Program and Abstracts of the 13th Transgenic Technology Meeting (TT2016): Clarion Congress Hotel, Prague, Czech Republic, 20-23 March 2016.

Transgenic Res (2016) 25:195–270 DOI 10.1007/s11248-016-9936-6

Springer International Publishing Switzerland 2016

ABSTRACTS

Program and Abstracts of the 13th Transgenic Technology Meeting (TT2016) Clarion Congress Hotel, Prague, Czech Republic, 20–23 March 2016

The TT2016 meeting is hosted by: the Czech Centre for Phenogenomics (CCP), BIOCEV, Prumyslova 595, 25242, Vestec, Czech Republic

Biotechnology and Biomedicine Center of the Academy of Sciences and Charles University in Vestec, Prumyslova 595, 252 42, Vestec, Czech Republic

Institute of Molecular Genetics of the ASCR, v. v. i. Vı´denˇska´ 1083, 142 20 Prague 4, Czech Republic

123

196

Transgenic Res (2016) 25:195–270

Organization Committee Radislav Sedlacek (Prague, Czech Republic) Inken M. Beck (Prague, Czech Republic) Kallayane Chawengsaksophak (Prague, Czech Republic) Zbynek Kozmik (Prague, Czech Republic) Petr Bartunek (Prague, Czech Republic) Ronald Naumann (Dresden, Germany) Boris Jerchow (ISTT, Berlin, Germany) Jan Parker-Thornburg (ISTT, Houston TX, USA) Martina Crispo (ISTT, Montevideo, Uruguay) Christian Mosimann (Zu¨rich, Switzerland) Nicole Chambers (Prague, Czech Republic)

Scientific Advisory Committee

Opening of TT2016 17:30–18:00

Welcome address—ISTT president & organizing committee

Session 1: Opening Keynote lecture 18:00–19:00

19:00–

Andras Nagy (Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital, Canada) Utilising transposon-delivered transgenes for understanding reprogramming Come together evening

Monday 21st March 2016 Wojtek Auerbach (Regeneron Pharmaceuticals Inc.NY, USA) Jiri Forejt (Institute of Molecular Genetics, Prague, Czech Republic) Alexandra L. Joyner (Sloan-Kettering Institute, NY, USA) Carlisle P. Landel (Transposagen Biopharmaceuticals, KY USA) K.C. Kent Lloyd (University of California, Davis, USA) Lluı´s Montoliu (CNB-CSIC, Madrid, Spain) Andras Nagy (Mount Sinai Hospital Lunenfeld-Tanenbaum Research Institute, Toronto, Canada) Janet Rossant (University of Toronto, Toronto, Canada) Francis Stewart (The Biotechnology Center (BIOTEC), Dresden, Germany) TT2016 Registration and Administration GUARANT International TT2016 sponsors Tecniplast + Trigon-plus Charles River Eppendorf Sigma Aldrich Transnetyx Janvier labs Research Instruments Ltd AgnTho’s The Jackson Laboratory Applied StemCell, Inc a-tune software AG Labotect GmbH Scionics Computer Innovation GmbH Hamilton Thorne Inc. (HTL.V) INFRAFRONTIER GVG Genetic Monitoring GmbH CELL CRYOGENICS LTD Cosmo Bio Advanced Analytical Envigo Horizon Discovery Ltd Genentech

08:00–18:00

Session 2: Generation of transgenic models I 09:00–09:30

09:30–10:00

10:00–10:30

10:30–10:50

10:50–11:05

11:05–11:20

11:20–11:35

11:35–11:50

13:00–20:00

123

Registration open

Charles A. Gersbach (Duke Center for Genomic and Computational Biology, USA) Genome and Epigenome Editing with CRISPR/ Cas9 for Gene Therapy and Disease Modeling Ralf Ku¨hn (Max-Delbru¨ck-Center for Molecular Medicine, Germany) Direct production of mouse mutants using engineered nucleases in one-cell embryos Lluis Montoliu (National Centre for Biotechnology (CNB), Spain) CRISPR-ing the non-coding genome TEA & COFFEE

Session 3: Generation of transgenic models II (selected presentations)

TT2016 Scientific Program Sunday 20th March 2016

Registration open

11:50–12:05

Se´verine Meńoret Increased efficiency of BAC transgenesis by piggyBac transposition but not by CRISPR/ Cas9 targeted integration for the generation of human SIRPalpha rats Grzegorz Kreiner Targeting nucleolus—a new approach in generating transgenic mouse models of neurodegenerative diseases and their exploitation to study possible neuroprotective Melissa A. Larson Nuclear Transfer between Strains of Inbred Mice Christian Mosimann Post-genome editing approaches for recombinase genetics in zebrafish Andrei Golovko 10 Years of TIGM: Important Lessons and Future Perspectives

Transgenic Res (2016) 25:195–270 12:05–12:20

12:20–13:30

Anna Anagnostopoulos Using the Human–Mouse: Disease Connection to Identify Mouse Models of Human Disease LUNCH & POSTERS

Sponsored session: Applied StemCell, Inc 12:20–13:20

Ruby Chen-Tsai (Applied StemCell Inc.) Development of integrase-based TARGATTTM method for generating site-specific transgenic rat models

Session 4: Running a Transgenic Service Facility 13:30–15:00

15:00–15:15

Round table discussion Marina Gertsenstein (Toronto Center for Phenogenomics (TCP), Canada) Cord Brakebusch (Biotech Research and Innovation Centre (BRIC), Denmark Lauryl Nutter (Toronto Center for Phenogenomics (TCP) (Canada) TEA & COFFEE

Session 5: Beyond transgenic model generation 15:15–15:45

15:45–16:15

16:15–16:45

16:45–17:00

Mary Dickinson (Baylor College of Medicine, USA) Analysis of embryonic lethal mutations in mice using 3D imaging Nicholas Gale (Regeneron Pharmaceuticals, USA) A large scale mouse phenotyping screen for the discovery of novel biotech targets in oncology and angiogenesis and other therapeutic areas Kent Lloyd (University of California, Davis, USA) An update on progress by the International Mouse Phenotyping Consortium (IMPC) TEA & COFFEE

Session 6: World of Nucleases: discovery and development 17:00–17:30

17:30–18:00

18:00–18:30

Francis Mojica (University of Alicante, Spain) Taking a look at the CRISPR biology and applications from a historical perspective Bernd Zetsche (Broad Institute of MIT and Harvard Cambridge, USA) Cpf1 is a single-RNA-guided endonuclease of a Class 2 CRISPR-Cas system Konstantin Severinov (Skolkovo Institute of Science and Technology, Russia) A pipeline approach for discovery of novel CRISRP-Cas systems

197 Tuesday 22nd March 2016

Session 7: Advances in animal biotechnology 08:30–09:00

09:00–09:30

09:30–10:00

10:00–10:15

Eckhard Wolf (LMU Munich, Germany) COST Action BM1308 ‘‘Sharing Advances on Large Animal Models—SALAAM’’ Yonglun Luo (Aarhus University, Denmark) Efficient precision gene editing in pigs: Towards a new era in generating genetically designed pigs of human diseases and regenerative medicine Chris Proudfoot (The Roslin Institute of the University of Edinburgh, UK) Genome engineering livestock TEA & COFFEE

Session 8: Advances in animal biotechnology (selected presentations) 10:15–10:30

10:30–10:45

10:45–11:00 11:00–11:15

Soo Young Yum Production and Analysis of a multi-copy integrated transgenic cattle via transposon Amy Kaucher Production of germline ablated male pigs via Crispr/Cas editing of the NANOS2 gene Sean Stevens Pig Genome Engineering for Xenotransplantation Wiebke Garrels Multiplex Transgenesis in Cattle via the Sleeping Beauty Transposon System

Parallel sessions

Session 9: Animal Ethics 11:20–11:40

11:40–12:00

12:00–12:20

Henriette Bout (University of Amsterdam, the Netherlands) Ethical aspects of the Crispr/Cas9 technology Aurora Brønstad (University of Bergen, Norway) The AALAS-FELASA Working Group on Harm-Benefit analysis of animal studies Michelle Stewart (Mary Lyon Centre, Medical Research Council UK) The Four R’s of phenotyping GA mice— Robustness, Reproducibility, Rigorousness, and Randomisation

Session 10: Technology development II 11:20–11:40

Toru Takeo (Center for Animal Resources and Development (CARD), Japan) Efficient production of mouse oocytes using superovulation by immunization against inhibin

123

198 11:40–12:00

12:00–12:20

12:20–14:00

Transgenic Res (2016) 25:195–270 Jeff Batton (GeneSearch, Inc., USA) New Cost-Effective Methods for Stem Cell Procedures on Pre-Implantation Embryos Sandra Hope (Brigham Young University, USA) Microfabricated Lance Array Nanoinjection system delivers CRISPR-Cas9 to Hundreds of Thousands of Cells Simultaneously LUNCH & POSTERS

09:30–10:00

10:00–10:15

Tomomi Aida (Medical Research Institute (MRI) of Tokyo Medical and Dental University (TMDU), Japan) Gene cassette knock-in in mice with cloningfree CRISPR/Cas system TEA & COFFEE

Session 15: Genetics, Epigenetics, Stem cell manipulation Session 11: Gene manipulation and genome editing and (disease) models I 14:00–14:30 14:30–15:00

Ethan Bier (University of California, USA) The implications of active genetics Didier Stainier (Max Planck Institute for Heart and Lung Research, Germany) Genetic compensation induced by deleterious mutations but not gene knockdowns

10:15–10:45

10:45–11:15

11:15–11:45 11:45–13:30

Robin Lovell-Badge (Francis Crick Institute, UK) Regulation of Sox9 in the gonad during sex determination F. Kent Hamra (University of Texas Southwestern Medical Center, USA) Rat Germline Editing in Donor Spermatogonial Stem Cells John Schimenti (Cornell University, USA) GWIS: Genetics with Interrogation of SNPs LUNCH & POSTERS

Session 12: Gene manipulation and genome editing and (disease) models II (selected presentations) 15:00–15:15

15:15–15:30

15:30–15:45

15:45–16:00

Marie-Christine Birling Generation of genomic structural variants by CRISPR/Cas9 genome editing in rodents Katharina Boroviak The possibilities and limitations of CRISPR/ Cas9 in mouse zygotes Kevin A. Peterson CRISPR/Cas9 mediated gene modification provides a robust platform for modeling developmental disorders TEA & COFFEE

Session 13: Orbis pictus lecture 16:00–16:45

16:45–18:00 19:15–

Richard Behringer (University of Texas MD Anderson Cancer Center, USA) Transgenic approaches in diverse animals species ISTT GENERAL ASSEMBLY Gala dinner (Zofin Palace)

Wednesday 23rd March 2016

Session 16: Generation of transgenic models I: Models of diseases and applications (selected presentations) 13:30–13:45

13:45–14:00

14:00–14:15

14:15–14:30

14:30–14:45

Yann Herault Modelling and understanding rare genetic diseases with intellectual disabilities for tomorrow’s treatment Petr Kasparek TALEN-mediated inactivation of Klk5 and Klk7 rescues lethal phenotype of Netherton syndrome mouse model Javier Martıń-Gonza´lez A powerful new tool to improve immunecompromised mouse models: derivation of NRG embryonic stem cell lines. Prem Premsrirut RNAi and CRISPR/Cas9 based In Vivo Models for Drug Discovery TEA & COFFEE

Session 17: Orbis pictus lecture II 14:45–15:30

Thomas Boehm (Max Planck Institute of Immunology and Epigenetics, Germany) Genetic basis of lymphoid organ formation

Session 14: Technology development 08:30–09:00

09:00–09:30

123

Masato Ohtsuka (Tokai University School of Medicine, Japan) GONAD and Easy (Isi)-CRISPR: novel mouse genome engineering tools Haoyi Wang (Institute of Zoology, Chinese Academy of Sciences, China) CRISPR-Cas9 Application in Mouse Model Creation and Transcription Regulation

Session 18: Genetics & models pluripotency/iPS cells 15:30–16:00

16:00–16:30

Rene Maehr (UMass Medical School, USA) Towards using pluripotent stem cell-based disease models to study immune syndromes Ron Weiss (Massachusetts Institute of Technology, USA) Mammalian Synthetic Biology: From Parts to Modules to Therapeutic Systems

Transgenic Res (2016) 25:195–270 16:30–16:45

TEA & COFFEE

199 15.00–15.15 15:15–16:00

Session 19: Award session 16:45–16:50 16:50–17:10

3rd ISTT Young Investigator Award Pablo Ross Embryonic stem cells and interspecies blastocyst complementation in farm animals

16.00–16.30

16:30–17:00 19:30 Session 20: Closing Keynote Lecture 17:10–17:55

17:55–18:10

Denis Duboule (University of Geneva, Switzerland) A Genetic Approach of Long-range Gene Regulation During Development and Evolution Close of Meeting

Day 2—Thursday 17th March 2016 07:30–10:30

TT2016 Hands-on Workshops Workshop organization committee Radislav Sedlacek (CCP, Prague, Czech Republic) Martin Fray (MRC, Harwell, UK) Petr Bartunek (IMG, Prague, Czech Republic) Bjoern Schuster (CCP, Prague, Czech Republic) Inken M. Beck (CCP, Prague, Czech Republic) Nicole Chambers (CCP, Prague, Czech Republic)

10:30–11:00 11:00–12:00

12:00–13:00 13:00–15:30 15.30–16:00

INFRAFRONTIER-I3—Mouse cryopreservation workshop

16.00–16:15 16:15–17:00

Day 1—Wednesday 16th March 2016 08:30–09:00 09.00–09:15

09:15–09:25 09:25–10:45

10:45–11:00 11:00–12:00

12:00–13:00 13:00–15:00

Arrival and registration Welcome and introduction to the IMG and CCP Radislav Sedlacek, IMG, Prague, Czech Republic Introduction to the course and the teaching material Principles and benefits of cryobiology Martin Fray, Medical Research Council, Harwell, UK TEA and COFFEE New approaches to exchanging mouse strains Lluis Montoliu, National Centre of Biotechnology, Madrid, Spain LUNCH Sperm Harvesting/Freezing Introduction A. Sperm freezing—(Practical) B. Preparing epididymides held for refrigerated transportation in Lifor (Practical) C. Sperm held on dry-ice (Demonstration)

TEA and COFFEE Preparation for Thursday’s IVF Media preparation A. Pre-incubation dish containing MBCD B. Fertilisation drops containing GSH C. Wash dish containing mHTF Animal welfare aspects on cryopreservation Marcello Raspa, CNR-IBCN, Monterotondo, Italy Recap/Review MEET IN PRAGUE FOR BAR DINNER

IVF Introduction (a) Set up an IVF using freshly harvested sperm and vitrified oocytes—(Demonstration) (b) Set up an IVF using sperm held on dry ice -(Demonstration) (c) Set up an IVF using sperm harvested from epididymides held overnight in Lifor— (Practical) (d) Set up an IVF using sperm frozen in LN2 (Practical) TEA AND COFFEE New development and ideas in sperm freezing techniques—Toru Takeo, CARD, Kumamoto University, Japan LUNCH Wash IVF—(Demonstration followed by practical training) INFRAFRONTIER-EMMA resource, principles to efficiently share mouse models—Susan Marschall (Helmholtz Zentrum Munich, Germany) Recap/Review CRISPR technology (joint lecture) Lluis Montoliu, National Centre of Biotechnology, Madrid, Spain

Day 3—Friday 18th March 2016 08:30–10:00 10:00–10:15 10:15–12:00 12:00–13:00 13:00–14:00 14.00–16.00 16.00–16.15 16:15–17:15 17:15–17:30

Assess IVF dishes—(Demonstration followed by practical) TEA AND COFFEE Embryo vitrification—(Demonstration followed by practical) Thawing vitrified embryos—(Demonstration followed by practical) LUNCH Non-surgical embryo transfer—Barbara Stone, Paratechs Corporation TEA and COFFEE Preparing frozen samples for shipment—Soren Knudsen—Cryoport Wrap up presentation and closure of the course

123

200


CCP programmable nucleases (CRISPR/Cas9) Transgenesis Course Day 1—Wednesday 16th March 2016 08:30–09:00 09.00–09:15 09:15–09:25

09:25–10:00

10:00–10:45

10:45–11:00 11:00–13:00

13:00–14:00 14:00–14:30

14:30–16:00

16.00–16.15 16:15–17:00 19:30

Arrival and Registration Welcome and Introduction to IMG and CCP Radislav Sedlacek (IMG/CCP) Introduction to the Course and the Teaching Material Bjo¨rn Schuster (IMG/CCP) Lecture: Mouse transgenesis: Pros-and-cons of programmable nucleases Radislav Sedlacek Sponsored lecture: Guide design and demonstration of web based tool Leigh Brody—Desktop Genetics TEA and COFFEE Practical training session I. A. CRISPR/Cas9 Zygote injection—Ronald Naumann B. Electroporation of zygotes—Haoyi Wang C. Bioinformatics, experimental design & targeting & genotyping—Bjo¨rn Schuster LUNCH Targeting design—validation of the tools— genotyping Bjo¨rn Schuster (IMG/CCP) CRISPR validation practical (cell culture & transfection) Bjo¨rn Schuster & Jana Kopkanova (IMG/CCP) TEA and COFFEE Lecture: oocyte—embryo transition in mammals Petr Svoboda—Institute of Molecular Genetics, CZ MEET IN PRAGUE FOR DINNER

16:15–17:00

19:30

Day 3—Friday 18th March 2016 09:00–09:45

09:45–10:00 10:00–12:00

12:00–13:00 13:00–15:00

15:00–15:15 15:15–16:00 16:00–17:15 17:15–17:30 17:30

Day 1—Wednesday 23rd March 2016 18:00–18:45 18:45–19:00 19:00–19:45

09:00–09:15 09:15–10:00

20:00–22:00

10:00–10:45

10:45–11:00 11:00–13:00

13:00–14:00 14:00–14:20

14:20–16:00

16.00–16:15

123

Development CRISPR-Cas9 technology & Cpf1 Bernd Zetsche—Broad Institute, USA TEA AND COFFEE Practical training session III. A. CRISPR/Cas9 Zygote injection—Ronald Naumann B. Electroporation of zygotes—Haoyi Wang C. Bioinformatics, experimental design & targeting & genotyping—Bjo¨rn Schuster LUNCH CRISPR validation practical (PCR based genotyping) Jana Kopkanova & Bjo¨rn Schuster (IMG/CCP) TEA and COFFEE Collection of results and preparation of short presentations Short group presentations and discussion Summary & Conclusions Radislav Sedlacek End of course

Zebrafish Genome Editing

Day 2—Thursday 17th March 2016 Recap/Review Lecture: Genotyping strategies and tools Jana Kopkanova & Bjo¨rn Schuster (IMG/CCP) Sponsored Lecture: CRISPR genome editing workflow Caroline Becket—Merck Millipore Sigma TEA AND COFFEE Practical training session II. A. CRISPR/Cas9 Zygote injection—Ronald Naumann B. Electroporation of zygotes—Haoyi Wang C. Bioinformatics, experimental design & targeting & genotyping—Bjo¨rn Schuster LUNCH Targeting design—validation of the tools— genotyping Bjo¨rn Schuster (IMG/CCP) CRISPR validation practical (DNA isolation and PCR based genotyping I) Jana Kopkanova & Bjo¨rn Schuster (IMG/CCP) TEA & COFFEE

Lecture—CRISPR technology Lluis Montoliu—CNB, Spain This lecture will be a joint lecture with the Cryopreservation workshop DINNER

Registration (Clarion Congress Hotel, Prague) Welcome and Introduction (P. Bartunek and Z. Kozmik) Talk-Zebrafish transgenesis and genome editing: state-of-the-art (C. Mosimann) Get together/roundtable discussion/course expectations and LIGHT DINNER

Day 2—Thursday 24th March 2016 08:30–09:00 09:00–12:30

12:30–13:30 13:30–14:00 14:00–15:30 16:00–16:30 16:30–18:00 18:00–18:30 19:00

Arrival at Institute of Molecular Genetics, Prague—TEA/COFFEE Collection of embryos, microinjections— morpholino oligonucleotides, CRISPR-Cas9 (mRNA and protein) LUNCH Talk-sgRNA design, genotyping and analysis of results (C. Mosimann) in vitro transcription and purification of sgRNA, discussion of alternative methods TEA and COFFEE Embryo manipulations, mounting, imaging, analysis (stereo, macroscope) Setup of adult zebrafish to generate injectionready embryos DINNER


201

Day 3—Friday 25th March 2016

the dynamics of the epigenome driving the generation of pluripotent cells. Keywords: stem cells, pluripotency, somatic cell reprogramming, epigenetics of stem cells

09:00–12:00 12:00–13:00 13:15–14:00 14:00–15:00 15:00–15:30 15:30–17:30 17:30–18:00 18:00

Collection of embryos, microinjections (Tol2 transposase, fluorescent constructs) LUNCH Special lecture (G. Lieschke) Molecular analysis of mutagenesis efficiency (T7 endo assay, gel electrophoresis) TEA and COFFEE Embryo manipulations, mounting, imaging, analysis (time-lapse, confocal) Discussion and closing remarks End of workshop

Oral Presentations Utilising transposon-delivered transgenes for understanding reprogramming Andras Nagy Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital, Toronto, Canada; Department of Obstetrics & Gynaecology and Institute of Medical Science, University of Toronto, Toronto, Canada The discovery of a defined set of transcription factors that can induce reprogramming of somatic cells to pluripotent stem cells (iPSCs) has had an unprecedented impact on our view on future cell transplantation-based tissue repair and restoration of faulty physiological functions. Somatic cell reprogramming is a several weeks long process through which cells reach pluripotency, the developmental state similar to embryonic stem cells. This cascade of events and the driving forces behind the phenomenon are very poorly understood. It is, however, crucial to uncover the fine details of this process in order to comprehend the true properties of iPSCs and so better tailor their future therapeutic use. To address this need we utilized the unique property of the transposon-mediated transgene delivery system combined with doxycycline inducible expression of the reprogramming factors. The transposon ITR-flanked transgenes were seemingly much less subjected to silencing than the virus-delivered ones. Therefore, we were able to generate highly efficient secondary reprogramming systems, allowing us a comprehensive molecular description of the reprogramming cascade toward two distinct pluripotent states. We explored alternative outcomes of somatic reprogramming by fully characterizing reprogrammed cells independent of preconceived definitions of reprogrammed iPSC states. We demonstrate that manipulating the expression level of the reprogramming factor influences the arrival of cells to a non-ES cell-like or ES cell like pluripotent state. This bifurcated process has been characterized with multiple ‘‘omic’’ platforms, consisting of the transcriptome (microRNA, lncRNA and mRNA), CpG methylation, ChIP-sequencing (for chromatin marks: H3K4me3, H3K27me3 and H3K36me3), in addition to quantitative mass spectrometry profiling of the global and cell surface proteome. This dataset enables crossreferencing between ‘‘omic’’ platforms, which facilitates deeper understanding of the cascade of molecular events and

Genome and epigenome editing with CRISPR/Cas9 for gene therapy and disease modeling Charles A. Gersbach Department of Biomedical Engineering, Duke University, Durham, USA The advent of genome engineering technologies, including the RNA-guided CRISPR/Cas9 system, has enabled the precise editing and regulation of endogenous human genes and epigenetic states. We have applied these tools to the correction of mutations that cause genetic disease and also adapted them to manipulate the epigenome and control cell fate decisions. For example, we engineered CRISPR/Cas9-based nucleases to correct the human dystrophin gene that is mutated in Duchenne muscular dystrophy patients. When we delivered these nucleases to cells from patients with this disease, the correct gene reading frame and expression of the functional dystrophin protein were restored in vitro and following cell transplantation into mouse models in vivo. When delivered directly to a mouse model of this disease, gene editing by the CRISPR/Cas9 system led to gene restoration and improvement of biochemical and mechanical muscle function. In other studies, we have engineered CRISPR/Cas9-based tools to regulate the expression of endogenous genes and applied these tools to control diverse genes relevant to disease, development, and differentiation. Genome-wide analysis of the DNA-binding, gene regulation, and chromatin remodeling by these targeted epigenome modifiers has demonstrated their exceptional specificity. We have recently applied these technologies to control the decisions of stem cells to become specific cell fates and reprogram cell types into other lineages that could be used for drug screening and disease modeling. Incorporating methods to dynamically control the activity of these proteins, such as optogenetic control of the proteins with light, has allowed us to pattern gene expression both temporally and spatially. Ongoing efforts include designing strategies to manipulate specific epigenetic marks that would enable deciphering the influence of epigenetics on gene regulation and disease states. Collectively, these studies demonstrate the potential of modern genome engineering technologies to capitalize on the products of the Genomic Revolution and transform medicine, science, and biotechnology. Keywords: genome editing, epigenome editing, CRISPR, gene therapy

Direct production of mouse mutants using engineered nucleases in one-cell embryos Ralf Ku¨hn Max-Delbru¨ck Center for Molecular Medicine, Berlin, Germany

123

202


Engineering of the mouse germline to create targeted mutants is a key technology for biomedical research. We use an expedite approach for the generation of mouse mutants by microinjection of engineered, sequence-specific nucleases into one-cell embryos. Such nucleases create targeted double-strand breaks (DSBs) and stimulate DNA repair by non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ religates the open ends, frequently leading to frameshift (knockout) mutations by the loss of nucleotides, whereas HDR enables the insertion of targeted (knockin) mutations from gene targeting vectors or oligonucleotides as repair templates. By this means mutant knockout and knockin founders are identified 7 weeks after embryo injections, enabling the fast establishment of mutant lines. Three nuclease generations, ZFNs, TALENs and the CRISPR/Cas9 system were validated in recent years for direct mutagenesis in embryos. In particular, CRISPR/Cas9 enables the generation of knockout and knockin alleles at frequencies of up to 40 and 10 %, respectively, among pups derived from embryo injections. Nevertheless, the dominance of NHEJ versus HDR requires further improvement. To tackle this problem we established ‘traffic light’ reporter lines indicating DSB repair by NHEJ or HDR through the expression of red or green fluorescent proteins. To enhance HDR, we suppressed NHEJ key molecules by gene silencing, by the inhibitor SCR7 or by the adenoviral proteins E1B55 K and E4orf6. In cell lines, SCR7 or the knockdown of KU70 and DNA Ligase IV promotes the efficiency of HDR up to 5-fold. Coexpression of the DNA Ligase IV degrading E1B55 K and E4orf6 proteins improves the efficiency of HDR up to 8-fold and essentially abolishes NHEJ repair. We are presently using TLR transgenic mice to enhance HDR repair of CRISPR/Cas-induced DSBs by NHEJ suppression in early embryos and somatic cells to optimize the generation of precisely targeted alleles in vivo. Keyword: Cas9

context, thus potentially leading to confounding conclusions or artifacts. The genomic engineering field changed completely with the advent of genome-editing nucleases. First ZFNs, then TALENs, and, eventually, CRISPR-Cas9 were developed, all sharing a common mechanism-of-action and enabling the precise edition of genomes. In particular, the bacteria- and archea-derived CRISPR-Cas9 tools, due to their simplicity and ease of implementation, have boosted the generation of many new genetically-modified organisms, in many species, including mice. The fact that CRISPR-Cas systems only require a 20-bp homology DNA stretch made it now possible to address the functional evaluation of DNA regulatory elements, even those hidden among a sea of repetitive DNA sequences, provided that some unique tiny DNA homology fragments could be identified. We have applied CRISPR-Cas9 genome-editing technologies to assess, in vivo, at the endogenous locations, the role and relevance of a subset of DNA regulatory elements associated with the mouse tyrosinase locus. In this presentation we will summarize our recent results obtained with mice (Seruggia et al. NAR 2015). Our findings indicate that both coding and non-coding DNA regions can contain mutations that may result in a pathological phenotype. These findings suggest that similar mutations in the non-coding genome can be found among human subjects affected by the same disease. These results could also be relevant for the group of 20–30 % of patients for any disease of genetic origin where traditional molecular diagnostic approaches focused to coding regions are unable to locate any mutation (Montoliu et al. PCMR 2014). Keywords: mammalian, genomes, tyrosinase, CRISPR-Cas9, edition, nucleases, non-coding, regulatory elements

CRISPR-ing the non-coding genome

Se´verine Meńoret2,3§, Cris J. Jung1§, Lucas Brusselle2,3, Laurent Tesson2,3, Claire Usal2,3, Vanessa Chenouard2,3, Se´verine Remy2,3, Laure-He´le`ne Ouisse2,3, Nicolas Poirier3,4, Bernard Vanhove3,4, Pieter J. de Jong1*, Ignacio Anegon2,3*

Lluı´s Montoliu1,2, Almudena Fernańdez1,2, Santiago Josa1,2, Rafael Jimeńez1, Marta Cantero1,2, Julia Fernańdez1,2, Davide Seruggia1,2 1

National Centre for Biotechnology (CNB-CSIC) and CIBERER-ISCIII, Madrid, Spain

2

Mammalian genomes contain about 22.000 genes, occupying 2 %, and intergenic sequences, accounting for the remaining 98 % of the genome. The non-coding genome contains different types of families of DNA repetitive elements, mobile elements and DNA regulatory elements. Traditionally, it has been difficult to functionally assess the role of all these DNA regulatory elements due to the high presence of repetitive DNA sequences usually surrounding them, thus preventing any standard homologous recombination approach. In fact, most previous experiments had been conducted on transgenes, including artificial chromosome-type transgenes, BACs or YACs, where the complexity was severely reduced and where homologous recombination methods could be applied, in bacteria or yeast cells, respectively. However, this suboptimal experimental approach implied the evaluation of those DNA regulatory in ectopic genomic locations, out of the appropriate

123

Increased efficiency of BAC transgenesis by piggyBac transposition but not by CRISPR/Cas9 targeted integration for the generation of human SIRPalpha rats

1

Center for Genetics, Children’s Hospital Oakland Research Institute, Oakland, CA 94609. 2 Platform Rat Transgenesis Immunophenomic, SFR Francois Bonamy, CNRS UMS3556 Nantes, F44093, France. 3 INSERM UMR 1064-ITUN; CHU de Nantes, Nantes F44093, France. 4 Effimune, 44000 Nantes, France. § equal contribution. * Equal contribution The zygote microinjection of piggyBac (PB) transposase has recently prove to transpose a full length BAC in the mouse. We aim to apply here this strategy to the rat, in order to generate human SIRPa rats that may be useful for humanizing the immune KO rats. The BAC clone (RP11-887J4) with c-system of existing Rag1/IL2R an insert carrying 176 kb of human DNA covering the SIRPa gene (hSIRPa BAC) was retrofitted with a cassette containing the 50 and 30 piggyBac Terminal Inverted Repeat (TIR) elements in the vector backbone. The piggyBac-mediated transposition approach was carried out by

Transgenic Res (2016) 25:195–270 co-microinjecting 2 ng or 3 ng of hSIRPa-BAC-TIRs DNA with 25 ng, 50 ng or 100 ng of hyperactive transposase (hyPBase) mRNA into the pronucleous and cytoplasm of rat zygotes. Genotyping showed that 6/25 pups were PCR positive in the 25 ng hyPBase condition (24 %). With 50 ng or 100 ng of hyPBase, 1/13 pups or 1/7 pups were found to be PCR positive (14.3 and 7.7 %, respectively). As controls, the microinjection of 2 ng of hSIRPa-BAC-TIRs and 25 ng of Cas9 mRNA yielded 1/15 embryos PCR positive (6.7 %). By using splinkerette PCR, and a series of 10 primer pairs at approximately 20 kb intervals along the BAC insert, we determined that 7/8 founders obtained with the PB system contained the hSIRPa-BAC intact and transpositioned between TTAA genomic sequences. Cytofluorimetry analysis of monocytes derived from F1 offspring showed the expression of human SIRPa, as observed in human monocytes, suggesting that regulation of hSIRPa protein expression may by the hSIRPa-BAC was conserved. We then sought to investigate whether targeting of this BAC into the Rosa26 safe harbor locus would be possible using the CRISPR/Cas9 system. To do this, we added to the hSIRPa-BAC, homology arms (0.8 Kb each) for the rat Rosa26 locus, with and without sequences recognized by Rosa26 targeting sgRNA (hSIRPa-BACRosa26 + and hSIRPa-BAC-Rosa26-, respectively). Either of these two BACs was co-microinjected with the Rosa26 sgRNAs and the Cas9 protein. Despite that we observed efficient NHEJ mutations in the Rosa26 locus, the frequency of BAC transgenic rats obtained with or without linearization by the Rosa26 sgRNA was low and comparable (1.7 vs. 3.6 %, respectively). Moreover, none of these rats had the hSIRPaBAC-Rosa26 + BAC inserted in the Rosa26 locus. Thus, converting the circular BAC DNA into a large piggyBac transposon is an efficient approach for generating transgenic rats that faithfully express the transgene. The CRISPR/Cas9 system using the hSIRPa-BAC with long homology arms did not lead to efficient targeting. Keywords: Trangenesis, BAC, CRISPR/Cas9

Targeting nucleolus—a new approach in generating transgenic mouse models of neurodegenerative diseases and their exploitation to study possible neuroprotective therapies Grzegorz Kreiner Deptartment of Brain Biochemistry, Institute of Pharmacology, Polish Academy of Sciences, Krako´w, Poland Neurodegenerative diseases are characterized by profound loss of certain neuronal populations associated with mitochondrial and proteasomal dysfunction, alteration of cellular defense mechanisms and extensive evidence of oxidative stress. However, the etiology of the majority of neurodegenerative diseases still remains unknown, and even for those diseases caused by identified genetic mutations, the direct pathways from gene alteration to the final cell death have not yet been fully elucidated. Advancements in genetic engineering have provided many transgenic mice that are used as an alternative to pharmacological models of neurodegenerative diseases. Surprisingly, even the genetic models reiterating the same

203 causative mutations often do not show clear phenotype covering all the cardinal dysfunctions. We applied a novel approach to generate mouse models of neurodegenerative diseases based on the activation of an endogenous suicide mechanism achieved by conditional inactivation of the gene encoding transcription initiation factor IA (TIF-IA) by the Cre/loxP system in chosen neuronal populations. Loss of TIF-IA blocks the synthesis of ribosomal RNA (rRNA) leading to nucleolar disruption and p53-mediated apoptosis. The inhibition of protein synthesis represents a basic response to cope with stressful conditions. The nucleolus, being a center of rRNA synthesis, is an essential stress sensor controlling cellular physiology and homeostasis. It has been shown that nucleolar malfunction is associated with the pathology of several genetic disorders (i.e. Werner syndrome, Treacher Collins syndrome), decreased rRNA synthesis have been also found in age-related neurodegenerative diseases, e.g. Parkinson’s disease. In our model, disruption of the nucleoli in dopaminergic neurons (TIFIADATCreERT2 line) and striatal dopaminoceptive neurons (TIFIAD1RCre line) resulted in the generation of mutant mice showing respectively the typical phenotype of Parkinson’s disease (degeneration of dopaminergic neurons in substantia nigra and ventral tegmental area, depletion of dopamine in the striatum and typical motor dysfunctions) or Huntington’s disease (loss of medium spiny neurons in striatum, impairment of motion control and clasping behavior). Investigated TIF-IA mutant mice are not only characterized by selective and progressive degeneration of particular cell populations, but in addition our study indicated that nucleolar function controls mitochondrial activity and critical stress signaling pathways, faithfully mimicking hallmarks of human neurodegenerative diseases. Further exploitation of TIF-IA mutant mice confirmed that they can represent a unique and novel tool to evaluate possible neuroprotective strategies based on intrinsic compensatory mechanisms enhancement, i.e. activation of noradrenergic transmission, modulation of neurogenesis and stimulation of autophagy. Acknowledgments: This work was supported by the grant no 2011/03/B/NZ7/05949 financed by NCN. Keywords: nucleolus, neurodegeneration, nucleolar stress, TIF-IA, Parkinson’s disease, Huntington’s disease

Nuclear transfer between strains of inbred mice Melissa A. Larson1, Illya Bronshteyn1, Carolyn J. Vivian2, Danny R. Welch2, and Jay L. Vivian1 1 Transgenic and Gene-Targeting Facility; 2Department of Cancer Biology, University of Kansas Cancer Center, Kansas City, KS, USA

Nuclear encoded oncogenes and tumor suppressors have been extensively analyzed for their roles in tumor initiation, progression, and metastasis. However, much less work has been done regarding the roles of the mitochondrially-encoded genome, and how polymorphisms within the mitochondrial genome influence cancer. Basic research studies are often conducted in inbred strains of mice with distinct propensities for supporting the development of tumors. For example, the C57BL/6 strain is resistant for most tumor growth, while the

123

204 FVB strain is more sensitive. Importantly, a small number of polymorphisms within the mitochondrial genome exist between these commonly used strains of mice, suggesting the genetic differences may play a role in their differential tumorigenic capacity. The most rigorous means of testing this hypothesis is to introduce the nuclear genome of one strain of mouse into a mitochondrial environment of another (termed mitochondrial/nuclear transfer, ‘MNX’). To this end, pronuclei were removed from C57BL/6 one-cell embryos and transferred to enucleated one-cell FVB cytoplasm. A single hole was lasered in the zona pellucida of one-cell embryos of each strain. In the presence of demecolcine and cytochalasin, FVB embryos were enucleated by inserting a needle through the lasered hole and applying suction to remove both pronuclei. Similarly, both pronuclei were removed from one C57BL/6 embryo at a time, being careful to avoid excess cytoplasm and therefore the transfer of C57BL/6 mitochondria. The karyoplast was then washed through a Sendai cell fusion virus and implanted under the zona pellucida of the FVB cytoplast. This procedure was repeated until 12–15 embryos had been reconstructed. Reconstructed embryos were transferred to recipient females in the presence of wildtype FVB embryos as carriers to assist in establishing the pregnancy. Recipient females gave birth to both black and white pups; pups were genotyped by PCR for a mitochondrial SNP. As only females are capable of maintaining the FVB mitochondrial contribution, we needed to produce C57BL/6 (nuclear) females free of C57BL/6 mitochondrial heteroplasmy. Our recent efforts resulted in two successful models for studying the role of mitochondrial influence on tumor progression. Future efforts will involve examining these MNX mice with their parental strains in different cancer-inducing genetic, transplatation and carcinogenesis models. We are also initiating the generation of more MNX models from different mouse strain combinations. This research was supported by the National Cancer Institute Cancer Center Support Grant P30 CA168524, Susan G. Komen for the Cure SAC110037 and National Foundation for Cancer Research. Keywords: nuclear transfer, mitochondria, cancer biology, tumor growth

Post-genome editing approaches for recombinase genetics in zebrafish Christian Mosimann Institute of Molecular Life Sciences, University of Zu¨rich, Zu¨rich, Switzerland The zebrafish’s genetic malleability only recently obtained transposon-mediated transgenesis, recombinase genetics, and rapid genome editing. Key challenges remain for the generation and control of lox transgenes (and reporter transgenes in general) and the use of Cre/lox-driven conditional mutants. Here, I will present several ongoing approaches to expand and improve recombinase genetics in zebrafish: optimized CRISPR-Cas9 for lox site knock-ins, generation of phiC31targeted attP transgene landing sites, and improvement of CreERT2 control. We have established in vitro-assembled, fluorescent Cas9sgRNA ribonucleoprotein complexes (RNPs) in optimally

