www.ietdl.org Published in IET Nanobiotechnology Received on 28th February 2014 Revised on 1st May 2014 Accepted on 23rd May 2014 doi: 10.1049/iet-nbt.2014.0003
ISSN 1751-8741
Presentation of a nano-based tag for immunoassay, based on amine-modified bovine serum albumin nanoparticles Ali Jebali1,2, Seyedhossein Hekmatimoghaddam3, Bahram Kazemi4,5, Jesus Martinez De La Fuente6,7,8 1
Department of Genetics, Research and Clinical Center for Infertility, Shahid Sadoughi University of Medical Sciences, Yazd, Iran 2 Department of Medical Nanotechnology, Pajoohesh Lab, Yazd, Iran 3 Department of Laboratory Sciences, School of Paramedicine, Shahid Sadoughi University of Medical Sciences, Yazd, Iran 4 Cellular and Molecular Biology Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran 5 Department of Biotechnology, Shahid Beheshti University of Medical Sciences, Tehran, Iran 6 Instituto de Nanociencia de Aragón (INA), Universidad de Zaragoza, Mariano Esquillor s/n, 50018 Zaragoza, Spain 7 Fundación ARAID 8 Institute of Nano Biomedicine and Engineering, Key Laboratory for Thin Film and Microfabrication Technology of the Ministry of Education, Research Institute of Translation Medicine, Shanghai Jiao Tong University, Dongchuan Road 800, 200240 Shanghai, People’s Republic of China E-mail: [email protected]
Abstract: The aim of this study was to evaluate four immunoassays, based on amine-modified bovine serum albumin nanoparticles (AMBSANPs). First, the capability of nitrate absorption by AMBSANPs under different conditions was evaluated. Then, serial concentrations of pure βHCG were added to wells coated with βHCG antibody for immunoassays 1 and 2, and wells coated with βHCG aptamer for immunoassays 3 and 4. Next, AMBSANPs conjugated with βHCG antibody was added for immunoassays 1 and 3, and AMBSANPs conjugated with βHCG aptamer were added for immunoassays 2 and 4. Finally, the optical density (OD) of each well was read at 340 nm, and compared with controls. Moreover, the concentration of βHCG in the clinical samples was quantified by immunoassays 1, 2, 3, 4 and ELISA, and then compared. The effect of some serum interferences on these immunoassay methods was evaluated. The authors observed that the amount of nitrate absorption by AMBSANPs increased with an increase in H + ion concentration and temperature, and decreased with an increase in ion strength. The correlation (R 2) between ELISA and immunoassays 1, 2, 3 and 4 were 0.97, 0.97, 0.98, 0.99, respectively. It was found that the increase in the serum interferences led to a decrease in the measured βHCG concentration.
1
Introduction
Immunoassay is a method for quantifying different antigens with various sizes, chemicals and physical properties, based on the interaction between antigen (Ag) and a labelled antibody (Ab) or between an Ab and a labelled Ag. Historically, immunoassays have been used for different clinical and research applications over the last five decades [1]. There are different types of immunoassays, including enzyme immunoassay, radioimmunoassay, fluorescence immunoassay and chemiluminescence immunoassay, which use enzymes, radioisotopes atoms, fluorescence tags and luminogenic enzymes, respectively [2–4]. Although these methods are used in the field, they have time-consuming steps, such as sample purification and separation. Moreover, they require several incubation and rinsing steps prior to analysis [5]. IET Nanobiotechnol., 2015, Vol. 9, Iss. 1, pp. 43–51 doi: 10.1049/iet-nbt.2014.0003
Nanoparticles (NPs) have brought many great advances and new opportunities in chemistry, physics, biology, medicine and so on. They are also good candidates for labelling antibodies, because of their unique chemical and optical properties [6]. There are some studies which show that various NPs can be used in immunoassays [6]. As is known, the use of NPs leads to higher signal and sensitivity compared with routine labels [7]. Aptamers are similar to antibodies that have affinity to various ligands and have been applied for the detection of proteins [8]. Aptamers are the short synthetic nucleotide sequences that are selected via the systematic evolution of ligands by exponential enrichment (SELEX) [9]. Once the aptamer sequence is identified, its straightforward synthesis makes it particularly desirable and attractive. Structurally, although aptamers are different from antibodies, they have similar functions, and can be used in various detection 43
& The Institution of Engineering and Technology 2015
www.ietdl.org methods [8]. Based on previous studies, several aptamer-based assays have been studied for protein detection [10–15]. Here, we wanted to introduce and evaluate amine-modified bovine serum albumin nanoparticles (AMBSANPs) as a novel tag for immunoassay. It was guessed that the tag might be superior to common immunoassay tags, due to its easy preparation and low cost. In this study, AMBSANPs were synthesised and conjugated with antibody of β subunit of human chorionic gonadotropin (βHCG) and aptamer of βHCG. Generally, the aim of this study was (1) to synthesise AMBSANPs, (2) to conjugate them with βHCG antibody and aptamer, (3) to measure the capability of nitrate absorption under different experimental conditions, (4) to evaluate conjugated AMBSANPs for quantification of βHCG and (5) to find the effects of various serum interferences on the βHCG detection.
