This article was downloaded by: [Dicle University] On: 04 November 2014, At: 11:59 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Preparative Biochemistry and Biotechnology Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/lpbb20
PRODUCTION OF HUMAN TISSUE PLASMINOGEN ACTIVATOR (tPA) IN Cucumis sativus a
a
a
Mishaneh Asgari , Mokhtar Jalali Javaran , Ahmad Moieni , Asad b
Masoumiasl & Maryam Abdolinasab
a
a
Department of Plant Breeding and Biotechnology, Faculty of Agriculture , Tarbiat Modares University , Tehran , Iran b
Department of biotechnology, Faculty of Agriculture , Yasuj University , Yasuj , Iran Accepted author version posted online: 14 Jun 2013.Published online: 23 Oct 2013.
To cite this article: Mishaneh Asgari , Mokhtar Jalali Javaran , Ahmad Moieni , Asad Masoumiasl & Maryam Abdolinasab (2014) PRODUCTION OF HUMAN TISSUE PLASMINOGEN ACTIVATOR (tPA) IN Cucumis sativus , Preparative Biochemistry and Biotechnology, 44:2, 182-192, DOI: 10.1080/10826068.2013.803480 To link to this article: http://dx.doi.org/10.1080/10826068.2013.803480
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms &
Downloaded by [Dicle University] at 11:59 04 November 2014
Conditions of access and use can be found at http://www.tandfonline.com/page/termsand-conditions
Preparative Biochemistry & Biotechnology, 44:182–192, 2014 Copyright # Taylor & Francis Group, LLC ISSN: 1082-6068 print/1532-2297 online DOI: 10.1080/10826068.2013.803480
Downloaded by [Dicle University] at 11:59 04 November 2014
PRODUCTION OF HUMAN TISSUE PLASMINOGEN ACTIVATOR (tPA) IN Cucumis sativus
Mishaneh Asgari,1 Mokhtar Jalali Javaran,1 Ahmad Moieni,1 Asad Masoumiasl,2 and Maryam Abdolinasab1 1 Department of Plant Breeding and Biotechnology, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran 2 Department of biotechnology, Faculty of Agriculture, Yasuj University, Yasuj, Iran
& Tissue plasminogen activator (tPA) as a serine protease with 72 kD molecular mass and 527 amino acids plays an important role in the fibrinolytic system and the dissolution of fibrin clots in human body. The collective production of this drug in plants such as cucumber, one of the most important vegetables in the world, could reduce its production costs. In this study, after scrutiny of the appropriate regeneration of cucumber plant (Isfahan variety) on MS medium with naphthalene acetic acid hormone (NAA; 0=1 mg L1) and benzyl amino purine hormone (BAP; 3 mg L1) hormones, the cloned human tPA gene under the CaMV 35S promoter and NOS terminator into pBI121 plasmid was transferred into cotyledon explants by Agrobacterium tumefaciens strain LBA4404. Subsequent to the regeneration of inoculated explants on the selective medium, the persistence of tPA gene in recombinant plants was confirmed by polymerase chain reaction (PCR) with specific primers. To evaluate the tPA gene expression in transgenic plants, RNA was extracted and the tPA gene transcription was confirmed by reverse-transcription (RT) PCR. Followed the extraction of protein from the leaves of transgenic plants, the presence of tPA protein was confirmed by dot blot and sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (PAGE) analysis in order to survey the production of recombinant tPA protein. The enzyme-linked immunosorbent assay (ELISA) test was used for recombinant tPA protein level in transgenic cucumber plants. It was counted between 0.8 and 1%, and based on this, it was concluded that the presence of three expressions of regulatory factors (CaMV 35S, Kozak, NOS) and KDEL signal in the construct caused the increase of the tPA gene expression in cucumber plants. Keywords cucumber, gene transfer, molecular farming, protein analysis, recombinant protein, tissue plasminogen activator (tPA)
Address correspondence to Mokhtar Jalali Javaran, Department of Plant Breeding and Biotechnology, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran. E-mail: [email protected]
Production of Human tPA in Cucumis sativus
183
Downloaded by [Dicle University] at 11:59 04 November 2014
INTRODUCTION Human tissue plasminogen activator (tPA) is one of the four types of plasminogen activator (urokinase, streptokinase, human tissue plasminogen activator, and DSPAa1) and produced in the liver wall and the blood vessels. This enzyme is a member of the secreted serine proteases family with 72 kD molecular mass and 527 amino acids. Human tPA converts the plasminogen to the plasmin in the presence of fibrin, and its recombinant form is used for treatment of cardiac and cerebral vascular occlusion.[1,2] It seems that due to the high importance, inevitable usage for treatment of heart diseases, and expensiveness, the necessity for large-scale production of this drug is corroborated by genetic engineering. At first, the tPA protein was extracted from human Bowes melanoma cells.[3] Many studies have been conducted for production of recombinant human tissue plasminogen activator (rtPA): for example, in the filamentary fungus Aspergillus nidulans,[4] mammalian cell lines,[5] insect cells,[6] Saccharomyces cerevisiae,[7] Escherichia coli,[1,8] and tobacco plants.[9,10] Among the different types of hosts for production of recombinant proteins, plants have a major role. Production of biopharmaceutical and valuable recombinant proteins in plants is called molecular farming. Molecular farming has unlimited potential to produce vaccines, antibodies, therapeutic proteins, growth factors, and enzymes.[11] Due to the outsider produced proteins in plants retaining their original structure, the transgenic plants could be used for production of valuable pharmaceutical proteins and peptides.[12] (One of the plants used in molecular farming is cucumber (Cucumis sativus), an important species of Cucurbitaceae.[13] Cucumber is a major produced vegetable in the world and is suitable to use in genetic engineering to improve products.[14,14] In the world, cucumber is cultivated on 2.5 million acres and with 42.5 million tons of crop.[16] In this study, after ensuring adequate regeneration from cucumber plant cells, a construct containing the cDNA of the human tPA gene was transferred into the nucleus of cucumber plant cells by Agrobacterium. Then its gene expression in RNA level was investigated. Also, the production of recombinant proteins in transgenic plants was examined.