123

Transgenic Res (2016) 25:195–270 stabilizing buffer to achieve maximal Cas9 activity in zebrafish embryos. Sequence analysis of targeted loci in individual embryos reveals highly efficient bi-allelic mutagenesis that reaches saturation (100 %) at several tested loci. Such virtually complete mutagenesis reveals preliminary loss-of-function phenotypes of candidate genes and of functional non-coding elements. We have further developed the R-based software CrispRVariants to analyze and visualize mutagenesis outcomes. Our results suggest that in vitro assembled and stabilized Cas9-sgRNA RNPs provide maximal mutagenesis efficiency in vivo, possibly beyond applications in zebrafish. Using this optimized approach, we can now achieve highly efficient knock-in and germline transmission of lox sites towards generating conditional alleles and of phiC31-compatible attP sites for targeted transgenesis. To generate universally applicable transgene integration sites in zebrafish, we have started to map the genomic location of reliably expressing Tol2 transgenes. Upon successful mapping, we are integrating an attP landing site into the locus by Cas9 targeting for subsequent phiC31-mediated transgenesis. This approach promises to generate universally applicable transgene integration spots for reliable, quantitative transgenesis, in particular the reproducible generation of lox cassette transgenes and Cre drivers. Towards improving lox recombination by CreERT2, we explored alternatives for the ERT2-binding trans-4-OHTamoxifen (4-OHT). Dissolved trans-4-OHT gradually loses its potency upon prolonged storage, postulated as result from gradual trans-to-cis conversion or degradation. While testing alternatives to trans-4-OHT, we found that the alternative Tamoxifen metabolite Endoxifen retains potent activation upon prolonged storage (3 months). Using 1H-NMR analysis, we revealed that trans-4-OHT isomerization is undetectable upon prolonged storage, ruling out isomer transformation as cause for the gradual loss of trans-4-OHT activity. We attribute the loss of trans-4-OHT potency to precipitation, and we show that heating or sonication of aged trans-4-OHT aliquots partially reinstates their CreERT2 induction potential. Our data establish Endoxifen as potent complementary compound to control ERT2 fusion proteins in vivo. Altogether, our combined efforts provide a potent tool box towards improved transgenic recombinase applications in zebrafish. Keywords: zebrafish, cre/lox, CRISPR, phiC31, transgenesis

10 Years of TIGM: important lessons and future perspectives Andrei Golovko, Huiping Guo, Johnathan Ballard, Amy Gonzales, John Adams and Benjamin Morpurgo Texas A&M Institute for Genomic Medicine, College Station, USA Texas A&M Institute for Genomic Medicine (TIGM) houses the world’s largest library of knockout C57BL/6N ES cells and provides transgenic mice for researchers worldwide. Since beginning its operation in 2006, TIGM has delivered more than 3700 ES cell clones and 320 mouse lines to investigators in more than 300 different academic and research institutions, as well as commercial entities from 26 countries. The TIGM International Mouse Repository currently has 188 C57/BL6N

Transgenic Res (2016) 25:195–270 and 58 129/SvEv 9 C57BL6/N cryopreserved lines all of which are available to the public on a cost recovery basis under the same Terms and Conditions as any of our other lines. TIGM mice and ES cells were featured in over 150 publications including such high profile magazines as Nature, Cell and Science and used to obtain 5 patents. Among multitude of genetic targets inactivated in TIGM gene trapped cells, there is a significant group of long noncoding RNAs (lncRNA) implicated in a variety of disease states and demonstrated their involvement in oncogenesis. Our screening of more than 18,000 clones has identified over 1,000 inactivated ncRNAs including a number of lncRNAs. One such clone, IST14461G11, was used to establish a colony of homozygous mutant Metastasis-Associated-Lung-Adenocarcinoma-TranScript-1 (Malat1) mice in pure C57BL/6N genetic background that is currently being studied by A&M scientists as a model for several important diseases. As interest in the gene trap lines declined, TIGM repositioned itself as a provider of basic transgenic core services to researchers within the Texas A&M system and external customers as well. Among the most recent additions to our array of services was the successfully tested production of mutant conditional and non-conditional knock in and knock out mouse lines and ES cells by CRISPR/Cas9. TIGM provides a variety of breeding services and performs simple animal studies as well as tissue collections and arrangements for their analysis. In collaboration with other TAMUS institutes and facilities, TIGM now offers centralized access to a variety of phenotyping services. Keywords: gene trap, large scale mutagenesis, repository

205 abnormal blood pressure. The graphical results display for this search shows, at the gene level, all affected systems and human diseases associated with mutant mice annotated to abnormal blood pressure where the mutation is in a mouse gene that is homologous to a human gene in the specified region. Only mouse phenotypes that can be clearly linked to a single causative gene are included in the results set. By restricting the results set in this way, users can quickly identify the strongest potential candidate genes and models. From the graphical display, users can get a sense of how much data supports the relationship between a gene and phenotype system or disease. In addition, each cell is an active link allowing for access to specific allele pair and phenotypes term associations. For example, by clicking on the Ptgs2 and Cardiovascular System cell, the user will see that 2 different mutations in Ptgs2 are associated with the Mammalian Phenotype term ‘‘increased systemic arterial systolic blood pressure’’. A link to the International Mouse Strain Resource is also provided in this view allowing for easy identification of any commercially available mutations in Ptgs2. After reviewing and filtering the results, users can download their gene and disease sets in text format using the list output displays. These list outputs also provide easy access to references in MGI related to either the mouse gene or mouse models of the human disease. The HMDC is continuing to be developed by MGI and should prove to be a powerful tool for the identification of candidate genes for and mouse models of human disease. Keywords: mouse, disease models

Analysis of embryonic lethal mutations in mice using 3D imaging Using the human–mouse: disease connection to identify mouse models of human disease Anna Anagnostopoulos, Susan M Bello, Cynthia L Smith, Howard Dene, Monika Tomczuk, Beverly Richards-Smith, Hiroaki Onda, Michelle Knowlton, MeiYee Law, Janan T Eppig Mouse Genome Informatics, The Jackson Laboratory, Bar Harbor, ME, USA The Human–Mouse: Disease Connection (HMDC, www. diseasemodels.org) has been designed to facilitate the identification of published and potential mouse models of human disease. Mouse mutation, phenotype and disease model data from the Mouse Genome Informatics database (MGI, www.informatics.jax.org) are integrated with human gene to disease relationships from NCBI and OMIM. Search results are displayed in both graphical and list formats. Users can start searches using human or mouse genes, human or mouse genome locations (including those from genome sequencing experiments in VCF format), mouse phenotypes, or human diseases. Multiple search criteria may be combined to create highly specific searches. For example, one can search for all human genes found in the region associated with Pseudohypoaldosteronism, Type IIA (Chr1:185800000-236600000; OMIM:145260) where the mouse homolog is associated with

Mary E. Dickinson Dept. of Molecular Physiology and Biophysics, Baylor College of Medicine, Houston, TX 77030 As part of the International Mouse Phenotyping Consortium (IMPC) and with support from the National Institutes of Health (NIH) Knock-out Mouse Project (KOMP) we have established a phenotyping pipeline to define developmental abnormalities in the 35 % of null alleles that are lethal or subviable (\12.5 % homozygous null) at weaning. In order to define structural abnormalities in embryos at 4 specific stages (E9.5, E12.5, E15.5 and E18.5) our pipeline employs the use of Optical Projection Tomography (OPT) and Microcomputed Tomography (MicroCT). These methods provide complete 3D image volumes of the entire embryo at spatial resolutions between 3 and 10 microns. Thus, even small features can be observed in mutant embryos and structural abnormalities can be detected either by skilled embryologists or automated methods to determine differences between mutant and control datasets. The presentation will provide an overview of the methods used for embryonic phenotyping, a summary of interesting phenotypes that have been discovered and new methods being employed to enhance the phenotyping efforts. Keywords: Knockout Mouse Project, microCT, OPT, embryo, lethal mutations

123

206 A large scale mouse phenotyping screen for the discovery of novel biotech targets in oncology and angiogenesis and other therapeutic areas Nicholas W Gale, Jennifer P Schmahl, Melissa G Dominguez, Ron A Deckelbaum, Johnathon R Walls, Keith D Anderson, Aris N Economides, Brian Zambrowicz, Venus Lai, Gavin Thurston, George D Yancopoulos, Calvin H C Lin and Andrew J Murphy Regeneron Pharmaceuticals, Inc. Tarrytown, NY 10591 USA The recent availability of large numbers of gene-targeted mice is now allowing new large-scale phenotyping efforts to systematically evaluate gene function on an unprecedented scale. Following on our previous gene targeting efforts funded by the NIH KOMP (Knockout Mouse Project), we have established a novel high-volume, broad phenotyping platform, or Tier1 screen, as a primary approach to evaluate secreted and transmembrane genes as potential biotechnology therapeutic targets. Targets of interest identified in the Tier1 screen can be rapidly followed up in therapeutic-area specific secondary assays. In this Tier1 screen we subject large F2 cohorts from 100 projects per year to an analysis including: 1) high-resolution reporter gene expression imaging and analysis in embryos and adults to reveal sites of potential gene function in situ; 2) Evaluation of mendelian inheritance to assess viability; 3) Evaluation of timing and causation of embryonic lethality to discover genes critical in embryonic development (Embryo morphology is analyzed by optical projection tomography (OPT) and soft tissue enhanced micro computed tomography (lCT)); 4) clinical serum chemistry and hematology analysis to broadly evaluate health; 5) lCT based analysis of body composition and bone to elucidate metabolic and skeletal phenotypes, 6) Sequencing-based transcriptome profiling of key tissues to reveal expression-based phenotypes; 7) FACs-based profiling of hematopoietic cell populations in key immune organs, to reveal immune phenotypes; and, uniquely, 7) Our screen also includes a novel challenge of tumor engraftment to evaluate the host response to cancer. All phenotype data are collected in a custom image and phenotype database. We mine the resulting data to help to understand biological functions of genes of interest as well as to evaluate potential therapeutic targets for our human antibody-based therapeutic pipeline. We have analyzed over 400 genes through this screen and have successfully identified targets that have progressed through our development pipeline in a variety of therapeutic areas. The novel tumor challenge screen has been particularly fruitful in identifying vascular and immune genes in cancer biology, and will be a focus of this talk.

An update on progress by the International Mouse Phenotyping Consortium (IMPC)

Transgenic Res (2016) 25:195–270 Five years on, the International Mouse Phenotype Consortium (IMPC) is having a transformative impact on the application of genetically-modified mice to inform mammalian pathobiology and disease. Made up of 18 + research institutions and 5 national funding agencies representing hundreds of scientists and technical staff on 4 continents, the overarching goal of the IMPC is ‘to discover functional insight for every gene by generating and systematically phenotyping 20,000 knockout mouse strains’ (www. impc.org; @impc). Systematic, broad-based embryo, juvenile, and adult phenotyping is being performed by each participating institution using standardized procedures found within the International Mouse Phenotyping Resource of Standardized Screens (IMPReSS) resource (www.mousephenotype.org/impress). Gene-to-phenotype-to-disease associations are made by a versioned statistical analysis with all data freely viewable and downloadable from Phenoview, an interactive web application with integrated media viewer for comparative visualization of genotypes and phenotypes ( www.mousephenotype.org/phenoview). By applying principles of the ARRIVE guidelines, IMPC partners are emphasizing experimental reproducibility through standardization and assessment of baseline data, validating test robustness through analysis of reference lines, and analyzing test variances to elucidate platform improvements. Because of their value as a valuable resource for basic scientific research as well as for generating new models of human diseases, IMPC mice are preserved and made broadly available and readily accessible to the scientific community from archive and distribution repositories around the world (www.komp.org; www.mmrrc.org; www.infrafrontier.eu; www.eummcr.org; www.cmmr.ca; www.brc.riken.jp). To date, participating IMPC Centers have performed approximately 7800 microinjections to generate more than 50,000 mice for 4898 genotype-confirmed mutant lines, and completed broad-based phenotyping on 2469 lines. In-depth analysis of 14 million data points and 98,000 images of mutant mice for 1453 genes reveal approximately 34 % (471 genes) of knockouts are lethal or subviable. Further, mice for 1042 of these genes have more than 3400 phenotype annotations with extensive, heretofore unrecognized and unannotated pleiotropy. Mice for more than half (630) of these genes exhibit new phenotypes not yet reported in MGI. Particularly noteworthy are IMPC-described phenotypes in 692 genes orthologous to human genes with disease associated or causal variants, 565 of which are potentially new disease models. Importantly, nearly half of phenotypic annotations reveal a high degree of sexual dimorphism. Additionally, extensive histopathological analysis of adult tissues from more than 400 genes reveals correlative, pleiotropic, and discrete phenotypes that have generated novel biological insights. In summary, in keeping with its mandate, the IMPC is revealing significant new features of the mammalian genome landscape. Keywords: phenotyping, mouse, mutagenesis, disease models

Taking a look at the CRISPR biology and applications from a historical perspective

K. C. Kent Lloyd, The International Mouse Phenotyping Consortium2

Francisco JM Mojica, Cristo´bal Almendros, Noemı´ M Guzmań, Jesu´s Garcıá-Martıńez, Ba´rbara Go´mez-Tavira, Rafael Maldonado

Department of Surgery, School of Medicine, and Mouse Biology Program, University of California, Davis, US; 218 research institutions on 4 continents

Department of Physiology, Genetics and Microbiology, University of Alicante, Alicante, Spain

123

Transgenic Res (2016) 25:195–270 Arrays of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) were first identified in bacteria almost three decades ago, where they were immediately used as genetic markers for differentiation of strains in a reduced number of closely related species of the Mycobacterium complex. Most research on these prokaryotic repeats during the 1990s dealt with this first application, unconnected to any biological role they might be playing in their hosts. In parallel to typing studies, CRISPR were reported in a diversity of prokaryotes as complete genomes of archaea and bacteria were sequenced, leading to the recognition of a new, widespread family of short regularly spaced repeats. The discovery of CRISPR-associated (Cas) proteins and the disclosure that CRISPR-intervening sequences (referred to as spacers) derive from transmissible genetic elements, suggesting an interference action against invaders, definitely stimulated investigations on CRISPR-Cas. As a result, the immune effect was soon demonstrated for a variety of systems and targets, and the interference mechanism unveiled for a few model microorganisms. Subsequently, a three-step (i.e., adaptation, expression and interference) general scheme was conceived, involving the common elements of apparently complete CRISPR-Cas systems: repeats, spacers, Cas proteins and the so called ‘‘leader’’ sequences (AT-rich stretches flanking CRISPR arrays). In brief, during adaptation, new spacers are integrated at the leader-proximal end of a CRISPR cassette. Afterwards, transcription from the leader and processing of the CRISPR transcript (expression stage) generates singlespacer CRISPR RNA (crRNA) molecules that direct a Cas endonuclease to targeted sequences, complementary to the carried spacer, leading to target cleavage and, eventually, to its degradation (interference). However, CRISPR-Cas systems may differ in composition, interference requirements, target nature and particular mechanistic aspects, as well as in the biological consequences of their action. Thus, some systems appear to be playing roles beyond acquired immunity, such as regulation of virulence and group behavior in particular bacteria. Moreover, either DNA or RNA can be targeted, the target can be cleaved or just bound by crRNA-Cas nucleoprotein complexes blocking accessibility, and sometimes CRISPR and Cas proteins act on their own, independently. The unique combination of versatility and feasibility of the diverse CRISPR-Cas components enables a great variety of applications, not only in the native carrier organism but also in heterologous (prokaryotic or eukaryotic) hosts, where they can be harnessed to achieve efficient and specific immunization, cell death, regulation of gene expression, locus labelling or genome editing, so far. Keywords: CRISPR, Cas, prokaryotic immunity, RNA-guided interference

Cpf1 is a single-RNA-guided endonuclease of a Class 2 CRISPR-Cas system Bernd Zetsche1,2,3,4,5*, Jonathan S. Gootenberg1,2,3,4,6*, Omar O. Abudayyeh1,2,3,4, Ian M. Slaymaker1,2,3,4, Kira S. Makarova7, Patrick Essletzbichler1,2,3,4, Sara Volz1,2,3,4, Julia Joung1,2,3,4, John van der Oost8, Aviv Regev1,9, Eugene V. Koonin7, and Feng Zhang1,2,3,4 1 Broad Institute of MIT and Harvard Cambridge, MA 02142; 2 McGovern Institute for Brain Research

207 Massachusetts Institute of Technology Cambridge, MA 02139; 3 Department of Brain and Cognitive Sciences Massachusetts Institute of Technology Cambridge, MA 02139; 4 Department of Biological Engineering Massachusetts Institute of Technology Cambridge, MA 02139; 5 Department of Developmental Pathology, Institute of Pathology, Bonn Medical School, Sigmund Freud Street 25 53127 Bonn, Germany; 6 Department of Systems Biology Harvard Medical School Boston, MA 02115; 7 National Center for Biotechnology Information National Library of Medicine, National Institutes of Health Bethesda, MD 20894; 8 Laboratory of Microbiology Department of Agrotechnology and Food Sciences Wageningen University, Dreijenplein 10 6703 HB Wageningen, Netherlands; 9 Department of Biology Howard Hughes Medical Institute Massachusetts Institute of Technology Cambridge, MA 02139 The microbial adaptive immune system CRISPR mediates defense against foreign genetic elements through two classes of RNA-guided nuclease effectors. Class 1 effectors utilize multiprotein complexes, whereas Class 2 effectors rely on singlecomponent effector proteins such as the well-characterized Cas9. Here we report characterization of Cpf1, a putative Class 2 CRISPR effector. We demonstrate that Cpf1 mediates robust DNA interference with features distinct from Cas9. Cpf1 is a single RNA-guided endonuclease lacking tracrRNA, and it utilizes a T-rich protospacer adjacent motif. Moreover, Cpf1 cleaves DNA via a staggered DNA double stranded break. Out of 16 Cpf1-family proteins, we identified two candidate enzymes, from Acidaminococcus and Lachnospiraceae, with efficient genome editing activity in human cells. Identifying this mechanism of interference broadens our understanding of CRISPR-Cas systems and advances their genome editing applications. Keywords: CRISPR, Cpf1, genome editing

A pipeline approach for discovery of novel CRISRP-Cas systems Konstantin Severinov1,2, Sergei Shmakov1,3, Omar Abudayyeh4, Kira Makarova, Yuri Wolf3, Ekaterina Semenova2, Leonid Minakhin2, Jonathan Gootenberg4, Feng Zhang4, Eugene Koonin2 1Skolkovo Institute of Science and Technology, Moscow, Russia; 2Waksman Institute of Microbiology, Piscataway, NJ, USA; 2NIH, Beteshda, USA; MIT, Cambridge, MA USA A new approach combining a semiautomated bioinformatic searches and systematic biochemical validation to discover novel CRISPR-Cas systems from available sequence data is described. Application of this approach to Class 1 CRISPR-Cas systems has resulted in identification of at least three new CRISPR-Cas systems types that rely on a single large effector protein for target recognition and target cleavage but are unrelated to Type II Cas9 proteins widely used for genomic engineering. In addition to providing new insights into CRISPR-Cas systems evolution, representatives of some of the newly discovered systems may complement or even have

123

208 distinct advantages over existing Type II systems as tools for genomic engineering. Keywords: CRISPR-Cas, Cas9, bioinformatics

COST Action BM1308 ‘‘Sharing Advances on Large Animal Models—SALAAM’’ Eckhard Wolf Gene Center and German Center for Diabetes Research (DZD), LMU Munich, Munich, Germany ([email protected]) The translation of novel discoveries from basic research to clinical application is a long, often inefficient and costly process. Consequently, ‘‘Translational Medicine’’ has become a top priority. Appropriate animal models are critical for the success of translational research. The choice of species will always depend on the specific problem that a research study aims to address. Although rodent models are widely used, they often fail to provide an accurate representation of the human disease. Thus, there is an urgent need for non-rodent animal models that mimic aspects of human anatomy and physiology more closely. Pigs, small ruminants and rabbits are excellent candidates. Examples that will be discussed include genetically tailored pig models of diabetes mellitus (1–3) as well as models of rare monogenic diseases such as cystic fibrosis and Duchenne muscular dystrophy (4,5). The goals of COST Action BM1308 (www.salaam. genzentrum.lmu.de) are (i) to share information and technology for the development of tailored large animal models; (ii) to develop criteria for selection of the species most suitable as a model for the question under investigation; (iii) to establish and validate standardized phenotyping protocols; (iv) to create a database of existing models, tissue samples, and validated phenotypic assays; and (v) to develop and communicate concepts for the scientific and ethical evaluation of experiments with large animals, including involvement of the regulatory authorities. While genetic engineering of large animal species is now very well established, systematic phenotyping remains a major bottleneck in the characterization and implementation of these novel animal models. Thus, standardization and validation of phenotypic assays and the establishment of a European Infrastructure Network for large animal models will be the most important goals of SALAAM in order to bridge the gap between mouse and man in translational research. 1. Renner S, et al., Permanent neonatal diabetes in INS(C94Y) transgenic pigs. Diabetes. 2013 May;62(5):1505–11. 2. Streckel E, et al., Effects of the glucagon-like peptide-1 receptor agonist liraglutide in juvenile transgenic pigs modeling a pre-diabetic condition. J Transl Med. 2015 Feb 25;13:73. 3. Renner S, et al., Incretin actions and consequences of incretin-based therapies: lessons from complementary animal models. J Pathol. 2016 Jan;238(2):345–58. 4. Klymiuk N, et al., Sequential targeting of CFTR by BAC vectors generates a novel pig model of cystic fibrosis. J Mol Med (Berl). 2012 May;90(5):597–608. 5. Klymiuk N, et al., Dystrophin-deficient pigs provide new insights into the hierarchy of physiological derangements

123

Transgenic Res (2016) 25:195–270 of dystrophic muscle. Hum Mol Genet. 2013 Nov 1;22(21):4368–82. Keywords: Translational Medicine, Large Animal Model, Phenotyping

Efficient precision gene editing in pigs: Towards a new era in generating genetically designed pigs of human diseases and regenerative medicine Yonglun Luo Department of Biomedicine, Aarhus University, 8000, Aarhus C, Denmark Pigs are excellent models for studying the pathogenesis of human diseases and regenerative medicine, such as diabetes, neurodegenerative diseases, and xenotransplantation 1. Two technical obstacles have been hampering the efficient generation and translation of genetically modified pigs into medicine: (1) Efficient, multigenic precision gene editing in primary pig cells, and (2) Pig cloning by somatic cell nuclear transfer (SCNT). Recent rapid growth in programmable DNA nucleases such as TALENs and CRISPR/Cas9 has revolutionized biomedical applications that require genome editing, including the generation of genetically modified pigs. Here we present three technical improvements that we have developed to evaluate and improve precision and multigenic gene editing in porcine fetal fibroblasts (PFF) by CRISRP/Cas9. First, we generated an dual-fluorescent reporter vector (referred as C-Check) for in vitro functional analysis of porcine CRISPR/ Cas9 vectors2; second, we evaluated the leakiness and efficiency of five inducible CRISPR/Cas9 systems-mediated targeted knockout in PFF; third, we developed a conventional multiplexed gRNA system that allows concordant delivery of over 10 gRNAs into PFF. The combination of inducible and multiplexed CRISPR/Cas9 system provides an efficient strategy for generating multigenically modified pig models. Furthermore, we demonstrate two applications of precision gene editing in porcine fibroblasts using TALEN- or CRISPR/ Cas9-mediated homologous recombination. With TALENs, a targeted efficiency of *25 % was achieved in homologydirected insertion of a diabetes-related mutant (IAPPS20G) in PFF. With CRISPR/Cas9, gene-editing efficiencies of 9.0–20.3 and 4.9 % was achieved when performing single and double gene targeting (MAPT and SORL1) in PFF, respectively. Using a simplified alternative of micromanipulation based SCNT method, handmade cloning (HMC), we have generated a pig model with aberrant pancreatic functions using the IAPPS20G modified PFF. Taken together, we showed that these programmable precision DNA nucleases are powerful tools for the generation of genetically modified pig models of human diseases and regenerative medicine. References: 1. Holm IE, Alstrup AK, Luo Y. (2015) Genetically Modified Pig Models for Neurodegenerative Disorders. J Pathol. 2015 Oct 8. doi: 10.1002/path.4654. 2. Zhou Y, Liu Y, et al., Luo Y. (2015) Enhanced genome editing in mammalian cells with a modified dual-fluorescent

Transgenic Res (2016) 25:195–270 surrogate system. Submitted. Cellular and Molecular Life Sciences (minor revision). Yonglun Luo’s group is supported by the Danish Council for Independent Research; the DFF Sapere Aude Research Talent Prize; the Danish National Innovation Foundation, and the Lundbeck Foundation for the DREAM and Casmere projects. Dr.Luo is a member of COST Action BM1308 ‘‘Sharing Advances on Large Animal Models (SALAAM). Keywords: genetically modified pigs, gene editing, CRISPR/ Cas9, homologous recombination, disease modelling, regenerative medicine

Genome engineering livestock Chris Proudfoot The Roslin Institute, The University of Edinburgh, Easter Bush, Midlothian, EH25 9RG, Scotland, UK Genetically engineered livestock have been produced for nearly 30 years now with early methods for transgenesis utilising pronuclear injection and somatic cell nuclear transfer. These robust methods lack finesse and were expensive both financially and with regard to animal numbers. Lentiviral technology brought about a great improvement in efficiencies, but is limited by carrying capacity and integration locus effects. The advent of genome editors now allows site-specific changes in the genome without leaving any other DNA footprint and the ability to do this easily and efficiently in the germline of livestock. Genome editors generate a double strand break (DSB) at a desired genomic locus resulting in the induction of the DNA repair machinery. By hijacking this DNA repair process we can generate desired genomic changes either through indel formation resulting from non-homologous end joining (NHEJ) or allele exchange in the presence of an appropriate DNA template by homology dependent repair (HDR). Gene edited livestock have been produced through the direct injection of these tools into livestock zygotes. Initial projects have explored resilience to viral disease, but the potential applications in large animals is limited only by the imagination of researchers. Keywords: transgenesis, genome editor, livestock

Production and Analysis of a multi-copy integrated transgenic cattle via transposon SooYoung Yum1, SongJeon Lee2, HyunMin Kim3, WooJae Choi1, JiHyun Lee1, ChoongIl Lee1, SangHee Lee1, SangEun Hahn1, Byeong Chun Lee1, Goo Jang1 1

Laboratory of Theriogenology, Department of Veterinary Clinical Science, College of Veterinary Medicine, Seoul National University, Seoul, Republic of Korea, 151-742. 2 Embryo Research Center in Seoul Milk Coop, Gyeongi-Do, Republic of Korea, 3Theragen BiO Institute, TheragenEtex, Suwon 443-270, Republic of Korea One of transgenesis, piggybac (PB), can deliver efficiently the target gene into the transgenic animals with multi-copy, even

209 though multi-copy and integration position might be harmful to produce transgenic animals. In this study, we demonstrate that the PB is an effective methods to produce a transgenic cattle with multi-copy of transgene. For this study, we microinjected the PB-DNA with GFP gene into in vitro fertilized bovine embryos and the transgene expressing blastocyst was transferred into a surrogate mother. The transgenic cattle was naturally born and expressed strong GFP without UV light. To identify the transgene integration site, the genomic DNA from blood was extracted and next-generation sequencing (NGS) technology was used. A total of 15 transgene copies was identified and were confirmed by manual PCR with target specific primer. We believe that PB-DNA integrated position in the transgenic cattle will be used as a safe harbor region because a transgenic cattle with 15 transgene copies have been grown up without a health issue. To engineer the transgene integration position, the primary cells from the ear skin tissue of a transgenic calf were co-transfected with sgRNA for GFP and Cas9 DNAs. At 7 days post-transfection, GFP-negative cells were observed. The loss of GFP expression indicated that all the transgene (15 copies) were knockouted (KO). Next, we focused on knock-in (KI) at specific loci (GFP integration site) via CRIPR/Cas9-mediated homologous recombination (HR). The KI donor DNA including puromycin resistance gene with homologous arms were co-transfected with sgRNA for GFP and Cas9 and then the cells were treated with puromycin for 4 days. Finally, KI were confirmed by PCR. In conclusion, we have generated successfully a transgenic cattle with multi-copy via transposon and the integration site and number of the transgene was identified by NGS. Furthermore, KO/KI to all the transgenes were successfully carried out and the cells will be used for somatic cell nuclear transfer. This work was supported by IPET (#109023-05-5-CG000). Keywords: CRISPR/Cas9, Knockout, Knockin, NGS, Piggybac, Transgenic Cattle

Production of germline ablated male pigs via Crispr/Cas editing of the NANOS2 gene Amy Kaucher1, Ki-Eun Park2,3, Melissa Oatley1, Anne Powell3, David M. Donovan3, Le Ann Blomberg3, Simon Lillico4, Bruce Whitelaw4, Alan Mileham5, Bhanu Telugu2,3, and Jon Oatley1 1 Center for Reproductive Biology, College of Veterinary Medicine, Washington State University, Pullman, WA, USA; 2Department of Animal and Avian Sciences, University of Maryland, College Park, MD, USA; 3Animal Bioscience and Biotechnology Laboratory, USDA, ARS, Beltsville, MD, USA; 4Roslin Institute, University of Edinburgh, Edinburgh, Scotland; 5Genus PIC, De Forest, WI, USA

The availability of alternative models to flies, worms, and mice for studying germ cell biology is important for translating findings to higher order mammals. In this context, investigation in pigs and other livestock species can serve a ‘‘dual purpose’’ in finding applications for basic research as well as for agriculture. The goal of

123

210 this study is to investigate whether the role of NANOS2 in specifying the male spermatogenic lineage in flies and mice is conserved in higher order mammals, and to generate pigs that lack germline but retain an intact soma in males. Targeted inactivation of genes essential for germ cell survival in livestock species is impractical using embryonic stem (ES) cells because of the lack of proven chimera-competent ES cell lines, or arduous and technically demanding, requiring somatic cell nuclear transfer or cloning. The recent development of CRISPR/Cas based gene editing allows for creation of double strand breaks at the target site, and introduction of random insertions or deletions, and generation of knockout animals in one generation by microinjection into zygotes. Here, we attempted to generate NANOS2 null male pigs by microinjection of in vitro transcribed Streptococcus pyogenes (Sp) Cas9 and single guide (sgRNA) targeting NANOS2 into in vivo derived porcine 1-cell embryos. Following microinjection and transplantation into synchronized surrogate pigs, 18 live piglets were obtained with an array of genotypes. All surviving piglets were found to be edited, with eight animals possessing biallelic frameshift mutations. All edited animals were viable and matured normally. Examination of cross-sections from biopsies of testicular tissue revealed complete lack of germline in homozygous knockout males but the presence of germ cells and spermatogenesis in heterozygous males. Lack of sperm in the ejaculates from homozygous knockout males confirmed the sterile phenotype. Although the germline was lacking in knockout males, the seminiferous tubules and interstitial tissue appeared intact. On the other hand, NANOS2 null females had intact follicles and regular estrous cycles. Collectively, the reproductive parameters in NANOS2 knockout pigs phenocopies Nanos2 null mice demonstrating evolutionary conservation in the role of NANOS2 for development of the spermatogenic lineage specifically. Furthermore, the creation of this NANOS2 mutant line of pigs provides a novel mammalian model to study male germline development. Keywords: CRISPR/Cas, gene editing, livestock, germline, fertility

Pig genome engineering for xenotransplantation Sean Stevens Synthetic Genomics, Inc., 11149 North Torrey Pines Road, La Jolla, CA 92037, USA High quality organs for transplantation are a critical unmet medical need. The use of animal organs for human transplant, or xenotransplantation, has the potential to alleviate organ shortages, but has been limited by the rapid organ destruction by the human immune system. Newly-developed engineering tools allow efficient alteration of mammalian genomes to overcome the many immunological mechanisms involved in xenorejection. Through a combination of genomics and transcriptomics, complex large-scale genome engineering and immunological functional assays and target discovery, we are creating novel genetically-modified pigs which address the many pathways involved in xenorejection. We will present current progress in pig genome informatics and engineering which provides a path for more successful xenotransplantation. Keywords: xenotransplantation, genome, engineering, editing

123

Transgenic Res (2016) 25:195–270 Multiplex transgenesis in cattle via the sleeping beauty transposon system Wiebke Garrels1,2,$, Thirumala R. Talluri1,5,$, Ronja Apfelbaum1, Pablo Bosch3, Ester Grueso4, Zoltan Ivics4, Wilfried A. Kues1 1 Friedrich-Loeffler-Institut, Institut fu¨r Nutztiergenetik, Neustadt, Germany; 2Institute for Laboratory Animal Sciences, Medical School Hannover (MHH), Germany; 3 Departamento de Biologıá Molecular, FCEFQyN, Universidad Nacional de Rıó Cuarto, Co´rdoba, Argentina; 4 Paul-Ehrlich-Institute, Langen, Germany. 5 National Institute for Research on Equines, Bikaner, India. $These authors contributed equally

Cattle are an important model for zoonotic diseases, such a bovine spongiform encephalitis and tuberculosis. Genetic engineering can expand the utility of cattle for modelling human diseases, for developing novel therapies and for the production of recombinant proteins in the udder. However, the efficiencies for the generation of genetically engineered cattle by the available techniques, like pronuclear injection or cloning methods are relative inefficient. Here, we present a highly efficient method for the generation of multi transgenic cattle, produced via the Sleeping Beauty (SB) transposon system in combination with cytoplasmic plasmid injection (CPI). We generated heteromeric transposon transgenic cattle with ubiquitous expression of the Venus fluorophore, lens-specific expression of the tdTomato reporter and udder-specific expression of a viral envelope subunit. The transposase catalyzed gene delivery increased the efficiency of chromosomal integration and favoured single copy insertion events into euchromatic regions. Zygotes were produced in vitro and were injected via cytoplasmic plasmid injection. Injected embryos were cultured for 7 days to blastocyst stage in vitro and then screened for Venus fluorescence. Venus positive blastocysts were transferred to synchronized fosters (n = 6) and after nine moth two transgenic calves were born. The Venus-transposon contains heterospecific loxP sites, which allows a targeted exchange of the Venus transgene cassette in a pretested locus against a transgene of choice by transient expression of Cre recombinase and subsequently the cells can be used for somatic cell nuclear transfer. Keywords: Multiplexing, transgenic cattle, Sleeping Beauty Transposon System

Ethical aspects of the Crispr/Cas9 technology Henriette Bout University of Amsterdam, the Netherlands Say we completely master Crispr/Cas9 technology. How, then, would we go about judging this technology from an ethical perspective? Is the large scale application of the Crispr/Cas9 in fact ethically permissable? In my lecture, I will explore various considerations while searching for an answer to this question. The standard way to

Transgenic Res (2016) 25:195–270 approach this issue would be to draw up a Harm Benefit Analysis. I will make an attempt here to assess the ‘Benefits’ and the ‘Harm’ within the Crispr/Cas9 technology. In doing so, I will outline the various perceptions from which we can analyse the concepts of ‘harm’ and ‘benefit’. This, however, will only add to the confusion, because different fields of perception offer different definitions of Harms and Benefits. What could help here are the EU guidelines. In these guidelines one can find an unequivocally ethical approach, namely consequentialist and zoocentric. This in turn provides an answer to the ethical permissibility of the technology, but at the same time, the possible objections to this answer also emerge. My goal is to join forces with the participants in Prague to come up with creative solutions for the stumbling- blocks to large scale use of the Crispr/Cas9 technology. Keywords: ethics, Crispr/Cas9, Harm Benefit Analysis The AALAS-FELASA Working Group on Harm-Benefit analysis of animal studies Aurora Brønstad1, Christian E Newcomer2, Thierry Decelle3, Jeffrey I. Everitt4, Javier Guillen5, Kathy Laber6 Department of Clinical Medicine, University of Bergen, Norway1, AAALAC International, USA2, Sanofi, France3, Department of Laboratory Animal Science, GlaxoSmithKline, USA4, AAALAC International, Spain5, Chief, Comparative Medicine Branch, NIEHS/NIH, USA6 Background: International regulations and guidance strongly suggest that the use of animal models in scientific research should be initiated only after the responsible for the review of animal studies has concluded a thoughtful harm-benefit analysis (HBA) and deemed the project to be appropriate. In many institutions the relevant factors and algorithms used in conducting the harm-benefit analysis during the review process are poorly defined or lacking. The aim of this work was to define the concept of harm-benefit analysis and give recommendations how it can be implemented. Methods: Literature review included papers from 1986 to 2015. References on cost/ risk benefit from clinical trials and other industries were also included. Results Several approaches to HBA were identified including algorithms, graphic presentations and generic processes. All existing processes have been criticized. The common definition of harm is based on a several factors influencing animal welfare. The 5 freedoms were suggested as a basis for harm assessment. Severity categories for harm are also defined. Subjective opinions cause problematic bias. To limit bias different modulating factors which aggravate and mitigate are defined for the HBA. Benefit domains include benefits for humans, animals, environment, knowledge and education. It was questioned if economic benefits alone can justify animal use. A similar approach to limit bias was applied to harm analysis. Examples of the working groups approach illustrations are included in the working group report. Conclusion Several approaches to HBA are presented in the literature. The WG proposes a practical methodology to address HB analysis. Independent of method HBA must be systematic, transparent and verifiable. Keywords: harm-benefit, ethical evaluation, animal experiments, animal etics

211 The four R’s of phenotyping GA mice—robustness, reproducibility, rigorousness, and randomisation Michelle Stewart Mary Lyon Centre, Medical Research Council, Didcot, UK The publication of the human genome and the advances in genome engineering technologies over the last decade, have led to a huge increase in both the number of genes being studied and the variety of alleles. These models have provided invaluable data on the function of many mammalian genes. However, there has been criticism from the scientific community that a significant proportion of data produced cannot be reproduced. In the past year, several papers have been published criticizing mouse research and pointing out the problems of reproducibility and the lack of advancement in several well-funded areas. Undoubtedly, there is not a single cause for the lack of reproducibility. Some of these differences in data can be explained when all the conditions (for example cage size, food formulation, equipment calibration) are known. Controlling these conditions or, at least publishing the metadata, can assist with data interpretation. Seemingly simple information such as correct strain nomenclature can have a large impact on the interpretation of the study and the comparisons that can be made with other research. As part of the International Mouse Phenotyping Consortium we have made focused on addressing some of these issues to standardise tests across many different laboratories on five different continents. This has been a challenging but illuminating task and has provided some interesting data on the critical variables affecting certain phenotyping tests. It has also become clear from many studies that randomising cohorts and blinding researchers to the genotypes is essential to ensure unbiased data. This is not always easy when working with live animals as other factors need to be taken into account, for example male mice cannot be re-housed to create randomised cages. However, with good planning and coordination between the animal house and the research staff, randomisation and blinding can be achieved in a way that works for everyone. All eyes are on the mouse phenotyping community at the moment, and with the variety and number of mouse models continuing to rise we need to move quickly towards robust and rigorous phenotyping, generating reproducible data which can provide critical information on human disease. Keywords: Phenotyping, reproducibility

Efficient production of mouse oocytes using superovulation by immunization against inhibin Toru Takeo, Naomi Nakagata Division of Reproductive Engineering, Center for Animal Resources and Development (CARD), Kumamoto University, Kumamoto, Japan Research and development of mouse reproductive technology is necessary to efficiently conduct research using genetically engineered mice. The improvement of reproductive techniques has contributed to the production, archiving, and distribution of genetically engineered mice. Superovulation is an important

123

212 method for increasing the number of ovulated oocytes in reproductive technology. The administration of equine and human chorionic gonadotropin (eCG and hCG, respectively) has been widely accepted in mice. However, the technique of superovulation showed no improvement for more than half a century. Inhibin is a non-steroidal hormone that suppresses the secretion of follicle stimulating hormone and regulates the number of ovulated oocytes. Immunization against inhibin is a unique target to induce superovulation in mammals. Recently, we reported the coadministration of inhibin antiserum (IAS) and eCG, termed as IASe protocol, which produced [100 oocytes from a single C57BL/6 female mouse at 4 weeks old. The oocytes derived from superovulation using IASe were fertilized and developed to pups by in vitro fertilization and embryo transfer. We confirmed the efficacy of IASe on various ages of C57BL/6 and other mice strains. IASe was applied to our mouse repository system and improved the efficiency of embryo preservation and animal production of genetically engineered mice. In summary, the superovulation protocol using IASe is the best choice to maximize the number of ovulated oocytes and to minimize the number of oocyte donors to optimally conduct animal experiments. Keywords: mouse, superovulation, inhibin antiserum, gonadotropin

New cost-effective methods for stem cell procedures on pre-implantation embryos Jeff Batton, Paul Taylor GeneSearch, Inc., Bozeman MT, USA Researchers have developed elegant methods and sophisticated tools for use in a wide range of transgenic procedures performed on early embryos. Unfortunately, some of these methods can be quite expensive given the high costs of the equipment and the infrastructure required. The logistical problems of sending mice or their embryos to regional specialists for some procedures can lead to these procedures being avoided altogether. Over the past few years, design developments in microtools have led to the possibility of cost-effective and efficient new methods for many of these manipulations. Using a patented ‘‘suck and puncture’’ method for holding and operating on even the smallest embryos, co-axial embryo tools combine holding and injection pipettes into one easy-to-use instrument. This means that some key procedures can now be done with very basic infrastructure and at relatively low operating cost. Such tools also offer a novel way of delicately but firmly holding a portion of the nearside of an embryo for injection, volume reduction, or biopsy. This strategy can be used for procedures on the oocytes and pre-implantation embryos of all mammals at all stages of development…including at the hatched blastocyst stage, which has been largely ignored by embryologists until now. In this talk, I will describe how these advancements have been achieved, illustrate some of the methods and manipulations that are now within reach, and invite discussion of other applications that may also be possible using such tools.