ml was separately added to 1 ml of serial concentrations (15, 31, 62, 125, 250 and 500 µg/ml) of AMBSANPs, and separately incubated at pH (5,7 and 9), temperature (4, 25 and 37°C), incubation time (1, 5 and 10 min) and ionic strength (50, 100 and 150 mM). After incubation, all tubes were centrifuged at 3000g, and the supernatant of each tube was collected. Then, the concentration of nitrate in the supernatant was quantified by Griess assay according to its protocol [16]. Finally, the absorption rate was measured:
2
The schematic of immunoassays 1, 2, 3 and 4 is shown in Figs. 1a–d, respectively. First, 100 µl of serial concentrations (25, 50, 150, 300, 500 and 1000 mIU/ml) of pure βHCG were separately added to wells coated with antibody of βHCG (for immunoassays 1 and 2). In the case of immunoassays 3 and 4, wells were coated with aptamer of βHCG. Then, all wells were incubated at 37°C for 15 min, and washed three times with washing buffer. In the next step, 100 µl of secondary antibody conjugated with AMBSANPs (for immunoassays 1 and 3) and 100 µl of aptamer conjugated with AMBSANPs (for immunoassays 2 and 4) were separately added to each well, incubated for 15 min at 37°C, and again washed three times with washing buffer. Then, 100 µl of AgNo3 at a concentration of 100 mg/ml was separately added to each well. Finally, after incubation at room temperature for 1 min, 100 µl of NADH at a concentration of 50 mmol/l was added to each well and incubated for 15 min at room temperature. Then, the optical density (OD) of each well was read at 340 nm and divided by the OD of negative control. In the end, the correlation between concentration of βHCG and ODtest/ODcontrol was calculated for each immunoassay. In the negative control, βHCG was not used, and normal saline was applied.
2.1
Materials and methods Materials
Bovine serum albumin (BSA), N-(2-aminoethyl)-3aminopropylmethyldimethoxysilane (APTES), N-ethyl-N(dimethylaminopropyl) carbodiimide (EDC), human serum albumin (HSA), haemoglobin, cholesterol, triglyceride, silver nitrate (AgNo3) and nicotinamide adenine dinucleotide (NADH) were provided by Sigma-Aldrich Company (St Louis, USA). The ELISA kits of βHCG were sourced from DiaPlus Inc., Canada. Oligonucleotide (anti-βHCG aptamer) (5′-AGCAAATTAAGGCGCGA TTATTATCAACCAATGGAAGCTACGCGATTATTAGA GTAT-3′) was synthesised by Invitrogen Biotech and used without further purification. This sequence was identified via the SELEX process from a library of randomised single-stranded DNA. Anti-βHCG antibody was provided by DiaPlus Inc. The conjugations of anti-βHCG aptamer and anti-βHCG antibody were ordered by the Zyst Fannavar Shargh Company by means of EDC crosslinker. 2.2 Synthesis, modification and characterisation of BSA NPs To synthesise BSA NPs, the precipitation method was used. In the first step, 25 ml of ethyl alcohol (70% v/v) and 100 µl of formaldeide (10% v/v) were gently added to 25 ml of BSA at a concentration of 500 mg/ml, and shaken for 20 min at room temperature. In the next step, synthesised BSA NPs were centrifuged at 3000g for 5 min, and washed three times with distilled water (DW). To modify BSA NPs, 1 ml of 100 mg/ml EDC was added to washed BSA NPs, and incubated for 30 min at 37°C. After incubation, one ml of 50 mg/ml APTES was added to EDC-activated BSA NPs, and incubated for 30 min at 37° C. Finally, the concentration of APTES-modified-BSA NPs was adjusted to 500 µg/ml with DW. The AMBSANPs were characterised by scanning electron microscopy (SEM) (Hitachi, S-2400, Japan), transmission electron microscopy (TEM) (JEOL, JEM-1200EX, USA), dynamic light scattering (DLS) (Malvern Instruments, Italy) and Fourier transform infrared spectroscopy (FTIR) (ZFS Co.). 2.3
Study of nitrate absorption by AMBSANPs
To evaluate the effect of pH, temperature, incubation time and ionic strength, 1 ml of AgNo3 at a concentration of 100 mg/ 44
& The Institution of Engineering and Technology 2015
Absorption rate (%) = (A − B) × 100/A
(1)
where A is the concentration of nitrate before incubation and B is the concentration of nitrate after incubation. 2.4 Evaluation of immunoassays 1, 2, 3 and 4 by pure βHCG
2.5
Preparation of clinical samples