MATERIALS AND METHODS Plasmid and Bacteria In this research, the cDNA of the human tPA gene (Gene Bank accession number I01047) with Sac I and Bam HI restriction sites was cloned into the plant expression vector pBI121 containing the cauliflower mosaic virus promoter CaMV 35S and transcription terminator sequences
Downloaded by [Dicle University] at 11:59 04 November 2014
184
M. Asgari et al.
(NOS), and ß-glucuronidase gene. Also, Kozak sequence and KDEL signal were attached to the amino and carboxy terminals of tPA gene, respectively. The tPA was amplified with primers containing Xba I and Hinc II restriction sites 50 -gagtctagataaacatggatgcaatgaagagaaccc-3 0 , including the Kozak sequence before the starting codon as the forward primer (FA), and 5 0 atagtcaactcatagctcatctttcggtcgcatgttg-3 0 , including the KDEL sequence before the stopping codon as the reverse primer (RA). Then it was inserted into the plant binary vector pBI121 (taken from NIGEB) under the control of the cauliflower mosaic virus promoter 35S and NOS terminator. The middle of this gene was amplified with two primers (FB: 50 -ttgatgcgaaactgaggctg-30 and RB: 50 -cttctcagatttcgtgstacc-30 ) and the final construct was named as pBItPA. The 1.7-kb polymerase chain reaction (PCR) product was inserted into the two CaMV35S and NOS terminator (from nptII gene) and downstream of the pBI121 vector with Xba Iand Bam HI restriction sites (during subcloning of PCR2.1 in pBI121). Then they were refilled with T4 DNA ligase. Cucumber Transformation In this experiment, the cotyledon explants of cucumber plant (Esfahan local variety) were used. Disinfected, the cucumber seeds were cultured. After 6 days, the cotyledons were isolated from stem linkage with a curved end and divided into 5 5-mm pieces.[14] To verify proper regeneration, the cotyledon explants of cucumber plants were placed on MS medium with naphthalene acetic acid hormone (NAA) and different concentrations of benzyl amino purine hormone (BAP). Also, in another test, different concentrations of the kanamycin antibiotic were studied in order to eliminate non-transgenic cells. Purified from Escherichia coli, pBI121 plasmid (containing the tPA gene) was transferred to Agrobacterium LBA4404 by melting and solidification.[17] Transformation of tPA gene into the cotyledon explants of the cucumber plant was done via the Agrobacterium and manual method.[18] PCR and RT-PCR Analysis Because the regenerated plants resistant to kanamycin antibiotic may not be true transgenic plants—for example, the plant cells received only vector (without tPA gene)—the PCR reaction was used for confirming the presence of the gene. The extraction of DNA from the fresh young cucumber leaves regenerated on selective medium was performed via CTAB method.[19] The presence of the tPA gene was investigated in cucumber plant cells regenerated on selective medium by PCR reaction and tPA
Production of Human tPA in Cucumis sativus
185
gene-specific primers. The sequences of the primers were the following: F -tPA: 50 GAGTCTAGATAAACAATGGATGCAATGAAGAGAGGG 30
Downloaded by [Dicle University] at 11:59 04 November 2014
R-tPA: 50 ATAGTCAACTCATAGCTCATCTTTCGGTCGCATGTTG 30 Necessary conditions for the DNA proliferation of tPA gene included the initial denaturation 180 s=95 C, 35 cycles of denaturation 60 s=95 C, annealing 30 s=60 C, and elongation 120 s=72 C. The PCR product was checked on 1% agarose gel and was stained with Gelred. The young leaves of transgenic cucumber and RNX-Plus solution (Synagene, Inc.) were used for extraction of the RNA. Construction of cDNA was performed using the cDNA extraction kit (Fermentase Co.). The reverse-transcription (RT) -CR reaction and specific primers (designed from the middle of the gene) were used for the tPA gene expression in transgenic cucumber plant cells. The sequences of primers were the following: F -tPA: 50 TGGGGAACCACAACTACTGCAGAAAC 30 R-tPA: 50 GAAACCTCTCCTGGAAGCAGTGGG 30 The conditions for cDNA amplification of tPA gene included the primary denaturation 180 s=95 C, 35 cycles of three steps of denaturation 60 s=95 C, annealing 45 s=60 C, and elongation 40 s=72 C. Dot Blot Enzyme Immunoassay The production of tPA recombinant protein in the transgenic cucumber plant cells was investigated via the dot blot technique and using specific antibodies. To use this technique for detection of recombinant tPA protein production in transgenic plant extracts, first, 20 ng of absolute tPA protein (positive control) and extracted proteins from leaves of transgenic and non-transgenic plants (as control) were placed on nitrocellulose paper. The other parts of the paper were blocked with bovine serum albumin (BSA). The paper was washed with PBS-T buffer and the primary antibody (200 mg mL1) was added. After the washing, secondary peroxidase-linked antibody (400 mg mL1) was accrued. With adding of enzyme substrate containing DAB stain solution with H2O2, a color change was observed only in plant extracts containing the tPA proteins. SDS-PAGE Analysis For recombinant tPA protein molecular mass detection (toward other the produced proteins in transgenic cucumber plants compared with
186
M. Asgari et al.
non-transgenic plants), polyacrylamide gel electrophoresis (PAGE) was carried out. This simple method has appropriate resolution for identification and purity specification of proteins. In this study, the sodium dodecyl sulfate (SDS) PAGE method[20] with a little modification was used for protein electrophoresis. The gel was composed of two parts: separating gel with a concentration of 12.5%, and blocking gel with a concentration of 4%. To prepare these gels, acrylamide, bisacrylamide, SDS, Tris, and TEMED were used. At the end of electrophoresis, stained and bleached, the gels were imaged by scanner.
Downloaded by [Dicle University] at 11:59 04 November 2014
Enzyme-Linked Immunosorbent Assay The enzyme-linked immunosorbent assay (ELISA) reaction was used for determination of the quantity of recombinant tPA protein in relative to the total soluble proteins in transgenic cucumber plants. For this purpose, after the density determination of extracted proteins in transgenic and non-transgenic plants leaves with spectrophotometer, 50 ng per each sample was placed in a plate with 5 repeats. Also, to produce a standard curve, six different concentrations of tPA protein were used. After accomplishment of the different stages of the experiment including adding of the nonreflexive protein, for example, bovine serum albumin (BSA), the diluted primary antibody (200 times), and the secondary diluted antibody (200 times) containing the peroxidase, the TMB enzyme substrate attached to secondary antibody was used. After 15 min, the stopping solution was added and then its absorption was read at 450 nm with an ELISA reader device.
RESULTS Transformation of Cucumber The tPA gene was cloned into the pBI121 vector under the CaMV35S promoter, Kozak sequence, and KDEL signal. Cloning of tPA gene was confirmed by colony PCR, enzyme digestion, and sequencing. Then the produced structure was transformed to the bacterial host cell (E. coli strain DH5a). The pBI121-tPA construct information is shown in Figure 1. The study of cucumber plant cells regeneration was done in different concentrations of NAA and BAP. According to Abukazemy et al. research in 2011[21] and recent experiments in the present study, the best regeneration was attained on MS medium with NAA (0=1 mg=L1) and BAP (3 mg L1) hormones (data not shown). After preparing of the cotyledon explants, the inoculating was performed by Agrobacterium containing
Production of Human tPA in Cucumis sativus
187
Downloaded by [Dicle University] at 11:59 04 November 2014
FIGURE 1 The pBI-tPA expression vector containing the kanamycin resistance gene (NPT II), CaMV 35S promoter, transcription terminator sequences (NOS-ter), Kozak sequence, KDEL signal, and tPA gene (color figure available online).
pBI121-tPA structure. The best concentration of kanamycin antibiotic for elimination of non-transgenic cells was determined to be 40 mg L1. The selection of transgenic plants was carried out via their regeneration on selective medium containing the kanamycin antibiotics. In this case, the explants that did not receive the construct were not capable of regenerating on selective medium. Figure 2 exhibits the stages of inoculating cotyledon explants and also rooting the regenerated plants.