123

Transgenic Res (2016) 25:195–270 Keywords: embryo, tool, manipulation, pipette, injection, biopsy, micro, CRISPR

Microfabricated Lance Array Nanoinjection system delivers CRISPR-Cas9 to hundreds of thousands of cells simultaneously Sandra Hope1, John W. Sessions2, Craig S. Skousen1, Brandon T. Garcia1, Kevin D. Price1, Brad W. Hanks2, Jonathan K. Alder3, Brian K. Jensen2 1 Microbiology and Molecular Biology Department, 2 Mechanical Engineering Department, 3Physiology and Developmental Biology Department, Brigham Young University, Provo, Utah, USA

CRISPR-Cas9 systems are powerful tools for genetic modification. Transfection of CRISPR-Cas9 constructs is necessary for functionality but can be complicated by the sensitivity of some cell types wherein current techniques may yield inefficient transfection percentages or result in cell death or damage to sensitive cells. We present a new transfection technology called Lance Array Nanoinjection (LAN) as an alternative method of delivering DNA or other macromolecule payloads by directly injecting hundreds of thousands of cells simultaneously. This work was built upon our previous success with a single lance nanoinjector that delivered transgenic DNA into fertilized mouse eggs. The new LAN technology we present here is a silicon chip with 4 million lances in an array. Each lance is 10 lm in length, photolithographically-designed and plasmaetched on a silicon chip. The semi-conductor lances on the chip operationally use electrostatic attraction of DNA and physical penetration of cell membranes to place genetic loads within the cells before electrically reversing the lances’ charge and leaving the DNA inside the cells. The advantages of LAN include the ability to inject smaller cell sizes, such as embryonic stem cells, cell lines or primary cell cultures, as well as the ability to simultaneous inject hundreds of thousands of cells without using traditional reagents, instrumentation, or viral delivery systems. To illustrate LAN application with CRISPR-Cas9 constructs, we utilized a constitutively expressing, isogenic GFP positive HeLa229 cell line, and demonstrated that LAN delivery of CRISPR-Cas9 effectively knocked-out GFP expression at a median rate of 93.2 % after three serial injections. Samples nanoinjected three times had modification rates as high as 12 times greater than analogously treated singleinjected samples. Moreover, cell survival experimentation with HeLa cells demonstrated cell viability rates between 85 and 95 %. Additionally, we demonstrated that LAN effectively delivers transcription up-regulating CRISPR-Cas9 in primary neonatal fibroblasts (BJ, ATCC CRL-2522TM) to up-regulate expression of platelet-derived growth factor receptor beta (PDGFR-b). With two injections, treated samples expressed 16.40 % PDGFR-b compared to 8.75 and 5.73 % expression in mock-treated and untreated cells respectively. This represents a CRISPR-driven 9.1 fold increase in the number of living cells expressing PDGFR-b over untreated samples after 48 h. Because LAN is able to generate large numbers of modified

Transgenic Res (2016) 25:195–270 cells in a single sample, our findings are particularly encouraging in terms of gene therapy in tissues as well as other uses in development of transgenic or genetically modified embryonic tissues sensitive to other transfection methods. Keywords: nanotechnology, nanoinjection, CRISPR, lance array, LAN, transfection

The implications of active genetics Valentino Gantz, Ethan Bier Section of Cell and Developmental Biology, University of California, San Diego, La Jolla, CA 92093, USA Classic rules of Mendelian inheritance impose several significant constraints on genetic manipulation of organisms (e.g., random segregation of distant loci and coinheritance of closely linked loci). In his talk Dr. Bier will discuss how these ‘‘passive’’ rules of inheritance can in principle be superseded by a new form of ‘‘active genetics’’ based on a new CRISPR method referred to as the Mutagenic Chain Reaction (MCR). In initial experiments performed by Valentino Gantz, then a graduate student in Dr. Bier’s lab, an MCR construct disrupting a pigmentation locus in fruit flies was found to convert the opposing chromosome with 95 % efficiency. These results, seen also in mosquitoes and yeast, open the door to a new era of genetics wherein the laws of traditional Mendelian inheritance can be bypassed for a broad variety of purposes. Dr. Bier considers the implications of this fundamentally new form of ‘‘active genetics’’, its applications for gene-drives, reversal and amplification strategies, its potential for contributing to cell and gene therapy strategies, and ethical/biosafety considerations associated with such active genetic elements. Keywords: CRISPR, mutagenic chain reaction, MCR, active genetics, mosquito, malaria

Genetic compensation induced by deleterious mutations but not gene knockdowns Didier Stainier Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany My laboratory investigates questions related to organogenesis including cell differentiation, tissue morphogenesis, organ homeostasis and function, as well as organ regeneration. We study these questions in zebrafish as well as in mouse and are currently looking at several mesodermal (heart, vasculature) and endodermal (pancreas, lung) organs. We utilize both forward and reverse genetic approaches, and aim to dissect cellular processes using high-resolution live imaging. One goal of our studies is to gain understanding of vertebrate organ development at the single-cell level, and beyond. This talk will focus on the differences observed between mutant and morphant (morpholino-induced) phenotypes. Indeed, the increasing use of reverse genetics in zebrafish, and other model systems, has revealed profound differences between the phenotypes caused by genetic mutations and those caused by gene knockdowns at many loci, an observation previously reported in mouse and Arabidopsis. To identify the reasons

213 underlying the phenotypic differences between mutants and knockdowns, we generated mutations in zebrafish egfl7, an endothelial extracellular matrix gene of therapeutic interest, as well as in vegfaa. egfl7 morpholino-injected animals (morphants) exhibit severe vascular defects but egfl7 mutants do not show any obvious phenotypes. We further observed that egfl7 mutants were less sensitive than their wild-type siblings to Egfl7 knockdown, arguing against residual protein function in the mutants or significant off-target effects of the morpholinos when used at a moderate dose. Comparing egfl7 mutant and morphant proteomes and transcriptomes, we identified a set of proteins and genes that were upregulated in mutants but not in morphants. Among them were extracellular matrix genes that can rescue egfl7 morphants, indicating that they could be compensating for the loss of Egfl7 function in the phenotypically wild-type egfl7 mutants. Moreover, egfl7 CRISPR interference, which obstructs transcript elongation and causes severe vascular defects, did not cause the upregulation of these genes. Similarly, vegfaa mutants but not morphants show an upregulation of vegfab. Taken together, these data reveal the activation of a compensatory network to buffer against deleterious mutations, which was not observed after translational or transcriptional knockdown. Keywords: antisense, mutation, phenotype, compensation

Generation of genomic structural variants by CRISPR/ Cas9 genome editing in rodents Marie-Christine Birling1, Laurence Schaeffer1, Philippe Andre´1, Guillaume Pavlovic1, Yann He´rault1,2 1 Institut Clinique de la Souris, PHENOMIN, CNRS UMR7104, INSERM U964, Universite´ de Strasbourg, 1 rue Laurent Fries BP 10142 Parc d’Innovation 67404 Illkirch, France; 2Institut de Geńe´tique Biologie Molećulaire et Cellulaire (IGBMC), CNRS, INSERM, Universite´ de Strasbourg, UMR7104, UMR964, Illkirch, France

Structural variations contribute to the variability of our genome and are often associated with disease. When encompassing one or several coding units, deletions, inversions and duplications lead to changes in gene dosage. The human genome contains many large number of gene clusters. Up to now, very few have been tested experimentally. Indeed, generating duplication and deletion of genomic regions was labor intensive and time consuming. With the advent of clustered regularly interspaced short palindromic repeats (CRISPR)-associated nuclease 9 (Cas9), it is now possible to generate at much lower expenses and in a record time both duplications and deletions. Furthermore, many other rearrangements can occur such as inversions, head to tail duplications and so on rendering possible the generation any kind of structural variants. This opens a new field in research. It is now possible to generate all the panel of possible variants and to study them simultaneously. We have been able to generate for the first time deletions, duplications and inversions of genomic regions as large as 24.4 Mb, reproducing in rat a Down syndrome model similar to a previously generated mouse model. We have shown that DNA deletions, duplications and inversions could be transmitted through germlines in mice and rats. We specifically produced deletions, inversions and duplications at seven different

123

214 genomic loci ranging from 16.7 kb to 24 Mb. We also confirmed that the variety of alleles observed in founders by genotyping tails or ears is not complete. Indeed, we have been able to recover duplicated regions in founders for which we only detected deletions. These observations showed that the CRISPR approach has still not finished to surprise us. This CRISPR approach will allow the scientific community to manipulate the rodent genome in a fast and efficient manner that was not possible before. Keywords: Structural vairants, CRISPR/Cas, mouse, rat, deletions, duplications, inversions

The possibilities and limitations of CRISPR/Cas9 in mouse zygotes Katharina Boroviak, Brendan Doe, Allan Bradley Wellcome Trust Sanger Institute, Wellcome Genome Campus, Hinxton, Cambridge United Kingdom CB10 1SA The CRISPR/Cas9 system is now established as a tool for genome engineering in mouse zygotes. It has been widely used to generate mutants containing small insertions/deletions (indels) as well as single nucleotide polymorphisms (SNPs), loxP sites and, less efficiently and to varying degrees of success, for the introduction of targeting constructs. We investigate the possibilities and limitations of CRISPR/ Cas9 by cytoplasmic injection of RNA or protein into mouse zygotes. First, we tested different sources of Cas9 mRNA and protein for their ability to generate indels and examined their efficiencies depending on the injected concentrations. We also compared different methods for generating SNPs and investigate the pitfalls of using CRISPR/Cas9 to generate homologous recombination alleles in zygotes. Another part of our work focuses on generating mouse models to study human diseases. Deletions, duplications and inversions of large genomic regions covering several genes are an important class of disease causing variants in humans. Modelling these structural variants in mice so far required multi-step processes in ES cells, which has limited their availability. We now demonstrate the direct generation of deletions, duplications and inversions of up to one million base pairs by zygote injection. Keywords: CRISPR/Cas9, mouse zygotes, cytoplasmic injection

CRISPR/Cas9 mediated gene modification provides a robust platform for modeling developmental disorders Kevin A. Peterson1, Candice N. Baker1, Xiaoqin Liu2, You Li2, Anne Guimier3, Christopher T. Gordon3, Cecilia Lo2 and Stephen A. Murray1 1 The Jackson Laboratory, Bar Harbor, Maine, USA 2 Department of Developmental Biology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA. 3Laboratory of embryology and genetics of congenital malformations, INSERM UMR 1163, Institut Imagine, Paris, France

Advances in genome editing technologies (e.g. CRISPR/Cas9) coupled with next generation sequencing allows for rapid

123

Transgenic Res (2016) 25:195–270 assessment of putative human disease alleles using animal models. Here, we explore the direct analysis of CRISPR/Cas9 modified P0 mouse embryos to model novel mutations potentially associated with human developmental disorders. Typically, the timescale from identification of possible causative allele to functional validation is on the order of several months to a year even with current technologies. In this study, we demonstrate the feasibility of direct investigation of P0 embryos to model embryonic lethal genes as well as human congenital heart defects reducing the time scale of analysis from months to weeks. Our method relies on injection of RNA guides and Cas9 mRNA into zygotes, which yield P0 embryos that mimic phenotypes observed in human disease cases. In proof-of-principle studies, we tested both single gene knock-out and knock-in strategies and modeled oligogenic mutations Identification of the desired mutation was confirmed via traditional cloning and sequencing approaches as well as deep sequencing to account for possible low abundant alleles. Additionally, we observed an intriguing phenomenon of regional mosaicism within tissues of different developmental origins within a single embryo. Here, we show that these potentially confounding effects can be mitigated by engineering mouse embryonic stem cells to contain the desired mutation followed by 8-cell injection into a genetically marked host. This approach eliminates potential genetic ambiguity and enables quick assessment of embryonic stem cell contribution to the embryo These advancements in generation and characterization of P0 embryos provide a robust and reliable method for validation of new human developmental disease models. Keywords: CRISPR/Cas9, human disease, embryo, developmental disorders

Transgenic approaches in diverse animals species Richard R. Behringer Department of Genetics, University of Texas MD Anderson Cancer Center, Houston, Texas, USA Gene transfer into the soma and/or germ line of animals and plants was a major scientific advancement to examine gene function in vivo, create models for human disease, and generate improvements in livestock and crops. The mouse was the first species in which transgenic animals were first reported because of advancements in molecular biology coupled with extensive knowledge of mammalian reproductive physiology. Subsequently, transgenic technologies have been applied successfully to many vertebrate and invertebrate species. The germ cells, embryos, and life cycles of each species provide opportunities and challenges to generate transgenic animals. Transgenic approaches will be presented comparing the unique features of diverse animal systems. Keywords: invertebrates, germ cells, embryos, life cycles

GONAD and Easy (Isi)-CRISPR: novel mouse genome engineering tools Masato Ohtsuka1, Hiromi Miura1,2, Gou Takahashi1,3, Rolen Quadros4, Masahiro Sato5, Channabasavaiah B Gurumurthy6 1 Department of Molecular Life Science, Division of Basic Medical Science and Molecular Medicine, Tokai University


215

School of Medicine, Isehara, Kanagawa, Japan; 2 Department of Regenerative Medicine, Basic Medical Science, Tokai University School of Medicine, Isehara, Kanagawa, Japan; 3Department of Bioproduction, Tokyo University of Agriculture, 196 Yasaka, Abashiri, Hokkaido, 099-2493, Japan; 4Mouse Genome Engineering Core Facility, University of Nebraska Medical Center, Omaha, NE, USA; 5Section of Gene Expression Regulation, Frontier Science Research Center, Kagoshima University, Kagoshima, Kagoshima, Japan; 6Developmental Neuroscience, Munroe Meyer Institute for Genetics and Rehabilitation, University of Nebraska Medical Center, Omaha, NE, USA

of up to 83 %. We named this new method as (Isi)-CRISPR: ivTRT-ssDNA insertion CRISPR (pronounced Easy-CRISPR). Keywords: CRISPR/Cas9, in vivo electroporation, GONAD, ssDNA, knock-in, Easy-CRISPR

The CRISPR/Cas9 system has emerged as a popular genome editing method because of its technical simplicity and robustness. It can be widely applied to generate genome editing animals including mice. In this talk I will present our recently developed add-on tools for CRISPR/Cas9 system: GONAD and Easy (Isi)-CRISPR. GONAD: Animal transgenesis involves three major technical steps; isolation of fertilized eggs, microinjection and subsequent transfer of eggs into recipient females. Of these, the microinjection is the most tedious step that requires sophisticated equipment as well as highly skilled personnel to perform the task. Using CRISPR system, some groups recently demonstrated that microinjection can be replaced with electroporation of eggs. Such ex vivo electroporation helped handling of many eggs simultaneously but it did not exclude other two steps of animal transgenesis. We developed a new system called Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) method that could bypass all three critical steps of traditional genome engineering methods. The GONAD strategy allows electroporation to deliver nucleic acids (NAs) to the zygotes within the intact mouse oviduct in situ. With this method (instillation of NA solution into the oviductal lumen of pregnant females and following electroporation to the oviducts), we successfully delivered NAs into the day 0.7 and day1.5 zygotes and obtained gene-disrupted embryos/pups when delivered CRISPR/Cas9 genome editing components. The GONAD method can also be potentially applied to generate genetically engineered models in other species. Easy-CRISPR: One of the major challenges of CRISPR/ Cas9 system is very poor efficiency of insertion of longer DNA cassettes at the Cas9 cut sites. Because smaller single-stranded OligoDeoxyNucleotides (ssODNs) get inserted at relatively higher efficiency than the longer double-stranded DNA cassettes, we hypothesized that longer single-stranded DNAs (ssDNAs) could also get inserted efficiently. Because longer ssDNAs ([200-bases long) cannot be readily synthesized commercially, such strategies require the use of dsDNAs (plasmid-based constructs) even though the dsDNA repair templates generally require long homology arms and are inserted with lower efficiency compared to ssDNA. We synthesized ssDNA donors of 0.2 to 0.5-kb or longer, using a standard molecular biology technique; in vitro Transcription and Reverse Transcription (ivTRT) that were then used in CRISPR/Cas9-mediated targeted insertion experiments (pronuclear and cytoplasmic injection of ssDNA together with CRISPR/Cas9 genome editing components). As a result, we routinely obtained knock-in mice with an insertion efficiency

CRISPR-Cas9 system has become the tool of choice for genome engineering. Previously we established the method of microinjecting CRISPR-Cas9 system into zygotes to generate mouse models. To overcome the technically demanding and inherently low throughput method of microinjection, we devised the Zygote Electroporation of Nuclease (ZEN) technology, which employs electroporation to deliver CRISPRCas9 reagents to the zygotes and generated live mice carrying targeted NHEJ and HDR mutations. The general principles discovered and described in this study have implications for high efficiency, high throughput genome engineering in animals. To extend the utility of the CRISPR-Cas9 system, we have taken advantage of the ability of Pumilio PUF domains to bind specific 8-mer RNA sequences. By combining these two systems, we established the Casilio system, which allows for specific and independent delivery of effector proteins to specific genomic loci. We demonstrated that the Casilio system enables independent up- and down-regulation of multiple genes, as well as live-cell imaging of multiple genomic loci simultaneously. Importantly, multiple copy of PUF binding sites can be incorporated on sgRNA backbone, therefore allowing for local multimerization of effectors. In addition, the PUF domain can be engineered to recognize any 8-mer RNA sequence, therefore enabling the generation and simultaneous operation of many Casilio modules. Keywords: Genome editing, CRISPR-Cas9, mouse model, transcription regulation

CRISPR-Cas9 application in mouse model creation and transcription regulation Haoyi Wang1,2 1

Institute of Zoology, Chinese Academy of Sciences, Bejing, China; 2The Jackson Laboratory, Bar Harbor, Maine, USA

Gene cassette knock-in in mice with cloning-free CRISPR/Cas system Tomomi Aida1, Tetsushi Sakuma2, Shota Nakade2, Takashi Yamamoto2, Kohichi Tanaka1 1 Laboratory of Molecular Neuroscience, Medical Research Institute (MRI), Tokyo Medical and Dental University (TMDU), Tokyo, Japan; 2Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan

Knock-in mice carrying functional gene cassettes have provided invaluable opportunities for in vivo functional analysis of genes, cells, and circuits in mammalian organisms. Although the CRISPR/Cas system has enabled one-step generation of knockout mice with high efficiency, relatively low success rates of gene cassette knock-in limit its application range. We

123

216


developed modified CRISPR/Cas system that cloning-free, direct nuclear delivery of Cas9 ribonucleoprotein complex with chemically synthesized dual RNAs (crRNA and tracrRNA). We applied this cloning-free CRISPR/Cas system to mouse zygotes and successfully generated knock-in mice carrying gene cassettes with high efficiency. The knock-in mice showed efficient germline transmission of knock-in alleles with less mosaicism, and less undesired off-target mutations. We further developed modified targeting vector for gene cassette knock-in without long homology arms. Together, cloning-free CRISPR/ Cas system provides simple, rapid, efficient, and scalable onestep generation of gene cassette knock-in mice. Keywords: CRISPR/Cas, knock-in, mouse

strongly suggest that there must be additional enhancers also able to drive Sox9 transcription in the early XY gonad. Progress in identifying such enhancers and strategies for understanding their role will be discussed as an example of how new techniques can permit dissection of complex regulatory regions, and how this knowledge could be of clinical relevance. Ways of using cell-type specific enhancers to help obtain Sertoli cells by directed differentiation from pluripotent stem cells will also be discussed. Keywords: sex determination, Sertoli cells, Sox9, enhancers, testis, transgenic, mutation

Rat germline editing in donor spermatogonial stem cells F. Kent Hamra

Regulation of Sox9 in the gonad during sex determination 1

1

1

Robin Lovell-Badge , Nitzan Gonen , Shiela Samson , Helen O’Neill1, Ryohei Sekido2, Danielle Maatouk3

Department of Pharmacology, Cecil H. & Ida Green Center for Reproductive Biology Sciences, University of Texas Southwestern Medical Center, 6001 Forest Park Road, Dallas, Texas 75390

1

Laboratory of Stem Cell Biology and Developmental Genetics, The Francis Crick Institute, The Ridgeway, Mill Hill, London NW7 1AA, UK; 2School of Medical Sciences, Institute of Medical Sciences, University of Aberdeen, Foresterhill, Aberdeen AB24 2ZD, UK 3Robert H Lurie Medical Research Center, Northwestern University, 303 E Superior, Chicago, IL 60611, USA The critical role of the sex-determining gene SRY is to initiate the expression of the autosomal gene Sox9 in precursor cells of the supporting cell lineage in the early gonad. SOX9 initiates and then, with the aid of SOX8 and additional pathways, maintains Sertoli cell differentiation. Unlike SRY, which ceases to express very rapidly following its onset, Sox9 expression persists throughout life in Sertoli cells. Expression of SOX9 in the early XX gonad can cause female to male sex reversal, whereas loss of function mutations in Sox9 in XY animals can cause male to female sex reversal, as long as gene expression is lost sufficiently early, or on a Sox8 null background. As Sox9 is widely expressed in many tissues and cell types, our lab initiated an attempt to discover the enhancers that regulate Sox9 expression specifically in the testis. A 3.2 kb fragment located 13 kb upstream of the Sox9 start site was discovered and termed TES (Testis-specific enhancer of Sox9). A 1.4 kb core fragment located within TES was defined and termed TESCO (TES core). Chromatin immunoprecipitation data showed that SRY (and both SF1 and SOX9) binds to TESCO in vivo. Moreover, both TES-LacZ and TESCO-CFP transgenic mice mimic Sox9 expression in the testis. To test whether TES is necessary and sufficient to induce Sox9 expression in the testis we used CRISPR/Cas9 to delete the enhancer in embryonic stem cells. These were used to generate chimeras and then heterozygous TES deleted mice after germ line transmission. Homozygous mutants obtained from these appear normal and viable and do not show obvious signs of XY sex reversal. Although Sox9 is still expressed in XY gonads at both embryonic and adult stages there is a substantial decrease in Sox9 mRNA levels in homozygous deleted mice when compared to controls. These results confirm that TES is involved in Sox9 expression in the gonad, but the absence of sex reversal and the residual expression seen

123

Gene targeting in donor spermatogonial stem cells opens new doors to genetically engineer model organisms used in biomedical research. Notably, rat fecundity facilitates effective donor spermatogonial haplotype transmission to large F1 litters. One rat testis holds capacity to mobilize mutant spermatozoa production from thousands of donor spermatogonial stem cells, enabling economical forward or reverse genetic analyses in rat models. As proof-of-concept, we previously used a genetically selected donor spermatogonial library (G418 r ) to generate a panel of [50 mutant Sprague–Dawley rat strains harboring b-Geo gene-trap transposon insertions in distinct protein coding genes. A sample of mutant rat strains derived from the donor spermatogonial library (n = 18 strains) was analyzed in a small-scale forward screen for reproduction phenotypes, which identified recessive gene-trap mutations that caused gametogenesis defects (n = 5 strains), behavior disorders (n = 1 strain), embryonic lethality (n = 6 strains) or postnatal end-stage disease (n = 1 strain). Similar to Sprague– Dawley rat spermatogonial lines, donor spermatogonial lines derived from other commonly applied commercially available inbred and outbred rat strains were amenable to genetic modification with transposable DNA constructs, while retaining potential to develop into functional transgenic spermatozoa. Recently, we used CRISPR/Cas9 to catalyze targeted genomic modifications in rat spermatogonial stem cell cultures by non-homologous end joining and homology-directed repair pathways. CRISPR/Cas9-modified spermatogonia regenerated spermatogenesis and displayed long-term sperm forming potential following transplantation into rat testes. Targeted germline mutations were vertically transmitted from recipients to exclusively generate ‘‘pure’’, non-mosaic mutant progeny. Rats harboring targeted germline mutations were produced with or without genetically selecting donor spermatogonia. Monoclonal enrichment of Erbb3-null germlines unmasked recessive spermatogenesis defects in culture that were buffered in recipients, yielding mutant progeny isogenic at targeted alleles. High donor germline colonization efficiency, transfection efficiency and sperm forming potential translated into robust mutant rat production by spermatogonial gene editing. Thus, spermatogonial gene editing provides an alternative

Transgenic Res (2016) 25:195–270 platform to efficiently generate heritable targeted germline modifications in rats. Keywords: spermatogonial, germline stem cells, transgenic rats, knockout rats, knockin rats, germline editing, spermatogenesis

GWIS: genetics with Interrogation of SNPs John Schimenti and Priti Singh Department of Biomedical Sciences, Cornell University, Ithaca, NY, USA About half of infertility cases in people have a genetic basis. Despite extensive knowledge gained from gene knockouts in mice, the genetic causes for the vast majority of idiopathic human infertilities are unknown. Traditional methods for studying inheritance, such as GWAS or linkage analysis, have been confounded by heterogeneity of infertility phenotypes and hundreds of genes involved in gametogenesis. To circumvent this problem, we implemented a novel approach called GWIS, which allows us to do genetics without genetics. GWIS uses CRISPR/Cas genome editing in mice to generate and functionally test nonsynonymous and putatively deleterious SNPs in human reproduction genes that segregate at low frequencies in the population. Several ‘‘humanized’’ mouse alleles have been generated. The results indicate that only about 25 % of meiosis gene SNPs—all computationally predicted to be deleterious— actually compromise fertility in mice, indicating that purely computational methods for predicting variant gene function is highly inaccurate. This project will ultimately reveal the proportion of genetically-based infertilities caused by inheritance of segregating alleles in the population, and form a crucial knowledge base for personalized genomic medicine. Keywords: CRISPR, fertility, mouse genetics

Modelling and understanding rare genetic diseases with intellectual disabilities for tomorrow’s treatment Yann Herault1,2, Hamid Meziane2, Thomas Arbogast1, Mohammed Selloum2, Abdel Ayadi2, Philipe Andre´2, Marie Wattenhoffer Donze2, Marie-Christine Birling2, Guillaume Pavlovic2, Tania Sorg2 and the Gencodys Network3 1

Institut de Geńe´tique Biologie Molećulaire et Cellulaire, IGBMC, CNRS, INSERM, Universite´ de Strasbourg, UMR7104, UMR964, 1 rue Laurent Fries, 67404 Illkirch, France; 2Institut Clinique de la Souris, PHENOMIN-ICS, CNRS, INSERM, Universite´ de Strasbourg, 1 rue Laurent Fries, 67404 Illkirch, France; 3 The Genetic and Epigenetic Networks in Cognitive Dysfunction www.gencodys.eu Genetic diseases with intellectual disability (ID) involved impairment of mental abilities that impacts adaptive functioning in the conceptual, the social or the practical domain with or without other features. ID can occur during the developmental period and is defined by an intellectual quotient below 70. Several genetic causes, including trisomy (Down syndrome), deletion or duplication of genomic regions (16p11.2, 17q21.31,…), and more than 700 individual genes, have been

217 associated with ID. To better understand the physiopathology of the genetic diseases with ID, we generated more than 80 mouse mutants for different causes and genes involved in various functions such as synaptic transmission or nuclear regulation. Here we will report the characterization of several ID mouse models using standardized behavioural and cognitive paradigms. We also took advantage of the International Mouse phenotyping resource to get additional information on the phenotypes of the ID models. Based on the new series of models, several ID genes were found inducing key defects in the mouse confirming, even for some challenged candidates, their involvement in ID and unravelling altered cellular mechanisms and molecular pathways. The data generated are challenging our current knowledge on the various role of ID genes on brain and cognitive function. Such studies lead to a better understanding of genetic disease with ID, how the cognition and behaviour is controlled in mouse and human and how to define and evaluate preclinical treatments. We will present here a few promising therapeutic avenues for a few for rare disease with ID. Keywords: Genetics, mouse models, behavior, phenotyping, standardisation, omics

TALEN-mediated inactivation of Klk5 and Klk7 rescues lethal phenotype of Netherton syndrome mouse model Petr Kasparek1, Zuzana Ileninova1, Oldrich Benada2, Olga Zbodakova1, Ivan Kanchev1, and Radislav Sedlacek1 1

Institute of Molecular Genetics of the ASCR, Laboratory of Transgenic Models of Diseases, Prague, Czech Republic; 2 Institute of Microbiology, ASCR, Prague, Czech Republic Netherton syndrome is a severe ichtyosis caused by mutations in the SPINK5 gene encoding the protease inhibitor LEKTI. It is mainly characterized by a disrupted epidermal barrier, chronic inflammation and structural abnormalities of hair shaft. Patients with Netherton syndrome and mouse models deficient for LEKTI exhibit increased proteolytic activity in the epidermis. To elucidate the role of the individual proteases KLK5 and KLK7 in LEKTI deficient epidermis, we have prepared a set of mouse models using TALEN-targeting deficient for LEKTI, double deficient for LEKTIxKLK5 and LEKTIxKLK7 and triple-deficient for LEKTI 9 KLK5 9 KLK7. We observe an improvement of a number of cutaneous symptoms of Netherton syndrom in both double deficient animal models and full rescue of Netherton syndrome-like phenotype in LEKTI 9 KLK5 9 KLK7. These data provide in vivo evidence that KLK5 and KLK7 are the main cause of epidermal pathologies in Netherton syndrome patients and help us to understand the role of these proteases in the disease. Keywords: Netherton syndrome, Spink5, kallikreins, TALEN

A powerful new tool to improve immune-compromised mouse models: derivation of NRG embryonic stem cell lines Javier Martıń-Gonza´lez1, Aurelie Baudet2, Sahar Abelchian1, Gunnar Juliusson3,4, Cord Brakebusch1 and Jo¨rg Cammenga3,4,5,6 1 Transgenic Core Facility, University of Copenhagen, Copenhagen, Denmark; 2Department of Molecular

123

218 Medicine and Gene Therapy, Lund University Hospital, Lund, Sweden; 3Department of Molecular Hematopoiesis, Lund University, Lund, Sweden; 4Department of Hematology, Lund University, Lund, Sweden; 5Department of Hematology, Linko¨ping University, Linko¨ping, Sweden; 6 IKE, Linko¨ping University, Linko¨ping, Sweden NOD (Non Obese Diabetic)-based mouse strains, such as NSG (NOD-Scid-il2Rg) or NRG (NOD-Rag1-il2Rg) are the best available models for studying human hematopoietic cells. Unfortunately, engraftment of normal human hematopoietic stem cells is variable and permissiveness of these models to different human malignant cells is very limited, for reasons that remain elusive. Attempts to improve upon the existing xenograft mouse models, i.e. using expression of human cytokines, resulted in higher overall engraftment but did not address the issues of permissiveness or variability, requiring then further improvement. Introduction of additional permissive mutations into these complex genetic backgrounds by natural breeding is a very demanding task in terms of time and resources. In addition, since the genetic elements defining the NSG/NRG phenotypes might have not yet been fully characterized, intense backcrossing is required to ensure transmission of the full phenotype. Alternatively, we present the CRISPR/CAS9 targeting of embryonic stem cell (ESC) lines derived from NRG preimplantation embryos generated by in vitro fertilization for the first time. Because the DNA-PK mutation responsible for the SCID defect in NSG mice renders the strain more vulnerable to genomic instability during ESC culture, and later to conventional chemotherapy in tumor models, we favored the NRG strain over NSG. Pluripotency has been tested in three of these newly established ESC lines by a chimera formation assay. After injected into morula stage embryos, cells from all three lines gave rise to chimeric adult mice showing high contribution of the ESC (70–100 %), assessed by coat color. Moreover, these lines have been successfully targeted using Cas9/CRISPR technology. To conclude, these new NRG ESC lines combined with genome editing nucleases bring a powerful genetic tool that facilitates the generation of new NOD-based immunodeficient mouse models with the aim to improve the existing xenograft models. Keywords: NRG mouse, Immunodeficient mouse model, Hematopoiesis mouse model, ESC derivation

RNAi and CRISPR/Cas9 based in vivo models for drug discovery Prem Premsrirut1, Gregory Martin2, Lukas Dow3, Sang Yong Kim4, Johannes Zuber5, Scott Lowe6, and Greg Hannon7 Mirimus Inc.; 2Department of Embryology, Charles River Laboratories Wilmington, MA, USA; 3Department of Biochemistry in Medicine, Weill Cornell Medical College, New York, NY, USA; 4Rodent Genetic Engineering Core, New York University New York, NY, USA; 5Dept. of Differentation and Disease, Research Institute of Molecular Pathology, Vienna, Austria; 6The Scott Lowe Lab, Memorial Sloan Kettering Cancer Center, New York, NY,

Transgenic Res (2016) 25:195–270 USA; 7Hannon Group, Cancer Research UK, Cambridge, UK With the advent of CRISPR-Cas9 technology, the speed and precision in which genetically engineered mouse models can be created is unprecedented. We now have at our disposal a genetic toolbox that will enable the rapid generation of sophisticated mouse models of human disease. Recently, an inducible CRISPRCas9 (iCRISPR) system was described that enables doxycyclineregulated Cas9 induction of widespread gene mutagenesis in multiple tissues. Previously, we also demonstrated how inducible RNA interference (RNAi) can be exploited experimentally to effectively and reversibly silence nearly any gene target not only in vitro but also in live mice. Here, we take advantage of these powerful technologies and combine both tet-inducible CRISPRCas9 and inducible RNAi-mediated gene silencing to develop animal models in which both de novo disease pathogenesis can be induced by Cas9-mediated genome editing and therapeutic strategies assessed downstream via RNA interference-mediated gene silencing. By using this combination of CRISPR/Cas9 and RNAi technologies, we are able to not only model disease, but also mimic drug therapy in the same mice, giving us advanced capabilities to perform preclinical studies in vivo. Using our robust flexible system, we have created a cost-effective and scalable platform for the production of complex genetically engineered mouse models with RNAi silencing of nearly any gene—mice with enormous predictive power that will shape our development of better tolerated therapies. Keywords: RNAi, genome editing, CRISPR, mouse models, gene knockdown, gene silencing

Genetic basis of lymphoid organ formation Thomas Boehm Department of Developmental Immunology, Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany The thymus is an evolutionarily conserved primary lymphoid organ that is present in all vertebrates. Without a functional thymic microenvironment, no T cell development can take place resulting in severe immunodeficiency. In an iterative process, we have used comparative genomics of chordates, genetic screens in zebrafish, and transgenic modifications in zebrafish and mice in order to functionally characterize developmental checkpoints of thymus and T cell development. Based on this information, we have reconstructed the hypothetical haematopoietic properties of the thymus of extinct prevertebrates and generated minimalistic thymopoietic tissues in vivo. Keywords: Chordates, mouse, zebrafish, lymphoid organ, thymus, T cell development

1

123

Towards using pluripotent stem cell-based disease models to study immune syndromes Rene Maehr Program in Molecular Medicine, UMass Medical School, Worcester, USA

Transgenic Res (2016) 25:195–270 Induced pluripotent stem cells provide us with an unprecedented opportunity to generate patient-specific disease models. This presentation will provide an update on recent efforts to generate a human stem cell-based humanized mouse models to investigate immune syndromes. In particular, efforts to generate thymic epithelial cells from pluripotent stem cells are discussed. In the long term, a human stem cell-based humanized model of immune syndromes shall permit detailed investigation of disease mechanisms and cellular dysfunction. Resulting mechanistic insights are anticipated to inform new approaches to curing, or even preventing, disease. Keywords: pluripotent stem cells, differentiation, disease models

Mammalian synthetic biology: from parts to modules to therapeutic systems Ron Weiss Department of Biological Engineering and Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology, Cambridge, MA, USA Synthetic biology is revolutionizing how we conceptualize and approach the engineering of biological systems. Recent advances in the field are allowing us to expand beyond the construction and analysis of small gene networks towards the implementation of complex multicellular systems with a variety of applications. In this talk I will describe our integrated computational/experimental approach to engineering complex behavior in a variety of cells, with a focus on mammalian cells. In our research, we appropriate design principles from electrical engineering and other established fields. These principles include abstraction, standardization, modularity, and computer aided design. But we also spend considerable effort towards understanding what makes synthetic biology different from all other existing engineering disciplines and discovering new design and construction rules that are effective for this unique discipline. We will briefly describe the implementation of genetic circuits and modules with finely-tuned digital and analog behavior and the use of artificial cell–cell communication to coordinate the behavior of cell populations. The first system to be presented is a multiinput genetic circuit that can detect and destroy specific cancer cells based on the presence or absence of specific biomarkers in the cell. We will also discuss preliminary experimental results for obtaining precise spatiotemporal control over stem cell differentiation for tissue engineering applications. We present a novel approach for generating and then co-differentiating hiPSC-derived progenitors with a genetically engineered pulse of GATA-binding protein 6 (GATA6) expression. We initiate rapid emergence of all three germ layers as a combined function of GATA6 expression levels and tissue context. We ultimately obtain a complex tissue that recapitulates early developmental processes and exhibits a liver bud-like phenotype that includes haematopoietic and stromal cells, as well as a neuronal niche. We will conclude by discussing the design and preliminary results for creating an artificial tissue homeostasis system where genetically engineered stem cells maintain indefinitely a desired level of pancreatic beta cells

219 despite attacks by the autoimmune response, relevant for diabetes. Keywords: genetic circuits, tissue enginering, synthetic biology, human iPS cells Embryonic stem cells and interspecies blastocyst complementation in farm animals Pablo J Ross Department of Animal Science, University of California Davis, Davis, USA The availability of embryonic stem cells (ESC) with germline chimera contribution potential has greatly contributed to the development of genetically engineered mice. In contrast, derivation of robust livestock ESC has been challenging. Adapting recently developed culture conditions amenable to efficient and robust derivation of mouse ESC and ease of maintenance of human ESC, we have derived bovine and ovine ESC. These cells can be efficiently derived from in vitro produced embryos and are easily maintained in culture. The cells express standard markers of pluripotency, incorporate to the ICM of blastocyst stage embryos, and form teratomas in immunocompromised mice; all characteristics of robust pluripotency. Recently, interspecific blastocyst complementation has raised the possibility that functional human tissues/organs could be developed in host species other than humans. Domestic animals represent an ideal host for human organ development given their similar size, physiology, anatomy, and speed of development/ growth. We have implemented the CRISPR/Cas9 system to generate organ-ablated livestock host embryos. Also, we have engaged in developing technologies for creating large-animal interspecies chimeras and determining the potential of human pluripotent stem cells for contributing to livestock embryogenesis. Advances in these areas will be presented and discussed. Keywords: ESC, livestock, cattle, sheep. blastocyst complementation, CRISPR/Cas9

A genetic approach of long-range gene regulation during development and evolution Denis Duboule School of Life Sciences, Ecole Polytechnique Fe´de´rale, Lausanne, Switzerland and Department of Genetics and Evolution, University of Geneva, Switzerland The emergence and evolution of digits was an essential step in the success of vertebrates. Hoxd genes are amongst the key players in this developmental process and are coordinately regulated during digital development. We examined their longrange transcriptional regulation in limb buds at early and late stages, by using both a large set of targeted chromosomal variants at the HoxD locus, and approaches combining chromosome conformation capture and chromatin signatures as well as transgenic approaches in vivo. In developing digits, we show that the active part of the gene cluster contacts several regulatory islands, located within the centromeric gene desert, which all contribute either quantitatively or qualitatively to Hox gene transcription. In contrast, the telomeric gene desert contains enhancers that are critical for the forearm regulation.