To investigate the efficacy of these methods under the actual condition, the clinical samples were obtained from different medical laboratories in Yazd, Iran. The approval number of the clinical samples for immunoassays 1, 2, 3 and 4 was 527, 515, 522 and 516, respectively. In this study, 5 ml of venous blood was obtained from women, who were in the age group of 20–50 years and with no smoking habits. Then, blood samples were placed in propylene plastic tubes, incubated at room temperature for 30 min and centrifuged at 1500g for 15 min. In the next step, the serum of each blood sample was isolated, stored at −70°C, and used for the present study. It must be mentioned that all women signed an informed consent form. 2.6 Evaluation of immunoassays 1, 2, 3 and 4 by clinical samples The βHCG concentration of all samples was first checked by the ELISA kit, and then by immunoassays 1, 2, 3 and 4. The experimental conditions for each procedure are described below. In the case of ELISA, according to the kit manual, 100 µl of each serum sample was added to ELISA wells IET Nanobiotechnol., 2015, Vol. 9, Iss. 1, pp. 43–51 doi: 10.1049/iet-nbt.2014.0003
www.ietdl.org
Fig. 1 Schematic of immunoassays which are used in this study a Immunoassay 1 b Immunoassay 2 c Immunoassay 3 d Immunoassay 4
which were previously coated with βHCG antibody, incubated for 30 min at 37°C and washed three times with washing buffer. Then, 100 µl of secondary antibody conjugated with horseradish peroxidase was added, incubated at 37°C for 30 min and rinsed three times with washing buffer. Next, 50 µl of substrate (H2O2) and 50 µl of TMB chromogen were added, incubated at 37°C for 15 min, stopped with 50 µl of 1 N HCL. Finally, the OD of each well was read at 450 nm, and βHCG concentration of the samples was measured, according to the standard curve, which was previously obtained by serial concentrations of βHCG. In the case of immunoassays 1, 2, 3 and 4, under the same process as ELISA, 100 µl of each serum sample was added to antibody coated wells (for immunoassays 1 and 2) and aptamer coated wells (for immunoassays 3 and 4), incubated for 15 min at 37°C and washed three times with IET Nanobiotechnol., 2015, Vol. 9, Iss. 1, pp. 43–51 doi: 10.1049/iet-nbt.2014.0003
washing buffer. Then, 100 µl of secondary antibody conjugated with AMBSANPs (for immunoassays 1 and 3) and 100 µl of aptamer conjugated with AMBSANPs (for immunoassays 2 and 4) were separately added to each well, incubated for 15 min at 37°C, and again rinsed three times with washing buffer. Next, 100 µl of AgNO3 (100 mg/ml) and 100 µl of NADH (50 mmol/l) was added, and incubated for 15 min at room temperature. Then, the OD of each well was read at 340 nm and divided by the OD of negative control. Finally, the βHCG concentration of each sample was separately calculated, according to the standard curve. To obtain the standard curve, serial concentrations of βHCG were used instead of clinical samples, and all steps for each immunoassay were carried out. In the case of negative control, βHCG solution was not used, and normal saline was applied. In the end, the correlation between ELISA and immunoassays 1, 2, 3 and 4 was calculated. 45
& The Institution of Engineering and Technology 2015
www.ietdl.org
Fig. 2 Characterisation of AMBSANPs a b c d
SEM image TEM image DLS spectrum FTIR spectrum
2.7 Effect of serum proteins, haemoglobin and blood lipids on the detection To evaluate the effects of the serum interferences, 16 women whose βHCG concentration was about 200 ± 5 mIU/ml were included in this study. Then, 1 ml of each serum sample was added to separate tubes, and then four groups were arranged. In group 1, 1 ml of different concentrations of HSA was separately added, whose final HSA concentrations were 250, 125, 62 and 31 g/l. In group 2, 1 ml of different concentrations of haemoglobin was separately added, whose final haemoglobin concentrations were 250, 125, 62 and 31 g/l. In group3, 1 ml of different concentrations of cholesterol was separately added, whose final cholesterol concentrations were 4, 3, 2 and 1 g/l. In group 3, 1 ml of different concentrations of triglyceride was separately added, whose final triglyceride concentrations were 4, 3, 2 and 1 g/l. Finally, the concentration of βHCG was separately quantified in each group by ELISA, immunoassays 1, 2, 3 and 4. 2.8
Statistical analysis
The results are shown as the mean ± standard deviation (SD) with three replicates. Parametric test (Student’s t-test) was applied to evaluate the significant differences using the SPSS software, V.16.0 for Windows (SPSS Inc., USA). P < 0.05 was considered as the level of significant difference.