Molecular Analysis of the Regenerated Cucumber Plants The PCR reaction with the gene-specific primers was done on extracted DNA from cucumber plants. Some bands were observed at 1700 bp in the
FIGURE 2 (a) The inoculated cucumber explants. (b) The regeneration of inoculated explants on selective medium. (c) The rooting of regenerated seedlings on rooting medium. (d) The transformation of seedlings to the soil and nonsterile environment (color figure available online).
188
M. Asgari et al.
transgenic plants. The presence of a single band in the region around the 1700 bp in each regenerated plant with its absence in control plants was a strong reason for tPA gene transformation to the cucumber plants. Figure 3A shows the results of the PCR. RT-PCR was performed on produced cDNA. RT-PCR with specific primers from the middle of the gene demonstrated some bands around 500 bp. Figure 3B exhibits the results of RT-PCR reaction. Absence of these bands in non-transgenic plants was the reason for tPA gene expression in transgenic plants.
Downloaded by [Dicle University] at 11:59 04 November 2014
Dot Blot Reaction In this experiment, the presence or absence of tPA protein among all the extracted protein in transgenic plant leaves was investigated with its specific antibody. After adding the enzyme-linked secondary antibody substrate, including staining solution of DAB, H2O2, and PBS, the color variation was observed from colorless to brown only in extracts containing the tPA protein. No change was seen in non-transgenic plants. Figure 4 shows the result of dot blot. The variation in color intensity in the positive control samples (pure tPA protein) perhaps is due to the undesirable difference in their concentration, while the difference between non-transgenic plants is due to the presence of impurities in their protein extracts. SDS-PAGE Reaction All the proteins were extracted from transgenic and control (nontransgenic) plants leaves by the Guy et al. method,[22] and in order to
FIGURE 3 (A) PCR result of transgenic plants. M, Molecular markers (1 kb). C, negative control (water). Cþ, pBI121-tPA vector. 1, 2, Transgenic cucumber plant samples. (B) RT-PCR result of transgenic plants. M, Molecular markers (1 kb). C, negative control containing RNA. wt, Non-transgenic plant. 1–3 RT-PCR results on transgenic plants cDNA.
Production of Human tPA in Cucumis sativus
189
Downloaded by [Dicle University] at 11:59 04 November 2014
FIGURE 4 Results of dot blot assay. Cþ, positive controls (tPA protein); wt, non-transgenic plants; 1–3 transgenic plants protein samples (color figure available online).
determine quality, polyacrylamide gel electrophoresis was performed. In one of the three transgenic plants compared with control plants, an additional band was seen in the area around 60–67 kDa (tPA protein weight), a band that there was not in the control plant (Figure 5). ELISA After doing all the steps and adding the stopper to each well, the absorbance of each transgenic and non-transgenic plant with three replications was measured at a wavelength of 450 nm. The rate of absorbance in transgenic plants was two times more than in non-transgenic plants. Figure 6a shows the absorption rate in each sample. Based on absorption rate in various concentrations of pure tPA protein as the positive control at a wavelength of 450 nm, the standard curve was plotted. Average absorption rate of each plant with three replications was placed in the standard equation.
FIGURE 5 SDS-PAGE result. L, protein molecular marker (unstained protein ladder); wt, control (non-transgenic plant) sample; 1–3 transgenic plants samples (color figure available online).
190
M. Asgari et al.
Downloaded by [Dicle University] at 11:59 04 November 2014
FIGURE 6 (a) Average absorption of each plant at wavelength 450 nm. (b) tPA protein production level in transgenic plants (ng ml1) (color figure available online).
The production values of tPA protein in transgenic cucumber plants were found in terms of ng ml1 and are shown in Figure 6b. Then the value of tPA protein production compared to the total protein in each transgenic cucumber plant (based on a Bradford standard graph) was calculated. The production rate of tPA protein levels in transgenic cucumber plants was found to be at least 0.8% and in the best case 1%. DISCUSSION In this research, the cloning steps, gene transformation by Agrobacterium, and approving of human tissue plasminogen recombinant protein production in cucumber plant cells hve been described. At first, cloning of tPA gene into pBI121 vector was confirmed by PCR cloning reaction, enzyme digestion, and sequencing. After transformation of the construct to cucumber plant cells by Agrobacterium and their regeneration on selective medium, the presence and expression of tPA gene were confirmed by PCR and RT-PCR assays. Finally, production of tPA protein and its value relative to total value of soluble proteins was determined by three experiments: dot blot, SDS-PAGE, and ELISA. The recombinant pharmaceutical protein production systems are using, for example, the microbial systems, insect and mammalian cell culture, and transgenic animals that have drawbacks in terms of production cost, product safety, and integrity.[23] Thus, today the tendency for production of proteins in plants has been increased. The tPA protein drug has some preference compared to other similar drugs. The tPA plasma half-life is less than for Reteplase, Saruplase, and Lanutplase, and its dose is lower than for Reteplase and Lantuplase.[24] The tPA specificity is much greater than for streptokinase; however, the approximate cost of each treatment is more than streptokinase. Therefore, in this study, it was found that with its voluminous production in cucumber plant, the diseases treatment became easier. The value of recombinant proteins in
Downloaded by [Dicle University] at 11:59 04 November 2014
Production of Human tPA in Cucumis sativus
191
transgenic plants was reported to be between 0.002% and 7% of total soluble proteins, depending on specific genes expression factors and plants used for transformation.[25] However, in this research, the tPA protein expression levels relative to the total soluble proteins in transgenic cucumber plant were 0.8–1%. The presence of three expressions of regulatory factors (CaMV 35S, Kozak, NOS) and KDEL signal in the construct caused the increase of the tPA gene expression in cucumber plant. In a report, this combined expression was used for production of hGM-CSF in tomato plant and caused the production of recombinant proteins at the level of 0.02% of total soluble protein.[26] The reason for this increase of production in cucumber plant perhaps is gene combination with the KDEL signal. By this operation the recombinant protein accumulation increases in plants highly.[27] At the end, other evaluation ways, factors, and methods for increasing the efficiency of gene transfer in order to have tPA protein production in cucumber and other plants are recommended.
