a threat for vulnerable populations, even more if they are associated with antibiotic resistance. The accumulation of virulence genes responsible for the synthesis of fimbrial adhesins and yersiniabactin siderophore in positive KPC isolates, together with the antimicrobial multiresistance observed in this study, impose significant therapeutic limitations on the treatment of infections caused by K. pneumoniae in Recife-PE, Brazil.
References 1. Bach S, De Almeida A, Carniel E (2000) The Yersinia highpathogenicity island is present in different members of the family Enterobacteriaceae. FEMS Microbiol Lett 183:289–294
123
2. Bachman MA, Oyler JE, Burns SH et al (2011) Klebsiella pneumoniae yersiniabactin promotes respiratory tract infection through evasion of lipocalin 2. Infect Immun 79:3309–3316 3. Ben-Hamouda T, Foulon T, Ben-Cheikh-Masmoudi A et al (2003) Molecular epidemiology of an outbreak of multiresistant Klebsiella pneumoniae in a Tunisian neonatal ward. J Med Microbiol 52:427–433 4. Bratu S, Landman D, Haag R et al (2005) Rapid spread of carbapenem-resistant Klebsiella pneumoniae in New York City. Arch Intern Med 165:1430–1435 5. Cabral AB, Melo RCA, Maciel MAV et al (2012) Multidrug resistance genes, including blaKPC and blaCTX-M-2, among Klebsiella pneumoniae isolated in Recife, Brazil. Rev Soc Bras Med Trop 45:572–578 6. Carniel E (2001) The Yersinia high-pathogenicity island: an ironuptake island. Microbes Infect 3:561–569 7. Clinical and Laboratory Standards Institute (CLSI) (2011) Performance standards for antimicrobial susceptibility testing; Twenty-first informational supplement. CLSI document M100S21, Wayne, PA: CLSI 8. Dienstmann R, Picoli SU, Meyer G et al (2010) Avaliac¸a˜o fenotı´pica da enzima Klebsiella pneumoniae carbapenemase (KPC) em Enterobacteriaceae de ambiente hospitalar. J Bras Patol Med Lab 46:23–27 9. Duan H, Chai T, Liu J et al (2009) Source identification of airborne Escherichia coli of swine house surroundings using ERICPCR and REP-PCR. Environ Res 109:511–517 10. Ejrnæs K (2011) Bacterial characteristics of importance for recurrent urinary tract infections caused by Escherichia coli. Dan Med Bull 58:1–22 11. El Fertas-Aissani R, Messai Y, Alouache S et al (2013) Virulence profiles and antibiotic susceptibility patterns of Klebsiella pneumoniae strains isolated from different clinical specimens. Pathol Biol (Paris) 61:209–216 12. Guilvout I, Mercereau-Puijalon O, Bonnefoy S et al (1993) Highmolecular-weight protein 2 of Yersinia enterocolitica is homologous to AngR of Vibrio anguillarum and belongs to a family of proteins involved in nonribosomal peptide synthesis. J Bacteriol 175:5488–5504 13. Han HL, Huang Y, Zhang MM et al (2012) Clinical analysis of early postoperative pulmonary infection in children after living donor liver transplantation. Zhonghua Er Ke Za Zhi 50:612–616 14. Ktari S, Arlet G, Mnif B et al (2006) Emergence of multidrugresistant Klebsiella pneumoniae isolates producing VIM-4 metallo-b-lactamase, CTX-M-15 extended-spectrum b-lactamase, and CMY-4 AmpC b-lactamase in a Tunisian University Hospital. Antimicrob Agents Chemother 50:4198–4201 15. Langstraat J, Bohse M, Clegg S (2001) Type 3 Fimbrial (mrkA) of Klebsiella pneumoniae, but not the fimbrial adhesin (mrkD), facilitates biofilm formation. Infect Immun 69:5805–5812 16. Lawlor MS, O’Connor C, Miller VL (2007) Yersiniabactin is a virulence factor for Klebsiella pneumoniae during pulmonary infections. Infect Immun 75:1463–1472 17. Leavitt A, Chmelnitsky I, Colodner R et al (2009) Ertapenem resistance among extended-spectrum-b-lactamase-producing Klebsiella pneumoniae isolates. J Clin Microbiol 47:969–974 18. Mamina C, Bonura C, Di Bernardo F et al (2012) Ongoing spread of colistin-resistant Klebsiella pneumoniae in different wards of an acute general hospital, Italy, June to December 2001. Euro Surveill 17:20248 19. Monteiro J, Santos AF, Asensi MD et al (2009) First report of KPC-2-producing Klebsiella pneumoniae strains in Brazil. Antimicrob Agents Chemother 53:333–334 20. Peirano G, Seki L, Passos VLV et al (2009) Carbapenem-hydrolysing beta-lactamase KPC-2 in Klebsiella pneumoniae
R. de Ca´ssia Andrade Melo et al.: Presence of fimH, mrkD and irp2 Virulence Genes
21.