3 3.1
Results Characterisation of AMBSANPs
The SEM and TEM images of AMBSANPs are shown in Figs. 2a and b, respectively. As is seen, their shape was 46
& The Institution of Engineering and Technology 2015
approximately spherical and the size range (Fig. 2c) of AMBSANPs was near 30–50 nm. Their zeta potential was + 35.5 mV (at pH = 7 and ionic strength = 50 mM). The FTIR spectrum of AMBSANPs is shown in Fig. 2d. As denoted, AMBSANPs had sharp peaks at 3299, 1654, 1539, 1394 and 1240 cm (−1). 3.2 Effect of different parameters on nitrate absorption The effects of pH, temperature, incubation time and ionic strength are demonstrated in Figs. 3a–d, respectively. As shown, acidic conditions could dramatically raise absorption rate. At any given concentration of AMBSANPs, the absorption rate at pH = 5 was higher than the absorption rate at pH = 7 and pH = 9 (P < 0.05). Moreover, any increase in temperature increased the absorption rate. In the case of temperature, the absorption rate at 37°C was significantly higher than at 25 and 4°C (P < 0.05). This study showed that there were no significant differences between different incubation times (P > 0.05). An increase in ionic strength decreased the absorption rate. The absorption rate with ionic strength of 50 mM was higher than its rate in 100 and 150 mM (P < 0.05). 3.3
Evaluation of immunoassays 1, 2, 3 and 4
The correlation between the concentration of βHCG and ODtest/ODcontrol for immunoassays 1, 2, 3 and 4 is shown in Figs. 4a–d, respectively. As shown, R 2 for immunoassays 1, 2, 3 and 4 was 0.95, 0.96, 0.97, 0.99, respectively. Relative sensitivity (RSe), relative specificity (RSp), predictive value of positive (PVP), predictive value of negative (PVN), false discovery rate (FDR) and false IET Nanobiotechnol., 2015, Vol. 9, Iss. 1, pp. 43–51 doi: 10.1049/iet-nbt.2014.0003
www.ietdl.org
Fig. 3 Effect of various pHs, temperatures, time and ionic strengths on nitrate absorption by AMBSANPs a pHs (5, 7, 9) b Temperatures (4, 25, 37°C) c Time (1, 5, 10 min) d Ionic strengths (50, 100, 150 mM) *P < 0.05 compared with the absorption rate in pH 7 and pH 9 at the same concentration. **P < 0.05 compared with the absorption rate in 4 and 25°C at the same concentration ***P < 0.05 compared with the absorption rate with ionic strength of 100 and 150 mM at the same concentration
positive rate (FPR) for each immunoassay are demonstrated in Table 1. As seen, the highest RSe, RSp, PVP, PVN, FDR and FPR were observed for immunoassay 4. Moreover, reproducibility and the percentage of RSD within and between days are demonstrated in Table 2. The best reproducibility and least distribution of RSD were seen for immunoassay 4. The correlation between ELISA and immunoassays 1, 2, 3 and 4 is shown in Figs. 5a–d, respectively. As shown, R 2 for immunoassays 1, 2, 3 and 4 was 0.97, 0.97, 0.98 and 0.99, respectively.