REFERENCES 1. Pennica, D.; Holmes, W.E.; Kohr, W.J.; Harkins, R.N.; Vehar, G.A.; Ward, C.A.; Bennett, W.F.; Yelverton, E.; Seeburg, P.H.; Heyneker, H.L.; Goeddel, D.V.; Collen, D. Cloning and Expression of Human Tissue-Type Plasminogen Activator cDNA in. E. coli. Nature 1983, 301, 214–221. 2. Coombs, G.S.; Dang, A.T.; Madison, E.L.; Corey, D.R. Distinct Mechanisms Contribute to Stringent Substrate Specificity of Tissue-Type Plasminogen Activator. J. Biol. Chem. 1996, 271, 4461–4467. 3. Collen, D.; Lijnen, H.R. Tissue-Type Plasminogen Activator: A Historical Perspective and Personal Account. J. Thromb. Haemost. 2004, 2, 541–546. 4. Upshall, A.; Kumar, A.A.; Bailey, M.C.; Parker, M.D.; Favreau, M.A.; Lewison, K.P.; et al. Secretion of Active Human Tissue Plasminogen Activator From the Filamentous Fungus Aspergillus nidulans. Nature Biotechnol. 1987, 5, 1301–1304. 5. Datar, R.V.; Cartwright, T.; Rosen, C.G. Process Economics of Animal Cell and Bacterial Fermentations: A Case Study Analysis of Tissue Plasminogen Activator. Biotechnology 1993, 11, 349–357. 6. Farrell, P.J.; Behie, L.A.; Iatrou, K. Transformed Lepidopteran Insect Cells: New Sources of Recombinant Human Tissue Plasminogen Activator. Biotechnol. Bioeng. 1999, 64, 426–433. 7. Martegani, E.; Forlani, N.; Mauri, I.; Porro, D.; Schleuning, W.D.; Alberghina, L. Expression of High Levels of Human Tissue Plasminogen Activator in Yeast Under the Control of an Inducible GAL Promoter. Appl. Microbiol. Biotechnol. 1992, 37, 601–608. 8. Kim, J.Y.; Fogarty, E.A.; Lu, F.J.; Zhu, H.; Wheelock, G.D.; Henderson, L.A. Twin-Arginine Translocation of Active Human Tissue Plasminogen Activator in Escherichia coli. Appl. Environ. Microbiol. 2005, 71, 8451–8459. 9. Schiermeyer, A.; Schinkel, H.; Apel, S.; Fischer, R.; Schillberg, S. Production of Desmodus rotundus Salivary Plasminogen Activator a1 (DSPAa1) in Tobacco is Hampered by Proteolysis. Biotechnol. Bioeng. 2005, 7, 848–858. 10. Masoumiasl, A.; Jalali-Javaran, M.; Mahboudi, F.; Alizadeh, H. Cloning and Expression of Tissue Plasminogen Activator (tPA) Gene in Tobacco Plants. Sci. Res. Essays 2010, 5(9), 917–922. 11. Schillberg, S.; Emans, N.; Fischer, R. Antibody Molecular Farming in Plants and Plant Cells. Phytochem. Rev. 2002, 1, 45–54. 12. Daniell, H.; Streatfield, S.J.; Wycoff, K. Medical Molecular Farming: Production of Antibodies, Biopharmaceuticals and Edible Vaccines in Plants. Trends Plant Sci. 2001, 6(5), 219–226. 13. Selvaraj, N.; Kasthurirengan, S.; Vasudevan, A.; Manickavasagam, M.; Choi, C.W.; Ganapathi, A. Evaluation of Green Fluorescent Protein as a Reporter Gene and Phosphinothricin as the Selective
192
14. 15.
16. 17. 18.
Downloaded by [Dicle University] at 11:59 04 November 2014
19. 20. 21. 22. 23. 24. 25.
26.
27.
M. Asgari et al.
Agent for Achieving a Higher Recovery of Transformants in Cucumber (Cucumis sativus L. cv. Poinsett76) via Agrobacterium tumefaciens. Soc. In Vitro Biol. 2010, 46, 329–337. Rajagopalan, P.A.; Perl-Treves, R. Improve Cucumber transformation by a modification explants Dissection and selection protocol. HORT Science. 2005, 40(2), 431–435. Lebeda, A.; Widrlechner, M.P.; Staub, J.; Ezura, H.; Zalapa, J.; Kristkova, E. Cucurbits (Cucurbitaceae; Cucumis spp., Cucurbita spp., Citrullus spp.). In Genetic Resources, Singh, R., ed. Chromosome Engineering and Crop Improvement Series, Vegetable Crops, CRC Press: Boca Raton, FL, pp. 271–376, 2007. Food and Agriculture Organization of the United Nations, Statistics Division. http://faostat.fao.org 2005 (accessed April 2011). Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, 1989. Horsch, R.B.; Fry, J.E.; Hoffmann, N.L.; Eichholtz, D.; Rogers, S.G.; Fraley, R.T. A Simple and General Method for Transferring Genes Into Plants. Science 1985, 227, 1229–1231. Murray, M.G.; Thampson, W.F. Rapid Isolation of High Molecular Weight Plant DNA. Nucl. Acid Res. 1980, 8, 4321–4325. Laemmli, U.K. Cleavage of Structural Proteins During the Assembly of the Head of Bacteriophage T4. Nature 1970, 227, 680–685. Abukazmi, K.; Jalali-Javaran, M.; Mohebodini, M.; Dehghani, H. Proansolin Human Gene Transfer to Plant Cucumbers. National Biotechnology Conference, September 2011 (in Persian). Guy, C.L.; Haskell, D. Detection of Polypeptides Associated With the Cold Acclimation Process in Spinach. Electrophoresis 1992, 9, 787–796. Ma, J.K.C.; Hein, M.B. Antibody Production and Engineering in Plants. Ann. NY Acad. Sci. 1996, 792, 73–81. Allan, M.; Ross, M.D. New Plasminogen Activators: A Clinical Review. Clin. Cardiol. 1999, 22, 165–71. Hahn, B.S.; Sim, J.S.; Kim, H.M.; Ahn, M.Y.; Pak, H.K.; Kim, N.A.; Kim, Y.H. Expression and Characterization of Human Tissue-Plasminogen Activator in Transgenic Tobacco Plants. Plant Mol. Biol. Rep. 2009, 27, 209–216. Kwon, T.H.; Kim, Y.S.; Lee, J.H.; Yang, M.S. Production and Secretion of Biologically Active Human Granulocyte-Macrophage Colony Stimulating Factor in Transgenic Tomato Suspension Cultures. Biotechnol. Lett. 2003, 25(18), 1571–4. Huang, W.M.; Lai, L.X.; Qiao, G.L.; Yue, J.M.; An, J.; Wang, K.; Fu, D.G.; Yin, Z.; Li, J. The Development of Mouse Bioreactor Expressing Human Tissue Plasminogen Activator (tPA) in Mammary Gland by Transfecting Spermatozoa in Testicular Duct. Shi Yan Sheng Wu Xue Bao 1999, 32(3), 227–232.