123

220 These two regulations are exclusive in cis from one another, with the telomeric enhancers being active before the implementation of the centromeric regulation, the latter one occurring one to two days later. I will discuss the ontogenic and phylogenetic rationals of this complex bimodal regulatory strategy, as well as what may control the switch between these two global regulations. In this seminar, I’ll try and illustrate how transgenic genomes and genome engineering and editing may help understand complex regulatory modalities. Keywords: animal, gene

Posters Developing a universal gene targeting construct to introduce complex modifications via co-electroporation of CRISPR reagents into mouse ESCs Alasdair J. Allan, Joffrey Q. Mianne, Jorik Loeffler, Marina Maritati, Gemma F. Codner, Lydia Teboul The Mary Lyon Centre, MRC Harwell, HSIC, Oxon, OX11 0RD, UK Understanding the basic function of genes and the effects of sequence variation is greatly aided by the use of mouse models. These models facilitate the initial characterisation of genes, which reveals their basic functions, whilst the development of technologies including reporters and other transgenic tools enables the introduction of complex tailored modifications to specific alleles. An increased understanding in the function of genes helps to develop and test new therapeutic treatments to complex genetic disorders and diseases, which can then begin to be applied in human health. Traditionally, manipulation of the mouse genome was performed through homologous recombination in embryonic stem cells (ESC). The description of the CRISPR/Cas system however has enabled researchers to generate mouse models significantly faster, more precisely and at a reduced cost. This system is currently used by the Genome Engineering services at MRC Harwell in order to generate tailored CRISPR/Cas mutants. This pipeline involves the design and modification of the gene of interest, followed by the pronuclear injection (PI) of CRISPR/Cas reagents into one cell stage mouse embryos. This system has proved effective for the generation of desired exon disruption/deletion mutants, as well as other subtle modifications such as point mutations. However this pathway is not yet efficient for more complex alleles involving the integration of large cassettes to support more sophisticated studies. Double stranded breaks of DNA are known to improve the rate of homologous recombination mediated repair. Here, we will present our initial data towards introducing more complex modifications into the mouse genome through co-electroporation of a targeting vector and CRISPR reagents into ESC. We will introduce the construction of a universal gene targeting plasmid, which will enable the efficient insertion of desired homology arms and critical regions specific to the gene of interest, to create a complete gene specific construct with both positive and negative selection cassettes. We will also present data outlining our initial experiments using the IKMC Serf2 construct detailing

123

Transgenic Res (2016) 25:195–270 our screening and QC strategies. This preliminary data suggests this is a highly efficient strategy to correctly target genes in ESC. Keywords: ESC, Mouse, CRISPR, construct

Investigation the role of microRNAs in early embryonic development and stem cells in rabbit and chicken Mahek Anand1,2, Pouhneh Maraghechi1, Kinga Nemeth1, Bence Lazar1, Elen Gocza1 1

Department of Animal Husbandry Sciences, Szent Istvan University, Godollo, Budapest, Hungary; 2National Agricultural Research and Innovation Center -Agricultural Biotechnology Center, Godollo, Budapest, Hungary MicroRNA (miRNA) are non-coding RNA that post-transcriptional regulate gene expression. However, emerging experimental studies discusses the role of miRNA in embryonic stem cell development. Recently, in our lab, SolidTM Sequencing analysis was done on rabbit embryos and pluripotent stem cells (rPSC) to identify potential pluripotency associated miRNA in different developmental stages. We identified ocu-miR-302 and ocu-miR290 clusters. The ocu-miR-302 cluster was homologous to human miR-302cluster, while ocu-miR-290 cluster showed less evolutionary conservation with its mouse homologue. Real time PCR analysis of both clusters was performed on rabbit embryos, and PSCs to study their expression pattern. The ocu-miR-302 cluster showed high expression post implantation, whereas the ocu-miR-290 cluster showed high expression before implantation. The ocu-miR-302 putative gene targets were identified using bioinformatics analysis. Based on the above results, a specific rabbit pluripotency-associated miRNA array was developed. The microarray profiling was continued on chicken primordial germ cells (cPGC), as in our stem cell culture laboratory a new technique, the long term PGC culture were adapted. Emerging studies describe PGCs as important pioneers in research for transgenic chicken, due to easiness of the PGCs collection from blood and they in vitro culture. The microarray profiling identified high expression level of gga-miR-302 cluster. The gga-miR-302 cluster is showing high homology with ocu-miR-302 cluster. Recently many novel miRNA were identified in chicken whatever them it is necessary to characterize in the future. The above study is the first study for identification of pluripotency-associated miRNAs in rabbit PSCs and gave new information about to chicken PGCs. These results open the venue for further studies on regulatory pathways of these pluripotency-associated miRNA in pluripotency maintenance in cPGCs and rPSCs. Keywords: MicroRNA, induced pluripotent Stem cells, Chicken Primordial germ cells, Rabbit embryonic stem cells

Screening of transgenic and knockout mice for eye phenotypes in the Czech Centre for Phenogenomics Barbora Antosova1,2, Jitka Lachova1,2, Zbynek Kozmik1,2 1 Laboratory of Eye Biology, Institute of Molecular Genetics AS CR, v. v. i., Prague, Czech Republic; 2 Czech Centre for Phenogenomics, Institute of Molecular Genetics AS CR, v. v. i., Prague, Czech Republic

Transgenic Res (2016) 25:195–270 The vision screen will be one of different complex screens performed in the emerging Czech Centre for Phenogenomics (CCP). Many parameters from various fields will be investigated by mouse researchers with the objective to improve our knowledge about the function of mammalian genes, and to generate new mouse models for human pathologies. The main purpose of the vision screen will be the detection of various eye abnormalities in eye morphology and eye physiology. Retina structure abnormalities will be examined by optical coherence tomography and functional analysis of the visual system will be performed using virtual optomotor system. Finally, the retinal function will be tested using electroretinography in selected transgenic and knockout mice. This approach allows us to detect changes in the visual functions effectively in vivo. Subsequently, suitable models for human eye pathologies can be selected from screened transgenic or knockout mice. Keywords: Czech Centre for Phenogenomics, vision screen, optical coherence tomography, optomotor system, electroretinography

Optimization of the one-step CRISPR/Cas9 gene knockout employing reporter transgenic zygotes Ronja Apfelbaum1*, Romina Bevacqua1,3*, Wiebke Garrels1,2*, Thirumala R. Talluri1, Ayan Mukherjee1, Maren Ziegler1, Birgit Burchardt1, Heiner Niemann1, Daniel Salamone3, Ester Grueso4, Zoltan Ivics4, Wilfried A. Kues1 1 Friedrich-Loeffler-Institut, Institut fu¨r Nutztiergenetik, Neustadt, Germany; 2Institute for Laboratory Animal Sciences, Medical School Hannover (MHH), Germany; 3 Departomento de Produccioń Animal, Facultad de Agronomıá, Universidad de Buenos Aires, Argentina; 4 Paul-Ehrlich-Institute, Langen, Germany; *equally contributing authors

The high efficiency of the CRISPR/Cas9 system allows genome editing in mammalian zygotes in a one-step manner. Here, we present a fluorophore mouse model for establishment and optimization of the one-step genome editing. The model is based on a transgenic mouse line, carrying a monomeric reporter transposon. The CAGGS promoter driven Venus reporter is systemically expressed, and a knock-out in cells or whole animals can be directly assessed by vital fluorescence imaging. The cytoplasmic injection of Cas9 and sgRNA plasmids targeting the reporter into hemizygous Venus zygotes was assessed. A knock-out efficiency of the Venus reporter of 17–25 % of the born pups was achieved, using total concentrations of 20 and 100 ng/ll of the CRISPR/Cas9 plasmids. Importantly, the majority of the targeted pups showed a complete knock-out of Venus in all organs. The remaining ones contained a Venus reporter mosaicism. The model allows the direct comparison of different compositions of the injections solution (plasmids vs. RNAs, ribonucleotide/Cas9 complexes), different injections sites (pronuclear, cytoplasmic), and the optimization of other parameters like the time point of injection, the injection volume and the concentration. Depending on the breeding schedule, the efficacy of mono- and biallelic knock-outs can be assessed. Keywords: Genome editing, Microinjection, Disease model

221 Production of new genetic tools with the help of CRISPR/Cas9 technologies to decipher THRA function in vivo Denise Aubert, Romain Guyot, Suzy Markossian, Frederic Flamant IGFL, ENS de Lyon, Lyon, France Thyroid hormone binds nuclear receptors (named THRA and THRB) that regulate the transcription of a large number of genes in many cell types. Unraveling the direct and indirect effect of this hormonal stimulation, and establishing links between these molecular events and the developmental and physiological functions of the hormone, is a major challenge. New mouse genetics tools are suitable to perform a multiscale analysis of T3 signaling and achieve this task. We developed mouse models using homologous recombination in ES cells and compared the efficiency of different strategies using different vectors associated or not with the CRISPR/Cas9 system. Targeting the same locus, we observed a 30 9 improvement of homologous recombination efficiency using CRISPR/Cas9 system (30 % vs less than 1 %). This efficiency of 30 % was also observed using two other vectors targeting different locus. In only one case CRISPR/Cas9 system was associated. The mouse models produced will allow CRE Recombinase dependant expression of a mutated or a tagged form of protein. Combining these different mouse lines with cell type-specific CRE-driver, we will be able to identify cell type specific functions of the nuclear receptor in vivo, in normal or pathological conditions. Keywords: T3 signaling, homologous recombination, CRISPR

Knockout mouse model for human autoimmune hair loss Ji-hyun Bae1, Woo-Sung Hwang1, Su-Cheong Yeom2 1 Designed Animal and Transplantation Research Institute, Greenbio Research and Technology, Seoul National University, 1447 Pyeongchang-Ro, Daewha, Pyeongchang, kangwon, Korea; 2Graduate School of International Agricultural Technology, Seoul National University, 1447 Pyeongchang-Ro, Daewha, Pyeongchang, Kangwon, Korea

Autoimmunity is related with numerous disorders, and alopecia areata (AA) is one kind of autoimmune disease with spot baldness in human. Impaired homeostasis between helper T cell and regulatory T (Treg) cell might induce autoimmune disease. CD80CD86 is important for CD25+ Treg cell generation and peripheral maintenance. Thus, CD80CD86 deficient cause impaired Treg homeostasis. In order to assess C57BL/ 6.CD80CD86 deficient mouse for human alopecia areata model, microscopic/macroscopic examination, flowcytometry analysis for CD4/Foxp3, immunohistochemistry analysis (CD4, CD8, MHCI, MHCII, mast cell) and cytokine assay (IL-2, IL-12p70, IL-4, IL-5, IL-10, IFN-c, TGF-b) were conducted. The CD80CD86-/- mice showed remarkably high prevalence of hair loss compared to C57BL/6 wild type, and the incidence of AA in CD80CD86-/- mice was almost up to 90 %, and it was also higher than C57BL/6 wild type. The onset of female hairloss started at 7–8 weeks, and male hairloss

123

222 was observed from 9 to 10 weeks after birth in CD80CD86-/mice. In histological examination for 8.5 month old CD80CD86-/-, destruction of hair follicle was observed. In flowcytometry analysis, CD80CD86-/- mice showed significant low CD4 + Foxp3 + Treg cell population than wild type. Furthermore, CD80CD86 deficient mice also showed high serum concentrations of T immune related cytokines such as IL2, IL4, IL10, IL12p70, IFNg. This result indicates that CD80CD86 deficiency caused impaired Treg homeostasis, and induce Th1 and Th2 over-activation. To confirm the relation between Treg and hairloss, additional CD25 monoclonal antibody treatment was conducted to C57BL/6. After CD25 depletion, 8-months old C57BL/6 mice showed a similar hairloss with C57BL/6.CD80CD86, and also showed hair follicle destruction. But female mouse with CD25 depleted didn’t develop hairloss. There were few animal models for human autoimmune alopecia. Especially in rodent, C3H mice is usually used as an autoimmune alopecia model. In this study, we have newly found that CD80CD86 deficient mice showed a similar phenotype with human autoimmune alopecia. Furthermore, CD80CD86 deficient mice showed early onset of alopecia (7–9 weeks old), and the incidence was relatively higher than C3H model. Keywords: alopecia areata, mouse model, regulatory T cell, Autoimmunity

Comparation of three different cell transfection reagents in ram spermatozoa transfection to obtain transgenic sheep embryos Gu¨l Bakirer Oztu¨rk1, Mehmet Koray Go¨K2, Kamber Demir3, Ramazan Arici3, Ays¸ e Can3, Saadet K.Pabuccuog˘lu2, Sema Birler3, Serhat Pabuccuog˘lu2 1

Department of Laboratory Animal Science, Institution of Experimental Medicine, Istanbul University, Istanbul, Turkey; 2Department of Chemical Technologies, Faculity of Chemical Engineering, Istanbul University, Istanbul, Turkey; 3Department of Reproduction and Artificial Insemination, Faculity of Veterinary Medicine, Istanbul University, Istanbul, Turkey Cell transfection reagents have been used in transgenic embryo production studies. Lipofectamine is one of used for that purpose in many species as they are known to be small molecules that made of cationic lipids which makes complex structures with negatively charged nucleic acids to carry into cell nuclei. TurboFectTM is a cationic polimer dissolved in water is recently being used in sperm mediated gene transfer (SMGT) in mammalian transgenesis. Lastly poli-b-aminoesters are nanopolymers are being used as alternative to poliethilenimines. In our study we used LipofectaminTM2000, TurboFectTM and poli-b-aminoester to transfect ram spermatozoa with plasmid DNA including eGFP. Intracytoplasmic sperm injection (ICSI) is used to fertilize oocytes from slaughterhouse. After trials to determine the optimum amount to use in SMGT, we tried 3, 4, 10 and 20 lg pDNA was mixed with appropriate amounts of Turbofect #R0531 Fermentas, 2, 2, 6 and 10 ll in respect and incubated at room temperature for 20 min. 1 9 106 spermatozoa was added and incubated at room temperature for

123

Transgenic Res (2016) 25:195–270 1 h. LipofectaminTM 2000 Reagent groups we similar to those in Turbofect, we used 3, 4, 8 and 10 ll Lipofectamin in order to carry 3, 4, 8 and 10 lg of p DNA, and incubated as above. Poli_b-aminoesters were synthesized at Department of Chemical Engineering, after centrufugation both supernatant and pellet groups were used, the pDNA was attached to them and incubated with spermatozoa at a concentration of 200 ng pDNA/2 9 105. In all gropus samples were mixed with 10 % PVP and used in ICSI. Except activation (only ionomycin activation was used in this study) and fertilization SOF media were used after fertilization, all embryonic procedures were made as in Birler et all 2010. Results in lipofectamin group was 10 lg pDNA carrying group gave us the highest transgenic embryo rates 37.73 % (p [ 0.05), but fragmentation rates 9.43 % were seen in this group statistically unimportantly (p [ 0.05). As similar to those in Turbofect groups 10 lg pDNA carrying group gave us the highest transgenic embryo rates 42.30 % (p [ 0.05) and had the highest degeneration rate of 48.64 % (p [ 0.05). In poli_b-aminoesters groups pellet group had the highest transgenic embryo rate 26.31 % and degeneration and fragmentation rates as 48.71 and 21.05 % in sequence. Keywords: SMGT, ram spermatozoa, transfection

The Czech Centre for Phenogenomics: International research infrastructure for mouse model production, archiving and phenotyping Inken M. Beck, Trevor A. Epp, Jan Honetschlager, Jan Prochazka, Radislav Sedlacek Czech Centre for Phenogenomics, Institute of Molecular Genetics ASCR, Prague, Czech Republic The Czech Centre for Phenogenomics (CCP, http://www. phenogenomics.cz/) is a newly built infrastructure consisting of state-of-the-art configurations necessary for transgenic model production, their archiving and phenotyping. As member of INFRAFRONTIER and the IMPC (International Mouse Phenotyping Consortium) the CCP is embedded in an associated global network that aims to analyze effects of knockout gene mutations in mice systematically and in detail. Our service at the transgenic module at CCP comprises nuclease-induced genetic mutagenesis and transgenesis, ES cell manipulation and injection, cryopreservation of embryos and spermatozoa, rederivation of pathogen-infected mouse lines as well as breeding and genotyping on demand. The phenotyping module houses a comprehensive collection of tools for the physiological and morphological assessment of mice and rats. CCP offers a wide variety of standardized tests and services, including those of IMPReSS (International Mouse Phenotyping Resource of Standardised Screens), mandated by our active partnership in the IMPC. Notable is our capacity for conducting comprehensive phenotyping pipelines, providing a wide breadth of clinical information per experimental animal, and thereby minimizing overall animal usage. The newly raised and recently obtained €24 million building with 7200 m2 floor space and maximum capacity of 13000 cages for mice (over 30 000 when combining with capacity at established campus) and 4000 cages for rats is planned to run in full production and phenotyping state during 2016. The CCP is

Transgenic Res (2016) 25:195–270 coordinated by Radislav Sedlacek and will employ over 70 persons. Located in the new BIOCEV complex (Biotechnology and Biomedicine Center of the Academy of Science and Charles University in Vestec) the CCP is combining genetic engineering capabilities, advanced phenotyping and imaging modalities, specific pathogen-free (SPF) animal production, housing and husbandry, as well as cryopreservation and archiving, all in one central location. Our mission is to create a research infrastructure that provides first-class expertise, tools and services to reveal gene functions in human diseases. Keywords: Transgenesis, phenotyping, infrastructure

The role of Fam208a in early mouse embryogenesis Shohag Bhattacharyya, Christiana Polydorou, Radislav Sedlacek, Trevor Allan Epp, Kallayanee Chawengsaksophak 1

Laboratory of Transgenic Models of Diseases, Institute of Molecular Genetics, Prague, Czech Republic; 2 Biotechnology and Biomedicine Center of the Academy of Sciences and Charles University in Vestec, Czech Republic The early mouse development is a highly dynamic process. Gastrulation resulting in the formation of the three germ layers is a key event in post-implantation embryo. It establishes the anterior-posterior (A-P) axis in an orchestrated manner under the tight guidance of gradients of morphogenetic signaling cues, both within and between embryonic and extra-embryonic regions. Two mouse strains with point mutations in Fam208a, a protein recently highlighted as a core member of the epigenetic silencing HUSH complex, were identified in an N-ethyl-N-nitrosourea (ENU) screen for modifiers of transgene variegation leading to homozygous embryonic lethality. They first appear growth retarded around 6.75 d.p.c., and as gestation proceeds, this growth retardation becomes increasingly severe, leading to their eventual resorption around 10.5 d.p.c. Wholemount Immunofluorescence and in situ hybridization on Fam208a-null embryos revealed significantly delayed epithelial-mesenchymal transition (EMT) and failure to elongate the primitive streak, resulting in complete absence of node. Further, the transcription factor Eomes is down-regulated together with increased anterior Wnt3 expression, suggestive of incorrect A-P patterning. Our data indicates that Fam208a is indispensable during early mouse development. Keywords: Fam208a, Gastrulation, EMT, Axis formation, Embryo development

Inactivantion of Tgf- b signalling in vascular smooth muscle cells using tissue specific inducible Cre recombinase: impact on development and progression of aortic aneurysm in a mouse model of Marfan Syndrome Paola Braghetta1, Francesco Da Ros1, Dario Bizzotto1, Daniela Carnevale2, Giuseppe Lembo2, Giorgio Bressan1 1 Department of Molecular Medicine, University of Padua, Padua, Italy; 2Department of Angiocardioneurology and Translational Medicine, IRCCS Neuromed, Pozzilli (IS), Italy

223 Marfan Syndrome (MS) is a systemic disorder that affects skeletal, ocular and vascular systems with an incidence of 1 per 5000 individuals. Fibrillin-1 (FBN1) gene mutations are the major genetic causes of MS appearance and development and thoracic aortic aneurysm (AA) dissection is the major lifethreatening manifestation of the disease in humans. In this field particular attention has been directed to TGF-b signalling that is found deregulated in MS and is considered causative of AA appearance and development in both humans and MS mouse models. On the other hand an increasing number of papers indicates that TGF-b has a protective role in maintain vessel homeostasis. In this scenario our work aims to better define, with a genetic approach, the role of TGF-b in the appearance of aortic aneurysm in a MS mouse model, carrying a point mutation (Fbn1 +/C1039G) that mimics the most common one in human patients. For this purpose we abolished only in vascular smooth muscle cells the expression of Smad4, which binds phosphorylated receptors Smad2/3 upon TGF-b receptor stimulation triggering downstream response after nuclear translocation. We achieved it by crossing Smad4f/f mice with a transgenic mouse line expressing an inducible Cre recombinase under the control of Smooth Muscle Myosin Heavy Chain promoter (Smmhc-CreERT2). The double transgenic mouse line was then backcrossed in Fbn1+/C1039G genetic background. After activation of Cre recombinase with Tamoxifen administration and consequent inactivation of Smad4 allele in vascular smooth muscle cells, the development of aortic aneurysm and aortic vessel damage in both thoracic and abdominal aortic segments were followed by echocardiography and analysed by histological staining, respectively. Moreover, to investigate the role of the inflammatory process in progression and rupture of aortic aneurysm, the Fbn1+/C1039G; Smad4f/f ; Smmhc-CreERT2 mice were crossed with a mutant mouse line deficient for Interleukin 1 receptor (IL1R-/-). Comparative analyses of Fbn1+/C1039G; Smad4f/f; Smmhc-CreERT2 mice and Fbn1+/C1039G; IL1R-/-; Smad4f/f; Smmhc-CreERT2 mice revealed a slowdown of the progression of AA in the latter mouse, suggesting that TGF-b signalling is essential for maintaining aorta integrity in MS aneurysm and that it is necessary to control and downregulate inflammatory process, whose contribution in aortic aneurysm progression is not fully understood. Keywords: Marfan Syndrome, extracellular matrix, aortic aneurysm

Designing for success: the right CRISPR design strategies for the right experiment Leigh Brody, Victor Dillard, Neil Humphryes, Riley Doyle Desktop Genetics, 3P1 Cooper House, 2 Michael Road, London SW6 2AD, UK The importance of selecting high activity sgRNAs is most emphasized when designing CRISPR/Cas9-mediated genome engineering for the generation of transgenic animal models. However, CRISPR design is a complex multi-variate problem. The weight of each variable differs depending on the experiment under consideration. Current methods of designing CRISPR experiments are based on a single-variable, resulting in poor experimental outcomes.

123

224 We have developed an integrated bioinformatics software platform to provide a single tool for designing sgRNA guides, which considers a wide range of design variables, including focusing on minimizing off-target activity while achieving high activity at the target locus. Our current scoring methods were tested and validated using an sgRNA library of over 3500 sgRNAs in essential genes with a variety of predicted sgRNA activities and specificities. From this experiment, we also investigated current design ‘best-practices’ and were unable to corroborate some currently accepted sgRNA selection criteria, which demonstrates the need to constantly challenge and improve sgRNA design rules. By using the right design rules for the right experiment, common modes of failure can avoided. These rules have been integrated into the free DESKGEN web platform, now used by over 1500 researchers worldwide supporting over 20 different species. The platform is continuously maintained up to date with the latest CRISPR developments, ensuring the CRISPR research community benefits from the latest science, always. From the numerous experiments enabled by the DESKGEN platform to date, we can demonstrate key design improvements to maximise experimental outcome. Keyword: CRISPR

Rat resource and research center Elizabeth C. Bryda1, Hongsheng Men1, Yuksel Agca1, Aaron C. Ericsson1, James M. Amos-Landgraf1, Craig L. Franklin1, Randy S. Prather2 1

Department of Veterinary Pathobiology, College of Veterinary Medicine, University of Missouri, Columbia, Missouri, USA; 2Division of Animal Science, University of Missouri, Columbia, Missouri, USA The Rat Resource and Research Center (RRRC) was established in 2001 with funding from the National Institutes of Health. The goals of the RRRC are to 1) shift the burden for maintaining and distributing rat models from individual investigators to a centralized repository, and 2) provide the biomedical community with ready access to valuable rat strains/stocks and other related services that enhance the use of rats in research. Currently, the RRRC has close to 400 rat lines received through active recruitment of important rat models and donations from investigators. Upon importation of strains/stocks into the RRRC, sperm and embryos are cryopreserved to ensure against future loss of the model. The RRRC distributes live animals, cryopreserved sperm and embryos as well as rat embryonic stem (ES) cell lines. Quality control measures for all materials include extensive genetic validation and health monitoring. Due to high success rates with intra-cytoplasmic sperm injection, the RRRC uses sperm cryopreservation as a cost-effective method for banking large collections of single gene mutations and ensuring reliable recovery when models are requested. The RRRC has expertise in rat reproductive biology, colony management, health monitoring, genetic assay development/optimization, and isolation of germline competent ES cell lines from transgenic rats; our staff and researchers are readily available for consultation and collaborations. The RRRC has a number of fee-for-service capabilities such as a wide variety of genetic analyses, cytogenetic characterization including spectral karyotype analysis, strain rederivation, spermatozoa cryopreservation, isolation of specific

123

Transgenic Res (2016) 25:195–270 rat tissues and microbiota characterization. Our website (www.rrrc.us) allows user-friendly navigation and provides information about all strains/stocks, cell lines, model donation procedures, on-line ordering, lists of services, and protocols. Current research efforts include refinement of models, characterization of the rat microbiota and its influence on model phenotypes, and generation of new rat models using CRISPR/Cas9 technology. In addition to the RRRC, the University of Missouri is home to two other NIH-funded animal resources: the MU Mutant Mouse Resource and Research Center (MMRRC) and the National Swine Resource and Research Center (NSRRC) as well as the newly established MU Metagenomics Center (MUMC). Together, these highly collaborative groups provide a variety of animal modelrelated services across species to facilitate biomedical research. Keywords: resource centers, animal models, rat

Using IVF to generate mice not obtainable by natural mating Sheila Bryson, Seren Stedman, Laurence Cadalbert, David Stevenson, Farah Naz Ghaffar, Douglas Strathdee Beatson Institute for Cancer Research, CR-UK Beatson Laboratories, Garscube Estate, Switchback Road, Bearsden, Glasgow, G61 1BD, Scotland, UK Cryopreservation of mouse sperm is a relatively simple and routinely used method to archive genetically engineered mice. Sperm cryopreservation can be used to save space, reduces costs associated with maintaining mouse lines and facilitates the transport of mouse strains between research facilities. In vitro fertilization (IVF) with cryopreserved mouse sperm is commonly used for rescusciation and rederivations and can be used for colony expansion, because it has the potential to generate a large number of embryos simultaneously. Here we show that IVF can also be used, in combination with treatment of embryos with Cre recombinase, to generate knockout animals more quickly and efficiently than possible by natural matings. Furthermore the same techniques allows the generation of animals carrying knockout alleles which cannot easily be obtained by natural mating alone. Mutation in the Tafazzin (Taz) gene underlies Barth syndrome, a rare X-linked mitochondrial disease, resulting in a variety of symptoms including cardiomyopathy. Disrupting the Taz gene in mice also results in male sterility as a result of a defect in germ cell meiosis and a resultant failure to produce mature spermatozoa. To circumvent this phenotype we have generated a conditional knockout allele, resulting in founder chimeric mice which transmitted through germline. Although achieving germline transmission we could not generate offspring from male F1 mice as male mice carrying a Taz knockout allele are sterile. HTN-Cre is a cell-permeable Cre recombinase that can be used in vitro to catalyse recombination events in mouse cells and embryos. We hypothesized that using IVF in combination with HTN-Cre treatment of the resultant embryos would allow us to generate KO mice to study more quickly than natural mating. Floxed TAZ/+ females were superovulated, oocytes collected and fertilized in vitro with sperm from either a wt male (+/Y) or Floxed TAZ +/Y male sperm to generate an intercross. After overnight incubation to 2-cell embryos, HTN-cre

Transgenic Res (2016) 25:195–270 treatment was performed and resulting Cre-treated embryos implanted into a pseudopregnant recipient female mouse. This procedure allowed generation of knockout male at a more efficient rate then breeding, and also allowed generation of TazKO female mice.The IVF/HTN-Cre approach also allowed us to generate and analyse TazKO animals for study significantly faster and more efficiently than breeding with Cre expressing mice. Of particular note theHTN-Cre treatment allowed generation of homozygous TazKO female mice which would be impossible to generate by conventional breeding using our Cre-deletor mice. Keywords: Tafazzin, mouse, IVF, 2-cell embryos, HTN-Cre

Inducible colorectal cancer in a genetic porcine model ´ rnado´ttir1, Morten M. Callesen1, Sigrid S. A 2 Jannik E. Jakobsen , Søren Høyer3, Henrik Callesen4, Torben F. Ørntoft1, Claus L. Andersen1 & Lars Dyrskjøt1 1 Department of Molecular Medicine, 2Biomedicin, 3 Pathology & 4Animal Science, Aarhus University, Aarhus, Denmark

Colorectal cancer (CRC) is one of the most common malignancies, and no rodent model has adequately, fully mimicked muscle-invasive and metastasizing CRC. Porcine with high resemblance to human genomics, physiology, metabolism, and organ development is, however, anticipated as a primer candidate to emulate human CRC. The triple aim of this study is to (1) develop a transgene CRC porcine models (2) characterize the genotype and properties, and (3) study the carcinomas by comparing pathology, genomics, chromosomal aberrations, and transcription profiles to those of humans. Two transgene constructs were genomically stable integrated by Sleeping Beauty transposase into fetal porcine fibroblasts and cloned by hand by porcine somatic-cell nuclear transfer. The CRC construct is promoted by an inducible, ubiquitous CAG promoter expressing KRASG12D, CMYC, and SV40LT upon flippase recombination. The second construct contained the codon-optimized flippase (FlpO) under control by the Villin promoter to ensure tissue specific expression in the colon and rectum. The FlpO recombinase is linked to an estrogen-receptor type2 (ERT2) making the system inducible by 4OH-tamoxifen stimulation. The number of vector integrations per genome was determined by qPCR and Southern blotting. Characterization of resulting cells and pigs was made though quantification of transcription and translation by RTqPCR, RT-PCR, IVIS scanning, and Western blotting. The porcine CRC models were born June 2014, and their genotype showed several, stably integrated activator cassettes and a single oncogene cassette both with detectable mRNA levels. Cancer progress, continuously monitored through colonoscopy, has shown carcinoma in situ at this point. Moreover, FlpO mediated recombination has been validated in the CRC model in vitro, from colon/rectum organoids, and ex vivo using colon/rectum biopsies. We hypothesize that muscle invasive carcinomas and metastases are achievable and may help map the complete pathology from dysplasia to distal metastases. In conclusion, the porcine CRC model is within reach and may implicate a fuller understanding or cancer development and hopefully aid in diagnostics and therapy.

225 Keywords: Organoids

Colorectal

Cancer,

Porcine,

SCNT,

FlpO,

Efficient CRISPR/Cas9 genome engineering using zygotes and embryos derived from transgenic mice overexpressing Cas9 Alberto Cebrian-Serrano, Chris Preece, Daniel Biggs and Benjamin Davies Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, OX4 3AS, UK Genome manipulation in the mouse via microinjection of CRISPR/Cas9 site specific nucleases has allowed the production time for mouse model development to be significantly reduced and the technique is now being widely adopted as the method of choice by research and core service laboratories. The method is of particular interest with respect to modelling human genetic disease, since pathogenic genetic variants can be efficiently introduced into the mouse genome. For laboratories establishing these techniques, the exact mode of delivery of the CRISPR/Cas9 components needs to be optimized. Successful genome manipulation in the mouse has already been reported using Cas9 supplied by microinjection of a DNA construct, purified in vitro transcribed mRNA and recombinant protein. As an alternative to these options, we have investigated the feasibility of supplying Cas9 genetically and for this purpose have generated a line of transgenic mice which overexpresses wild-type Cas9 ubiquitously, through the use of a CAG-Cas9 transgene, targeted to the ROSA26 locus via recombinase mediated cassette exchange. Microinjection of fertilized zygotes prepared from transgenic Cas9 overexpressing females with guide-RNAs resulted in high numbers of mutant mice and whole embryo analysis revealed that the level of mutagenesis was found to be significantly higher when Cas9 was supplied genetically relative to exogenous supply. Genetic supply of Cas9 was able to mediate loss-of-function alleles by indel mutation, point mutation changes by homology directed repair and small deletions using two gRNAs. These preliminary results suggest that generation of a mutant mouse can now be reliably achieved in a single microinjection session, vastly reducing the animal cost and the timing of transgenic production. Keywords: CRISPR nuclease

Generation of various organ/tissue specific ERT2creERT2 transgenic mice In-Yeong Choi1, Woo-sung Hwang1, Kyung-Jun Uh1, Dae-Kee Lee2, Su-Cheong Yeom3 1

Designed Animal and Transplantation Research Institute, Institutes of Green Bio Science and Technology, Seoul National University, 1447, Pyeongchang-daero, Daehwa, Pyeongchang, Gangwon, 25354, Korea, 2Ewha Womans University, 52, Ewhayeodae-gil, Seodaemun, Seoul, 03760 Korea, 3Graduate School of International Agricultural Technology, Seoul National University, 1447, Pyeongchang-daero, Daehwa, Pyeongchang, Gangwon, 25354, Korea

123

226 The inducible tissue specific knockout mouse using cre-loxp and ERT2 systems has been widely used in gene function study. However, when a single ERT2 is applied to cre-loxp system, non-specific cre recombinase expression could occur. Due to combination of ERT2 with cre recombinase is weak, so regulation of cre recombinase expression by ERT2 might be not perfect. Thus inducible system with double ERT2 bond was developed, and it showed more strong regulation for cre recombinase expression. In this study, we produced three kinds of inducible tissue specific transgenic mice using ERT2-cre-ERT2 system and confirm function of them. To generate mice with liver, tumor stem cell and paneth cell specific cre expression, ALB, Dclk1 and Defa6 promoter were selected for generating ERT2creERT2 transgenic mice. These models have not been developed with ERT2-cre-ERT2 system. Constructs were prepared using pCAG-ERT2-cre-ERT2 vector (addgene Plasmid #13777) as backbone. The promoters regions were switched by restriction enzyme cloning. To confirm the function of designed transgenic constructs, we used the pCMV-loxp-EGFP-loxp-RFP plasmid as reporter system, which plasmid might express RFP signal responding to cre recombinase. We conducted co-transfection reporter plasmid with each plasmid to HepG2 (Alb) and HCT116 (Dclk1, Defa6) cell. After treating 10uM tamoxifen at co-transfected cell for 48 h, RFP signal could be detected. To prepare injectable linear DNA, the plasmids were cut at Notl/Kpnl sites. These linear DNA size were 6.7 Kb in Alb, 9.2 Kb in Dclk1 and 10.5 Kb in Defa6 respectively. After conducting microinjection to pronucleus with 2 ng/ll linear DNA to FVB mouse, embryo transfer was conducted. Founder mice were confirmed by PCR, germline transmission test was followed. Then, to confirm the in vivo function of tissue specific cre recombinase activity, Rosa26 reporter mouse were used (Jax. 003504). Briefly, after injection of tamoxifen to dam via IP route, fetuses were harvested at E13.5 and whole mount X-gal staining was performed. After washing cand fixation, fetuses were stained with X-gal stain solution at 37 C for 3 h and were fixed with 10 % neutral buffered formalin at 4 C overnight. We could confirm tissue specific cre recombinase activity by visualization. In summary, we generated three kinds of ERT2creERT transgenic mice. These mice could be useful for gene function study for each target organ. Keywords: ERT2-cre-ERT2, alb, dclk1, defa6, cre recombinase cre mouse

Promoting the efficiency of CRISPR/Cas9-mediated knock-in mice through homology-directed repair via poly(A) tailing and Scr7 treatment Tzu-Yu Chou1, Pi-Fang Tsai1, Yi-Fang Tu2 and Ching-Yen Tsai1 1

Transgenic Core Facility, Inst. of Molecular Biology, Academia Sinica, Taipei, Taiwan; 2Department of Pediatrics, National Chang Kung University Hospital, College of Medicine, National Chang Kung University, Tainan, Taiwan

123

Transgenic Res (2016) 25:195–270 The CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 system is a powerful tool in introducing double strand break (DSB), which facilitates indel (insertion or deletion) mutation via non-homologous end joining (NHEJ) or precise incorporation of exogenous DNA fragments into target loci through homologous recombination (HR). The efficiency of HR relies on the ability of Cas9 in inducing DSB and the competition between non-homologous end joining (NHEJ) and homology directed-repair (HDR). In this study, the efficiency of Cas9 WT was compared to Cas9 nickase mutant (D10A) in their ability to induce DSB in a defined concentration in Cas9 mRNA/gRNAs injected mouse zygotes. Varied length of poly(A) tail were added to Cas9WT and Cas9D10A mRNA to clarify whether the stability of Cas9 mRNA affected their efficiency. The ratio of NHEJ were similar between Cas9WT and Cas9D10A with shorter or longer poly(A) tail (52.0 vs. 55.8 % in Cas9WT and 50.0 vs. 47.3 % in Cas9D10A, respectively). However, an elevated percentage of bi-allelic HDR was observed in group using Cas9WT with longer poly(A) tail (46.7 vs. 100 %). To further study the methods in enhancing HDR, we investigated whether Scr7, the DNA ligase IV inhibitor, would promote HDR through inhibiting NHEJ in mouse embryos. Scr7 was added into the injection solution, M2, and KSOM medium with different combinations. The ratio of HDR was significantly increased via pre-culture of mouse zygotes in Scr7/M2 before microinjection followed by post-culture of embryos in Scr7/KSOM overnight after conducting injection. Our preliminary data showed Cas9WT and Cas9D10A had similar ability in inducing DSB in a defined RNA concentration and poly(A) length, and the treatment of Scr7 in both precultured and post-cultured media is an essential step in promoting HDR in Cas9 mRNA/gRNAs injected mouse zygotes. Keywords: CRISPR/Cas9, poly(A) tail, Scr7

Applying Digital Droplet PCR (ddPCR) to screen for aneuploidy and gene targeting events in embryonic stem cells in a high-throughput pipeline Gemma F. Codner1, Loic Lindner2, Adam Caulder1, Marie Wattenhofer-Donze´2, Adam Radage1, Annelyse Mertz2, Benjamin Eisenmann2, Joffrey Mianne 2, Edward P. Evans1, Colin V. Beechey1, Marie-Christine Birling2, Yann Herault2, Guillaume Pavlovic2,*, and Lydia Teboul1 1 The Mary Lyon Centre, Medical Research Council, Harwell Science and Innovation Campus, Oxon, OX11 0RD, UK; 2 PHENOMIN Institut Clinique de la Souris, ICS; GIE CERBM, CNRS, INSERM, University of Strasbourg, 1 rue Laurent Fries, BP 10142, 67404, Illkirch Cedex, France

The Mary Lyon Centre (MLC) at MRC Harwell provides the global research community with a wide variety of tools and services for mouse functional genomics. As part of the International Mouse Phenotyping Consortium (IMPC), MRC Harwell is charged with the conversion of embryonic stem (ES) cells bearing targeted mutations into transgenic mice.