3.4 Effect of serum interferences on the quantity of detection Table 3 shows the effect of serial concentrations of HSA, haemoglobin, cholesterol and triglyceride on the concentration of βHCG obtained by ELISA, immunoassays 1, 2, 3 and 4. The results showed that the increase of all interferences including HSA, haemoglobin, cholesterol and triglyceride led to decrease in the measured βHCG concentration. It must be mentioned that the pattern was related to the concentration of interferences; that is, the higher the concentration of interferences, the lower the measured concentration. IET Nanobiotechnol., 2015, Vol. 9, Iss. 1, pp. 43–51 doi: 10.1049/iet-nbt.2014.0003
4
Discussion
The aim of this study was to evaluate four immunoassay methods, based on nitrate absorption by AMBSANPs. First, the capability of nitrate absorption by AMBSANPs was investigated under different experimental conditions. We saw that the absorption rate was raised with increase in H + ion concentration and temperature. In the case of acidic and neutral condition, the high absorption rate may be because of the effect of NP charge, as the zeta potential of AMBSANPs at pH = 7 and 5 was +35.5 and +42.3 mV, respectively. In the case of temperature, the higher interaction between nitrate ions and AMBSANPs may be the reason for higher absorption at higher temperatures. We also found that incubation time is not an important factor, and absorption is carried out in 1 min or maybe even in
ISSN 1751-8741
Presentation of a nano-based tag for immunoassay, based on amine-modified bovine serum albumin nanoparticles Ali Jebali1,2, Seyedhossein Hekmatimoghaddam3, Bahram Kazemi4,5, Jesus Martinez De La Fuente6,7,8 1
Department of Genetics, Research and Clinical Center for Infertility, Shahid Sadoughi University of Medical Sciences, Yazd, Iran 2 Department of Medical Nanotechnology, Pajoohesh Lab, Yazd, Iran 3 Department of Laboratory Sciences, School of Paramedicine, Shahid Sadoughi University of Medical Sciences, Yazd, Iran 4 Cellular and Molecular Biology Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran 5 Department of Biotechnology, Shahid Beheshti University of Medical Sciences, Tehran, Iran 6 Instituto de Nanociencia de Aragón (INA), Universidad de Zaragoza, Mariano Esquillor s/n, 50018 Zaragoza, Spain 7 Fundación ARAID 8 Institute of Nano Biomedicine and Engineering, Key Laboratory for Thin Film and Microfabrication Technology of the Ministry of Education, Research Institute of Translation Medicine, Shanghai Jiao Tong University, Dongchuan Road 800, 200240 Shanghai, People’s Republic of China E-mail: [email protected]
Abstract: The aim of this study was to evaluate four immunoassays, based on amine-modified bovine serum albumin nanoparticles (AMBSANPs). First, the capability of nitrate absorption by AMBSANPs under different conditions was evaluated. Then, serial concentrations of pure βHCG were added to wells coated with βHCG antibody for immunoassays 1 and 2, and wells coated with βHCG aptamer for immunoassays 3 and 4. Next, AMBSANPs conjugated with βHCG antibody was added for immunoassays 1 and 3, and AMBSANPs conjugated with βHCG aptamer were added for immunoassays 2 and 4. Finally, the optical density (OD) of each well was read at 340 nm, and compared with controls. Moreover, the concentration of βHCG in the clinical samples was quantified by immunoassays 1, 2, 3, 4 and ELISA, and then compared. The effect of some serum interferences on these immunoassay methods was evaluated. The authors observed that the amount of nitrate absorption by AMBSANPs increased with an increase in H + ion concentration and temperature, and decreased with an increase in ion strength. The correlation (R 2) between ELISA and immunoassays 1, 2, 3 and 4 were 0.97, 0.97, 0.98, 0.99, respectively. It was found that the increase in the serum interferences led to a decrease in the measured βHCG concentration.
1
Introduction
Immunoassay is a method for quantifying different antigens with various sizes, chemicals and physical properties, based on the interaction between antigen (Ag) and a labelled antibody (Ab) or between an Ab and a labelled Ag. Historically, immunoassays have been used for different clinical and research applications over the last five decades [1]. There are different types of immunoassays, including enzyme immunoassay, radioimmunoassay, fluorescence immunoassay and chemiluminescence immunoassay, which use enzymes, radioisotopes atoms, fluorescence tags and luminogenic enzymes, respectively [2–4]. Although these methods are used in the field, they have time-consuming steps, such as sample purification and separation. Moreover, they require several incubation and rinsing steps prior to analysis [5]. IET Nanobiotechnol., 2015, Vol. 9, Iss. 1, pp. 43–51 doi: 10.1049/iet-nbt.2014.0003
Nanoparticles (NPs) have brought many great advances and new opportunities in chemistry, physics, biology, medicine and so on. They are also good candidates for labelling antibodies, because of their unique chemical and optical properties [6]. There are some studies which show that various NPs can be used in immunoassays [6]. As is known, the use of NPs leads to higher signal and sensitivity compared with routine labels [7]. Aptamers are similar to antibodies that have affinity to various ligands and have been applied for the detection of proteins [8]. Aptamers are the short synthetic nucleotide sequences that are selected via the systematic evolution of ligands by exponential enrichment (SELEX) [9]. Once the aptamer sequence is identified, its straightforward synthesis makes it particularly desirable and attractive. Structurally, although aptamers are different from antibodies, they have similar functions, and can be used in various detection 43
& The Institution of Engineering and Technology 2015
www.ietdl.org methods [8]. Based on previous studies, several aptamer-based assays have been studied for protein detection [10–15]. Here, we wanted to introduce and evaluate amine-modified bovine serum albumin nanoparticles (AMBSANPs) as a novel tag for immunoassay. It was guessed that the tag might be superior to common immunoassay tags, due to its easy preparation and low cost. In this study, AMBSANPs were synthesised and conjugated with antibody of β subunit of human chorionic gonadotropin (βHCG) and aptamer of βHCG. Generally, the aim of this study was (1) to synthesise AMBSANPs, (2) to conjugate them with βHCG antibody and aptamer, (3) to measure the capability of nitrate absorption under different experimental conditions, (4) to evaluate conjugated AMBSANPs for quantification of βHCG and (5) to find the effects of various serum interferences on the βHCG detection.