Preparative Biochemistry and Biotechnology Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/lpbb20
PRODUCTION OF HUMAN TISSUE PLASMINOGEN ACTIVATOR (tPA) IN Cucumis sativus a
a
a
Mishaneh Asgari , Mokhtar Jalali Javaran , Ahmad Moieni , Asad b
Masoumiasl & Maryam Abdolinasab
a
a
Department of Plant Breeding and Biotechnology, Faculty of Agriculture , Tarbiat Modares University , Tehran , Iran b
Department of biotechnology, Faculty of Agriculture , Yasuj University , Yasuj , Iran Accepted author version posted online: 14 Jun 2013.Published online: 23 Oct 2013.
To cite this article: Mishaneh Asgari , Mokhtar Jalali Javaran , Ahmad Moieni , Asad Masoumiasl & Maryam Abdolinasab (2014) PRODUCTION OF HUMAN TISSUE PLASMINOGEN ACTIVATOR (tPA) IN Cucumis sativus , Preparative Biochemistry and Biotechnology, 44:2, 182-192, DOI: 10.1080/10826068.2013.803480 To link to this article: http://dx.doi.org/10.1080/10826068.2013.803480
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms &
Downloaded by [Dicle University] at 11:59 04 November 2014
Conditions of access and use can be found at http://www.tandfonline.com/page/termsand-conditions
Preparative Biochemistry & Biotechnology, 44:182–192, 2014 Copyright # Taylor & Francis Group, LLC ISSN: 1082-6068 print/1532-2297 online DOI: 10.1080/10826068.2013.803480
Downloaded by [Dicle University] at 11:59 04 November 2014
PRODUCTION OF HUMAN TISSUE PLASMINOGEN ACTIVATOR (tPA) IN Cucumis sativus
Mishaneh Asgari,1 Mokhtar Jalali Javaran,1 Ahmad Moieni,1 Asad Masoumiasl,2 and Maryam Abdolinasab1 1 Department of Plant Breeding and Biotechnology, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran 2 Department of biotechnology, Faculty of Agriculture, Yasuj University, Yasuj, Iran
& Tissue plasminogen activator (tPA) as a serine protease with 72 kD molecular mass and 527 amino acids plays an important role in the fibrinolytic system and the dissolution of fibrin clots in human body. The collective production of this drug in plants such as cucumber, one of the most important vegetables in the world, could reduce its production costs. In this study, after scrutiny of the appropriate regeneration of cucumber plant (Isfahan variety) on MS medium with naphthalene acetic acid hormone (NAA; 0=1 mg L1) and benzyl amino purine hormone (BAP; 3 mg L1) hormones, the cloned human tPA gene under the CaMV 35S promoter and NOS terminator into pBI121 plasmid was transferred into cotyledon explants by Agrobacterium tumefaciens strain LBA4404. Subsequent to the regeneration of inoculated explants on the selective medium, the persistence of tPA gene in recombinant plants was confirmed by polymerase chain reaction (PCR) with specific primers. To evaluate the tPA gene expression in transgenic plants, RNA was extracted and the tPA gene transcription was confirmed by reverse-transcription (RT) PCR. Followed the extraction of protein from the leaves of transgenic plants, the presence of tPA protein was confirmed by dot blot and sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (PAGE) analysis in order to survey the production of recombinant tPA protein. The enzyme-linked immunosorbent assay (ELISA) test was used for recombinant tPA protein level in transgenic cucumber plants. It was counted between 0.8 and 1%, and based on this, it was concluded that the presence of three expressions of regulatory factors (CaMV 35S, Kozak, NOS) and KDEL signal in the construct caused the increase of the tPA gene expression in cucumber plants. Keywords cucumber, gene transfer, molecular farming, protein analysis, recombinant protein, tissue plasminogen activator (tPA)
Address correspondence to Mokhtar Jalali Javaran, Department of Plant Breeding and Biotechnology, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran. E-mail: [email protected]
Production of Human tPA in Cucumis sativus
183
Downloaded by [Dicle University] at 11:59 04 November 2014
INTRODUCTION Human tissue plasminogen activator (tPA) is one of the four types of plasminogen activator (urokinase, streptokinase, human tissue plasminogen activator, and DSPAa1) and produced in the liver wall and the blood vessels. This enzyme is a member of the secreted serine proteases family with 72 kD molecular mass and 527 amino acids. Human tPA converts the plasminogen to the plasmin in the presence of fibrin, and its recombinant form is used for treatment of cardiac and cerebral vascular occlusion.[1,2] It seems that due to the high importance, inevitable usage for treatment of heart diseases, and expensiveness, the necessity for large-scale production of this drug is corroborated by genetic engineering. At first, the tPA protein was extracted from human Bowes melanoma cells.[3] Many studies have been conducted for production of recombinant human tissue plasminogen activator (rtPA): for example, in the filamentary fungus Aspergillus nidulans,[4] mammalian cell lines,[5] insect cells,[6] Saccharomyces cerevisiae,[7] Escherichia coli,[1,8] and tobacco plants.[9,10] Among the different types of hosts for production of recombinant proteins, plants have a major role. Production of biopharmaceutical and valuable recombinant proteins in plants is called molecular farming. Molecular farming has unlimited potential to produce vaccines, antibodies, therapeutic proteins, growth factors, and enzymes.[11] Due to the outsider produced proteins in plants retaining their original structure, the transgenic plants could be used for production of valuable pharmaceutical proteins and peptides.[12] (One of the plants used in molecular farming is cucumber (Cucumis sativus), an important species of Cucurbitaceae.[13] Cucumber is a major produced vegetable in the world and is suitable to use in genetic engineering to improve products.[14,14] In the world, cucumber is cultivated on 2.5 million acres and with 42.5 million tons of crop.[16] In this study, after ensuring adequate regeneration from cucumber plant cells, a construct containing the cDNA of the human tPA gene was transferred into the nucleus of cucumber plant cells by Agrobacterium. Then its gene expression in RNA level was investigated. Also, the production of recombinant proteins in transgenic plants was examined.