Transgenic Res (2016) 25:195–270 Karyotypic integrity is essential for the successful germ line transmission of mutated alleles in ES cells. However, classical methods for the identification of aneuploidy involve cytological analyses that are both time consuming and require rare expertise to identify mouse chromosomes. Using cytological analysis data gathered from over 1500 ES clones, we found that the germ line transmission (GLT) efficiency of clones is compromised when over 50 % of cells harbour chromosome number abnormalities. In JM8 cells, chromosomes 1, 8, 11 or Y displayed copy number variation most frequently, whilst the remainder generally remain unchanged. We developed protocols employing droplet digital polymerase chain reaction (ddPCR) to accurately quantify the copy number of these four chromosomes, allowing efficient triaging of ES clones prior to microinjection. We verified that assessments of aneuploidy, and thus decisions regarding the suitability of clones for microinjection, were concordant between classical cytological and ddPCR-based methods. Finally, we improved the method to include assay multiplexing so that two unstable chromosomes are counted simultaneously (and independently) in one reaction, to enhance throughput and further reduce the cost. We validated a PCR-based method as an alternative to classical karyotype analysis. This technique enables laboratories that are non-specialist, or work with large numbers of clones, to precisely screen ES cells for the most common aneuploidies prior to microinjection to ensure the highest level of germ line transmission potential. This method can be applied to any other experiments that require accurate analysis of the genome for copy number variation (CNV) e.g. detection of transgene copy number following pronuclear injection. The application of this method allows early exclusion of aneuploid ES cell clones in the ES cell to mouse conversion process, thus improving the chances of obtaining germ line transmission and reducing the number of animals used in failed microinjection attempts. Keywords: Aneuploidy, karyotype, droplet digital PCR, cell culture, copy counting, multiplex assay, ES cells

A low cost and high through-put mouse rederivation SOP using sperm cryopreservation and IVF Mitra, Cowan, Mariette Ouellet, Andreá Barrios Service d’Animalerie, Centre de recherche du Centre hospitalier de l’Universite´ de Montreál, Montreál, Canada Vivariums house and care for all our experimental animals and help provide a proper, safe, and humane environment for our research animals. The ever-increasing use of GM models in research has led Universities to build larger vivariums that are often designed to consolidate several smaller vivariums. One of the biggest challenges during a move to a new vivarium is that animals housed in older facilities do not meet the stricter health status implemented in these newly built facilities. Recently, two new vivariums were built to support two main research centres in Montreál, Canada: the Centre de Recherche du Centre Hoˆspitalier de l’Universite´ de Montreál and the McGill University Health Center. This move involved consolidating animals housed in several smaller vivariums, and ensuring the stricter health status of the new facilities would meet the current and future needs of the scientists.

227 A large-scale rederivation project (165 lines total) was designed to transfer and repopulate the new vivariums. Two main concerns were considered in designing an optimal rederivation approach: 1) minimizing the cost and impact on the researchers’ mouse colonies and 2) overcoming the lack of any quarantine space available at either institute. Our transgenic laboratory created an efficient, low cost and high through-put rederivation SOP by combining several of the newly published sperm cryopreservation and In Vitro Fertilization (IVF) protocols. This rederivation SOP allows us to cryopreserve the sperm of all mouse lines in their original vivarium, thus avoiding the transportation of contaminated animals to the new vivarium. In addition, this approach provides the added benefit of having all mouse lines cryopreserved and protected against future loss due to infection or lab accidents. We produced fertilized embryos by IVF for largescale embryo transfers in our transgenic facility. Following the individual testing of all rederived lines using the PRIATM (PCR Rodent Infectious Agent) Panel service offered by Charles River laboratories, animals were used to populate the newly built vivariums at the CRCHUM and MUHC research institutes. As of December 2015, 2 years after the CRCHUM move, and 10 months after the MUHC move, no pathogens have been detected in any of the rederived lines. We believe this rederivation SOP can easily be implemented at any Transgenic facility and can be useful for either small scale or large-scale rederivation projects that are undertaken either due to a pathogen outbreak or move to a new facility with a higher health status. Keywords: sperm cryopreservation, embryo cryopreservation, IVF, high through-put mouse rederivation

Influences of the gut microbiota on animal models of multiple species Daniel J. Davis, Susheel B. Busi, Marcia L. Hart, Catherine H. Gillespie, James M. Amos-Landgraf, Craig L. Franklin, Aaron C. Ericsson, Elizabeth C. Bryda Department of Veterinary Pathobiology, University of Missouri, Columbia, USA The gut microbiota (GM) represents a dynamic microbial community whose collective set of genes encodes a vast array of functions. These microbes play a major role in many physiological processes within the host and are essential for survival. Ongoing research suggests that the GM is not only involved in gut physiology but may also have significant effects on many other aspects of health and disease. However, many researchers are unaware of the impact the GM can have on their animal models, which can hinder reproducibility. Here, we demonstrate the ability of the GM to influence a broad array of phenotypes of different animal models in multiple species. First, we show that isogenic mice with divergent GM exhibit different neurobehavioral phenotypes as assessed by anxiety- and depression- related behavior tests. Moreover, we demonstrate that the GM mitigates anxiety-related behavior and is required for characteristic stress responses in zebrafish larvae. Lastly, we provide two examples as proof-of-principle that Complex Microbiota Targeted Rederivation (CMTR) has the potential to

123

228 influence model phenotypes in a GM-dependent manner. Specifically, rederivation of the IL-10-/- mouse model of inflammatory bowel disease (IBD) using surrogate dams harboring different GM results in varying disease severity associated with the acquired GM. Similarly, genetically identical APC-mutant Polyposis in Rat Colon (Pirc) rats rederived in surrogate dams with three distinct GM profiles developed colorectal cancer with significant differences in tumor burden, in a GM-dependent manner. These findings underscore how changes in GM that can occur during rederivation or model development may contribute to phenotypic differences of many different animal models. The influence of the GM on animal models can thus be considered not only as a potential hindrance to model reproducibility, but also as a tool to identify which microbes might be investigated further as potential diagnostic or therapeutic modalities. Keywords: Microbiota, microbiome, animal models, rederivation

EMMA: The European mouse mutant archive Marıá Jesu´s del Hierro1, Julia Fernańdez1, Marta Castrillo1, Isabel Martıń-Dorado1, Lluı´s Montoliu1 , Michael Hagn2, Fabio Mammano3, Yann He´rault4,10, Steve Brown5, Brun Ulfhaake6, Jocelyne Demengeot7, Helen Parkinson8, Ramiro Ramı´rez-Solis9, George Kollias11, Radislav Sedlacek12, Raija Soininen13, Thomas Ru¨licke14, Jos Jonkers15, Fuad Iraqi16, Martin Hrabe´ De Angelis2 1 Centro Nacional de Biotecnologia (CNB-CSIC), Madrid, Spain; 2Helmholtz Zentrum Mu¨nchen, Institute of Experimental Genetics (HMGU-IEG), Munich, Germany; 3 CNR Campus ‘‘A. Buzzati-Traverso’’ in Monterotondo, Italy; 4Centre National de la Recherche Scientifique, Transgeńe`se et Archivage d’Animaux Mode`les (CNRSTAAM), Orleans, France; 5Medical Research Council, Mammalian Genetics Unit (MRC-MGU), Harwell, UK; 6 Karolinska Institutet, Department of Cell and Molecular Biology (KI-CMB), Stockholm, Sweden; 7Fundaçao˜ Calouste Gulbenkian, Instituto Gulbenkian de Cieˆncia, Oeiras, Portugal; 8European Molecular Biology Laboratory, European Bioinformatics Institute (EMBL-EBI), Hinxton, UK; 9Genome Research Limited, Wellcome Trust Sanger Institute (WTSI), Hinxton, UK; 10GIE-Centre Europeén de Recherche en Biologie et en Me´decine, Institut Clinique de la Souris (GIE-CERBM-ICS), Illkirch/Strasbourg, France; 11 B.S.R.C. ‘‘Alexander Fleming’’, Vari/Athens, Greece; 12 Institute of Molecular Genetics (IMG), Prague, Czech Republic; 13Biocenter Oulu, Oulu, Finland; 14Biomodels Austria (BIAT), Vienna, Austria; 15Nederlands Kanker Instituut (NKI), Amsterdam, The Netherlands; 16Tel Aviv University (TAU), Tel Aviv, Israel

The European Mouse Mutant Archive (EMMA) is a non-profit repository for the collection, archiving (via cryopreservation) and distribution of relevant mutant strains essential for basic biomedical research. The EMMA network is currently formed by a partnership of 16 nodes in 13 different countries. EMMA is supported by the partner institutions, national research programmes and by the EC’s FP7 Capacities Specific Programme, through the INFRAFRONTIER- I3 EC grant (2013–2016),

123

Transgenic Res (2016) 25:195–270 where the production of new transgenic lines, associated phenotyping activities, cryopreservation and archiving tasks are jointly addressed by a larger group of partners, 23 scientific partners from 15 European countries and Canada. EMMA’s primary objective is to establish and manage a unified repository for maintaining biomedically relevant mouse mutants and making them available to the scientific community. Therefore, EMMA archives mutant strains and distributes them to requesting researchers. At present, EMMA holds more than 5000 mouse strains, corresponding to transgenic mice, different type of mutants, gene-traps, knock-ins, knock-outs from the scientific community, and also including some targeted alleles from Deltagen, Lexicon and IKMC/IMPC projects. EMMA represents the third largest archive world-wide for mouse lines of interest in Biomedicine. EMMA’s technology development programme is focusing on further improving sperm cryopreservation methods by implementing CARD-University of Kumamoto protocols, setting ICSI protocols, implementing and developing techniques to allow the shipment of refrigerated, unfrozen mouse embryos and epididymis, or frozen sperm in dry ice, without the need of using liquid nitrogen, and the use of non-surgical solutions for embryo transfer. EMMA also hosts cryopreservation courses, at MRC-Harwell and at CNR-Monterotondo, in collaboration with The Jackson Laboratory, to promote the use and dissemination of frozen embryos and spermatozoa. All EMMA procedures and all required information to deposit or request mouse lines from EMMA are easily available through the INFRAFRONTIER web site at: www.infrafrontier.eu. Keywords: archive, cryopreservation, embryo, sperm, IVF, repository, transgenic, knockout

A fast, easy and reliable method for the generation of KO mice using CRISPR/Cas9 by a single person: a small laboratory perspective Fabien Delerue & Lars Ittner Transgenic Animal Unit (TAU), Mark Wainwright Analytical Centre, University of New South Wales (UNSW), Sydney, Australia The recent development of engineered endonucleases such as Zinc Finger Nucleases (ZFN), Transcription activator-like effector nucleases (TALEN), and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR/Cas9) offer easy, flexible, and fast alternatives to ES-Cell based gene targeting, a lengthy process that requires substantial manpower. Thanks to multiple advantages such as ease of synthesis and unprecedented efficiency, the CRISPR system superseded its predecessors and became a popular method for genome editing. As CRISPR is considered a ‘‘disruptive technology’’, which is a technological innovation that creates a paradigm shift, we examined the use of CRISPR from a small laboratory perspective. More specifically, we assessed the possibility for a single person to perform the entire procedure of speedy generation of KO mice without any external assistance. By developing a simple strategy based on the non-cloning method to generate guide RNAs, and systematically coinjecting 2 guides targeting genomic sequences distant only from few base pairs, we managed to streamline the process, allowing one to reliably generate KO mice on their own.

Transgenic Res (2016) 25:195–270 Using this procedure, we by-passed the pre-test of cleavage efficiency of the guides, and identified successful gene deletion by direct sequencing of PCR products, avoiding the screen of multiple alleles modifications by TOPO cloning or the like. We systematically obtained high efficiency gene KO (up to 100 % homozygous pups) and a single person can now generate easily identifiable mouse KO lines by performing the complete process, from design of the guides to microinjection and identification of founders in about 7 weeks. Keywords: CRISPR, KO mice, Non cloning method, coinjection of SgRNAs

Comparison of conventional & cloning free methods of generating CRISPR/Cas mutant mice Paul S Devenney1, Derya D Ozdemir2, Laura A Lettice1, Nick D Hastie1, Peter Hohenstein2 1

IGMM University of Edinburgh, Edinburgh, UK; 2Roslin Institute University of Edinburgh, Edinburgh, UK The recent development of the Clustered Regularly Interspaced Short Palindromic Repeat/CRISPR Associated Protein (CRISPR/Cas) genome editing system has allowed rapid and efficient generation of knockout mice through the direct editing of the genome in mouse zygotes in vivo. While the CRISPR/Cas system is highly effective in introducing random mutations into the genome via the Non Homologous End Joining pathway (NHEJ), it’s efficiency is, in general, more limited when it comes to precise gene modification via the Homology Driven Repair (HDR) pathway. The CRISPR/Cas system most commonly used in the genome editing field consists of Cas9 nuclease and an artificially generated chimeric sgRNA. However, when the CRISPR/Cas system was first described, it consisted of Cas9 nuclease and two small RNAs rather than a single chimeric RNA. It was recently hypothesised that the use of these two small RNAs (crRNA; which acts as a guide for the Cas9 complex and tracrRNA; which forms a ribonucleoprotein with the Cas9 nuclease after binding to the crRNA) rather than a single chimeric sgRNA may improve efficiency of the generation of mutant mice through precise gene editing via the HDR pathway. Furthermore, these components can be synthetically generated and thus provide a cloning free method of genome editing. Here we explore the use of both the traditional CRISPR/Cas system and the cloning free system. Keywords: CRISPR/Cas, Cloning free

Using human frameshift mutations to dissect the pathobiology of ALS Anny Devoy1, Julian Jaeger1, Heesoon Park1, Abraham Acevedo-Arozena2, Elizabeth Fisher1 1 Dept of Neurodegenerative Disease, UCL Institute of Neurology, London, UK; 2MRC Mammalian Genetics Unit, Harwell, Oxfordshire, UK

229 Background: FUS is an ALS-causative gene that plays key roles in RNA metabolism (1, 2). Frameshift mutations have the benefit of creating novel C-terminal peptide sequences which can be used as naturally occurring protein tags. We have modified the endogenous mouse Fus locus by a) humanizing the 30 end and introducing a human ALS mutation, ‘FUS delta140 and now b) humanising the entire Fus locus and soon will be introducing the mutation Q519Ifs using CRISPR. The delta 14 mutation is a splice junction point mutation in the second to last exon of FUS—resulting in onset of ALS at the age of 20 years and disease duration of 22 months(3). The Q519Ifs mutation is a 4 bp deletion in the last exon of FUS—resulting in onset of ALS at the age of 18 years and disease duration of 6 months (4) Both Delta14 and Q519Ifs mutations share the same C-terminal nonsense peptide sequence. Methods and Results: The 30 humanisation of endogenous mouse Fus (FUS Delta14), was achieved with standard knockin techniques, using the C57BL6/N ESC line JM8-F6. The full genomic humanisation of Fus was achieved with standard knock-in techniques, using the 129/SvJ hybrid ESC line R1. To investigate the specific role of the mutant FUS protein we have developed a novel antibody that specifically recognises the frameshift nonsense peptide. This antibody is being used to identify cellular localisation as well as protein–protein and protein-RNA interactions. Conclusion: We have developed novel models by (a) modifying the endogenous Fus locus in mouse so that our modified gene is tightly regulated in a physiologically relevant manner and (b) choosing human mutations that naturally create a novel epitope, allowing for mutant-specific analysis and further filtering of whole transcriptome (and proteome) datasets. By combining these approaches we can best identify the changes from loss and gain of function of FUS that are most relevant to ALS and also increase our general understanding of FUS biology. Acknowledgements: Funding Is provided by the Medical Research Council (MRC), the Motor Neurone Disease Association (MNDA) and the ALS Association (ALSA). References: 1.Kwiatkowski TJ, Bosco DA, Leclerc AL, et al. Mutations in the FUS/TLS gene on chromosome 16 cause familial amyotrophic lateral sclerosis. Science. 2009;323(5918): 1205–1208. doi:10.1126/science.1166066. 2.Lagier-Tourenne C, Cleveland DW. Rethinking ALS: the FUS about TDP-43. Cell. 2009;136(6):1001–1004. doi: 10.1016/j.cell.2009.03.006. 3.DeJesus-Hernandez, M. et al. (2010) De Novo Truncating FUS Gene Mutation as a Cause of Sporadic Amyotrophic Lateral Sclerosis. Human Mutation 31, E1377–E1389 4.Baümer D, Hilton D, Paine SM, Turner MR, Lowe J, Talbot K, Ansorge O. Juvenile ALS with basophilic inclusions is a FUS proteinopathy with FUS mutations. Neurology. 2010Aug 17;75(7):611–8. Keywords: ALS, FUS, Mouse, Frameshift mutation

123

230


Exclusive germline transmission through mouse chimeras from sterile male blastocysts

Keywords: Genetics, inbred mice, differentiaion of substrains, STR markers, speed congenics, genetic background determination

John Dixon1, Frank Koentgen1, Jiangwei Lin2, Markella Katidou2, Isabelle Chang2, Mona Khan2, Jacqui Watts1 & Peter Mombaerts2*

The neglected Y-chromosome of inbred mice

Ozgene Pty Ltd, PO Box 1128, Bentley, WA 6983, Australia; 2 Max Planck Research Unit for Neurogenetics, Max-von-Laue-Strasse 4, 60438 Frankfurt, Germany

Peter Dobrowolski1, Olaf Gelsen1, Melina Fischer2

We have developed a method to generate mouse chimeras whereby males transmit exclusively the genome of injected embryonic stem cells to their offspring. The goGermline technology is based on blastocysts from Tsc22d3 floxed females mated with ROSA26-Cre males, a cross that produces males that are sterile due to a cellautonomous defect in spermatogenesis. We validated the method for gene- targeted clones from commonly used ES cell lines: Bruce4, E14, and JM8A3. Keywords: embryonic stem cell, microinjection, sterility, Tsc22d3, Gilz

A set of polymorphic STR (short-tandem-repeat) markers was established for the analysis of the Y- chromosome of inbred mice. Using these markers in multiplex PCR, unique Y-haplotypes can be identified for individual inbred strains. Moreover, the discriminatory power of this technique is very high and thus enables even the differentiation of C57BL/6 substrains. Furthermore, specific autosomal mutations can serve as markers to differentiate between C57BL/6 sub-strains. The mutation Crb1rd8 is present in all C57BL/6N sub-strains, a deletion of exons 7–11 in the Nnt gene is typical for C57BL/ 6JTjl, C57BL/6JCrl and C57BL/6JRj, and a mutation of Snca is unique for C57BL/6JOlaHsd. The combination of these three specific autosomal markers with Y-chromosomal haplotypes enables a rapid background check of C57BL/6 transgenic mice. By testing transgenic animals from a number of German scientific institutions using marker genes Crb1, Nnt and Snca, a C57BL/6-based genetic background has been verified in most cases. Surprisingly, in almost 50 % of the investigated strains the Y-chromosome could not be assigned to any known Y-haplotype of C57BL/6. For many of the transgenic strains the pedigree of their generation could not be reconstructed. Nevertheless, our findings indicate that during the breeding process recipient Y-chromosome had not been crossed in. As a result the Y-chromosome of the original donor strain was still present. As in the past no appropriate screening system was available, the problem of remaining donor strain Y-chromosome has been neglected until now. Our conclusion is that more attention should be paid to the Y-chromosome during the breeding process in order to minimize residual donor DNA. Keywords: C57BL/6, inbred mice, STR-markers

New prospects for genetic analysis and characterization of inbred mice Peter Dobrowolski1, Olaf Gelsen1, Melina Fischer2, Ronald Naumann3 GVG Genetic Monitoring GmbH, Leipzig, Germany; 2 Genolytic GmbH, Leipzig, Germany; 3 Max Planck Institute of Molecular Cell Biology and Genetics, Dresden, Germany Introduction: Unclear or misclassified genetic background of laboratory rodents or a lack of strain awareness causes a number of difficulties in performing or reproducing scientific experiments. Until now, genetic differentiation between strains and substrains of inbred mice has been a challenge. Methods: A set of highly informative STR (Short Tandem Repeats) markers covering the 19 autosomes as well as X and Y chromosomes have been identified. Several strains and substrains of C57BL/6 have been analyzed by employing these markers using multiplex PCR and capillary electrophoresis. Results: The results indicate that strains and substrains can be differentiated with a large number of informative markers: Up to 50 % out of more than 230 markers differ between C57BL/ 6 J and N substrains. Individuals of the same substrain, provided from different commercial breeders exhibit considerable differences in their STR profiles. Siblings within inbred strains can be differentiated and allocated to parent couples. No individual has proven to be genetically identical with one another. The large number of informative markers provides the opportunity for background determination of strains or substrains and individuals of unknown pedigree as well as speed congenics projects for back-crossing to well defined genetic background. Outlook: Which level of genetic variability is acceptable and required to guarantee validity and reproducibility of experiments, in order to control cost and effort, within the breeding process, still needs to be defined.

123

1 GVG Genetic Monitoring GmbH, Leipzig, Germany, Genolytic GmbH, Leipzig, Germany

2

Improving the injection procedure for manipulating the chicken embryo Shahin Eghbalsaied, Ahmadreza Rahaee, Saeedeh Moghaddasi, Zohreh Hajihoseini Transgenesis Center of Excellence, Isfahan branch, Islamic Azad University, Isfahan, Iran Modifying the chicken genome by transfection or infection need to remove some parts of the egg shell, spend a long time to find the embryo, conduct the micromanipulation, and seal the egg shell which all decreased the embryo survival rate. Therefore, any effort in developing a more straight forward protocol for modifying the chicken genome can be of very high importance. In this study, the in ovo injection procedure for Morpholino-like sequences, compound oligonucleotides, was evaluated to knock

Transgenic Res (2016) 25:195–270 down the CYP-19A gene in chicken embryos. First, the egg albumen nuclease effect on an oligonucleotide, which was designed to be complemented with the aromatase mRNA, was assessed. The oligonucleotide was completely resistant to the nucleases. Then, the in ovo injection site of oligonucleotide was evaluated to see if we can minimize the handling steps of in ovo injection. Since the aromatase expresses after day-3 of chicken embryo incubation, the oligonucleotide injection site was seek at day-3 egg/embryo. If we could translocate the embryo under the air sac of the egg, the genetic modification reagent could be injected through a small tiny hole on the width end of the egg either in the beneath of the shell membranes or between egg shells, in the air sac. It has been evident that keeping the egg upright facilitates the embryo to move upward to the shell beneath. We incubated the fertilized eggs by putting the widthend upright while turning off the rotation through the first three days of incubation. The blind injection was carried out in the inter-air sac injection, under-air sac injection, and/or inter- and under air sac, without opening the shell. Among the injection sites, co-injection of the oligonucleotides under and inter the air sac associated with the lowest mortality. However, the embryo survival rate was quite low, ranging from 40 to 60 % while the majority of the dead embryos were attached to the egg shell and the shell membranes. Then, we compared a three-day vs. one-day rotation off which started at day-0 and day-2, respectively. Our results indicated that one-day rotation-off is enough for the embryo translocation to the air sac beneath while it substantially improved the embryo survival, ranging from 75 to 80 %. In overall, this study revealed that in ovo injection of oligonucleotides can be efficiently carried out by making a small tiny hole on the egg shell followed by a blind injection under the air sac. Keywords: Chicken, embryo, modification, morpholino, transgenesis

Generation of induced pluripotent stem cells from human umbilical cord vein mesenchymal stem cells Fardin Fathi, Mehdad Abdi, Sonia Zare, Seyed hadi Anjamrooz, Mohammad Jafar Rezaei, Jalal Rostamzadeh Cellular and Molecular Research Center, Kurdistan University of Medical Science, Sanandaj, Iran Background and Aim: The aim of this study is to generate induced pluripotent stem cells from human umbilical cord vein mesenchymal stem cells with plasmid vector. Materials and methods: Mesenchymal stem cells in this research were extracted from the human umbilical cord vein wall with thpe IV collagenase enzyme and then were cultured. These cells were transfected with plasmid vector which carried selfrenewal transcription factors OCT4 and SOX2 with electroporation.After 9 days the induced pluripotent stem cells like colonies were observed. The nature of obtained cells were evaluated with Immionocytochemistry and Alkalin phosphatase assessments to determine expression of embryonic stem cells markers. Results: Immionocytochemical analysis showed that these cells express the pluripotency markers OCT4, SSEA4, TRA1-

231 60, TRA1-81, and were also possitive for Alkalin Phosphatase enzyme. Conclusion: This study revealed that transient expression of self renewal genes OCT4 and SOX2 can result in induced pluripotent stem cells like colonies from Umbilical cord vein mesenchymal stem cells. Keywords: Embryonic stem cells, Umbilical cord vein mesenchymal stem cells, Reprogramming, selfrenewal genes

RHEB1 expression in embryonic and postnatal mouse Lev M. Fedorov1,3, Qi Tian1, James L. Smart4, Joachim H. Clement6, Yingming Wang1, Alex Derkatch1, Harald Schubert3, Michael V. Danilchik5, Daniel L. Marks2 1

Transgenic Mouse models Shared Resource, Oregon Health & Science University, Portland, OR, USA; 2 Department of Pediatrics, Oregon Health & Science University, Portland, OR, USA; 3 Friedrich-SchillerUniversity, Jena, Germany; 4George Fox University, Newberg, OR, USA; 5 Department of Integrative Biosciences, Oregon Health & Science University, Portland, OR, USA; 6 Department of Hematology & Oncology, Jena University Hospital, Jena, Germany RHEB1 (ras homolog enriched in brain) is a member within the superfamily of GTP–binding proteins encoded by the RAS oncogenes. RHEB1 is located at the crossroad of several important pathways including the insulin-signaling pathways and thus plays an important role in different physiological processes. To understand better the physiological relevance of RHEB1 protein, the expression pattern of RHEB1 was analyzed in both embryonic (at E3.5–E16.5) and adult (one month old) mice. RHEB1 immunostaining and X-gal staining was used for wild type and Rheb1 gene trap (GT) mutant mice respectively. These independent methods revealed similar RHEB1 expression patterns during both embryonic and postnatal development. Ubiquitous uniform RHEB1/b-Gal and/or RHEB1 expression was seen in preimplantation embryos at E3.5 and post-implantation embryos up to E12.5. Between stages E13.5 and E16.5, RHEB1 expression levels became complex: in particular, strong expression was identified in neural tissues, including the neuroepithelial layer of the mesencephalon, telencephalon and neural tube of CNS and dorsal root ganglia. In addition, strong expression was seen in certain peripheral tissues including, heart, intestine, muscle and urinary bladder. Postnatal mice have broad spatial RHEB1 expression in different regions of the cerebral cortex, subcortical regions (including hippocampus), olfactory bulb, medulla oblongata and cerebellum (particularly in Purkinje cells). Significant RHEB1 expression was also viewed in internal organs including the heart, intestine, urinary bladder and muscle. Moreover, adult animals have complex tissue- and organ-specific RHEB1 expression patterns with different intensities observed throughout postnatal development. Its expression level is in general comparable in CNS and other organs of mouse. Thus, the expression pattern of RHEB1 suggests that it likely plays a ubiquitous role in development of the early embryo with more tissue-specific roles in later development. Keywords: Rheb1 gene, Expression pattern, Immunohistochemistry, X-gal staining, Gene trap, Embryos, Adult mice

123

232 Testing the CARD ultra-superovulation IASe protocol for EMMA archiving purposes Julia Fernańdez1,2, Marıá Jesu´s del Hierro1, Marta Castrillo1, Isabel Martıń-Dorado1, Toru Takeo3, Naomi Nakagata3 and Lluı´s Montoliu1,2 1 Spanish EMMA node at the National Centre for Biotechnology (CNB-CSIC) and 2CIBERER-ISCIII, Madrid, Spain; 3CARD-University of Kumamoto, Japan

The European Mouse Mutant Archive (EMMA) is a non-profit repository for the collection, archiving (via cryopreservation) and distribution of relevant mutant strains essential for basic biomedical research. The EMMA network is currently formed by a partnership of 16 nodes in 13 different countries. The CNB-CSIC in Madrid hosts the Spanish EMMA node. We have decided to test the most recent CARD ultra-superovulation IASe protocol developed by Takeo and Nakagata (PLoS One 2015; May 29;10(5):e0128330). The IASe protocol combines the use of anti-inhibin serum (IAS), produced in goats, with equine-derived chorionic gonadotropin hormone (eCG), known as IASe superovulation protocol. The use of IASe on young C57BL/6 mouse females has been reported to result in about 100 oocytes per female, a number about five times higher than the figures obtained with standard superovulation protocols, based on the use of PMSG/hCG hormones. Such impressive high yields might be extraordinary relevant for mouse international archives, such as EMMA, where the cryopreservation of many mutant mouse lines is regularly achieved. The higher number of oocytes that can be obtained per female with the IASe protocol would allow using less animals, in line with the recommendations included in all current animal welfare legislations. Therefore, animal and cost savings appear to be associated with this innovative superovulation protocol. At the CNB-CSIC, and upon receiving IASe samples kindly provided by CARD, we have tested the use of IASe ultra-superovulation protocol for IVF purposes, one of the routine techniques we apply in our EMMA archive. We have used the oocytes derived from the ultra-superovulation in combination with freshly-obtained and frozen mouse sperm, both for wild-type and genetically-engineered mouse lines, using both inbred and outbred mouse strains. We will report our findings in this presentation. Keywords: superovulation, hormone, IVF, oocyte, inbred, outbred, antiserum

Harnessing The Power Of CRISPR: Generation of a diverse set of mouse models through direct microinjection of mouse embryos Michael Flores, Gary Kucera, Meilang Flowers, Cheryl Bock, Scott Soderling Duke Cancer Institute Transgenic Core Facility, Duke University, Durham, US The Duke Cancer Institute Transgenic Core facility has been adapting CRIPSR technology for providing advanced mouse models to Principal Investigators across a broad range of scientific disciplines. In the brief time we have been using this

123

Transgenic Res (2016) 25:195–270 technology, we have generated a variety of genetically modified mice that include indels for loss of function alleles (N = 6), single nucleotide changes (N = 4), non-sequential multiple nucleotide changes (N = 1), a targeted 1 kb deletion (N = 1), and a knockin of GFP (N = 1). Further, we have been exploring the use of Scr7 as an inhibitor of non-homologous end joining to boost the efficiencies of homology directed repair using repair oligos as well as donor plasmid. We will present our efficiencies at generating each of these diverse models as well as provide information on pronuclear versus cytoplasmic injection of CRISPR reagents, concentrations of CRISPR reagents, and the use of Scr7. Keywords: CRISPR, Transgenic, Duke Cancer Institute

Dissection of genetic redundancy by the CRISPR/Cas system reveals a novel role for FGF signaling during mouse eye development Yas Furuta1,2, Takaya Abe1, Yui Yamashita1,2, Yoshiko Mukumoto1, Atsumi Denda1, Mari Kaneko1,2, Megumi Watase1, Hiroshi Kiyonari1,2 1

Genetic Engineering Team and 2Animal Resource Development Unit, RIKEN Center for Life Science Technologies, Kobe, Japan

The fibroblast growth factor (FGF) signaling system comprises a battery of ligands and receptors that are promiscuous in their binding partners. Due to apparent functional redundancy, the collective function of endogenous FGF family ligands in embryonic development has not been fully understood genetically. To examine the role of FGF signaling in the developing eye, we are generating mice lacking the function of multiple Fgf gene family members. While Fgf3, Fgf9, and Fgf15 are the major family members expressed in the developing retina, homozygous mutants lacking either of their genes individually exhibit subtle or no morphological defects during early eye development. Therefore combining multiple mutations is required to better understand the function of these genes. However, generation of Fgf3;Fgf9;Fgf15 compound mutants by conventional genetic crosses have been hampered due to suboptimal fertility of compound heterozygous mutants and a close genetic linkage between Fgf3 and Fgf15 loci on the same chromosome. To circumvent these problems, we have employed CRISPR/Cas9-mediated multi-gene targeting to generate compound mutant embryonic stem (ES) cells. Mutant ES cells are used to generate completely ES-derived F0 chimeras for direct phenotypic characterization. Preliminary phenotypic analyses have revealed that embryos lacking the functions of both Fgf9 and Fgf15 show misrouting of retinal ganglion cell axons (RGCs) soon after the initiation of RGC differentiation. Subsequently, RGC axons fail to target the central retina, resulting in the absence of the optic nerve. These results suggest a previously unrecognized role of Fgf signaling during retinal development, controlling RGC axon behaviors to properly target the central retina for proper formation of optic nerve. Further phenotypic analyses of mutants with various Fgf3;Fgf9;Fgf15 compound genotype combinations are currently underway. These approaches have provided us with a stable source of compound mutants, and thus will allow for efficient genetic analyses of multi-gene lethal mutations.

Transgenic Res (2016) 25:195–270 Keywords: fibroblast growth factor, mouse development, retina, CRISPR/Cas

Combining CRISPR/Cas9 with large targeting vectors in mouse ES cell electroporations to produce homozygous F0 mice Anthony Gagliardi, Gustavo Droguett, Alejo Mujica, Sean Trzaska, Charleen Hunt, Junko Kuno, Marine Prissette, David Frendewey, Venus Lai, David Valenzuela, Wojtek Auerbach, Brian Zambrowicz Velocigene, Regeneron Pharmaceuticals Inc., Tarrytown, NY The CRISPR/Cas9 system has been shown to be a versatile tool for scientific research. With its ability to create double-strand DNA breaks it has been used to inactivate genes by creating indels and, in conjunction with oligos or small vectors, introduce SNPs or other small targeted modifications. Use of these tools to produce mice, by either pronuclear or cytoplasmic injection often results in mosaic F0 s. The subsequent production of the necessary homozygous targeted mice is timeconsuming, requiring two rounds of breeding, at least 6 months before usable mice are available after initial injections. Since each founder mouse might harbor a different mutation, breeding of several founder lines is required. By combining CRISPR/Cas9 along with large targeting vectors (LTVECs) in ES cell electroporation (EP), we have not only achieved enhancement in targeting events, but were also able to make homozygous large modifications ([100 kb deletions and insertions). When those cells were used to create fully ES cell derived mice by 8-cell embryo injection we could create study cohorts of identical, homozygous targeted F0 mice in 3 months after EP in contrast to the 6–8 month needed to produce study cohorts by pronuclear injection. In summary our method of incorporating CRISPR/Cas9 with LTVECs in ES cells produces homozygous F0 s, even for large targeting events, directly from microinjection. Some of the advantages of leveraging the CRISPR/Cas9 system in this manner are the time savings compared to conventional breeding to produce homozygous mice and the large reduction in the number of animals produced by breeding. By combining CRISPR/Cas9 with LTVECs in ES cells followed by 8-cell embryo injection, we have produced multiple study cohorts where a mouse gene was replaced by its human homolog, enabling direct testing of human antibody drug candidates in mice. Keywords: CRISPR/Cas9, Homozygous Targeting, Large Modifications

233 Reproductive Sciences; Eli and Edythe Broad Center of Regeneration Medicine and Stem Cell Research, University of California, San Francisco, USA 4Lunenfeld Tanenbaum Research Institute, Mount Sinai Hospital, Toronto, Canada; Department of Physiology; Department of Obstetrics and Gynecology, University of Toronto, Canada 5Program in Developmental and Stem Cell Biology, Peter Gilgan Centre for Research and Learning, The Hospital for Sick Children, Toronto, Canada; Department of Molecular Genetics, University of Toronto, Canada Cre recombinase has long been used in genetically modified mice to excise selection cassettes introduced during embryonic stem (ES) cell targeting and to enable both tissue- and developmental stage-specific control of gene expression. These applications have traditionally involved establishing and mating of at least two different mouse lines—one with the target sequence flanked by loxP sites and one with tissue- or stagespecific expression of Cre recombinase. Here we describe applications using cell-permeable Cre protein (TAT-Cre) to perform Cre excision in embryos and adult tissues. We show that TAT-Cre treatment of pre-implantation stage mouse embryos from three Cre reporter lines resulted in efficient excision of the target sequences and consequent reporter gene expression. We used the conditions established with reporter lines to effect germline conversion of conditional-ready tm1a alleles into definitive null tm1b alleles for TCP’s International Mouse Phenotype Consortium (IMPC) production pipeline using embryos obtained by mating and in vitro fertilization. In addition we demonstrate that the treatment of mouse blastocysts with TAT-Cre results in Cre-mediated excision of loxPflanked DNA only in outer trophoblast progenitors and their placental derivatives, thus representing an efficient tool for the generation of trophoblast-specific gene knockouts. Finally, we demonstrate that injection of TAT-Cre under ovarian bursa can result in excision of loxP-flanked DNA in the ovary and in the fallopian tubes. Collectively these studies demonstrate a multitude of uses for TAT-Cre and provide methods for the use of conditional alleles in tissues and organs that do not yet have specific Cre-expressing mouse lines. Keywords: Mouse embryo, Cre recombinase, TAT-cre, cellpermeable, Cre reporter, trophoblast, placenta

Humanising the mouse Taz Locus to allow the generation of accurate disease models Farah Ghaffar, David Stevenson, Sheila Bryson, Fiona Warrander and Douglas Strathdee Beatson Institute for Cancer Research, Transgenic Technologies group, Glasgow, G61 1BD, Scotland

Site-specific recombination in pre-implantation stage embryos and adult reproductive tissues using cellpermeable Cre protein Marina Gertsenstein1, Lauryl M.J. Nutter1,2, Steffen Biechele3, Andrea Jurisicova4, Janet Rossant5 1

The Centre for Phenogenomics (TCP), Toronto, Canada 2 Physiology & Experimental Medicine, The Hospital for Sick Children, Toronto, Canada 3Center for Reproductive Sciences, Department of Obstetrics, Gynecology and

Mutation of the Tafazzin (Taz) gene underlies Barth Syndrome (BTHS). A knockout of the Taz gene in mouse gives rise to a number of phenotypic effects which are similar to that seen in human patients with BTHS. However despite these similarities, there remain differences between the phenotype of the mouse model and BTHS. For example, the mice are sterile and although this role appears to be conserved in other species, such as Drosophila, this is not one of the clinical features of BTHS in humans.