ml was separately added to 1 ml of serial concentrations (15, 31, 62, 125, 250 and 500 µg/ml) of AMBSANPs, and separately incubated at pH (5,7 and 9), temperature (4, 25 and 37°C), incubation time (1, 5 and 10 min) and ionic strength (50, 100 and 150 mM). After incubation, all tubes were centrifuged at 3000g, and the supernatant of each tube was collected. Then, the concentration of nitrate in the supernatant was quantified by Griess assay according to its protocol [16]. Finally, the absorption rate was measured:
2
The schematic of immunoassays 1, 2, 3 and 4 is shown in Figs. 1a–d, respectively. First, 100 µl of serial concentrations (25, 50, 150, 300, 500 and 1000 mIU/ml) of pure βHCG were separately added to wells coated with antibody of βHCG (for immunoassays 1 and 2). In the case of immunoassays 3 and 4, wells were coated with aptamer of βHCG. Then, all wells were incubated at 37°C for 15 min, and washed three times with washing buffer. In the next step, 100 µl of secondary antibody conjugated with AMBSANPs (for immunoassays 1 and 3) and 100 µl of aptamer conjugated with AMBSANPs (for immunoassays 2 and 4) were separately added to each well, incubated for 15 min at 37°C, and again washed three times with washing buffer. Then, 100 µl of AgNo3 at a concentration of 100 mg/ml was separately added to each well. Finally, after incubation at room temperature for 1 min, 100 µl of NADH at a concentration of 50 mmol/l was added to each well and incubated for 15 min at room temperature. Then, the optical density (OD) of each well was read at 340 nm and divided by the OD of negative control. In the end, the correlation between concentration of βHCG and ODtest/ODcontrol was calculated for each immunoassay. In the negative control, βHCG was not used, and normal saline was applied.
2.1
Materials and methods Materials
Bovine serum albumin (BSA), N-(2-aminoethyl)-3aminopropylmethyldimethoxysilane (APTES), N-ethyl-N(dimethylaminopropyl) carbodiimide (EDC), human serum albumin (HSA), haemoglobin, cholesterol, triglyceride, silver nitrate (AgNo3) and nicotinamide adenine dinucleotide (NADH) were provided by Sigma-Aldrich Company (St Louis, USA). The ELISA kits of βHCG were sourced from DiaPlus Inc., Canada. Oligonucleotide (anti-βHCG aptamer) (5′-AGCAAATTAAGGCGCGA TTATTATCAACCAATGGAAGCTACGCGATTATTAGA GTAT-3′) was synthesised by Invitrogen Biotech and used without further purification. This sequence was identified via the SELEX process from a library of randomised single-stranded DNA. Anti-βHCG antibody was provided by DiaPlus Inc. The conjugations of anti-βHCG aptamer and anti-βHCG antibody were ordered by the Zyst Fannavar Shargh Company by means of EDC crosslinker. 2.2 Synthesis, modification and characterisation of BSA NPs To synthesise BSA NPs, the precipitation method was used. In the first step, 25 ml of ethyl alcohol (70% v/v) and 100 µl of formaldeide (10% v/v) were gently added to 25 ml of BSA at a concentration of 500 mg/ml, and shaken for 20 min at room temperature. In the next step, synthesised BSA NPs were centrifuged at 3000g for 5 min, and washed three times with distilled water (DW). To modify BSA NPs, 1 ml of 100 mg/ml EDC was added to washed BSA NPs, and incubated for 30 min at 37°C. After incubation, one ml of 50 mg/ml APTES was added to EDC-activated BSA NPs, and incubated for 30 min at 37° C. Finally, the concentration of APTES-modified-BSA NPs was adjusted to 500 µg/ml with DW. The AMBSANPs were characterised by scanning electron microscopy (SEM) (Hitachi, S-2400, Japan), transmission electron microscopy (TEM) (JEOL, JEM-1200EX, USA), dynamic light scattering (DLS) (Malvern Instruments, Italy) and Fourier transform infrared spectroscopy (FTIR) (ZFS Co.). 2.3
Study of nitrate absorption by AMBSANPs
To evaluate the effect of pH, temperature, incubation time and ionic strength, 1 ml of AgNo3 at a concentration of 100 mg/ 44
& The Institution of Engineering and Technology 2015
Absorption rate (%) = (A − B) × 100/A
(1)
where A is the concentration of nitrate before incubation and B is the concentration of nitrate after incubation. 2.4 Evaluation of immunoassays 1, 2, 3 and 4 by pure βHCG
2.5
Preparation of clinical samples