MATERIALS AND METHODS Plasmid and Bacteria In this research, the cDNA of the human tPA gene (Gene Bank accession number I01047) with Sac I and Bam HI restriction sites was cloned into the plant expression vector pBI121 containing the cauliflower mosaic virus promoter CaMV 35S and transcription terminator sequences
Downloaded by [Dicle University] at 11:59 04 November 2014
184
M. Asgari et al.
(NOS), and ß-glucuronidase gene. Also, Kozak sequence and KDEL signal were attached to the amino and carboxy terminals of tPA gene, respectively. The tPA was amplified with primers containing Xba I and Hinc II restriction sites 50 -gagtctagataaacatggatgcaatgaagagaaccc-3 0 , including the Kozak sequence before the starting codon as the forward primer (FA), and 5 0 atagtcaactcatagctcatctttcggtcgcatgttg-3 0 , including the KDEL sequence before the stopping codon as the reverse primer (RA). Then it was inserted into the plant binary vector pBI121 (taken from NIGEB) under the control of the cauliflower mosaic virus promoter 35S and NOS terminator. The middle of this gene was amplified with two primers (FB: 50 -ttgatgcgaaactgaggctg-30 and RB: 50 -cttctcagatttcgtgstacc-30 ) and the final construct was named as pBItPA. The 1.7-kb polymerase chain reaction (PCR) product was inserted into the two CaMV35S and NOS terminator (from nptII gene) and downstream of the pBI121 vector with Xba Iand Bam HI restriction sites (during subcloning of PCR2.1 in pBI121). Then they were refilled with T4 DNA ligase. Cucumber Transformation In this experiment, the cotyledon explants of cucumber plant (Esfahan local variety) were used. Disinfected, the cucumber seeds were cultured. After 6 days, the cotyledons were isolated from stem linkage with a curved end and divided into 5 5-mm pieces.[14] To verify proper regeneration, the cotyledon explants of cucumber plants were placed on MS medium with naphthalene acetic acid hormone (NAA) and different concentrations of benzyl amino purine hormone (BAP). Also, in another test, different concentrations of the kanamycin antibiotic were studied in order to eliminate non-transgenic cells. Purified from Escherichia coli, pBI121 plasmid (containing the tPA gene) was transferred to Agrobacterium LBA4404 by melting and solidification.[17] Transformation of tPA gene into the cotyledon explants of the cucumber plant was done via the Agrobacterium and manual method.[18] PCR and RT-PCR Analysis Because the regenerated plants resistant to kanamycin antibiotic may not be true transgenic plants—for example, the plant cells received only vector (without tPA gene)—the PCR reaction was used for confirming the presence of the gene. The extraction of DNA from the fresh young cucumber leaves regenerated on selective medium was performed via CTAB method.[19] The presence of the tPA gene was investigated in cucumber plant cells regenerated on selective medium by PCR reaction and tPA
Production of Human tPA in Cucumis sativus
185
gene-specific primers. The sequences of the primers were the following: F -tPA: 50 GAGTCTAGATAAACAATGGATGCAATGAAGAGAGGG 30
Downloaded by [Dicle University] at 11:59 04 November 2014
R-tPA: 50 ATAGTCAACTCATAGCTCATCTTTCGGTCGCATGTTG 30 Necessary conditions for the DNA proliferation of tPA gene included the initial denaturation 180 s=95 C, 35 cycles of denaturation 60 s=95 C, annealing 30 s=60 C, and elongation 120 s=72 C. The PCR product was checked on 1% agarose gel and was stained with Gelred. The young leaves of transgenic cucumber and RNX-Plus solution (Synagene, Inc.) were used for extraction of the RNA. Construction of cDNA was performed using the cDNA extraction kit (Fermentase Co.). The reverse-transcription (RT) -CR reaction and specific primers (designed from the middle of the gene) were used for the tPA gene expression in transgenic cucumber plant cells. The sequences of primers were the following: F -tPA: 50 TGGGGAACCACAACTACTGCAGAAAC 30 R-tPA: 50 GAAACCTCTCCTGGAAGCAGTGGG 30 The conditions for cDNA amplification of tPA gene included the primary denaturation 180 s=95 C, 35 cycles of three steps of denaturation 60 s=95 C, annealing 45 s=60 C, and elongation 40 s=72 C. Dot Blot Enzyme Immunoassay The production of tPA recombinant protein in the transgenic cucumber plant cells was investigated via the dot blot technique and using specific antibodies. To use this technique for detection of recombinant tPA protein production in transgenic plant extracts, first, 20 ng of absolute tPA protein (positive control) and extracted proteins from leaves of transgenic and non-transgenic plants (as control) were placed on nitrocellulose paper. The other parts of the paper were blocked with bovine serum albumin (BSA). The paper was washed with PBS-T buffer and the primary antibody (200 mg mL1) was added. After the washing, secondary peroxidase-linked antibody (400 mg mL1) was accrued. With adding of enzyme substrate containing DAB stain solution with H2O2, a color change was observed only in plant extracts containing the tPA proteins. SDS-PAGE Analysis For recombinant tPA protein molecular mass detection (toward other the produced proteins in transgenic cucumber plants compared with
186
M. Asgari et al.
non-transgenic plants), polyacrylamide gel electrophoresis (PAGE) was carried out. This simple method has appropriate resolution for identification and purity specification of proteins. In this study, the sodium dodecyl sulfate (SDS) PAGE method[20] with a little modification was used for protein electrophoresis. The gel was composed of two parts: separating gel with a concentration of 12.5%, and blocking gel with a concentration of 4%. To prepare these gels, acrylamide, bisacrylamide, SDS, Tris, and TEMED were used. At the end of electrophoresis, stained and bleached, the gels were imaged by scanner.
Downloaded by [Dicle University] at 11:59 04 November 2014
Enzyme-Linked Immunosorbent Assay The enzyme-linked immunosorbent assay (ELISA) reaction was used for determination of the quantity of recombinant tPA protein in relative to the total soluble proteins in transgenic cucumber plants. For this purpose, after the density determination of extracted proteins in transgenic and non-transgenic plants leaves with spectrophotometer, 50 ng per each sample was placed in a plate with 5 repeats. Also, to produce a standard curve, six different concentrations of tPA protein were used. After accomplishment of the different stages of the experiment including adding of the nonreflexive protein, for example, bovine serum albumin (BSA), the diluted primary antibody (200 times), and the secondary diluted antibody (200 times) containing the peroxidase, the TMB enzyme substrate attached to secondary antibody was used. After 15 min, the stopping solution was added and then its absorption was read at 450 nm with an ELISA reader device.
RESULTS Transformation of Cucumber The tPA gene was cloned into the pBI121 vector under the CaMV35S promoter, Kozak sequence, and KDEL signal. Cloning of tPA gene was confirmed by colony PCR, enzyme digestion, and sequencing. Then the produced structure was transformed to the bacterial host cell (E. coli strain DH5a). The pBI121-tPA construct information is shown in Figure 1. The study of cucumber plant cells regeneration was done in different concentrations of NAA and BAP. According to Abukazemy et al. research in 2011[21] and recent experiments in the present study, the best regeneration was attained on MS medium with NAA (0=1 mg=L1) and BAP (3 mg L1) hormones (data not shown). After preparing of the cotyledon explants, the inoculating was performed by Agrobacterium containing
Production of Human tPA in Cucumis sativus
187
Downloaded by [Dicle University] at 11:59 04 November 2014
FIGURE 1 The pBI-tPA expression vector containing the kanamycin resistance gene (NPT II), CaMV 35S promoter, transcription terminator sequences (NOS-ter), Kozak sequence, KDEL signal, and tPA gene (color figure available online).
pBI121-tPA structure. The best concentration of kanamycin antibiotic for elimination of non-transgenic cells was determined to be 40 mg L1. The selection of transgenic plants was carried out via their regeneration on selective medium containing the kanamycin antibiotics. In this case, the explants that did not receive the construct were not capable of regenerating on selective medium. Figure 2 exhibits the stages of inoculating cotyledon explants and also rooting the regenerated plants.