123

234 There is also evidence of evolution of function at the molecular level. The tafazzin gene shows a number of differences in splicing between humans and mice. In particular the human gene has an additional exon that is not present in the mouse. Greater than 95 % of mouse genes have an identical exon number to their human orthologues and it is unusual for human genes to have novel exons not present in the mouse. One important consequence of this difference between the human and mouse Taz genes, is that attempts to replicate human disease-causing mutations in the mouse may not give the anticipated results. To allow us to generate more accurate human disease models, we decided to generate a targeted mouse line in which the Taz genomic region is replaced by the corresponding human sequence. Just over 12 kb of mouse genome will be replaced by 14.9 kb of the corresponding human sequences. We then intend to assess the phenotype of these mice and introduce mutations of the tafazzin gene associated with human disease to assess the phenotypic effect. Keywords: Tafazzin, Human Disease, Mouse Model

Parthenogenetic activation, but not electrofusion, alters developmental kinetics and hatching of mouse embryos Marcelo Fa´bio Gouveia Nogueira, Pablo Diego Moço, Bruna Martins Garcia, Elisa Mariano Pioltine, Gabriela Berni Brianezi, Letıćia Rustici Chica, Lı´via Vieira Saura Department of Biological Sciences, Univ Estadual Paulista, Assis, Brazil The functioning of the trophectoderm (TE) is influenced by epigenetic modifications and requires biparental complementation. Parthenogenesis alters the epigenetic environment and affects the physiological function of embryonic cells. This work aimed to evaluate the development of murine embryos after oocyte and embryonic manipulation. Kinetics and hatching rate were evaluated in blastocysts: (i) derived from parthenogenetic activation followed (Group EP) or not (Group PG; theoretically haploid) by electrofusion; (ii) from electrofusion of two blastomers (Group EL; theoretically tetraploid) and; (iii) from in vivo fertilization (Control Group). There was no statistical difference (Qui-square or Exact Fisher’s Test, P [ 0.05) for the hatching rate between groups Control and EL (56.9 and 47.5 %), but they differed from the other groups. Between the groups PG and EP, hatching rates were similar (respectively, 14.6 and 7.5 %) and the lowest of all groups. By itself, the electrofusion technique (EL) was not deleterious to hatchability. Thus, parthenogenesis itself and/or the activation process might have negatively affected groups PG and EP. There was a clear difference in developmental kinetics between the groups. While group EL developed similarly to the control group, the embryos that underwent parthenogenetic activation were delayed, possibly due to the exclusively maternal genome. There are reports in the literature that it was possible to rescue the paternal imprinting in parthenogenetic mouse embryos, by ESC derivation (Chen et al., Stem Cells, 27:2136–45, 2009), or by serial SCNT (Hikichi et al., Development, 137:2841–47, 2010). The authors reported that

123

Transgenic Res (2016) 25:195–270 parthenogenetic cells could constitute placenta and fetus itself, partially reverting the original imprinting. Although only morphologically evaluated, the difference observed in the embryos of group EP, compared to embryos PG, suggests that diploidy was not beneficial for parthenogenetic embryos as previously described (Liu et al., Biol Reprod, 66:204–10, 2002). We infer that since diploidy on group EP was exclusively maternal, the full function of the trophectoderm was impaired, in which paternal imprinting is important. Expansion and hatching kinetics of blastocysts was used for the assessment of TE functionality. These functions arise from the capacity of TE to pump sodium ions into the blastocoele, promoting water influx. On group EP, the electrofusion apparently was not the detrimental source to the embryos as embryos from group EL had developmental kinetics and hatching rate similar to those in control group. Financial support FAPESP: 12/50533-2, 13/05083-1, 13/07730-4 and 11/23890-6. Keywords: Embryo Development, Parthenogenesis, Electrofusion, Hatching, Blastocyst, Mice

Production of Crispr/Cas9 generated mutants using frozen/thawed 1 cell C57Bl6/N mouse zygotes Evelyn Grau, Ellen Brown, Mike Woods, Stuart Newman, Ed Ryder, Diane Gleeson, Hannah Wardle-Jones, Graham Duddy, Ramiro Ramirez-Solis, Sanger MGP, Katharina Boroviak and Brendan Doe Wellcome Trust Sanger Institute, Genome Campus, Hinxton, Cambridgeshire, CB10 1SA, England The CRISPR/Cas9 system is now established as a tool for genome engineering in mouse zygotes, and generation of mutants with this technology can be considered routine. Until now we have used freshly harvested zygotes, but here we show how we have successfully generated Crispr/Cas9 mutants for the Sanger large scale mutant mouse production using frozen/ thawed mouse zygotes. We directly compared birth rates, mutant rates and germ line transmission rates using fresh and frozen/thawed embryos. The successful use of frozen/thawed embryos for Crispr production has allowed us a more flexible approach to scheduling work, given us a way to supplement our embryo harvest if poor or failed superovulation, as well as given us an opportunity to utilize the use of any surplus C57Bl6/N female mice from our breeding colonies. Keywords: Frozen/thawed zygotes, Crispr/Cas9 generated mutants

From ENU mutagenesis to knock-in reporter fusion alleles: using genetic technologies to study the role of Fam208a Veronika Gresˇa´kova´1,2; Shohag Bhattacharyya1; Bjo¨rn Schuster1, Inken M. Beck1, Radislav Sedlaćˇek1, Kallayanee Chawengsaksophak1 and Trevor A. Epp1 1

Biocev, IMG AV CR v.v.i. Videnska 1083 Praha 14220, Czech Republic; 2LF UPOL Tr. Svobody 8 Olomouc 77126, Czech Republic

Transgenic Res (2016) 25:195–270 Heterochromatin formation is essential for suppressing undesirable or unrequired genetic elements, and thereby serves essential protective, structural and regulatory roles. In order to identify genes important for heterochromatin formation, a dominant ENU mutagenesis screen was conducted on a transgenic mouse line containing a GFP reporter under control of hemoglobin promoter. Mutants that suppress or enhance variegation of GFP expression were termed Modifiers of Murine Metastable Epialleles (Momme). We chose to focus on two mutant lines, that suppressed transgene variegation, and contain point mutations in the uncharacterized protein— Fam208a: the MommeD6 line contains a non-conservative substitution and the MommeD20 line contains a splice site mutation. Both are homozygous lethal during gastrulation with compound heterozygosity replicating the homozygous phenotype. Our results show that this protein is a putative player in heterochromatin formation via its interaction with the ankyrin repeat domain of Mphosph8 protein. This interaction was identified by yeast two hybrid screening and verified by Immunoprecipitation and Immunofluorescence in both human (HEK 293T) and murine (NIH 3T3) cells. Interestingly, the MommeD6 mutation seems to impair nuclear localization of Fam208a as well as its interaction with Mphosph8. More recently we have successfully prepared a fluorescent reporter knock-in strain using a CRISPR/Cas9-driven strategy, and have confirmed its single-copy integration by droplet digital PCR. This strain will help us to visualize and study the endogenous protein in its native form. Keywords: Fam208a, citrine, CRISPR/Cas9, Momme, variegation, supressor

A novel non-surgical embryo transfer with TCET in mice Ruonan Liu1, Yanping Miao1, Xinchong Duan1, Mo Guan2, Xiangyun Li1 College of Animal Science and Technology, Agricultural University of Hebei, Baoding, Hebei 071000, China; 2 Medical Research Council, Mary Lyon Centre, Harwell Campus, Oxfordshire, OX11 0RD, UK Although non-surgical transfer of embryos in mice has many advantages over a surgical method, the low success rate of nonsurgical transfer has hampered its acceptance and use. In our studies, we discovered that the uterine injury and embryo loss during the procedure are the main causes of a low success rate for non-surgical transfer. We found that the material and shape of the transfer catheter, the implantation-related factors, the volume of transfer medium and the techniques of transfer significantly affected embryo implantation. Therefore, we developed a novel non-surgical device—TCET (Transcervical Embryo Transfer). The device comprises of an arched, thin, soft tip catheter with blunt ends, which will avoid or minimize the risk of scratching the endometrium or puncturing the uterine horn during the procedure, and the right length of the catheter tip can improve the delivery of the embryos in the best position in the uterus for successful implantation. We also refined the transfer techniques and the component and volume of transfer medium, which significantly reduces the uterine injury and embryo loss and improves the embryo implantation.

235 In these experiments reported here, 62 blastocysts from natural cycle CD1 mice were non-surgically transferred into the uteri of 8 CD1 recipient females (2.5d). As the control, 116 embryos were surgically transferred into the uteri of 15 CD1 recipient females (2.5d). The results showed that 100 % recipient females (8/8) got pregnant and gave birth to 51 live pups (82.2 %) from TCET transfer. The results from the control group were: 93.3 % pregnancy rate (15/14) and 70.6 % birth rate (82/116). Compared with surgical embryo transfer, the procedure of TCET transfer is much simpler, quicker, easier, markedly less traumatic and less stressful to the recipient females. In Summary, we established a novel and efficient non-surgical embryo transfer using TCET here, which could be an alternative to surgical embryo transfer. In addition, this non-surgical embryo transfer technique in mice establishes an animal model for the study of rats, cattle, other large animals and human embryo transfer techniques. Keywords: non-surgical embryo transfer, TCET (transcervical embryo transfer), mice

A simple and efficient vitrification procedure for cryopreserving mouse embryos and oocytes using plastic semen straws Mo Guan, Martin Fray Medical Research Council, Mary Lyon Centre, Harwell Campus, Oxfordshire, OX11 0RD, UK Vitrification is a freezing method in which cells and media are solidified without ice crystal formation. Consequently, injuries related to ice formation are less likely to occur. To achieve success in vitrification, high cooling rates and high concentrations of solutes are commonly believed to be necessary. However, to reduce the toxicity of the vitrification solutions and to achieve a high cooling rate, a minimum time in the vitrification solution and a minimum volume of vitrification solution are thought to be essential. However, these requirements make embryo/oocyte handling difficult during the vitrification, and subsequent warming procedures. Compared with other vitrification methods, the DAP213 vitrification method (Nakao et al., 1997) is a simple and efficient, and only requires a brief two-step exposure of embryos/oocytes to the vitrification solution prior to plunging directly into liquid nitrogen. However, this method has traditionally used a specific type of vial as the sample carrier, which is not compatible with many laboratories which use plastic semen straws as their preferred storage system. At the MRC we have developed an aluminium cooling plate for vitrification in straws. The cooling plate ensures stable refrigeration at 0 C during the equilibration process. In the experiments reported here, 2-cell embryos from C57BL/6N Tac mice were used. For comparison, embryos were vitrified in straws (n = 3) and vials (n = 3) using DAP213 as vitrification solution. The viability of vitrified embryos was compared in terms of post-warming survival rate, as well as their in vitro and in vivo developmental rates. The results demonstrated that there is no significant difference between straws and vials in survival rate (97.14 ± 2.86 vs 98.10 ± 0.95), development to blastocyst (94.74 ± 2.90 vs 84.48 ± 6.16) and birth rate (43.33 vs 46.67). These results indicated that DAP213 vitrification procedure can

123

236 be adapted for use with straws which are cheap to buy and compatible with space saving bulk tank storage systems. This method can also be used for oocytes vitrification. Keywords: vitrification, mice, embryo, oocyte

An attP landing pad in rat Rosa26 locus allows site-specific integrase-mediated transgenesis

Transgenic Res (2016) 25:195–270 CRISPR/Cas9 generated mouse models as a tool for rapid characterization of human disease: confirmation of a role for TENM1 in congenital general anosmia Rebecca Haffner-Krausz1, Elina Berkovitz1, Golda Damari1, Sima Peretz1, Michael Tsoory1, Tsviya Olender2, Pavlo Tatarskyy2, Valery Boyko2, Doron Lancet2 and Anna Alkelai2 1

Shuqin Zhang1, Suxia Bai2, Xianling Zhao1, Xin Su1, Shumei Zhao1, Xiaohao Yao1, Nelson Spruston1 and Caiying Guo1

Department of Veterinary Resources, Weizmann Institute of Science, Rehovot, Israel; 2Dept. of Molecular Genetics, Weizmann Institute of Science, Rehovot, Israel

Janelia Research Campus, HHMI, Ashburn VA, USA; 2 Yale Genome Editing Center, Yale School of Medicine, New Haven, CT, USA

CRISPR/Cas9 gene targeting is an effective technology for generating mouse models of human diseases. It provides a simpler, cheaper and importantly a much faster method than traditional ES cell based gene-targeting methods, to generate mouse lines with modified candidate genes, enabling assessment of their roles in disease phenotypes. We present an example in a study of Non-Syndromic Congenital General Anosmia (CGA), a poorly characterized human neurological disorder which entails a complete inability to sense odors. Whole-exome sequencing of a family with CGA, revealed a missense mutation in the TENM1 (teneurin 1) gene. To rapidly test the hypothesis that the TENM1 gene plays a role in congenital general anosmia, and that the mutation identified in the affected family is the cause of the anosmia phenotype, we employed CRISPR/Cas9 gene targeting to generate mice carrying Tenm1 mutations. Direct co-injection of RNAs encoding the Cas9 protein and locus-specific guide RNAs into one-cell mouse embryos was employed. Two types of mutants were produced. Knockout Tenm1 mice were generated, by targeting the fifth exon of the Tenm1 gene, to result in frame shift mutations and premature stop codons. Additionally, a strategy was designed to generate knock-in mice using homology directed repair (HDR)-based precise gene editing, to recapitulate the point mutation identified in the affected family. A single-stranded DNA (ssDNA) oligonucleotide with the modified G to A substitution and 140 bp of homologous sequence flanking the target site, was co-injected together with Cas9 encoding RNA and a relevant guide RNA designed to cut close to the site of the human mutation. 60 pups with indels in the exon 5 target site, and 16 pups with the desired homozygous or heterozygous missense single base modifications were identified. Potential off-target mutations were screened for in F1 mutants using Sanger sequencing. Behavioral tests in adult F1 mutants revealed that both Tenm1-/- knockout mice and Tenm1A/A knock-in mice have a reduced ability to locate a buried food pellet and an impaired ability to sense aversive odors, supporting the hypothesis that TENM1 plays a role in the olfactory system. Thus in as little as five months from the initiation of the project, we obtained corroborative results linking phenotype with genotype in F0 mice. These findings were later confirmed more extensively in the F1 generation. CRISPR/Cas9 generated mouse models proved to be a rapid and effective tool in the characterization of the human disorder CGA.

1

The ROSA26 locus is the most targeted locus in the mouse (Jax database) but a few knock-ins in the rat have been reported so far due to the lack of robust rat ES cell lines. We knocked attP sites into rat ROSA26 locus using Crispr/Cas9 system. The attP sites serve as a landing pad that allows to generate knockin rats through site-specific integrase-mediated transgenesis by microinjection. Generation of rats with an attP landing pad Two rat ROSA26 gRNA sequences: taggcgggagtcttctgggc and cttccctcgtgatctgcaac were cloned to a vector with a T7 promoter and TracRNA. The gRNAs and Cas9 mRNA were in vitro transcribed using mMESSAGE mMACHINE T7 Kit. The donor DNA contains 2x attP site flanked by two homologous arms of 495 and 493 bp respectively. The single strand donor DNA was prepared using PCR with a biotinylated primer. The PCR product was denatured and the biotinylated strand was immobilized to the streptavidin-coupled Dynabeads. The nonbiotinylated strand was then collected for microinjection. The cas9 mRNA 100 ng/ll, two gRNAs 50 ng/ll each and the single strand donor DNA 5 ng/ll were co-injected into SD rat embryos. 117 embryos were transferred that generated 28 pups and 2 of them were correctly targeted with the attP landing pad. Site-specific integrase-mediated transgenesis: Two attB cassettes were constructed. One was attB- CAG-GFP-WPREPA-attB to express GFP ubiquitously. The other one was attBloxP-3xstop-loxP-CAG-GFP-WPRE-PA-attB to express GFP conditionally. The insertion lengths were 3585 and 4574 bp respectively. The circular construct 12 ng/ll was co-injected with 100 ng/ll PhiC31 mRNA into the rat embryos homozygous for the attP landing pad. After optimized PhiC31 mRNA preparation, we achieved a transgenic rate of 8.8 %. The GFP knockin rats showed a ubiquitous expression pattern. The floxed GFP lines are breeding and will be tested by virus injection of Cre. Conclusion: An attP landing pad was knocked into rat ROSA26 using Crispr/cas9 system. Two attB flanked cassettes were inserted into the landing pad successfully. The approach allows to knockin a large segment of DNA while requires no mologous arms. Keywords: Crispr/cas9 PhiC31 ROSA26 rat

123

Transgenic Res (2016) 25:195–270 Keywords: CRISPR/Cas9, mouse models, gene targeting, Congenital General Anosmia, TENM1, olfaction

Using programmable nucleases for the generation of a viable mouse model for Netherton syndrome Radka Haneckova, Petr Kasparek, Irena Jenickova, Inken M. Beck, Radislav Sedlacek Laboratory of Transgenic Models of Diseases, Institute of Molecular Genetics of the ASCR, v. v. i., Prague, Czech Republic Netherton syndrome, a severe ichtyosis caused by mutations in the SPINK5 gene, is characterized by epidermal barrier disruption, chronic inflammation and hair shaft abnormalities. Several mouse models deficient for Spink5 have been reported that exhibit symptoms similar to Netherton syndrome patients due to unregulated proteolytic activity in the epidermis. However, Spink5 deficiency in traditional KO mouse models leads to early post-natal lethality, which hampers analysis of Netherton syndrome-like pathology in adult age. In this study, we present the generation of a Spink5 deficient mouse model using TALEN technology which is characterized by mosaic inactivation of the Spink5 gene. Furthermore, we evaluate an alternative strategy to generate chimeric Spink5 deficient mice by injection of Spink5 deficient ES cells into the developing wild-type embryo. Both strategies lead to generation of mouse models that reproduce the previously reported phenotype of Spink5 deficiency—however the mice are viable and survive to adulthood. Adult mice show patches of lesional epidermis that are characterized by keratinocyte hyperproliferation, abnormal differentiation, severe itch and alopecia. We show that both targeting strategies can be successfully used to study adult phenotypes that are associated with early post-natal lethality. Keywords: Netherton syndrome, Spink5, epidermis, mouse model

Mouse reproductive fitness is maintained up to an ambient temperature of 28oC while used for producing transgenic mice Jussi Helppi1, Dora Schreier1, Ronald Naumann1 and Oliver Zierau2 1

Max Planck Institute of Molecular Cell Biology and Genetics, Dresden, Germany; 2Institute of Zoology, Technische Universita¨t Dresden, Germany Production of genetically-modified mice is strongly dependent on environmental conditions. Mice are commonly housed at 22 C, which is significantly lower than their thermoneutral zone. But, when given a choice, mice often seem to prefer higher ambient temperatures. In the current study we investigated the effect of higher ambient temperature on the production of transgenic mice, with emphasis on embryo and sperm yield and quality. Mice (C57BL/6JOlaHsd) were housed under four different ambient temperatures (22, 25, 28 and 30 C). Female mice were superovulated, and mated with males. As indicators for reproductive fitness, the success of the

237 mating was observed, including embryo yield and quality, as well as sperm count, motility and progressivity. Female mice were found to produce high amounts of high quality embryos from 22 to 28 C. Sperm count dropped continuously from 22 to 30 C, but sperm motility and progressivity remained high from 22 to 28 C. Conclusively, our data show that ambient temperatures of up to 28 C can be tolerated by mice without an adverse effect in their early reproductive fitness (pregnancy rate, embryo yield and quality, sperm yield and quality). Furthermore, our data show that the shift from 28 C to 30 C results in a significant drop in both male and female reproductive fitness. We conclude that higher ambient temperatures than currently recommended could be used in the context of good performance in early reproduction of mice, and therefore current recommendations for mouse holding temperatures ought to be revised. Higher mouse room temperatures could also lead to significant cost savings regarding ventilation and cooling. Keywords: Environmental tolerance, temperature, sexual behaviour, GM models, embryo

Guidelines for generation of genetically modified mice via CRISPR/Cas Yueh-Chiang Hu, Yinhuai Chen, Huirong Xie, Alexandra Falcone, Susan R. Martin, Melissa A. Scott Cincinnati Children’s Hospital Medical Center, Cincinnati, Ohio 45229, USA The CRISPR/Cas9 system has emerged as a powerful tool for creating genetically modified animals via direct modification of the genome of fertilized zygotes. However, not all introduced sgRNAs produce activity high enough to create genetic modifications in mouse embryos. A simple and reliable validation system to select against weak guide RNAs is critically needed. To investigate this, we chose 24 sgRNAs whose editing activity compared to Tet2 sgRNA activity varied from 25 to 150 % in mouse kidney epithelial cells when assessed by T7E1 cleavage. We then injected individual sgRNAs into fertilized zygotes, followed by embryo transfer and production of live offspring. We consequently identified the minimum required activity for a sgRNA to induce genetic modifications in mouse zygotes. We then further surveyed 162 sgRNAs targeting 51 different genetic loci using the same cellular assay. We found that 61 of the sgRNAs (38 %) have activity below the minimum threshold, including 8 (5 %) with zero activity. This suggests that a substantial fraction of sgRNAs do not have sufficient activity for making genetically modified animals. In addition, we tested a wide variety of designs for making knock-in animals and found that using a single-strand donor oligo with sequence complementary to the PAM-containing strand and homologous arms of asymmetric lengths, we could obtain mice with precise homozygous insertions at efficiency up to 55 %. Furthermore, we have optimized every step of mutant mouse production and substantially reduced the amount of fertilized zygotes needed for each desired mutation. In the recent 60 knockout or knockin mouse projects performed at our facility, we only need an average of 60 fertilized zygotes to generate at least 2 founders for each desired mutation. In this presentation, we provide a

123

238 general guideline for efficient and reliable production of mutant mouse lines via the CRISPR/Cas technology. Keywords: CRISPR/Cas, sgRNA, knockout, knockin, genome editing

Mice double-deficient for Klk5 and Klk7 generated by programmable nucleases show altered epidermal barrier Zuzana Ileninova, Petr Kasparek, Henrieta Palesova, Ivan Kanchev, Radislav Sedlacek Czech Centre for Phenogenomics, Institute of Molecular Genetics AS CR, v. v. i., Prague, Czech Republic The kallikrein-related peptidases (KLKs) appear to be involved in many physiological and pathological processes, however their roles in vivo are still not fully understood, partially due to the unavailability of suitable mouse models. KLK5 and KLK7 have been identified to be involved in the tightly regulated proteolytic pathways that are crucial for epidermal homeostasis. Knock-out mouse models for KLK5 and KLK7 did not show an obvious phenotype and generation of a mouse model lacking both proteases by conventional strategies is impossible as both genes are located within close proximity on the same locus. Thus, double-deficient KLK5/KLK7 mice were generated using the microinjection of TALEN mRNA targeting Klk7 into Klk5-deficient oocytes. These KLK5/7 double deficient mice show severe phenotype in altered barrier integrity and peculiarly strong thickening of the skin, caused by defective shedding of keratinocytes from the skin surface. These results provide in vivo evidence that KLK5 and KLK7 together are indispensable for the process of desquamation. Keywords: KLK5, KLK7, TALEN, epidermis

Transgenic Res (2016) 25:195–270 immunohistochemistry (c-kit, mast cell, macrophage, neutrophil), quantitative PCR (TLRs and inflammatory cytokine genes) and intestinal permeability test. NMS treatment induced neonatal stress, and it was confirmed by tyrosine hydroxylase (TH) gene expression in adrenal cortex. The relative TH gene expression was higher in NMS group than control group. C57BL/6 mice with NMS showed IBS-D type in water contents analysis (NMS vs control: 14.67 vs 7.65 % at 12 weeks). In other hand, C57BL/6.iNOS-/- and C57BL/ 6.nNOS-/- with NMS showed IBS-C type (B6.iNOS-/- vs control: 17.70 vs 22.96 % at 12 weeks and nNOS-/- vs control: 7.76 vs 11.96 % at 18 weeks). Severity of IBS in feces water contents, were increased according to number of repeated stresses. There were no remarkable inflammation lesion in NMS and control mice of every strain in histological examination such as H&E and immunohistochemistry for F4/ 80, Gr1, CD3 and mast cell chymase. In addition, quantitative PCR for detecting mRNA of TLRs and inflammatory cytokine genes also didn’t show significant difference between NMS and control mice. Interestingly, strong c-kit expression was detected in interstitial cell of cajal (ICC) in NMS treated mice, but control mice showed none or weak c-kit expression. This might indicate that NMS mediated stress induce ICC stimulation, and followed increasing of visceral motor activity. In summary, C57BL/6 seemed to be good model for human IBS-D, and NOS deficient mice seemed to develop IBS-C. The most important finding is high c-kit expression in NMS group and c-kit might be hall marker of stress induced ICC stimulation. ICC activated colonic motor activity and induced functional disorder like diarrhea symptom in IBS-D model. NO deficient mice with NMS also showed high c-kit expression, but showed IBS-D phenotype. Further study for mechanism is needed between NOS and visceral motor activity. Keywords: c-kit, ICC, Irritable bowel syndrome, Nitric oxide, NMS, stress, water contents

Nitric oxide knock out mouse is good disease model for constipation dominant irritable bowel syndrome Da-Eun Jang1, Woo-Sung Hwang2, Su-Cheong Yeom1 1

Graduate School of International Agricultural Technology, Seoul National University, 1447 Pyeongchang-Ro, Daewha, Pyeongchang, Kangwon, 232-916, Korea; 2Designed Animal and Transplantation Research Institute, Greenbio Research and Technology, Seoul National University, 1447 Pyeongchang-daero, Daewha, Pyeongchang, kangwon, 232-916, Korea Irritable bowel syndrome (IBS) is a prevalent chronic functional bowel disorder characterized by visceral hyperalgesia, abdominal pain, diarrhea and constipation without any structural cause. Although IBS is not fatal, but highly disruptive to a patient’s daily life, and affects approximately 10–20 % of world’s population. We generate IBS mouse model by neonatal maternal separation (NMS) using nitric oxide synthase (NOS) deficient mice and assess its characters. C57BL/6, C57BL/6.iNOS-/- and C57BL/6.nNOS-/- mice were used for this study. Briefly, littermate pups were separated for 3 h during postnatal days 3–14 or left undisturbed with their dam. At 8–18 weeks of age, mouse were assessed for IBS phenotype by feces test, histological analysis,

123

Optogenetic tools to study cAMP signaling in cilia and flagella Vera Jansen1, Jan Jikeli1, Shatanik Mukherjee2, Luis Alvarez2, Peter Hegemann3, U.Benjamin Kaupp2, Dagmar Wachten1 1 Minerva Research Group - Molecular Physiology, Center of Advanced European Studies and Research (caesar), Bonn, Germany; 2Department Molecular Sensory Systems, Center of Advanced European Studies and Research (caesar), Bonn, Germany; 3Institute of Biology, Experimental Biophysics, Humboldt-Universita¨t zu Berlin, Invalidenstraße 42, 10115 Berlin, Germany

Cilia are microtubule-based organelles that extend from the surface of almost every mammalian cell. Primary cilia and motile flagella perform various functions such as chemosensation or cell movement, and are considered as independent and specialized signaling compartments. The expression of proteins involved in cAMP-signaling is confined to primary cilia and sperm flagella, indicating that their function is controlled by cAMP. We aim to unravel the action of cAMP in cilia and flagella using optogenetics.

Transgenic Res (2016) 25:195–270 Optogenetics is a powerful technique to control and analyze cellular activity by using light. To analyze cAMP signaling in sperm flagella, we generated a transgenic mouse model expressing the bacterial photoactivated adenylate cyclase bPAC exclusively in sperm. This mouse model allowed us to manipulate cAMP levels in sperm and, thereby, control flagellar motility by light. In addition, we generated a transgenic mouse expressing a novel FRET-based biosensor (mlCNBD-FRET) in sperm flagella, which allowed us to quantitatively analyze cAMP dynamics in this small compartment. We are currently developing strategies to apply these methods to primary cilia in vitro and in vivo. In combination, these tools provide spatio-temporal control of the intracellular cAMP concentration and enable to measure cAMP dynamics, which will contribute to a better understanding of cAMP signaling events in cilia and flagella. Keywords: optogenetics, cAMP, cilia, flagella

239 indels found on nPAGE were confirmed by sequencing. In total 12 ES cell lines containing the transgene were derived from hCas9 transgenic embryos. These ES cell lines will be used for cloning free CRISPRs transfection together with the loxP containing transgene to generate conditional ‘‘knock-out’’ ES cell line. The zygote/ES cell lines expressing the hCas9 protein simplify genome targeting with CRISPR/Cas9 technology. Compared to inducible hCas9 expression, for example, the cells with constitutive expression of hCas9 protein represent a complete tool for targeting. The transgene for hCas9 can be removed from the mouse genome by subsequent breeding, if necessary, in the lines generated from hCas9 transgenic cells. Keywords: Cas9, Rosa26, ES cells, zygote, transgenic, CRISPR

Generation of mouse lines through IVF Constitutively expressing hCas9 transgenic mouse generated through targeting in Rosa26 locus Irena Jenickova1, Maja Sabol2, Bjoern Schuster1, Petr Kasparek1, Inken Beck1, and Radislav Sedlacek1 Laboratory of Transgenic Models of Diseases and Czech Centre for Phenogenomics, BIOCEV, Institute of Molecular Genetics of the ASCR, v.v.i., Prague, Czech Republic; 2 Laboratory for Hereditary Cancer, Division of Molecular Medicine, Rudjer Boskovic Institute, Zagreb, Croatia CRISPR/Cas9 technology permits highly effective genome editing. The nuclease complex consists of gRNA and Cas9 protein. These components are transfected/injected into the cells/zygote as RNA or DNA sequence (plasmid). The sequences must first be transcribed to form functional component of CRISPR/Cas9 complex. This causes some delay in the targeting action and can influence the targeting efficiency. Here we produced hCas9 transgenic mouse which mediates constant hCas9 expression. For the transfection of the hCas9 transgenic mice, delivery of gRNA only is sufficient to induce double strand breaks. The mouse was produced on the C57BL/6N genetic background by pronuclear co-injection of plasmid containing hCas9 with CBh promoter and FLAG, flanked with ROSA26 homology arms and ROSA26 specific TALENs. We generated 4 correctly targeted transgenic mice and confirmed by sequencing. We verified the mice further with RTPCR (gene expression), Southern blot (correct targeting), ddPCR (copy number), and Western blot (protein expression). From the 4 lines, 1 line had correctly localized single copy transgene with detectable protein expression. The other lines had multiple copy insertion of the transgene. The activity of Cas9 protein from the single-copy line was confirmed by in vitro assay with transfection of MEFs (mouse embryonic fibroblasts) with sgRNA together with reporter gene. The indels were checked on native PAGE (nPAGE). The single-copy line has constitutive expression of hCas9 protein with germline transmission. Consequently the line was used for zygote pronuclear injection and ES cell (embryonic stem cells) derivation. Cloning free CRISPRs for Lamp3 were injected into the zygotes of hCas9 transgenic mice and the embryos were evaluated at 3.5 dpc. The

Sarah Johnson, Ying Chen, Zhenjuan Wang, Laurie Chen, and Lin Wu Genome Modification Facility, Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts, USA Our facility has generated more than 780 mice through more than 30 In Vitro Fertilization (IVF) projects to either retrieve mouse lines for initiating colonies for research projects or to rapidly produce large cohorts of age-matched animals for specific studies. This process could also improve the health status of mouse colonies. Here, we describe our work, and share our experiences on the IVF projects that were carried out with cryopreserved or fresh sperm, and with or without L-glutathione (GSH) added to the reagent when fresh sperm was used. We have resuscitated 21 mouse lines and more than 270 mice through IVF with cryopreserved sperm, and generated 9 lines and 500 mice via IVF with fresh sperm. It is critical for a successful IVF project to produce a sufficient number of oocytes, high efficiency of fertilization rate, and good live pup birth rate. Our data indicated that subcutaneous or shallow intraperitoneal (IP) hormone injection method produced 15–20 % more oocytes than standard IP injection. Using cryopreserved mouse sperm and 1.25 mM GSH in the fertilization reagent, we have achieved 70–90 % fertilization rate and good live pup birth rate. However, when fresh sperm was used in IVF, 1.25 mM GSH yielded 80–95 % fertilization rate, but 72 % lower birth rate compared to cryopreserved sperm IVF. It was found that adding 1.25 mM GSH to the fertilization reagent for cryopreserved sperm IVF and no added GSH in the fertilization reagent for fresh sperm IVF produced the best results of both fertilization rate and live pup birth rate. Additionally, we found that pseudo-pregnant recipients with a higher (32–35 g) body weight and age of over 10 weeks had a greater number of live pups born than recipients of lower body weight. To have an optimal IVF protocol, it is important to consider the differences that occur from using fresh or cryopreserved sperm. Our findings indicate that while GSH plays a critical role in aiding IVF when using cryopreserved sperm, it is not required for IVF using fresh sperm. Keywords: In Vitro Fertilization, Sperm Cryopreservation, Mouse

123

240


Functional assessment of far-upstream DNA regulatory elements of the mouse Tyr gene by CRISPR-Cas9 mutagenesis Santiago Josa1,2, Davide Seruggia1,2, Almudena Fernańdez1,2, Rafael Jimeńez1, Marta Cantero1,2, Julia Fernańdez1,2, Lluı´s Montoliu1,2 1

National Centre for Biotechnology (CNB-CSIC) and CIBERER-ISCIII, Madrid, Spain

2

Tyrosinase (Tyr) is the key enzyme in pigment production, the bottle-neck of the melanin biosynthetic pathway. The Tyr gene is only expressed in pigment cells, of which two types are known: melanocytes, derived from neural crest, and retinal pigment epithelium (RPE) cells, derived from the optic cup. Tyrosinase mutations result in hypopigmentation or albino (null) phenotypes, associated with severe visual impairment. The equivalent human rare disease is known as oculocutaneous albinism type 1 (OCA1). Previous works from our and other laboratories have established the main DNA regulatory elements that appear to drive the expression of Tyr in these two cellular types: melanocytes and RPE cells. Using standard and artificial chromosome-type BAC and YAC Tyr transgenic mice it was initially concluded that the promoter and proximal elements (280 bp) contained sufficient information to drive the expression of the gene adequately. Later on a major DNA regulatory sequence, containing boundary and enhancer elements, was found 15 kb upstream, apparently responsible for the melanocyte-specific expression pattern (reviewed in Giraldo & Montoliu, PCR 2002). However, specific DNA elements, responsible for the Tyr expression in RPE, remained to be identified. Some years ago, through the use of genome comparative analyses and transient lacZ reporter BAC Tyr transgenic mice, it was suggested the existence of additional DNA regulatory elements in the mouse Tyr locus, further far upstream than previously investigated, which could be responsible for/contribute to the RPE-specific expression of the gene (Murisier et al. Dev Biol 2007). We have now applied a CRISPR-Cas9 mutagenesis approach to decipher the functional relevance of these predicted far-upstream DNA elements of the mouse Tyr locus. We have obtained a series of mutant alleles with deletions involving this far-upstream genomic region and will report our findings in this presentation. Keywords: tyrosinase, retina, melanocytes, pigmentation, melanin, boundaries

Archiving mouse lines—Why archive a line? How much does it cost? How do I submit a line for archiving? Janet Kenyon and Martin Fray Mary Lyon Centre, MRC Harwell, Harwell Campus, Oxfordshire, OX11 0RD, UK The Mary Lyon Centre, MRC Harwell, maintains a non-profit mouse archive that is built on the work of researchers from across the scientific community who have sent their lines for cryopreservation and distribution. We do not make a profit instead our archive is built on a cost recovery model. This

123

allows us to offer the scientific community a free archiving service, with any costs recuperated from clients who order the lines. Our archive aims to collate a wealth of useful mouse mutants that will be publically available and accessible to the whole scientific community. Together with the scientists who deposit at our archive we are looking to establish a cooperative future in mouse research that will benefit the scientists, funders and ultimately society as a whole through a better understanding of human disease. You can submit your line directly at; https://www. infrafrontier.eu/emma/publicSubmission/submissionForm.emma or if you would like further information please contact us at [email protected]. Keyword: Archiving

Efficiently generates CRISPR/Cas9 knock-in and conditional mice using in vitro one cell-controlled method Sang Yong Kim1, Ping Zhou1, Amy Sun2, Crequer Amandine2, Marcus Hines2, Adrian Erlebacher2, Sergei Koralov2 and David Levy3 Rodent Genetic Engineering Core, New York University, School of Medicine, Department of Pathology, 540 First Ave, New York NY 10016 2 New York University, School of Medicine, Department of Pathology, 540 First Ave New York NY 10016, 3 New York University, School of Medicine, Department of Pathology and Molecular Pathology, 540 First Ave New York NY 10016 Recently, a large number of CRISPR/Cas9-mediated knockout mice were produced from the CRISPR/Cas9 system. The direct microinjection of CRISPR/Cas9 into the pronuclei or cytoplasmic of fertilized zygotes required the superovulation of many females and stud male mice by obtaining fresh fertilized zygotes, especially the C57BL/6 mouse strain for each microinjection. However, harvesting fresh fertilized zygotes for each microinjection is time-consuming, expensive and very laborious work. If a large number of embryos or spermatozoa are cryopreserved before microinjection, either wild type or transgenic mice may be produced from the cryopreserved zygotes and sperm at any time. In this study, C57BL6/J or reporter transgenic mice lines, (R26CAG-eYFP-Stop-Lox, B6.129.Rosa26-Td.Tomato-eGFP and Oct4-eGFP) were cryopreserved spermatozoa with a different genetic background by the sperm freezing method. Various types of CRISPR/Cas9 (Knock-In, conditional and multi-gene mutants) were constructed by directly microinjecting into the cytoplasmic of in vitro fertilized zygotes, and surviving 2-cell stage embryos were transferred to pseudopregnant mice. As a result, CRISPR/Cas9-mediated mice were generated from both the Cas9 nickase and cleavage group. Conditional alleles were produced (average frequency 19 % of live pups born) and Nickase shown more efficiently produced (average frequency 26 % of live pups born). We demonstrated the applicability of in vitro cell-controlled using In vitro fertilization (IVF) method for CRISPR/Cas9-mediated mice production. In addition, we generated CRISPR/Cas9 mediated ES-cells mice using vitrified-thawed blastocysts

Transgenic Res (2016) 25:195–270 injection. These advantages indicate that in vitro one cellcontrolled method provides a rapid, reduction of cost and number animals for create new mutant and multi-gen mutants in mice. Keywords: CRISPR/Cas9, One cell-controlled, Conditional KO mice, In vitro fertilization (IVF)

241 The role of Fmr1nb in oocytes maturation and meiosis progression Slavomı´r Kinsky´1, Iris Minosalva1, Kallayanee Chawengsaksophak1, Barbora Singerova1, Andrej Susor2, Ivan Kanchev1, Trevor Epp1 and Radislav Sedlaćˇek1 1

Characterisation of complex CRISPR induced genotypes in mice Ruairidh King, Joffrey Mianne´, Adam Caulder, Gemma Codner, Rachel Fell, Marina Maritati, Alasdair Allan, James Jarrold, Martin Fray, Wendy Gardiner, MLC Microinjection team, Sara Wells and Lydia Teboul The Mary Lyon Centre, MRC Harwell, Harwell Campus, Oxfordshire, OX11 0RD, UK The comparison of genetically modified mice to their unmodified background strain is a valuable tool in medical research. Such tools are employed to determine the function of genes and pathology of genetic diseases in vivo, and allow novel therapies intended for treatment of human disease to be developed and tested. Generating these mouse models for the study of human disease depends on the ability to introduce specific genetic changes. The CRISPR/Cas9 technology is revolutionising the field, allowing tailored modification of the mouse genome with far greater efficiency than previously available techniques. With this increase in efficiency comes a reduction in timescale, animal use, labour, and cost. However, the genotypes of generated mutants are more complex, and provide new challenges in genotyping. The MRC Mary Lyon Centre is a high-throughput production centre for the IMPC (International Mouse Phenotyping Consortium). We increasingly turn to CRISPR/Cas9 as the system of choice for genome editing, and therefore must be able to quickly and accurately determine the precise sequence of all alleles within an animal. The nature of in vivo genome editing—employing endogenous repair mechanisms to produce desired changes—means that a variety of possible mutations may occur in any combination. Deletions, insertions, substitutions, legitimate and illegitimate repair may all occur concurrently and, although Cas9 protein is intended to be active at the one-cell-stage, editing events can occur after cell division leading to mosaic animals. This complexity is further compounded by the fact that biopsies for genotyping are not representative genetic samples, and may not contain copies of every allele—hidden mosaicism. Here we report on our strategy for determining genotypes of founder animals and lines generated using CRISPR/Cas9. We will discuss this with reference to two projects on the C57BL/6N mouse strain, which aimed to eliminate acquired mutations in the genes Cdh23 and Crb1 along with the resulting degenerative neurosensory phenotypes. The success of the projects was dependent upon our ability to reliably detect the corrected genotypes within genetically complex animals. Keywords: CRISPR Cas9, mice, C57BL/6N, genotyping, subcloning, sequence analysis