22.
23.
24.
25.
26.
27.
28.
isolated in Rio de Janeiro, Brazil. J Antimicrob Chemother 63:265–268 Pereira PS, Arau´jo CFM, Seki LM et al (2012) Update of the molecular epidemiology of KPC-2-producing Klebsiella pneumoniae in Brazil: spread of clonal complex 11(ST11, ST437 and ST340). J Antimicrob Chemother 68:312–316 Pfaller MA, Acar J, Jones RN et al (2001) Integration of molecular characterization of microorganisms in a global antimicrobial resistance surveillance program. Clin Infect Dis 32:156–167 Podschun R, Fischer A, Ullman U (2000) Characterization of Klebsiella terrigena strains from humans: haemagglutinins, serum resistance, siderophore synthesis, and serotypes. Epidemiol Infect 125:71–78 Podschun R, Fischer A, Ullman U (2000) Expression of putative virulence factors by clinical isolates of Klebsiella planticola. J Med Microbiol 49:115–119 Ramos PIV, Pica˜o RC, Almeida LGP et al (2014) Comparative analysis of the complete genome of KPC-2-producing Klebsiella pneumoniae Kp13 reveals remarkable genome plasticity and a wide repertoire of virulence and resistance mechanisms. BMC Genomics 15:54 Sahly H, Navon-Venezia S, Roesler L et al (2008) Extendedspectrum b-lactamase production is associated with an increase in cell invasion and expression of fimbrial adhesins in Klebsiella pneumoniae. Antimicrob Agents Chemother 52:3029–3034 Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A 74:5463–5467 Santos DF, Pimenta FC, Alves R et al (2008) Extended-spectrum b-lactamases producing Klebsiella pneumoniae isolated in two hospitals in Goiaˆnia/Brazil: detection, prevalence, antimicrobial susceptibility and molecular typing. Braz J Microbiol 39:608–612
831
29. Schjørring S, Struve C, Krogfelt KA (2008) Transfer of antimicrobial resistance plasmids from Klebsiella pneumoniae to Escherichia coli in the mouse intestine. J Antimicrob Chemother 62:1086–1093 30. Schubert S, Cuenca S, Fisher D et al (2000) High-pathogenicity island of Yersinia pestis in Enterobacteriaceae isolated from blood cultures and urine samples: prevalence and functional expression. J Infect Dis 182:1268–1271 31. Souza Lopes AC, Rodrigues JF, Morais Ju´nior MA (2005) Molecular typing of Klebsiella pneumoniae isolates from public hospitals in Recife, Brazil. Microbiol Res 160:37–46 32. Stahlhut SG, Chattopadhyay S, Struve C et al (2009) Population variability of the fimH type 1 fimbrial adhesin in Klebsiella pneumoniae. J Bacteriol 191:1941–1950 33. Struve C, Bojer M, Krogfelt KA (2009) Identification of a conserved chromosomal region encoding Klebsiella pneumoniae type 1 and type 3 fimbriae and assessment of the role of fimbriae in pathogenicity. Infect Immun 77:5016–5024 34. Tosin I, Silbert S, Sader HS (2003) The use of molecular typing to evaluate the dissemination of antimicrobial resistance among Gramnegative rods in Brazilian Hospitals. Braz J Infect Dis 7:360–369 35. Vaara M, Sader HS, Rhomberg PR et al (2012) Antimicrobial activity of the novel polymyxin derivative NAB739 tested against Gram-negative pathogens. J Antimicrob Chemother 68:636–639 36. Wallace KMP, Bethel CR, Destler AM et al (2010) Inhibitor resistance in the KPC-2 b-lactamases, a preeminent property of this class A b-lactamases. Antimicrob Agents Chemother 54:890–897 37. Wilson JW, Schurr MJ, LeBlanc CL et al (2002) Mechanisms of bacterial pathogenicity. Postgrad Med J 78:216–224 38. Woodford N, Dallow JW, Hill RL et al (2007) Ertapenem resistance among Klebsiella and Enterobacter submitted in the UK to a reference laboratory. Int J Antimicrob Agents 29:456–459
123