Molecular Analysis of the Regenerated Cucumber Plants The PCR reaction with the gene-specific primers was done on extracted DNA from cucumber plants. Some bands were observed at 1700 bp in the
FIGURE 2 (a) The inoculated cucumber explants. (b) The regeneration of inoculated explants on selective medium. (c) The rooting of regenerated seedlings on rooting medium. (d) The transformation of seedlings to the soil and nonsterile environment (color figure available online).
188
M. Asgari et al.
transgenic plants. The presence of a single band in the region around the 1700 bp in each regenerated plant with its absence in control plants was a strong reason for tPA gene transformation to the cucumber plants. Figure 3A shows the results of the PCR. RT-PCR was performed on produced cDNA. RT-PCR with specific primers from the middle of the gene demonstrated some bands around 500 bp. Figure 3B exhibits the results of RT-PCR reaction. Absence of these bands in non-transgenic plants was the reason for tPA gene expression in transgenic plants.
Downloaded by [Dicle University] at 11:59 04 November 2014
Dot Blot Reaction In this experiment, the presence or absence of tPA protein among all the extracted protein in transgenic plant leaves was investigated with its specific antibody. After adding the enzyme-linked secondary antibody substrate, including staining solution of DAB, H2O2, and PBS, the color variation was observed from colorless to brown only in extracts containing the tPA protein. No change was seen in non-transgenic plants. Figure 4 shows the result of dot blot. The variation in color intensity in the positive control samples (pure tPA protein) perhaps is due to the undesirable difference in their concentration, while the difference between non-transgenic plants is due to the presence of impurities in their protein extracts. SDS-PAGE Reaction All the proteins were extracted from transgenic and control (nontransgenic) plants leaves by the Guy et al. method,[22] and in order to
FIGURE 3 (A) PCR result of transgenic plants. M, Molecular markers (1 kb). C, negative control (water). Cþ, pBI121-tPA vector. 1, 2, Transgenic cucumber plant samples. (B) RT-PCR result of transgenic plants. M, Molecular markers (1 kb). C, negative control containing RNA. wt, Non-transgenic plant. 1–3 RT-PCR results on transgenic plants cDNA.
Production of Human tPA in Cucumis sativus
189
Downloaded by [Dicle University] at 11:59 04 November 2014
FIGURE 4 Results of dot blot assay. Cþ, positive controls (tPA protein); wt, non-transgenic plants; 1–3 transgenic plants protein samples (color figure available online).
determine quality, polyacrylamide gel electrophoresis was performed. In one of the three transgenic plants compared with control plants, an additional band was seen in the area around 60–67 kDa (tPA protein weight), a band that there was not in the control plant (Figure 5). ELISA After doing all the steps and adding the stopper to each well, the absorbance of each transgenic and non-transgenic plant with three replications was measured at a wavelength of 450 nm. The rate of absorbance in transgenic plants was two times more than in non-transgenic plants. Figure 6a shows the absorption rate in each sample. Based on absorption rate in various concentrations of pure tPA protein as the positive control at a wavelength of 450 nm, the standard curve was plotted. Average absorption rate of each plant with three replications was placed in the standard equation.
FIGURE 5 SDS-PAGE result. L, protein molecular marker (unstained protein ladder); wt, control (non-transgenic plant) sample; 1–3 transgenic plants samples (color figure available online).
190
M. Asgari et al.
Downloaded by [Dicle University] at 11:59 04 November 2014
FIGURE 6 (a) Average absorption of each plant at wavelength 450 nm. (b) tPA protein production level in transgenic plants (ng ml1) (color figure available online).
The production values of tPA protein in transgenic cucumber plants were found in terms of ng ml1 and are shown in Figure 6b. Then the value of tPA protein production compared to the total protein in each transgenic cucumber plant (based on a Bradford standard graph) was calculated. The production rate of tPA protein levels in transgenic cucumber plants was found to be at least 0.8% and in the best case 1%. DISCUSSION In this research, the cloning steps, gene transformation by Agrobacterium, and approving of human tissue plasminogen recombinant protein production in cucumber plant cells hve been described. At first, cloning of tPA gene into pBI121 vector was confirmed by PCR cloning reaction, enzyme digestion, and sequencing. After transformation of the construct to cucumber plant cells by Agrobacterium and their regeneration on selective medium, the presence and expression of tPA gene were confirmed by PCR and RT-PCR assays. Finally, production of tPA protein and its value relative to total value of soluble proteins was determined by three experiments: dot blot, SDS-PAGE, and ELISA. The recombinant pharmaceutical protein production systems are using, for example, the microbial systems, insect and mammalian cell culture, and transgenic animals that have drawbacks in terms of production cost, product safety, and integrity.[23] Thus, today the tendency for production of proteins in plants has been increased. The tPA protein drug has some preference compared to other similar drugs. The tPA plasma half-life is less than for Reteplase, Saruplase, and Lanutplase, and its dose is lower than for Reteplase and Lantuplase.[24] The tPA specificity is much greater than for streptokinase; however, the approximate cost of each treatment is more than streptokinase. Therefore, in this study, it was found that with its voluminous production in cucumber plant, the diseases treatment became easier. The value of recombinant proteins in
Downloaded by [Dicle University] at 11:59 04 November 2014
Production of Human tPA in Cucumis sativus
191
transgenic plants was reported to be between 0.002% and 7% of total soluble proteins, depending on specific genes expression factors and plants used for transformation.[25] However, in this research, the tPA protein expression levels relative to the total soluble proteins in transgenic cucumber plant were 0.8–1%. The presence of three expressions of regulatory factors (CaMV 35S, Kozak, NOS) and KDEL signal in the construct caused the increase of the tPA gene expression in cucumber plant. In a report, this combined expression was used for production of hGM-CSF in tomato plant and caused the production of recombinant proteins at the level of 0.02% of total soluble protein.[26] The reason for this increase of production in cucumber plant perhaps is gene combination with the KDEL signal. By this operation the recombinant protein accumulation increases in plants highly.[27] At the end, other evaluation ways, factors, and methods for increasing the efficiency of gene transfer in order to have tPA protein production in cucumber and other plants are recommended.