Laboratory of Transgenic Models of Diseases and Czech Centre for Phenogenomics, BIOCEV, Prague, Czech Republic; 2Laboratory of Biochemistry and Molecular Biology of Germ Cells, Libechov, Czech Republic Hybrid sterility contributes to the diversification and evolution of species by creating reproductive isolation barriers. Our previous research mapped a new region of the X chromosome (Hstx2) that contributes to hybrid sterility in mouse intersubspecific hybrids. Within this interval, Fmr1nb (fragile X mental retardation 1 neighbour) was identified as the most prospective candidate, and therefore we proceeded to produce a mouse knockout. Although Fmr1nb knockout males did not exhibit phenotypes typical for hybrid sterility, we did identify impaired fecundity in females. This, together with our observation of ovary-specific expression in E14.5 female embryos and previous published findings linking Fmr1nb depletion with mitotically derived aneuploidies, compelled us to study oocyte maturation and meiotic chromosome segregation in more detail. Chromosome spreads confirmed a higher incidence of abnormal chromosome counts in Fmr1nb mutants. Furthermore, abnormalities in the spindle apparatus of metaphase II oocytes could be visualized by whole mount immunohistochemistry using anti a- or b-tubulin antibodies. The meiotic spindles did not assemble completely into typical barrel-structures, and the main spindle apparatus was usually accompanied with numerous ectopic microtubule organization centers (MTOCs) scattered throughout the cytoplasm. We determined that the membranespanning Fmr1nb protein, through microinjection of an in-vitro transcribed Fmr1nb-GFP reporter construct, to be localized to the endoplasmic reticulum (ER). Interestingly a functional relationship between ER function and spindle organization was recently identified in mitotic cells. Our results suggest that the ER may have a similar role in spindle assembly during meiosis, and that Fmr1nb is an important regulator of this process. Keywords: hybrid sterility, meiosis, oocytes, spindle, endoplasmic reticulum

Update: gene editing rat resource center (GERRC) Jason Klotz2, Rebecca Schilling1,2, Michael Grzybowski1,2, Angela Lemke1,2, Jocelyn Miller1,2, Anne Temple1,2, Allison Zappa1,2, Chieh-Ti Kuo1,2, Lynn Lazcares1,2, Shawn Kalloway1,3, Jamie Foeckler1,3, Akiko Takizawa1,2, Jozef Lazar1, Howard J Jacob1,2, Aron M Geurts1,2, Melinda Dwinell1,2 1 Genome Editing Rat Resource Center (GERRC), Human & Molecular Genetics Center; 2Department of Physiology, Medical College of Wisconsin, Milwaukee, WI 53226; 3 Blood Center of Wisconsin, Blood Research Institute, Milwaukee, WI, 53226

123

242 With the advent of site specific genome editing endonucleases like Transcription Activator-like Effector Nucleases (TALENs), Zinc-Finger Nucleases (ZFNs), and Clustered Regularly Interspaced Short Palindromic Repeats/Cas9 (CRISPR/Cas9), and the highly efficient Sleeping Beauty (SB) transposon transgenesis method, we have the opportunity to quickly and efficiently generate gene-modified rat strains for the research community. Our established infrastructure of trained personnel, gene editing proficiency, embryo microinjection, high-throughput genotyping, sequencing, cryopreservation and network of rat distribution has generated over 300 novel rat models for investigators in the past seven years. More recently the CRISPR/Cas9 nuclease and SB systems have been implemented to generate knockout, knockin, and transgenic rat models. The Genome Editing Rat Resource Center (GERRC) R24 produces novel custom models free of charge for heart, lung, and blood research investigators who submit a meritorious, peer-reviewed application. Genes nominated by the research community are reviewed by an External Advisory Board and selected based on their scientific value. Progress through year 3 has resulted in more than 9800 microinjected rat embryos, of which over 1800 have resulted in live born pups and over 1500 of these have been screened for mutagenesis of the target locus. Our team has successfully generated *340 pups containing mutations in 47 genes in 12 inbred, consomic and congenic rat strains (Dark Agouti [DA/ MolTac], Dahl Salt-Sensitive [SS/JrHsdMcwi and SS/ HsdMcwiCrl], Wistar Kyoto [WKY/NCrl], Lewis [LEW/Crl], Type II Diabetes Nephropathy [T2DN/Mcwi], Spontaneously Hypertensive Stroke Prone [SHRSP/A3NCrl], SS.BN(D13Rat124-Scor13_3694), SS-Chr 13BN/McwiCrl, LH-17LN, Polycystic Kidney [PCK/CrljCrl-Pkhd1pck/Crl], Fawn-hooded Hypertensive [FHH/EurMcwi] and FHH-Chr 3BN/Mcwi). After establishing germline transmission, heterozygous pups are transferred to the requesting investigator and the model is made available to the scientific community. All models are preserved through sperm cryopreservation. To date, 28 mutant strains have been distributed or are ready for distribution, 7 are currently being expanded, and 9 have new founders designated for breeding. Investigators are encouraged to nominate their own gene by submitting an application. Keywords: Genome Editing Rat Resource Center, transgenics, ZFN, TALEN, CRISPR/Cas9

A mouse model of neuronal-specific MeCP2 overexpression Martha V. Koerner, Jim Selfridge and Adrian P. Bird Wellcome Trust Centre for Cell Biology, University of Edinburgh, Edinburgh, UK Expression of MeCP2 in the brain occurs in both glial and neuronal cells. Neurons express approximately 6-7fold more MeCP2 protein than glia. It has been demonstrated that MeCP2 binds and recruits the NCoR complex to chromatin. In humans, mutations in the NCoR interaction domain (NID) cause Rett Syndrome. This shows that the NID is crucial for MeCP2 function. In addition, overexpression of wildtype MeCP2 leads to MeCP2 Duplication Syndrome, demonstrating that an excess of MeCP2 is detrimental. Using a previously established mouse

123

Transgenic Res (2016) 25:195–270 model for MeCP2 Duplication Syndrome, we have knocked in either wildtype MeCP2 or MeCP2 with a mutation in the NID (R306C) into the neuronal-specific Tau gene. Analysing total brain extracts, both, Tau-MeCP2 and Tau-MeCP2-R306C are expressed at *2-fold levels compared to endogenous MeCP2. Expression of Tau-MeCP2 rescues lethality and phenotypic scoring of MeCP2 null mice. Mice with heterozygous TauMeCP2 expression in a wildtype background are leaner than wildtype littermates, but viable and fertile. Homozygous expression of Tau-MeCP2 however is lethal between birth and weaning. In contrast, homozygous Tau-MeCP2-R306C mice which express wildtype levels of non-mutated MeCP2 plus *4-fold levels of MeCP2-R306C are viable, fertile and phenotypically undistinguishable from wildtype littermates. This indicates that it is not solely the excess of MeCP2 protein in the nucleus, but the amplified interaction of NCoR with MeCP2, which is detrimental in MeCP2 duplication syndrome. Keywords: MeCP2, mouse model, MeCP2 duplication syndrome

Function of cyclin-dependent kinase 13 during mouse development Jirˇ´ı Kohoutek1, Monika Nova´kova´1, Hana Paculova´1, Kallayanee Chawengsaksophak2 and Radislav Sedlaćˇek2 1

Department of Chemistry and Toxicology, Veterinary Research Institute, v.v.i., Brno, Czech Republic; 2 Czech Centre for Phenogenomics, Institute of Molecular Genetics AS CR, v. v. i., Prague, Czech Republic Gene expression is a tightly controlled process involved in a broad spectrum of biological processes, ultimately giving cells the ability to take control of their growth, apoptosis, differentiation and developmental potential. Regulation of gene expression is orchestrated primarily at the level of transcription of specific mRNAs by RNA polymerase II (RNAPII) and its activity is primarily regulated at the level of posttranslational modifications; among them, phosphorylation is the most prevalent. We have recently unveiled that the cyclin-dependent kinase 13 (CDK13), similar to CDK9 and CDK12, phosphorylates RNAPII and thereby influence transcription of various sets of genes involved in variety of physiological processes. Importantly, the function of CDK13 during mouse development has not been demonstrated as of today, therefore we decided to dissect functional role of CDK13 during early mouse development. Initially, we employed embryonic stem cells with potential to generate complete and conditional knock-out CDK13 mice. Heterozygous cdk13 ?/- mice were bred and their offspring with wild type allele were born at regular rates and appear normal; however, CDK13 complete knock-out mice were not born at all. It shows that cdk13 plays the key function during early mouse development. At the moment, we carry out detail analyses to reveal at what embryonic stage the lethal phenotype appears. The project is supported by the grant of the Ministry of Agriculture RO 0514. Keywords: CDK13, transcription, mouse development, RNAPII

Transgenic Res (2016) 25:195–270 Optimization of the delivery of CRISPR system to cultured cells and single cell embryos Evguenia Kouranova, Xiaoxia Cui Horizon Discovery, 2033 Westport Center Drive, St. Louis, MO 63146, USA The CRISPR/Cas9 system has been rapidly adapted to practically every model system for its ease to generate and high efficiencies to cleave target DNA. An active CRIPSR nuclease has a constant protein component, Cas9, and an RNA component, named small guide RNA (sgRNA) containing a variable portion of sequence that base pairs with one strand of a given target site. Unlike our experience with Zinc Finger Nucleases, in human, rat and mouse cell lines we tried, successful cotransfection of Cas9 mRNA and sgRNA was cell-line dependent, and often resulted in either very low or no cleavage activities. In the meantime, sequential transfection of cells with Cas9 DNA first, and sgRNA followed 24 h later, reliably produced good level of activity, indicating the requirement of Cas9 presence at the time of introduction of sgRNA. Not surprisingly, creation of a cell line stably expressing Cas9 led to consistently high cleavage activities upon transfection of sgRNAs. And transfection of recombinant Cas9 protein precomplexed with sgRNA (ribonucleoprotein particles, or RNPs) led to efficient cleavage as well. On the other hand, Cas9 mRNA and sgRNA can be microinjected into single cell embryos and cleave target sites as efficiently as RNPs to produce straight KOs as well as large deletions between two target sites. However, RNPs seem to have advantages over mRNAs at certain target sites for KIs. We will also discuss titration of RNPs for microinjection and potential competition when multiple sgRNAs are used. Keywords: gene editing, Cas9/CRISPR, RNP, microinjection, single cell embryos

Interpreting gene regulatory information of invertebrate chordate amphioxus: an insight from transgenic studies in zebrafish and medaka Iryna Kozmikova, Zbynek Kozmik Institute of Molecular Genetics AS CR, v. v. i., Prague, Czech Republic Cephalochordates, commonly known as amphioxus or lancelets, are the most basal subphylum of chordates. Cephalochordates are thus key to understanding the origin of vertebrates and molecular mechanisms underlying vertebrate evolution. The evolution of developmental control mechanisms during invertebrate-to-vertebrate transition involved not only gene duplication events but also specific changes in spatial and temporal expression of many genes. To get insight into spatiotemporal regulation of gene expression during invertebrate-tovertebrate transition, functional studies of amphioxus gene regulatory elements are highly warranted. Here, we performed transgenic reporter studies in zebrafish and medaka using promoters and enhancers derived from the genome of Florida amphioxus. We found that vertebrate embryo can, at least in

243 some cases, correctly interpret the regulatory information encoded by the amphioxus genome indicating deep evolutionary conservation. We envision that comparative transgenic analysis of gene regulatory sequences in the context of amphioxus and vertebrate embryos will likely provide an important mechanistic insight into the evolution of vertebrate body plan. Keywords: promoter, enhancer, amphioxus, zebrafish, reporter gene, transgenesis

Cre-ZOO: Indispensable tool for time- and tissuespecific deletion of genes in the mouse eye Jitka Lachova, Barbora Antosova, Lucie Zilova, Anna Zitova, Radislav Sedlacek, Zbynek Kozmik Institute of Molecular Genetics AS CR, v. v. i., Prague, Czech Republic The mouse model represents an attractive alternative for studies of eye development and pathogenesis of human eye. Many of the genes responsible for eye development and differentiation have necessary function elsewhere in the developing organism. Threfore, the use of conditional mutants of these genes is required. However, the utility of conditional mutant mice is to great extent dependent on the availability of suitable strains of mice with the tissue- or time- restricted activity of Cre recombinase. For an area of interest (in this case an eye) it is necessary to generate a panel of various Cre-expressing transgenic mice (Cre-ZOO). Here, we present results of our effort to generate and validate novel Cre-expressing transgenic mouse lines with the defined expression in the eye tissues. Subsequently, our newly characterized Cre lines will be used for the systematic analysis of conditional mutants in selected genes. This specific aproach will not only help to extent our knowledge about eye development and differentiantiation, but can also provide novel mice models for human eye pathologies. Keywords: Cre line, eye development, conditional mutant

Targeted Transgenesis by Nucleases: the experience of the Mouse Genetics Engineering Center facility Francina Langa, Gae¨lle Chauveau-Le Friec, Ilta Lafosse, Carine Moigneu Mouse Genetics Engineering Center, Institut Pasteur, Paris, France The Mouse Genetics Engineering Center (Centre d’Ingeńierie Geńe´tique Murine, CIGM) is the Institut Pasteur’s transgenesis core facility. The CIGM aims to generate new models of transgenic mice and rats by classical/additive transgenesis together with targeted transgenesis using Homologous Recombination in Embryonic Stem (ES) cells or, more recently, by direct microinjection of zygotes by specific nucleases. Since 2012 we have introduced at the CIGM the three major technologies for gene editing by nucleases. Thus, in historical order, in 2012 we used Zinc Finger Nucleases for new KO and KI rat models, in 2013 TALE Nucleases for new NOD/J KO mouse lines and since 2014 the CRISPR/Cas9 System, to

123

244 obtain successful targeted KO/KI genome modifications in rats and mice. These systems, directly microinjected in the zygote, have great potential to increase the efficiency of the modifications and because they bypass the need of ES cells, they also reduce the time needed to produce genetically engineered models (KOs by Non Homologous End Joining-NHEJ, KIs when a DNA donor matrix is present with the nuclease system). Specially CRISPR technology of gene editing is developing very rapidly due to its design simplicity and its great versatility (possibility of multiple mutations in a single step modification) and it is currently leading a revolution in genome engineering. The first experiences using the CRISPR/Cas9 system started at the CIGM in 2014 and since then several genetic modified mice lines in different genetic backgrounds (B6D2F1, C57BL/ 6N, FVB/N) have been generated with good efficiencies (10–70 %): i.e., a double KO mouse for an immunology project, simple and double KI mice for the introduction of a TAG-HA or punctual mutations using wild-type or nickase Cas9 versions. We will discuss our results obtained by pronuclear microinjection of different CRISPR/Cas9 systems (plasmid, mRNA, protein, dual) together with future projects using this new technology. Keywords: Nucleases, ZFN, TALE, CRISPR/Cas9 system, zygote, pronuclear microinjection, genetic background, mouse, rat

Baylor college of medicine KOMP2 high throughput CRISPR mouse production Denise Lanza, John Seavitt, Isabel Lorenzo, and Jason Heaney BaSH Consortium - Knockout Mouse Project (KOMP2) and Department of Molecular and Human Genetics, Baylor College of Medicine, Houston TX, USA The aim of the NIH Knockout Mouse Phenotyping (KOMP2) production project is to generate conditional-ready and reporter null allele mice for a significant fraction of the mouse genome within available funding. CRISPR/Cas9 genome editing technology permits the creation of both null and conditional alleles more rapidly and at substantially reduced cost compared to traditional gene targeting. We at Baylor College of Medicine have been generating null alleles by CRISPR/Cas9 targeting for almost two years. We are now routinely creating conditional alleles, and optimizing our targeting strategies as a foundation for generating more elegant CRISPR/Cas9-generated KOMP2 alleles. We have injected over 6000 embryos for null allele creation and over 4000 embryos for conditional allele generation. Guide RNAs, and Cas9 and Cas9D10 mRNA were prepared through in vitro transcription using commercially available kits. Donor plasmid DNA and single-stranded oligonucleotides (ssOligos) were custom ordered. We are now successfully injecting as few as 50 embryos per targeting attempt. We used a two-guide approach to generate null alleles, excising a critical exons by non-homologous end joining (NHEJ) repair. Null allele generation efficiencies were roughly the same using either wild type Cas9 or Cas9D10 mRNA. The additional cost driven by the paired guide RNAs required for Cas9D10 targeting has led us to perform subsequent null allele production

123

Transgenic Res (2016) 25:195–270 with wild type Cas9. We were able to dramatically increase our efficiency, in terms of founders obtained per embryo injected, by performing multi-gene injections, which combine multiple guide RNAs targeting unrelated genes within a single injection. No off-target mutagenesis was detected from either single gene or multi-gene injections. We have successfully generated conditional alleles using either Cas9 protein with plasmid donor DNA for homologous recombination (HR) or Cas9 mRNA with paired ssOligo donor DNA for homology-directed repair (HDR). We observed increased efficiency generating conditional allele founder mice using HDR, and current conditional allele production is through HDR. NHEJ repair occurs in parallel to HDR targeting in these injections, therefore, the dual repair pathways have the additional benefit of simultaneously generating the null allele required for phenotyping. HDR targeting with ssOligos is an expedient and economical way to generate mouse lines with conditional alleles. Multiple genes can be targeted to create null alleles in one injection, though segregating the resultant alleles and excluding mutagenesis at non-targeted alleles reduces the time saved in producing and screening founders. Keywords: CRISPRs, KOMP, Knockout, Conditional

Generating inducible Knockout models of Cancer using CRISPR-Cas9 technology Laprano, N.1,2; Stevenson, D.1; Ghaffar, F.1; Cadalbert, L.1; Bryson, S.1; Warrander, F.1; Strathdee, D.1 1 The Beatson Institute for Cancer Research. Switchback Road, G61 1BD, Bearsden, Glasgow, Scotland; 2University Of Glasgow, Institute of Cancer Sciences, University Avenue, G12 8QQ, Glasgow, Scotland

Murine models of Cancer are one of the most sophisticated tools available in modern cancer medicine. They allow the researchers to perform extensive studies, to manipulate the environment in a controlled way and to experiment novel treatments without subjecting patients to stressful and possibly harmful protocols. For this reason, the production of new and improved cancer models is of paramount importance. In this study we propose a new approach to tumour modelling aimed to an even better simulation of cancer onset and its interaction with the surrounding tissues. We designed and produced a novel inducible CRISPR/Cas9 allele which uses the well-established Tet-On technology to Knockout relevant genes in Embryonic Stem Cells (ESCs) following Doxycycline stimulation. The allele drives the constitutive expression of three different guide RNAs (gRNAs) targeting p53, APC and Pten and Cas9 under the control of the Tet-On promoter. The GM ESCs can be used for Blastocyst injection and Chimera production. The disruption of the three genes, subsequent to Doxycycline induction, should trigger the onset of Cancer in the chimeric tissue. The Chimeras will thus be a new and improved tool for tumour modelling. The mosaicism in the tissues will provide a unique environment to study Cancer and its interactions with both healthy and diseased tissue, providing an effective simulation of the behaviour of cancer cells in a physiological environment. Keywords: CRISPR, Cas9, Cancer, Mouse Models, Inducible, Tetracycline

Transgenic Res (2016) 25:195–270 Efficient generation of mouse models with the CRISPR/ Cas9 technology Karelia Lipson Ruffert1, Jean-Paul Moussu1, Miguel Taillepierre1, Ce´line Becker1, Catherine Cailleau1, Karine Charton2,3, Laurence Suel2,3, Sara F Henriques2, Matteo Bovolenta4, Isabelle Richard2,3 and Jean-Pierre de Villartay5,6 SEAT-TAAM PHENOMIN, UPS44 CNRS, Villejuif, France1; INSERM, U951, Evry, France2; Geńe´thon, R&D department, INTEGRARE research unit, Evry, France3; Department of Life Sciences and Biotechnology, University of Ferrara, Ferrara, Italy4; Laboratory of Genome Dynamics in the Immune System (DGSI), INSERM UMR1163, Paris, France5; Paris-Descartes, Sorbonne Paris Cite´ University, Imagine Institute, Paris, France6 The CRISPR-Cas9 system allows rapid generation of a large spectrum of genetically modified mouse models. Here we present efficient gene knock-out, knock-in and exon deletion projects undertaken at our transgenesis platform located in the near suburbs of Paris (SEAT-TAAM PHENOMIN). The delivery of different forms of spCas9 into the pronucleus of murine zygotes and the analysis of injected embryos at the blastocyst stage or beyond have allowed us to obtain mouse models from hybrid and inbred strains for studies in myology, immunology, reproduction biology, etc. with a success rate of about 10 % (KI)–70 % (KO) in the founder generation. Keywords: CRISPR Cas9 myology immunology reproduction biology SEAT-TAAM PHENOMIN CNRS genetic engineering mouse models

Improved CRISPR-mediated genome editing specificity with destabilized Cas9 (PEST-Cas9) Yong Liu1, Yan Zhou1, Trine Skov Petersen1, Lin Lin1, Lars Bolund1, Yonglun Luo1* Department of Biomedicine, Aarhus University, Aarhus, Denmark; *Corresponding author: [email protected] Recently, the Clustered Regularly Interspersed Short Palindromic Repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) has rapidly growth as the most powerful tool for precision genome editing. Mediated by a small guide RNA (sgRNA), the universal Cas9 endonuclease can introduce double-strand DNA breaks (DSBs) to the targeted genomic loci that are complementary to the sgRNA guide sequences. However, it has been observed that the Cas9 can introduce indels to off-target loci that harbored 1–3 mismatches to the sgRNA guide sequences. Several strategies has been reported to enhance Cas9 specificity, including reducing Cas9 amount, using Cas9 nickase, truncating sgRNAs, using a pair of catalytically inactive Cas9 nucleases, or creating Cas9 variants (eSpCas9). We reason that reducing the amount of active Cas9 in the cell can also be achieved through destabilization. Here we developed a modified destabilized Cas9, fused to the destabilized peptide sequences (PEST), also referred to as PEST-Cas9. We fused 1–2 copies of PEST to the N terminus, C terminus or both N and C terminus. Only the N terminus fusion can significantly reduce Cas9 stability, as revealed by a time-

245 course Western blot analysis. Currently, we are comparing the on-target cleavage efficiency and off-target activity at 13 ontarget sites and 22 off-target sites in human cells. This PESTCas9 nuclease will provide an alternative strategy to improve the CRISPR/Cas9 specificity and applied for genome editing applications. This project is funded by the Danish Research Council for Independent Research: Technology and Production Science. Keywords: PEST-Cas9, CRISPR, off-target, genome editing

chNHE1 and chicken resistance to ALV-J: prospects for biotechnological solution Anna Lounkova, Jiri Plachy, Dana Kucerova, Marketa Reinisova, Jiri Hejnar Laboratory of Viral and Cellular Genetics, Institute of Molecular Genetics of the ASCR Subgroup J avian leukosis virus (ALV-J) is a highly pathogenic retrovirus that causes myeloid leukosis and hemangiosarcomas in both meat- and egg-type chickens and is responsible for severe economic losses in Asian poultry industry. Because no resistant chicken lines have been described so far and no sources of genetic variability have been found, a biotechnological solution to generation of such resistance would be convenient. As a receptor for ALV-J, chicken Na+/H+ exchanger type 1 (chNHE1) was identified, encoded by the tvj locus on chromosome 23. We demonstrate that W38 of chNHE1 is a critical determinant of the Tvj receptor function, and a single amino-acid deletion of W38 completely abrogates the susceptibility to ALV-J. This simple genetic basis of resistance points to the use of the CRISPR/Cas 9 system and homology-directed repair. We demonstrate that application of the CRISPR/Cas9 system with specific gRNA toward the tvj locus introduced NHE1 knockouts in chicken fibroblast cell line DF-1 and we prove that these cells are resistant to ALV-J. Further strategy towards specific knock-out in the chicken will be discussed. Keywords: ALV-J, chNHE1, CRISPR/Cas 9

Validation of guide RNAs for CRISPR-Cas9 system using in-vitro cultured mouse embryos Jinping Luo1, Timothy Dahlem2, Susan Tamowski1 1 Transgenic and Gene Targeting Core, University of Utah, Salt Lake City, Utah, USA; 2Mutation Generation and Detection Core, University of Utah, Salt Lake City, Utah, USA

CRISPR-Cas9 system is a powerful tool for targeted modification of mammalian genomes and has recently been employed for making genome-modified mouse models. Compared to the traditional methods of pronuclear injection of plasmid constructions for random integration and blastocyst injection of gene-targeted ES cells for production of chimeric animals, the CRISPR-Cas9 system appears to be easier in designing, higher efficiency, and much shorter in production cycle. The effectiveness and specificity of this system is highly dependent on

123

246 the selection of active guide RNAs (gRNAs). gRNAs target the CRISPR system to induce double stranded breaks (DSB) at specific loci in a genome. These DSB are the initiating events for targeted gene knockout and knockin. The ability of gRNAs to effectively target specific loci is paramount to the success of creating genome modified mouse models via the CRISPR-Cas9 system. To date there is no appropriate assay to validate in-vivo activity of gRNAs. We have developed a blastocyst validation assay to test the activity and effectiveness of selected gRNAs using in vitro cultured embryos that is a timesaving and costeffective step when using CRISPR-Cas9 for the production of genome modified mouse models. We delivered CRISPR-Cas9 reagents to mouse zygotes at the pronuclear stage by injection of: (1) plasmids co-expressing Cas9 and gRNA, (2) a mixture of in vitro transcribed gRNAs with Cas9 RNAs or protein, and (3) in-vitro transcribed gRNAs into zygotes from mice embryonically expressing Cas9. After 4.5 days in vitro culture of injected embryos, single blastocysts were transferred to 10 ll of DNA extraction buffer. gRNA-induced DSB were identified as indel mutations at the target genomic loci by High Resolution Melt Analysis (HRMA). The activity and relative efficiency of selected gRNAs was determined using all three different delivery methods (option 1, 15 projects; option 2, 4 projects; option 3, ongoing projects). The activity of 51/53 selected gRNAs was confirmed using this blastocyst validation step and the activity of these gRNAs was further proved in G0 mice. We suggest that this ‘‘blastocyst validation’’ procedure become a routine step prior to generating genome-modified mice using the CRISPR-Cas9 system. Keywords: CRISPR-Cas9, gRNA, blastocyst validation, HRMA

Transgenic Res (2016) 25:195–270 Results: The average time to first vaginal plug was 1.8d in Group 1, 2.7d in Group 2 and 3.2d in Group 3, while the average time between consecutive vaginal plugs was 9.2d (Group 1), 10d (Group 2), and 9.25d (Group 3). The average time between consecutive estrous cycles was 9.7d (Group 1), 11.8d (Group 2), and 9.4d (Group 3). The congruence between visual and cytological examination in determining proestrus/ estrus in Group 2 was 100 % and that for the 4 stages in Group 3 was 79 % with a range of 44–100 %. From 162 plug-positive females selected in proestrus/estrus, 49, 30, 19, and 2 % were plug-positive on d1, d2, d3, and d4, respectively showing that pseudopregnant mice production significantly increased on the first 2 days. From 192 plug-positive females selected randomly, these values were 31, 21, 35, 10, and 3 % on d1, d2, d3, d4, and d5, respectively. No significant differences were observed between groups with respect to ETs with fresh or cryopreserved embryos although the number of pups born per litter was higher in Group A with fresh (7.57 vs. 6.39) and cryopreserved/thawed embryos (5.0 vs. 4.38). Furthermore, the sex ratio and the genotype of the pups were not significantly affected. Conclusion: Estrous cycle staging is a valuable skill to know and implement, thereby contributing to animal welfare since the number of mice needed in the recipient colony is reduced. Keywords: estrous cycle staging, pseudopregnancy, vaginal cytology, embryo transfer, assisted reproductive technologies

Monogamous versus polygamous mating influences the superovulation efficiency in four strains of mice Malte Heykants, Esther Mahabir Comparative Medicine, Center for Molecular Medicine, University of Cologne, Cologne, Germany

Estrous cycle staging before mating increased the production of pseudopregnant recipients without negatively affecting embryo transfer in mice Malte Heykants, Esther Mahabir Comparative Medicine, Center for Molecular Medicine, University of Cologne, Cologne, Germany Objectives: In contemporary mouse facilities where ARTs coupled with ET are performed, pseudopregnant recipients can be limiting. Our goal was to assess the congruence in determining the estrous cycle stage (proestrus, estrus, metestrus, and diestrus) by visual observation of the vagina or cytological examination of vaginal smears. Furthermore, CD-1 females were selected in the proestrus/estrus stage or randomly before mating for the production of 0.5 day (d) old pseudopregnant recipients for ET. Materials and Methods: Females were 8–15 weeks old and were divided into 3 groups with 10 mice each; Group 1: only daily visual observation, Group 2: daily visual observation and cytological examination only on day 1, Group 3: daily visual observation and daily cytological examination. A total of 30 vasectomized CD-1 mice were used for mating over 14 days. The presence of a vaginal plug was monitored daily. Subsequently, 274 females were selected in the proestrus/estrus stages visually (Group A) and 364 females were randomly selected before mating (Group B) and ETs were performed.

123

Objectives: The number of genetically engineered mice available for superovulation is often limited. For embryo production, usually one male is mated with one hormonallytreated female. We determined the influence of monogamous or polygamous mating (1 male:2 females) on vaginal plug rate and embryo production in four strains of mice. Materials and Methods: Outbred Crl:CD1(ICR) (CD-1), inbred C57BL/6NCrl (B6), BALB/cAnNCrl (BALB/c), and FVB/NCrl (FVB) mice originated from Charles River Laboratories. Females were 24 days (d) or 45d–48d old at the time of first hormone treatment, and males were 12 weeks old at the time of first mating. Mice were kept in individually ventilated cages at 20 to 24 C under a humidity of 50–60 %, 75 air exchanges per hour and a 12/12-h light/dark cycle. Mice had chow and water ad libitum. Females received 5 IU eCG/5 IU hCG (24d) or 7.5 IU eCG/7.5 IU hCG (45d–48d) 48 h apart. Immediately after the hCG injection, females were mated with males. Using the same males, monogamous (5 males:5 females) or polygamous mating (5 males:10 females) was performed in alternating weeks. The number of vaginal plugpositive females and 2-cell embryos were determined. Statistical analysis was performed using the Student’s t test (P = 0.05). In total, 5–9 replications were performed for each strain. Results: The percentage of plug-positive females was significantly higher with monogamous compared to polygamous

Transgenic Res (2016) 25:195–270 mating for the B6 (71 vs. 47 %) and FVB (77 vs. 51 %) strains in the 45d–48d group. No significant differences were observed with respect to the number of plug-positive females according to the mating scheme in the 24d group for all strains. The percentage of embryo donors was significantly higher with monogamous mating for the B6 (76 vs. 50 %) and FVB (87 vs. 61 %) strains in the 24d group and for the B6 (94 vs. 53 %) and CD-1 (90 vs. 68 %) strains in the 45d–48d group. The total number of embryos per schedule was higher with polygamous than with monogamous mating for all strains. The number of intact 2-cell embryos per plug-positive (8.3 vs. 5.5) and donor mouse (8.4 vs. 6.3) was significantly higher with monogamous than with polygamous mating in the 24d group only for the FVB strain. Conclusion: The number of 2-cell embryos per schedule was higher with polygamous than with monogamous mating in all strains. As such, we recommend polygamous mating to increase the effectiveness of routine superovulation. Keywords: monogamous, polygamous, superovulation, embryo production, assisted reproductive technologies

Murine norovirus is not transmitted to mice via in vitro fertilization, intracytoplasmic sperm injection and ovary transplantation Marcello Raspa1, Esther Mahabir2, Martin Fray3, Ferdinando Scavizzi1 National Research Council (IBCN), CNR-Campus International Development (EMMA-INFRAFRONTIERIMPC), Monterotondo Scalo, Italy1, Comparative Medicine, Center for Molecular Medicine, University of Cologne, Cologne, Germany2, Mary Lyon Centre, MRC Harwell, Harwell Science and Innovation Campus, Oxfordshire, OX11 0RD, United Kingdom3 Objectives: Since its discovery in 2003, murine norovirus (MNV) is still endemic in many rodent animal facilities. Our aim was to determine the risk of transmission of MNV to recipients and pups via ARTs, especially those which compromise the integrity of the zona pellucida (ZP). Materials and Methods: IVF, assisted IVF with reduced glutathione (AIVF), ICSI, and ovary transplantation were performed. MNV was detected by qualitative and quantitative RT-PCR. Immunocompetent C57BL/6NTacCnrm and immunodeficient athymic nude mice were naturally infected with MNV (91 % homology to MNV3). Results: The mesenteric lymph nodes, small intestine, spleen, liver, lung, brain, ovary and testis were infected at specific intervals over a one-year period. The peak infection of the sex organs was at 12 weeks with 20 to 50 viral genomes/mg gonad. MNV strictly adhered to spermatozoa collected from infected mice since three washes did not remove MNV from the sperm. After using MNV-positive sperm for IVF, AIVF and ICSI, 27 to 30 genomes were detected in IVF (n = 100) and AIVF

247 (n = 100) embryos from both mouse strains. Approximately 87 % of MNV detected in these embryos was found in the ZP. All embryo transfer recipients, pups and ovary recipients were MNV-negative. Conclusion: The results indicate that manipulation of the germplasm through ARTs did not lead to transmission of MNV to mice. This may be due to the absence of an infectious dose or failure of the MNV strain to replicate effectively in developing embryos and the reproductive tract. Keywords: murine norovirus, ARTs, IVF, AIVF, ICSI, ovary transplantation

A potential mouse model of sporadic AD with dysregulated neuronal calcium homeostasis Lukasz Majewski, Filip Maciag, Jacek Kuznicki Laboratory of Neurodegeneration, International Institute of Molecular and Cell Biology in Warsaw, Poland Background and aims: Alzheimer’s disease (AD) is the most common age-related neurodegenerative disorder. At least two types of AD can be distinguished: sporadic AD (SAD) of unknown etiology, which accounts for most cases, and genetically encoded familial AD (FAD), which affects up to 5 % of all the patients. The major risk factor for developing SAD is age. It has been suggested that brain ageing is a result of a subtle, but long-lasting dysregulation of Ca2+ homeostasis in neurons. Disturbances in Ca2+ signaling are found before any obvious Ab pathology in SAD patients; moreover, Ca2+ dysfunction augments Ab formation and Tau hyperphosphorylation. Our group showed that the cytoplasmic resting Ca2+ level in primary culture of rat cortical neurons can be modulated by overexpression of STIM proteins, ER Ca2+ sensors involved in the Store Operated Calcium Entry (SOCE) [1, 2]. We also detected an enhanced magnitude of Ca2+ influx during SOCE in human lymphocytes from SAD patients [3]. One of the objectives of our present project is to understand how elevated basal Ca2+ level in neurons contributes to neurodegeneration. Methods: Generation of transgenic mice using DNA microinjection technique. Results: We have created lines of transgenic mice with elevated gene expression of STIM1, STIM2 and Orai1 in brain neurons and have been analyzing Ca2+ homeostasis in primary neuronal culture derived from these mice. Conclusions: The obtained lines can be a suitable model to verify the hypothesis that brain dysfunction during ageing is induced by changes in Ca2+ homeostasis. [1] J. Gruszczynska-Biegala, et al., PLoS One 6:e19285 (2011). [2] L. Majewski and J. Kuznicki, Biochim Biophys Acta 1853:1940–52 (2015). [3] A. Jaworska, et al., Biochim Biophys Acta 1833:1692–9 (2013) Keywords: STIMs, Orai1, Store Operated Calcium Entry (SOCE), Alzheimer’s disease (AD)

123

248 Creation and characterization of the first transgenic rabbit model of long QT5 syndrome Pe´ter Major1, Istvań Baczko´2, La´szlo´ Hiripi1, ¨ rdo¨g2, Andra´s Varro´2, Katja E. Odening3, Bala´zs O Zsuzsanna B}osze1 1 Rabbit Genome and Biomodel Group, NARICAgricultural Biotechnology Institute, H-2100 Go¨do¨ll} o, Hungary; 2Department of Pharmacology & Pharmacotherapy, University of Szeged, H-6720 Szeged, Hungary; 3Department of Cardiology and Angiology I, Heart Center University of Freiburg, D-79106 Freiburg, Germany

Long QT syndrome (LQTS) is a heritable disease associated with ECG QT interval prolongation, ventricular tachycardia, and sudden cardiac death in young patients. The laboratory rabbit (Oryctolagus cuniculus) as experimental model has significant advantages over the mouse in this respect. Moreover, rabbits have similar repolarizing ion channels as human subjects. The model is based on a KCNE1 missense mutation G52R first identified in a Chinese LQT5 syndrome family. The KCNE1 gene encodes a transmembrane protein, which coassembles with KCNQ1, to form the b- and a- subunits of IKs channels, respectively. Loss-of-function mutations within KCNE1 gene were implicated in cardiac action potential prolongation and ventricular arrhythmogenesis in LQT5. KCNE1, also known as minK, was the first among the Kv channel accessory subunits, which was cloned from human heart. The transgenic rabbit expressed tissue specifically the mutant human KCNE1 mRNA and protein in the heart and had reduced repolarisation reserve. Suprisingly, the ratio of homozygous offspring were significantly lower than expected in this transgenic line, when two heterozygote rabbit were mated. These results have implications for understanding the nature and heterogeneity of cardiac arrhythmias. Supported by OTKA CNK 77855 and NK 104397 Keywords: Long QT syndrome (LQTS), transgenic rabbit

The Rederivation of animals to the Francis Crick Institute Katharine Mankelow, Mary Ann Haskings, Marta Miret, Ian Rosewell, Sarah Hart-Johnson The Francis Crick Institute We review the outcome of a 24-month programme to rederive in excess of 1350 mouse strains from contributing institutes to the Francis Crick Institute, via an intermediate health-screened animal facility at Poplar Block, Clare Hall, Hertfordshire. In light of the increasing evidence of the effect of the microbiota on phenotype, we undertook a comprehensive analysis of the metagenome of animals at NIMR (National Institute of Medical Research) and LRI (London Research Institute), and to provide a baseline of the microbiota within all donor units, and within the CD1 recipients. Poplar Block, Clare Hall, now houses 29,000 mice, from over 1300 mouse strains. We are about to commence the next stage of the rederivation process—the mass expansion of mouse lines, ready for migration to the new Francis Crick

123

Transgenic Res (2016) 25:195–270 Institute site at St. Pancras, Central London in Summer 2016. To manage these lines, we have chose the ‘‘Mouse Colony Management System’’ (MCMS) developed for the Wellcome Trust Sanger Institute, which allows us to manage breeding, track pedigrees, manage cryopreserved stock, monitor health concerns and also regulate and monitor experimental cohorts. Throughout the large-scale rederivation process, we have also tried to reduce and refine animal use wherever possible. Two ways in which we have done this are through the use of genetically sterile Prm1 Tg mice to provide all embryos transfer recipients, and by using the Paratech NSET device to transfer embryos non-surgically without the need for anaesthesia wherever possible. We have also improved out aseptic surgical techniques in line with the latest national and local guidelines and advice. Keywords: Francis Crick Institute, Rederivation, NSET, MCMS, Prm1, 16s

Generation of new germline mutations in mouse thyroid hormone receptor TRa1 by in ovo CRISPR/Cas9 genome editing to model the RTHa genetic disease Suzy Markossian1, Vale´rie Risson2, Marie Teixeira2, Fre´de´ric Flamant1 1

Ecole Normale Supe´rieure de Lyon, IGFL, INRA USC 1370, CNRS UMR5242; 2Plateau de Biologie Expe´rimentale de la Souris, Ecole Normale Supe´rieure de Lyon, SFR BioSciences Gerland The first human germline mutation in the THRA gene, encoding thyroid hormone receptor TRa1, has been discovered recently in 2012 (Bochukova et al., NEJM vol366 p243). There are currently 24 known patients with 13 different mutations. All known mutations introduce amino-acid substitutions or frameshifts in the ligand binding domain, either reducing ligand affinity, or preventing the recruitment of coactivators. Mutant receptors exert a dominant-negative activity, reducing the sensitivity of most tissues to thyroid hormone stimulation. The presentation of this new genetic disease, called RTHa (resistance to thyroid hormone due to TRa1 mutation) has some similarities with congenital hypothyroidism, but the circulating level of hormone remains within normal range. The clinical traits are quite variable, usually associating impairment of body growth and retarded cognitive development. Homologous recombination in embryonic stem cells has been previously used to introduce mutations in the mouse THRA gene. Like in human patients, the developmental and physiological consequences of these knock-in mutations substantially vary from one strain to the other. This variability may stem from differences in transgene design or mouse genetic background. A less trivial possibility would be that seemingly similar mutations can have diverse consequences, because they alter the conformation of TRa1-containing multiprotein complexes in different ways. To address this later possibility, we generated new THRA germline mutation in mice, using CRISPR/Cas9 genome editing. We first used Non Homologous End Joining approach to generate allelic series. In ovo microinjection of a vector driving the expression of the RNA-guided Cas9 nuclease and the synthesis of a guide RNA targeted to the last exon of THRA

Transgenic Res (2016) 25:195–270 generated 4 different frameshift mutations. Each of them altered the C-terminal end of TRa1 required for coactivator recruitment. Preliminary analysis of the derived mouse lines confirms that mutations within the same TRa1 domain, carried by mice with the same genetic background, can have different consequences. More recently, we successfully used in ovo Homology Directed Repair with single stranded oligonucleotide template to generate a mouse model carrying the same single point mutation than one of the patients. The mutation has been transmitted to germline and the mouse line is currently amplified for phenotyping. Our results illustrate the great potential of CRISPR/Cas9 in creating genetically modified mice, paving the way for future applications in disease modeling. Keywords: CRISPR/Cas9, thyroid hormone receptor, RTHa mouse model

Development of an iPS cell-based model to study the role of p73 gene in adipocyte differentiation Laura Maeso-Alonso1, Marta Martin-Lopez1, Sandra Fuertes-Alvarez1, Margarita M. Marques2 and Maria C. Marin1 1

Department of Molecular Biology and Institute of Biomedicine, University of Leon, Leon, Spain; 2 Department of Animal Production and Institute for Animal Breeding and Health, University of Leon, Leon, Spain The study of adipogenesis and the identification of the genes that regulate this process has become a priority research area in the developed countries due to the increased prevalence of obesity and related diseases. In particular, the early phases of the adipogenic differentiation process are not well characterized. Stem cells, either embryonic or induced pluripotent stem cells (iPSCs) can recapitulate different stages of differentiation. Therefore, they are emerging as an excellent tool to improve our understanding of the mechanisms that regulate adipocyte differentiation. The p53 gene family comprises the transcription factors p53, p73 and p63. The members of this family share a similar structure and sequence identity and have been described as regulators of several differentiation processes. p73 has been related to myeloid and erythroid differentiation. Several groups, including ours, have recently demonstrated that p73 is a positive regulator of endothelial cell differentiation and angiogenesis. This suggests that p73 may be an important player in differentiation to the mesodermal lineage. Therefore, we sought to analyze p73 requirement for adipocyte differentiation. To address this, we developed an adipogenic differentiation model using iPSCs. We reprogrammed wild type (WT) and p73 knockout (p73KO) mouse embryonic fibroblasts using the piggyBac transposon system. The generated iPSCs were differentiated via embryoid body formation by the hanging drop method. After 12 days in culture, cells were disaggregated with accutase and at day 15, cells were treated with an adipogenic cocktail (modified from Cuaranta-Monroy et al., 2014), containing isobuthilmethilxanthin (IBMX), dexamethasone, insulin, indomethacin and ascorbic acid.