To investigate the efficacy of these methods under the actual condition, the clinical samples were obtained from different medical laboratories in Yazd, Iran. The approval number of the clinical samples for immunoassays 1, 2, 3 and 4 was 527, 515, 522 and 516, respectively. In this study, 5 ml of venous blood was obtained from women, who were in the age group of 20–50 years and with no smoking habits. Then, blood samples were placed in propylene plastic tubes, incubated at room temperature for 30 min and centrifuged at 1500g for 15 min. In the next step, the serum of each blood sample was isolated, stored at −70°C, and used for the present study. It must be mentioned that all women signed an informed consent form. 2.6 Evaluation of immunoassays 1, 2, 3 and 4 by clinical samples The βHCG concentration of all samples was first checked by the ELISA kit, and then by immunoassays 1, 2, 3 and 4. The experimental conditions for each procedure are described below. In the case of ELISA, according to the kit manual, 100 µl of each serum sample was added to ELISA wells IET Nanobiotechnol., 2015, Vol. 9, Iss. 1, pp. 43–51 doi: 10.1049/iet-nbt.2014.0003
www.ietdl.org
Fig. 1 Schematic of immunoassays which are used in this study a Immunoassay 1 b Immunoassay 2 c Immunoassay 3 d Immunoassay 4
which were previously coated with βHCG antibody, incubated for 30 min at 37°C and washed three times with washing buffer. Then, 100 µl of secondary antibody conjugated with horseradish peroxidase was added, incubated at 37°C for 30 min and rinsed three times with washing buffer. Next, 50 µl of substrate (H2O2) and 50 µl of TMB chromogen were added, incubated at 37°C for 15 min, stopped with 50 µl of 1 N HCL. Finally, the OD of each well was read at 450 nm, and βHCG concentration of the samples was measured, according to the standard curve, which was previously obtained by serial concentrations of βHCG. In the case of immunoassays 1, 2, 3 and 4, under the same process as ELISA, 100 µl of each serum sample was added to antibody coated wells (for immunoassays 1 and 2) and aptamer coated wells (for immunoassays 3 and 4), incubated for 15 min at 37°C and washed three times with IET Nanobiotechnol., 2015, Vol. 9, Iss. 1, pp. 43–51 doi: 10.1049/iet-nbt.2014.0003
washing buffer. Then, 100 µl of secondary antibody conjugated with AMBSANPs (for immunoassays 1 and 3) and 100 µl of aptamer conjugated with AMBSANPs (for immunoassays 2 and 4) were separately added to each well, incubated for 15 min at 37°C, and again rinsed three times with washing buffer. Next, 100 µl of AgNO3 (100 mg/ml) and 100 µl of NADH (50 mmol/l) was added, and incubated for 15 min at room temperature. Then, the OD of each well was read at 340 nm and divided by the OD of negative control. Finally, the βHCG concentration of each sample was separately calculated, according to the standard curve. To obtain the standard curve, serial concentrations of βHCG were used instead of clinical samples, and all steps for each immunoassay were carried out. In the case of negative control, βHCG solution was not used, and normal saline was applied. In the end, the correlation between ELISA and immunoassays 1, 2, 3 and 4 was calculated. 45
& The Institution of Engineering and Technology 2015
www.ietdl.org
Fig. 2 Characterisation of AMBSANPs a b c d
SEM image TEM image DLS spectrum FTIR spectrum
2.7 Effect of serum proteins, haemoglobin and blood lipids on the detection To evaluate the effects of the serum interferences, 16 women whose βHCG concentration was about 200 ± 5 mIU/ml were included in this study. Then, 1 ml of each serum sample was added to separate tubes, and then four groups were arranged. In group 1, 1 ml of different concentrations of HSA was separately added, whose final HSA concentrations were 250, 125, 62 and 31 g/l. In group 2, 1 ml of different concentrations of haemoglobin was separately added, whose final haemoglobin concentrations were 250, 125, 62 and 31 g/l. In group3, 1 ml of different concentrations of cholesterol was separately added, whose final cholesterol concentrations were 4, 3, 2 and 1 g/l. In group 3, 1 ml of different concentrations of triglyceride was separately added, whose final triglyceride concentrations were 4, 3, 2 and 1 g/l. Finally, the concentration of βHCG was separately quantified in each group by ELISA, immunoassays 1, 2, 3 and 4. 2.8
Statistical analysis
The results are shown as the mean ± standard deviation (SD) with three replicates. Parametric test (Student’s t-test) was applied to evaluate the significant differences using the SPSS software, V.16.0 for Windows (SPSS Inc., USA). P < 0.05 was considered as the level of significant difference.