REFERENCES 1. Pennica, D.; Holmes, W.E.; Kohr, W.J.; Harkins, R.N.; Vehar, G.A.; Ward, C.A.; Bennett, W.F.; Yelverton, E.; Seeburg, P.H.; Heyneker, H.L.; Goeddel, D.V.; Collen, D. Cloning and Expression of Human Tissue-Type Plasminogen Activator cDNA in. E. coli. Nature 1983, 301, 214–221. 2. Coombs, G.S.; Dang, A.T.; Madison, E.L.; Corey, D.R. Distinct Mechanisms Contribute to Stringent Substrate Specificity of Tissue-Type Plasminogen Activator. J. Biol. Chem. 1996, 271, 4461–4467. 3. Collen, D.; Lijnen, H.R. Tissue-Type Plasminogen Activator: A Historical Perspective and Personal Account. J. Thromb. Haemost. 2004, 2, 541–546. 4. Upshall, A.; Kumar, A.A.; Bailey, M.C.; Parker, M.D.; Favreau, M.A.; Lewison, K.P.; et al. Secretion of Active Human Tissue Plasminogen Activator From the Filamentous Fungus Aspergillus nidulans. Nature Biotechnol. 1987, 5, 1301–1304. 5. Datar, R.V.; Cartwright, T.; Rosen, C.G. Process Economics of Animal Cell and Bacterial Fermentations: A Case Study Analysis of Tissue Plasminogen Activator. Biotechnology 1993, 11, 349–357. 6. Farrell, P.J.; Behie, L.A.; Iatrou, K. Transformed Lepidopteran Insect Cells: New Sources of Recombinant Human Tissue Plasminogen Activator. Biotechnol. Bioeng. 1999, 64, 426–433. 7. Martegani, E.; Forlani, N.; Mauri, I.; Porro, D.; Schleuning, W.D.; Alberghina, L. Expression of High Levels of Human Tissue Plasminogen Activator in Yeast Under the Control of an Inducible GAL Promoter. Appl. Microbiol. Biotechnol. 1992, 37, 601–608. 8. Kim, J.Y.; Fogarty, E.A.; Lu, F.J.; Zhu, H.; Wheelock, G.D.; Henderson, L.A. Twin-Arginine Translocation of Active Human Tissue Plasminogen Activator in Escherichia coli. Appl. Environ. Microbiol. 2005, 71, 8451–8459. 9. Schiermeyer, A.; Schinkel, H.; Apel, S.; Fischer, R.; Schillberg, S. Production of Desmodus rotundus Salivary Plasminogen Activator a1 (DSPAa1) in Tobacco is Hampered by Proteolysis. Biotechnol. Bioeng. 2005, 7, 848–858. 10. Masoumiasl, A.; Jalali-Javaran, M.; Mahboudi, F.; Alizadeh, H. Cloning and Expression of Tissue Plasminogen Activator (tPA) Gene in Tobacco Plants. Sci. Res. Essays 2010, 5(9), 917–922. 11. Schillberg, S.; Emans, N.; Fischer, R. Antibody Molecular Farming in Plants and Plant Cells. Phytochem. Rev. 2002, 1, 45–54. 12. Daniell, H.; Streatfield, S.J.; Wycoff, K. Medical Molecular Farming: Production of Antibodies, Biopharmaceuticals and Edible Vaccines in Plants. Trends Plant Sci. 2001, 6(5), 219–226. 13. Selvaraj, N.; Kasthurirengan, S.; Vasudevan, A.; Manickavasagam, M.; Choi, C.W.; Ganapathi, A. Evaluation of Green Fluorescent Protein as a Reporter Gene and Phosphinothricin as the Selective
192
14. 15.
16. 17. 18.
Downloaded by [Dicle University] at 11:59 04 November 2014
19. 20. 21. 22. 23. 24. 25.
26.
27.
M. Asgari et al.
Agent for Achieving a Higher Recovery of Transformants in Cucumber (Cucumis sativus L. cv. Poinsett76) via Agrobacterium tumefaciens. Soc. In Vitro Biol. 2010, 46, 329–337. Rajagopalan, P.A.; Perl-Treves, R. Improve Cucumber transformation by a modification explants Dissection and selection protocol. HORT Science. 2005, 40(2), 431–435. Lebeda, A.; Widrlechner, M.P.; Staub, J.; Ezura, H.; Zalapa, J.; Kristkova, E. Cucurbits (Cucurbitaceae; Cucumis spp., Cucurbita spp., Citrullus spp.). In Genetic Resources, Singh, R., ed. Chromosome Engineering and Crop Improvement Series, Vegetable Crops, CRC Press: Boca Raton, FL, pp. 271–376, 2007. Food and Agriculture Organization of the United Nations, Statistics Division. http://faostat.fao.org 2005 (accessed April 2011). Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, 1989. Horsch, R.B.; Fry, J.E.; Hoffmann, N.L.; Eichholtz, D.; Rogers, S.G.; Fraley, R.T. A Simple and General Method for Transferring Genes Into Plants. Science 1985, 227, 1229–1231. Murray, M.G.; Thampson, W.F. Rapid Isolation of High Molecular Weight Plant DNA. Nucl. Acid Res. 1980, 8, 4321–4325. Laemmli, U.K. Cleavage of Structural Proteins During the Assembly of the Head of Bacteriophage T4. Nature 1970, 227, 680–685. Abukazmi, K.; Jalali-Javaran, M.; Mohebodini, M.; Dehghani, H. Proansolin Human Gene Transfer to Plant Cucumbers. National Biotechnology Conference, September 2011 (in Persian). Guy, C.L.; Haskell, D. Detection of Polypeptides Associated With the Cold Acclimation Process in Spinach. Electrophoresis 1992, 9, 787–796. Ma, J.K.C.; Hein, M.B. Antibody Production and Engineering in Plants. Ann. NY Acad. Sci. 1996, 792, 73–81. Allan, M.; Ross, M.D. New Plasminogen Activators: A Clinical Review. Clin. Cardiol. 1999, 22, 165–71. Hahn, B.S.; Sim, J.S.; Kim, H.M.; Ahn, M.Y.; Pak, H.K.; Kim, N.A.; Kim, Y.H. Expression and Characterization of Human Tissue-Plasminogen Activator in Transgenic Tobacco Plants. Plant Mol. Biol. Rep. 2009, 27, 209–216. Kwon, T.H.; Kim, Y.S.; Lee, J.H.; Yang, M.S. Production and Secretion of Biologically Active Human Granulocyte-Macrophage Colony Stimulating Factor in Transgenic Tomato Suspension Cultures. Biotechnol. Lett. 2003, 25(18), 1571–4. Huang, W.M.; Lai, L.X.; Qiao, G.L.; Yue, J.M.; An, J.; Wang, K.; Fu, D.G.; Yin, Z.; Li, J. The Development of Mouse Bioreactor Expressing Human Tissue Plasminogen Activator (tPA) in Mammary Gland by Transfecting Spermatozoa in Testicular Duct. Shi Yan Sheng Wu Xue Bao 1999, 32(3), 227–232.