3 3.1
Results Characterisation of AMBSANPs
The SEM and TEM images of AMBSANPs are shown in Figs. 2a and b, respectively. As is seen, their shape was 46
& The Institution of Engineering and Technology 2015
approximately spherical and the size range (Fig. 2c) of AMBSANPs was near 30–50 nm. Their zeta potential was + 35.5 mV (at pH = 7 and ionic strength = 50 mM). The FTIR spectrum of AMBSANPs is shown in Fig. 2d. As denoted, AMBSANPs had sharp peaks at 3299, 1654, 1539, 1394 and 1240 cm (−1). 3.2 Effect of different parameters on nitrate absorption The effects of pH, temperature, incubation time and ionic strength are demonstrated in Figs. 3a–d, respectively. As shown, acidic conditions could dramatically raise absorption rate. At any given concentration of AMBSANPs, the absorption rate at pH = 5 was higher than the absorption rate at pH = 7 and pH = 9 (P < 0.05). Moreover, any increase in temperature increased the absorption rate. In the case of temperature, the absorption rate at 37°C was significantly higher than at 25 and 4°C (P < 0.05). This study showed that there were no significant differences between different incubation times (P > 0.05). An increase in ionic strength decreased the absorption rate. The absorption rate with ionic strength of 50 mM was higher than its rate in 100 and 150 mM (P < 0.05). 3.3
Evaluation of immunoassays 1, 2, 3 and 4
The correlation between the concentration of βHCG and ODtest/ODcontrol for immunoassays 1, 2, 3 and 4 is shown in Figs. 4a–d, respectively. As shown, R 2 for immunoassays 1, 2, 3 and 4 was 0.95, 0.96, 0.97, 0.99, respectively. Relative sensitivity (RSe), relative specificity (RSp), predictive value of positive (PVP), predictive value of negative (PVN), false discovery rate (FDR) and false IET Nanobiotechnol., 2015, Vol. 9, Iss. 1, pp. 43–51 doi: 10.1049/iet-nbt.2014.0003
www.ietdl.org
Fig. 3 Effect of various pHs, temperatures, time and ionic strengths on nitrate absorption by AMBSANPs a pHs (5, 7, 9) b Temperatures (4, 25, 37°C) c Time (1, 5, 10 min) d Ionic strengths (50, 100, 150 mM) *P < 0.05 compared with the absorption rate in pH 7 and pH 9 at the same concentration. **P < 0.05 compared with the absorption rate in 4 and 25°C at the same concentration ***P < 0.05 compared with the absorption rate with ionic strength of 100 and 150 mM at the same concentration
positive rate (FPR) for each immunoassay are demonstrated in Table 1. As seen, the highest RSe, RSp, PVP, PVN, FDR and FPR were observed for immunoassay 4. Moreover, reproducibility and the percentage of RSD within and between days are demonstrated in Table 2. The best reproducibility and least distribution of RSD were seen for immunoassay 4. The correlation between ELISA and immunoassays 1, 2, 3 and 4 is shown in Figs. 5a–d, respectively. As shown, R 2 for immunoassays 1, 2, 3 and 4 was 0.97, 0.97, 0.98 and 0.99, respectively.
3.4 Effect of serum interferences on the quantity of detection Table 3 shows the effect of serial concentrations of HSA, haemoglobin, cholesterol and triglyceride on the concentration of βHCG obtained by ELISA, immunoassays 1, 2, 3 and 4. The results showed that the increase of all interferences including HSA, haemoglobin, cholesterol and triglyceride led to decrease in the measured βHCG concentration. It must be mentioned that the pattern was related to the concentration of interferences; that is, the higher the concentration of interferences, the lower the measured concentration. IET Nanobiotechnol., 2015, Vol. 9, Iss. 1, pp. 43–51 doi: 10.1049/iet-nbt.2014.0003
4
Discussion
The aim of this study was to evaluate four immunoassay methods, based on nitrate absorption by AMBSANPs. First, the capability of nitrate absorption by AMBSANPs was investigated under different experimental conditions. We saw that the absorption rate was raised with increase in H + ion concentration and temperature. In the case of acidic and neutral condition, the high absorption rate may be because of the effect of NP charge, as the zeta potential of AMBSANPs at pH = 7 and 5 was +35.5 and +42.3 mV, respectively. In the case of temperature, the higher interaction between nitrate ions and AMBSANPs may be the reason for higher absorption at higher temperatures. We also found that incubation time is not an important factor, and absorption is carried out in 1 min or maybe even in