249 Immunofluorescense and transcriptional analysis revealed that WT-iPSCs not only expressed pre-adipocyte markers (Pref-1), but also mature adipocyte markers (FABP4-Fatty Acid Binding Protein-4). Lipid accumulation, assessed by oil red O staining, began to be visible in WT-iPSCs from 25 days in culture, and lipid droplets increased their size by day 27, altogether indicating that WT-iPSCs could differentiate into mature adipocytes using the developed differentiation protocol. However, the dynamics of adipocyte marker expression and lipid droplet accumulation was impaired in p73KO-iPSC cultures, suggesting that p73 deficiency alters the adipocyte differentiation process. Keywords: iPS cells, p73 gene, adipocyte differentiation

Embryonic stem cell culture conditions support distinct states associated with different developmental stages and potency Javier Martıń-Gonza´lez1, Sophie M. Morgani2, Kasper Bonderup1, Sahar Abelchian1, Cord Brakebusch1 and Joshua M. Brickman2 1

Transgenic Core Facility, University of Copenhagen, Copenhagen, Denmark; 2The Danish Stem Cell Centre DanStem, University of Copenhagen, Copenhagen, Denmark Embryonic stem cells (ESCs) are cell lines derived from the mammalian pre-implantation embryo. Here we assess the impact of derivation and culture conditions on both functional potency and ESC transcriptional identity. Independent ESC lines have been newly derived from blastocyst-stage mouse embryos in three different culture conditions: two small molecule inhibitors (2i), knockout serum replacement (KOSR) and foetal bovine serum (FBS). While ESCs derived in any of these three conditions showed similar ability to generate highly chimeric mice when injected as multiple cells, only cells cultured in either 2i or KOSR, but not FBS, generated chimaeras when injected as individual cells, regardless of how these cells were derived. ESCs cultured in 2i or KOSR showed a transcriptional correlation with early pre-implantation embryos (E1.5-E3.5) and contributed to development from the 2-cell stage. Conversely, the transcriptome of serum-cultured ESCs correlated with later stages of development (E4.5), at which point embryonic cells are more restricted in their developmental potential. Thus, ESC culture systems are not equivalent, but support cell types that resemble distinct developmental stages. Cells derived in one condition can be reprogrammed to another developmental state merely by adaptation to another culture condition. Keywords: Embryonic stem cell, ESC derivation, ESC culture conditions, ESC transcriptome

Communicating animal research: why and how—lessons from Europe Emma Martinez-Sanchez, PhD The European Animal Research Association (EARA), London, UK

123

250 The use of animals in scientific research is crucial in developing the knowledge underpinning many scientific and medical advances. However, animal research remains a contentious issue with a strong vocal opposition. Anti-animal research groups are large, well-funded organizations with professional staff, lobbyists, seasoned campaigners and media experts. These groups successfully promote a negative discourse on the subject of animal research, often based on misinformation and myths. Improving public understanding is central to gaining society and decision maker’s acceptance and potential support for important scientific research where animals play a central role. The recent European Citizens’ Initiative ‘Stop Vivisection’ was a clear example of how the lack of citizens’ understanding and support could result in the enforcement of poorly constructed policies in detriment of science, medicine and society. Pro-active Communications Over the past decades, scientists and their institutions were often guarded and defensive, refraining from communicating the rationale and importance of animal models in research. In many countries this approach resulted in the absence of an intelligent narrative to the public and decision makers on the benefits of animal research. The approach does not prevent those opposing these practices to access this information online, in public databases or via legislative processes. The lack of accurate communications leaves the public uninformed and prone to be persuaded by non-scientific arguments of anti-research groups. Scientific organisations are progressively shifting towards a more transparent and open way of communicating animal research. This new approach focuses on providing pro-active communications that seek to engage with the public and to actively participate in their local communities. Some objectives of this approach are 1) to develop an accessible policy statement that explains the animal welfare principles and guidelines regulating animal research at the institution, 2) to develop sound and long lasting media relationships and trust and 3) to oversee all opportunities for the institution and its staff to make the case for the importance and need of animal research. In this talk we will draw from the experiences of several research organisations across Europe. Attendees will learn how scientists, research staff and their institutions have begun to communicate about why and when animal models are used in scientific research, the regulations that need to be met before conducting any procedure on an animal and the benefits expected. We will explain what audiences are interested in learning and how to best handle myths, misconceptions and frequently asked questions. Keywords: animal research, European Directive 2010/63/EU, Communication

iMITS: supporting high-throughput strain production by CRISPR-based methods for the international mouse phenotyping consortium Peter Matthews and Terrence Meehan on behalf of the MPI2 Consortium European Molecular Biology Laboratory, European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SD, UK

123

Transgenic Res (2016) 25:195–270 Introduction: The International Mouse Phenotyping Consortium (IMPC) is building the first truly comprehensive functional catalog of a mammalian genome. This global effort requires generating and characterizing a knockout mutant strain for every protein-coding gene in the mouse genome and has produced over 2500 strains to date. The International Micro-Injection Tracking System (iMITS) is the centralized resource for the IMPC that provides tools to prevent unplanned duplications of mouse strains, identify production bottlenecks, capture QC information and provide reports to funders on progress towards milestones. Objectives: With IMPC centres increasingly using CRISPRbased methods to generate homozygous null strains, we are modifying iMITS to capture critical tracking information related to this technology. Methods: iMITS is piloting tools to determine the mutagenesis event and the corresponding transcription result based on genotyping sequence files provided by IMPC centres. This will be extended for predicted off-target sites and multiplex approaches. In addition, we are improving iMITS reporting mechanisms to reflect the faster turn around time of CRISPR-based strain production while continuing to support tracking and reporting of mouse strains produced from Embryonic Stem Cell colonies. Results and Conclusion: Sequencing files of alleles produced by CRISPR-generated methods have been successfully analyzed, mutations identified, and critical metadata incorporated into iMITS reporting mechanisms. This will ensure that iMITS remains the authoritative source for the wider scientific community on mouse strains produced by the IMPC. Keywords: CRISPR, high-throughput, IMPC

Simplification of embryo vitrification using cryovial adapters 1

K.John McLaughlin, 2N. Adrian Leu, 3Benoit Kanzler, Erin Grove

1 1

Center for Molecular and Human Genetics, Nationwide Children’s Hospital, Ohio State University, Columbus Ohio, USA; 2Center for Animal Transgenesis and Germ Cell Research, University of Pennsylvania, Pennsylvania, USA; 3 Max-Planck-Institut f. Immunbiologie u. Epigenetik, Freiburg, Germany Vitrification has several advantages over conventional slow freezing protocols including less lab time (less than 15 min), and equipment. Cryovials have several advantages over other cryopreservation devices including low cost, small storage volume and high compatibility with most freezer storage systems. Previously, a vitrification protocol was reported for embryo vitrification using a cryovial that was adapted to incorporate a micro spatula into the cryovial lid, fashioned from a laboratory pipette tip and fused to the cap by melting (Tsang and Chow, BioTechniques 46:550–552, June 2009). We used this protocol to successfully transfer 27/28 mouse strains to a new vivarium. To simplify construction of the microspatula we have developed alternative slide-in, re-useable cryovial lid inserts that can be manufactured by computer milling of polycarbonate sheet or by injection molding. This system has now been used and adopted by 5 laboratories with recovery rates typically greater than 95 % of the embryos cryopreserved. Using this device we have reduced the number of media

Transgenic Res (2016) 25:195–270 requirements for both pre and post vitrification and will report a detailed protocol at the meeting. Keywords: Cryopreservation, vitrification, cryovial CRISPRs system improves the overall efficiency in small transgenic facilities Maria Noel Meikle 1, Geraldine Schlapp1, Ana Paula Mulet1, Adriań Capoano2, Adriana Geisinger2, Martina Crispo1 1

Transgenic and Experimental Animal Unit, Institut Pasteur de Montevideo; 2Molecular Biology Unit, Instituto de Investigaciones Biolo´gicas Clemente Estable, Montevideo, Uruguay Small transgenic facilities have the great challenge to perform efficient and cost-effective services relying on research demand. The classical method of Knock-out (KO) mice production by blastocyst injection of modified ES cells is time consuming and labor intensive. Moreover, the success of this methodology strongly depends on the ES cells strain and it enables the production of chimeras instead of full-modified animals. The revolution of CRISPR/Cas9 system allows easy gene edition for specific locus targeting in the zygote genome. The aim of this study was to compare the efficiency of ES cells technology vs. CRISPR system in the generation of the same knockout mouse line. Lex3.13 (C57BL/6N) ES cells targeted with the gene of interest were obtained from TIGM consortium and microinjected into BALB/cJ blastocyst or morula-stage embryos. In a separate experiment, CRISPRCas9 RNA nuclease specific for the same gene (Invitrogen) were injected into the cytoplasm of one-cell B6D2 embryos. Our results showed that 24 ES cells microinjection sessions were needed to produce three chimeras that were fertile but unable to transmit the mutation to the germline. The post injection embryo survival rate was 87.6 % (990/1130) while the global transgenesis rate was 0.30 % (3/990). Additionally, 280 female mice were used as embryo donors and 60 foster mothers for embryo transfer. On the other hand, 31 mutant mice were produced in only four CRISPR injection sessions, 12 of them showing double mutation. Moreover, at least one of these males was fertile and produced 100 % mutant pups (13/13). The embryo survival rate after microinjection was 60.8 % (275/452) and the global transgenesis rate was 11.3 % (31/ 275). Furthermore, 31 females were used as embryo donors and eight females as recipients. Our data indicates that CRISPR mutagenesis is highly efficient and provides a rapid and costeffective alternative to traditional gene-targeting approaches in small facilities, promoting also the 3R’s principles. Keywords: CRISPR, ES cells Engineering the mouse genome using CRISPR/Cas9 technology Joffrey Mianne´, Adam Caulder, Gemma Codner, Ruairidh King, Rachel Fell, Marina Maritati, Alasdair Allan, James Jarrold, Martin Fray, Wendy Gardiner, MLC Microinjection team, Sara Wells and Lydia Teboul The Mary Lyon Centre, MRC Harwell, Didcot, United Kingdom

251 Mouse models are valuable tools to understand genes functions, genetic diseases and to develop and test new therapeutic treatments in vivo. The ability to introduce tailored modifications within the mouse genome is essential to generate these models for the study of Human diseases. The recently developed CRISPR/Cas system as genome engineering tool has brought new perspectives for the generation of mouse models in a more efficient and precise fashion, at reduced price, all within a shorter time scale. Here we will report the use of the CRISPR/Cas9 technology at the Mary Lyon Centre, MRC Harwell to introduce a wide range of modifications within the mouse genome through different methods. We will first present our high throughput mouse production pipeline allowing us to generate alleles containing indels, tailored deletions or point mutations through direct injection into zygotes. We will focus on the different parameters tested and optimised to increase the efficiency and the diversity of allele generated via this pipeline. Finally, we will introduce our pilot consisting of a new CRISPR reagents delivery strategy through in vivo testis electroporation. Developing these methods for genome engineering will enable the generation of a wide range of increasingly complex alleles in mice, both in a custom and high throughput context. Keywords: mouse, CRISPR

Comparison of the reproductive performance after unilateral or bilateral embryo transfer in mice Esther Mahabir1, Adrian Landsberger2, Sabine Manz2, Ellen Na2, Iris Urban2, Geert Michel2 1 Comparative Medicine, Center for Molecular Medicine, University of Cologne, Cologne, Germany, 2FEM, Transgenic Technologies Charite´, Berlin, Germany

Objectives: Embryo transfer (ET) is an inherent technique in contemporary animal and transgenic facilities. However, to date, there are no reports available that compares a high number of unilateral and bilateral ETs on reproductive parameters in mice. The aim of the present study was to analyze data collected over a period of 11 years to determine whether unilateral or bilateral ET influences the pregnancy rates of recipients, the percentage of pups born and litter size. Materials and Methods: For the production of in vivo two-cell embryos, female mice were superovulated by intraperitoneal injection of PMSG (5 IU, 1 to 3 p.m.) and hCG (5 IU, 1 to 3 p.m.) 48 h apart. Females were mated with the respective males immediately thereafter, and plug checks were made the following morning (Day 0.5 dpc). Plug-positive females were sacrificed on Day 1.5 dpc. IVF was performed with females, which were superovulated by intraperitoneal injection of PMSG (5 IU, 8 p.m.) and hCG (5 IU, 6 p.m.) 46 h apart. Oocytes were collected 14 h later and co-incubated with capacitated fresh epididymal spermatozoa for 4 to 5 h. After washing, oocytes were cultured for a further 20 h and the twocell embryos were selected. ETs were performed unilaterally (n = 1274) or bilaterally (n = 535) into the oviducts of CD-1 recipients with a total of 8–9, 10–11, 12–13, 14–15 and 16–17 embryos per recipient.

123

252 Results: Over all groups of embryos, the percentage of recipients giving birth after unilateral ET was generally higher than that for bilateral ET (77 vs. 70). The percentage of pups born in relation to the number of embryos transferred after unilateral ET was comparable to that after bilateral ET (32 vs. 31). The litter size with unilateral ET was generally lower than that for bilateral ET (4.3 vs. 4.7 pups). Conclusion: When 8 to 17 embryos are transferred, the results show that there is no difference in the reproductive efficiency between unilateral and bilateral ET. These results should be considered when performing ETs since unilateral ET saves time and contributes to animal welfare (refinement). Keywords: unilateral, bilateral, embryo transfer (ET), assisted reproductive technologies (ARTs)

Transgenic Res (2016) 25:195–270 of eyes for eGFP gene knockdown and Otx2 knockdown, respectively). Genotyping analyses showed targeted insertion of amiRNA sequences with efficiencies of 83 % for amiRNAeGFP and 67 % for amiRNA-Otx2. Taken together, our strategy offers a simple and efficient method to generate knockdown models using longer ssDNA. We are currently using this technology to generate conditional amiRNA expression mouse models for both eGFP and Otx2 knockdown, and also investigating whether these amiRNA knock-in alleles are successfully transmitted to the next generation and knockdown effect can be observed in adult mice. Keywords: CRISPR/Cas9, RNAi, knockdown, mice

Large-scale production of knockout mice using RNAguided nucleases Generation of knockdown mice by CRISPR/Cas9-based targeted insertion of artificial miRNA sequence Hiromi Miura1,2, Channabasavaiah B Gurumurthy3, Rolen Quadros4, Masahiro Sato5, Masato Ohtsuka1 1 Department of Molecular Life Science, Division of Basic Medical Science and Molecular Medicine, Tokai University School of Medicine, Isehara, Kanagawa, Japan; 2 Department of Regenerative Medicine, Basic Medical Science, Tokai University School of Medicine, Isehara, Kanagawa, Japan; 3Developmental Neuroscience, Munroe Meyer Institute for Genetics and Rehabilitation, University of Nebraska Medical Center, Omaha, NE, USA; 4Mouse Genome Engineering Core Facility, University of Nebraska Medical Center, Omaha, NE, USA; 5Section of Gene Expression Regulation, Frontier Science Research Center, Kagoshima University, Kagoshima, Kagoshima, Japan

RNAi-based gene silencing strategies have been used for generation of knockdown mice that exhibit hypomorphic phenotypes by repressing gene expression. Traditionally, knockdown mice are created using transgenic techniques by injecting artificial miRNA (amiRNA) expression cassettes containing a promoter, amiRNA sequence often coupled with a reporter gene and a polyA signal. In this study, CRISPR/Cas9-based genome editing method was used for generation of knockdown models by targeted insertion of ‘amiRNA sequence only’ into an intron of endogenous gene. Because many endogenous miRNA sequences have been identified in the introns, we reasoned that targeted insertion of ‘amiRNA’ sequences into introns by using CRISPR/Cas9 system would serve as a rapid and simple method for generation of knockdown mouse models. To establish this method, we used single-stranded DNA (ssDNA) of about 0.5 kb that contain amiRNA sequences against eGFP gene or Otx2 gene. Because such longer ssDNAs ([200-bases long) cannot be readily synthesized commercially, we used a method termed ‘‘in vitro Transcription and Reverse Transcription (ivTRT)’’ to synthesize long ssDNAs. We then injected these ssDNAs into the fertilized eggs derived from the eGFP transgenic mouse (for amiRNA against eGFP gene) or C57BL/ 6 mouse (for amiRNA against Otx2 gene), together with Cas9 mRNA and sgRNA targeted to an intron 6 in eEF-2 gene. The E14.5 embryos from these experiments showed expected knockdown outcomes (e.g. low eGFP fluorescence and lacking

123

Stephen A. Murray, Kevin A. Peterson, Leslie Goodwin, Susan Kales, Peter Kutny, Matthew McKay, Jocelyn Sharp, Rachel Urban

The Jackson Laboratory, Bar Harbor, ME, USA The overarching goal of the International Mouse Phenotyping Consortium (IMPC) and the Knockout Mouse Phenotyping Project (KOMP2) is to build a catalogue of gene function through the systematic generation and phenotyping of knockout (KO) mice. The Jackson Laboratory (JAX) and its consortium partners are currently transitioning from an ES cell-based production platform to the generation of mouse lines using Cas9 RNA guided nuclease technology (Cas9 RGN, also called CRISPR/Cas9). To this end we have engaged in a largescale pilot to establish a Cas9 RGN platform and to improve the efficiency of KO generation. To date, we have generated 91 new KO lines with a composite 85 % germline transmission efficiency using Cas9 RGN. Our analysis found no evidence of off target mutations in any N1 mouse examined, confirming that well-designed guides have minimal off-target risk. We have also tested the feasibility of embryo electroporation to generate exon deletion alleles, using Cas9 mRNA, Cas9 protein and a mouse line constitutively expressing Cas9. Finally, we have conducted a series of pilot experiments to generate complex alleles through homologous recombination, successfully generating both loxP-flanked and conditional inversion alleles. We will present our current progress and best practices towards these goals, providing the community with a large body of operational experience and outcomes. Keywords: Cas9, KOMP2, homologous, recombination

Cas9 RNA-guided nuclease—Efficient model generation in several strain backgrounds Lauryl M.J. Nutter1,2, Marina Gertsenstein1, Janet Rossant3 1 The Centre for Phenogenomics (TCP), Toronto, Canada; 2 Physiology & Experimental Medicine, The Hospital for Sick Children, Toronto, Canada; 3Developmental and Stem Cell Biology, Peter Gilgan Centre for Research and Learning, The Hospital for Sick Children, Toronto, Canada

Transgenic Res (2016) 25:195–270 and Department of Molecular Genetics, University of Toronto, Canada The use of Cas9 RNA-guided nuclease (RGN, aka CRISPR/ Cas9) has revolutionized mammalian genome editing. Targeted mutations can now be generated by co-injecting zygotes with guide RNAs (gRNAs) specific to the target site, Cas9 endonulcease, and a homologous repair template. The Model Production platform at The Centre for Phenogenomics (TCP) is a national facility serving both academia and industry in Canada and internationally. Since the first reports using Cas9 RGN for ‘‘onestep’’ generation of custom mouse models, investigators representing a broad spectrum of disciplines, and a wide variety of mouse research experience, have contacted TCP for model production services. The most commonly requested alleles are point mutations analogous to human disease-associated mutations; with sequence tagged and conditional alleles also being frequently requested. C57BL/6N and C57BL/6 J strains remain the most popular, but we have also successfully used 129S6/ SvEvTac, NOD/Jsd, FVB/NJ and outbred ICR(CD-1). We integrated a Molecular Biology Core with our Transgenic Core to cope with the growing demand of gene annotation and allele design, production, screening of founders and their offspring, as well as quality control of derived mouse lines. Here we show the methods and strains that we have used to successfully produce requested point mutant alleles, with an overall success rate of *80 % for 18 different loci in the C57BL/6 backgrounds. We also discuss the challenges we have faced, and the methods we have attempted to use, trying to produce sequence-tagged and conditional alleles. Keywords: Cas9 RNA-guided nuclease, point mutation, disease model production

High-throughput knockout mouse production using Cas9 RNA-guided nuclease Lauryl MJ Nutter1,2, Shinya Ayabe3, Gemma Codner4, Brendan Doe5, Graham Duddy5, Angelina Gaspero6, Leslie Goodwin7, Jason Heaney6, Susan Kales7, Denise Lanza6, Kent KC Lloyd8, Joffrey Mianne4, Stephen A Murray7, Yuichi Obata3, Kevin A Peterson7, Ramiro Ramirez-Solis5, Ed Ryder5, John Seavitt6, Lydia Teboul4, Sara Wells4, Brandon Willis8, Atsushi Yoshiki3

253 IMPC has produced more than 4000 knockout mouse lines from publicly available ES cells. Many of these have completed broad-based phenotyping that assessed the consequences of gene dysfunction across all major body systems. The phenotyping of these lines has provided insight into many areas of disease and development. With the introduction of the Cas9 RNA-guided nuclease (RGN aka CRISPR/Cas9) as a tool for genome editing in mice, many IMPC centres began testing the utility of Cas9 RGN for high-throughput knockout mouse production. The IMPC is uniquely positioned to systematically test Cas9 RGN approaches at a genomic scale. Here we present a summary of the allele designs, methods and results from several IMPC members. With more than 400 unique genes across the genome targeted, our work informs expectations and best practices for the production of knockout mice using Cas9 RGN. Several centres have also conducted off-target analysis to examine the fidelity of Cas9 RGN targeting in mouse zygotes. Members of the IMPC have determined that Cas9 RGN is a reliable, cost-effective and efficient method for producing knockout mice for phenotyping. Ongoing work at various centres, presented elsewhere at this meeting, aims to develop broadly applicable methods for the production of more sophisticated alleles, such as conditional and reporter alleles. The mouse lines produced by the IMPC are available from associated repositories including the CMMR (www.cmmr.ca), EMMA (www.infra frontier.eu), KOMP Repository (www.komp.org), MMRRC Repository (www.mmrrc.org), RIKEN BioResource Centre (en.brc.riken.jp), and elsewhere. In conclusion, the IMPC will provide a set of bioresources (mouse lines), phenotyping data, and methodology for genetic engineering in mice that will be of long-term utility to the scientific community. Keywords: Cas9, high throughput, null alleles

A knockin mouse with a missense mutation in the H/KATPase ATP4a gene, mimics an aggressive familial form of gastric type I neuroendocrine tumors in humans. Assessment of new therapeutic strategies Oriol Calvete1,2, Pierfrancesco Vargiu3, Andrea Varro4, Marta Oteo5, Miguel Angel Morcillo5, Alicia Barroso1, Mark Pritchard6, Jose´ Reyes7, Miriam Garcıá3, Jaime Munõz3, Javier Benitez1,2,* and Sagrario Ortega3,* 1

Physiology & Experimental Medicine, The Hospital for Sick Children, and 2The Centre for Phenogenomics, Toronto, Ontario, M5T 3H7, Canada; 3RIKEN BioResource Center, Ibaraki, 305-0074, Japan; 4Mary Lyon Centre, MRC Harwell, Oxfordshire, OX11 0RD, UK; 5The Wellcome Trust Sanger Institute, Hinxton, Cambridge, CB10 1SA, UK; 6Department of Molecular and Human Genetics, Baylor College of Medicine, Houston TX 77096, USA; 7The Jackson Laboratory, Bar Harbor, ME 04609, USA; 8Mouse Biology Program, UC Davis, Davis, CA 95618, USA

Human Genetics Group, Spanish National Cancer Research Centre (CNIO), Madrid, Spain; 2Spanish Network of Research on Rare Diseases (CIBERER); 3Transgenic Mice Unit, National Cancer Research Centre (CNIO), Madrid, Spain; 4Department of Physiology, University of Liverpool, Liverpool, UK; 5Centro de Investigaciones Energe´ticas, Medioambientales y Tecnolo´gicas (CIEMAT); 6 Department of Gastroenterology, Institute of Translational Medicine, University of Liverpool, L69 3GE Liverpool, UK; 7Department of Gastroenterology, Hospital INCA. 07300 Majorca, Spain. * JB and SO are co-corresponding authors

The International Mouse Phenotyping Consortium (IMPC) is a global multi-centre collaboration that aims to produce and phenotype single-gene knockout mice for every protein-coding gene in the mouse genome. In four years, 2011–2015, the

We recently described a missense mutation (R703C) in the human ATP4a (H/K-ATPase alpha) gene, a proton pump that regulates gastric acidification, in homozygous individuals that develop aggressive familial type I gastric neuroendocrine

1,2

123

254 tumors. These patients exhibit an early onset of the disease characterized by hypochlorhydria, hypergastrinemia, ferropenic anemia and nodal and intestinal metaplasia. Gastrectomy is the only treatment available for these patients that otherwise develop gastric carcinoid and carcinoma with time. To validate this mutation as the cause of carcinoid tumours in humans and to develop a model of this disease we have generated a knockin mouse that reproduces the human ATP4a R703C mutation found in patients. Homozygous mice develop most of the symptoms found in patients: achlorhydria, hypergastrinemia and iron-deficiency. Up to 1 year of age these mice develop severe gastric hyperplasia/displasya but, unlike human patients, they do not develop carcinoid or adenocarcinoma. Interestingly, artificial gastric acidification by feeding the mice 3 %ClH-water caused both prevention (treatment since birth) and reversion (treatment starting at 150 or 250 days of age) of the phenotype. In summary our model validates the R703 mutation as the initial cause of the disease relating achlorhydria with carcinoid development and provides a unique animal model to gain insight into the pathology of these patients. Our results open also a new venue for a treatment of these patients by regulating stomach acidification. Keywords: Mouse model/gastric carcinoid/

Developing transgenic tools to study Notch signaling in intact neural stem cell niches of the adult vertebrate brain in vivo Sara Ortica Gatti, Nicolas Dray, Se´bastien Bedu, Isabelle Foucher, Laure Bally-Cuif DevEvo Department, Paris-Saclay Institute for Neuroscience (Neuro-PSI), Gif-sur-Yvette, France The adult vertebrate brain harbors restricted sites of active neurogenesis, where glia and neurons can be generated from a pool of adult Neural Stem Cells (aNSCs). The vast majority of these cells are quiescent, but can be activated and reenter in the cell cycle when recruited. This balance between quiescence and activation needs to be finely regulated to ensure aNSC pool maintenance and neuronal production. Our goal is to understand the molecular and cellular mechanisms regulating aNSC homeostasis, using the zebrafish dorsal telencephalon, which is highly enriched in aNSCs, as a model. Our group previously demonstrated that Notch3 signaling controls homeostasis of the telencephalic aNSC pool by maintaining quiescence. We now aim to investigate whether and how fluctuations of Notch3 activity control the spatiotemporal pattern of aNSC activation at the population level across the germinal zone. To address this question, we are developing two Notch3 reporter transgenic lines. Both are based on the fact that, upon signaling, Notch3 is cleaved at the membrane and its C-terminal fragment N3ICD is translocated into the cell nucleus to directly regulate target gene transcription. As a first line, we are generating a classical Notch reporter line, Tg(her4:Venus-PEST-3’UTRher4). This line will express a destabilized Venus fluorophore under the control of the promoter and regulatory elements of her4, an E(spl) gene known to be a Notch target in aNSCs. Currently, Venus-PEST expression has been verified in F0 fish and these animals are

123

Transgenic Res (2016) 25:195–270 being grown. For the second line, we take advantage of the CRISPR/Cas9 system to knock-in in frame two fluorophores (AzamiGreen and nuclear RFP) at the 30 end of the coding portion of the genomic Notch3 sequence. These two fluorophores are separated by the P2A sequence, which is constitutively cleaved during translation. We will measure Notch activity as a ratio between AzamiGreen (visible at the membrane when Notch3 is expressed, and translocated into the nucleus when Notch3 is activated) and RFP signal (always nuclear). First knock-in trials using a Non-Homologous EndJoining repair strategy were ineffective, and led to off-target effects. We thus decided to switch to Homology-Directed Repair strategy, to precisely target Notch3 end. Our progress will be reported. With these reporter lines, we will monitor Notch activity in aNSCs using a new live imaging method developed in the laboratory. We will then be able to describe the spatiotemporal pattern of Notch3 activation and to correlate it with aNSC division events. Keywords: Neural Stem Cells, Notch reporter lines, CRISPR/ Cas9

Generation of targeted overexpressing models by CRISPR/Cas9 and need of careful validation of your knock-in line obtained by nuclease genome editing Guillaume Pavlovic1, Vale´rie Erbs1, Philippe Andre´1, Jacquot Sylvie1, Benjamin Eisenman1, Dominique Dreyer1, Romain Lorentz1, Marie Wattenhofer-Donze1, Marie-Christine Birling1, Yann He´rault1,2 1 Institut Clinique de la Souris, PHENOMIN, CNRS UMR7104, INSERM U964, Universite´ de Strasbourg, 1 rue Laurent Fries BP 10142 Parc d’Innovation 67404 Illkirch, France; 2Institut de Geńe´tique Biologie Molećulaire et Cellulaire (IGBMC), CNRS, INSERM, Universite´ de Strasbourg, UMR7104, UMR964, Illkirch, France

Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) protein 9 system has been described as a robust and multiplexable genome editing tool, enabling researchers to precisely manipulate specific genomic elements, and facilitating the elucidation of target gene function in biology and diseases. We used the CRISPR/Cas9 system to facilitate the generation of knock-in mouse models. In vitro, to increase the homologous recombination rate, we have electroporated different targeting vectors in ES cells in addition of a vector expressing both Cas9 and a target specific gRNA. We were able to recover projects which failed previously and increased considerably the number of positive clones in projects which gave only few positive clones without CRISPR. We have currently recovered more than 10 projects for which we were not able to obtain any targeted ES cells (in some case we screened previously more than 1500 ES cells) by standard electroporation. In vivo, we coinjected a ROSA26 targeting vector that contains a 6.9 kb conditional transgene and CRISPR/Cas9 gRNA and mRNA in mouse zygotes. After implantation of 1 000 eggs, we eventually obtained one positive knock-in mouse.

Transgenic Res (2016) 25:195–270 We then proceeded to a careful validation of the mutant ES cells and of the 6.9 kb ROSA26 mouse line. Here, we will demonstrate that the different constructs were integrated as ‘concatemers’ at the target site for more than 50 % of the tested mutant ES cells and for the knock-in line generated by pronuclear injection when the targeting vector is electropored or injected as circular template. We will point out that very careful validation of the knockin lines generated by CRISPR/Cas9 is requested, propose a mechanism of action and show that CRISPR/Cas9 can be used to generate overexpressing models with a transgene integrated in multiple copies, all in the same orientation, at a targeted locus. Keywords: CRISPR, concatemers, overexpression, genome editing, model validation

The questions you should ask yourself for efficient CRISPR/Cas9 genome editing Guillaume Pavlovic1, Pascale Mercier3, Vale´rie Risson4, Philippe Schmitt5, Marie-Christine Birling1, Francina Langa6, Suzy Markossian4, Lydia Teboul7, Erwana Harscoet8, Karelia Lipson9, Sandra Offner10, Fabien Angelis11, Isabelle Barde10, Matthieu Bringart12, Jean-Paul Concordet13, Fre´de´ric Fiore11, Te´re´sa Jagla14, Laurent Tesson15, Jean-Ste´phane Joly16 and Yann He´rault1,2 1

Institut Clinique de la Souris, PHENOMIN, CNRS UMR7104, INSERM U964, Universite´ de Strasbourg, 1 rue Laurent Fries BP 10142 Parc d’Innovation 67404 Illkirch, France; 2Institut de Genetique Biologie Moleculaire et Cellulaire (IGBMC), CNRS, INSERM, Universite´ de Strasbourg, UMR7104, UMR964, Illkirch, France; 3Centre National de la Recherche Scientifique, Institut de Pharmacologie et de Biologie Structurale, F-31077 Toulouse, France; 4Institut de Geńomique Fonctionnelle de Lyon, Universite´ de Lyon, Centre National de la Recherche Scientifique (CNRS), Institut National de la Recherche Agronomique, Ećole Normale Supe´rieure de Lyon, 69364 Lyon, France; 5CELPHEDIA, CNRS, 1 rue Laurent Fries BP 10142 Parc d’Innovation 67404 Illkirch, France; 6Centre d’Ingeńierie Geńe´tique Murine, Institut Pasteur, Paris, France; 7The Mary Lyon Centre, Medical Research Council, Harwell, Oxfordshire OX11 0RD, UK; 8INRA UMR1198, Biologie du De´veloppement et Reproduction, Jouy en Josas, France; 9SEAT, Villejuif; 10School of Life Sciences and Frontiers in Genetics Program, Ecole Polytechnique Fe´de´rale de Lausanne (EPFL), 1015 Lausanne, Switzerland; 11Centre d’Immunopheńomique (CIPHE), Aix Marseille Universite´, Marseille, France; 12 INSERM-US006 CREFRE (Centre Re´gional d’Exploration fonctionnelle et Ressources Expe´rimentales) Toulouse; 13 TACGene, Museúm National d’Histoire Naturelle, CNRS UMR 7196, INSERM U565, Paris F-75231, France; 14 Genetics, Reproduction and Development, Institut National de la Sante´ et de la Recherche Me´dicale U931, Centre National de la Recherche Scientifique UMR6247, Clermont University, Clermont-Ferrand, France; 15INSERM UMR

255 1064-ITUN, Centre Hospitalier Universitaire de Nantes, Faculte´ de Me´decine, Nantes, France; 16TEFOR, Centre National de la Recherche Scientifique, Gif-sur-Yvette, 91190, France Since Cong et al. Science publication in February 2013 that first demonstrated the use of type II CRISPR/Cas9 system to engineer eukaryote genome, Cas9 nucleases directed by short RNAs have emerged as a revolution for genome editing, allowing precise gene modification in virtually any species. Enthusiasm from the international scientific community for this technology is illustrated by the huge and growing number of publications including the acronym « CRISPR » . In 2014 and 2015, more than 1700 papers can be retrieved, which is incredible for such a recent discovery. During this very short 2-year period, improvements followed one another, including new Cas9 proteins or use of Non Homologous End Joining inhibitors. However, most of these developments were validated with very low number of cases and thus need confirmations. Moreover, all PROs and CONs, possibilities, bias like mosaicism or off-target events are far from being completely understood. Correctly designing a CRISPR/Cas9 gene editing experiment can still be challenging, especially for complex modifications. CELPHEDIA, a large scale French network aims to develop innovative and standardized technological approaches in animal genetics. It gathers experts using CRISPR/Cas9 system in various models including mouse, rat, zebrafish and drosophila. By sharing our knowledge, experience and an extensive bibliographic review, we have worked together to write some recommendations, available as frequently asked questions (FAQ) on www.celphedia.eu. Our goal is to help scientists who want to use the CRISPR/Cas9 technology for gene editing by summarizing current advances on many technical aspects, from the RNA guide optimized design to the genotyping analysis and the validation of the newly generated models. Keywords: Frequently askeds questions, CRISPR, genome editing, optimization

Improving the efficiency of Cas9/CRISPR genome engineering by optimizing Cas9 delivery Pawel Pelczar1, Heide Oller1, Mara Kornete2, Dietmar Schreiner3, Mario Hermann4, Lukas Jeker2 1 Center for Transgenic Models, University of Basel, Basel, Switzerland; 2Department of Biomedicine, University of Basel, Basel, Switzerland; 3Biozentrum, University of Basel, Basel, Switzerland; 4Institute of Laboratory Animal Science, University of Zurich, Zurich, Switzerland

The advent of the Cas9/CRISP-mediated genome editing has revolutionized mouse genome engineering by allowing targeted genome alterations to be carried out directly in mouse oocytes. While simple NHEJ-mediated knockouts can generally be achieved with good efficiency, the more complex modifications achieved via homologous recombination are more difficult and require higher Cas9 cleavage efficiencies. We have investigated whether the mode of Cas9 delivery into the mouse oocyte can influence the overall cleavage efficiency

123

256


mediated by the same set of gRNAs. We found that that coinjection of gRNA and Cas9 protein or injection of gRNA into oocytes of Cas9 overexpressing strains resulted in higher editing efficiencies when compared to co-injection of gRNA and Cas9 mRNA. The efficiency of genome editing using Cas9 mRNA could be improved by staggering the delivery of Cas9 mRNA and gRNA in time demonstrating that reaching high levels of Cas9 protein and circumventing low gRNA stability are important considerations for optimal Cas9 activity. Keywords: Cas9, transgenic mice, oocyte microinjection

Generation of Gal-KO bovine fibroblast colonies using CRISPR/Cas9 technology and magnetic beads selection 1

1

1

Andrea Perota , Irina Lagutina , Corinne Quadalti , Roberto Duchi1, Paola Turini1, Gabriella Crotti1, Silvia Colleoni1, Giovanna Lazzari1,3, Cesare Galli1,2,3 1

Avantea, Laboratorio di Tecnologie della Riproduzione, Cremona, Italy; 2Dept. of Veterinary Medical Science, University of Bologna, Ozzano Emilia, Italy; 3Avantea Foundation, Cremona, Italy Site-specific nucleases (ZFN, Tal Effector Nucleases and CRISPRs) boosted the genome editing in mammals as well as in the bovine (Proudfoot C. et al., Wei et al., 2015; Jeong YH et al. 2015; Heo YH et al., 2015). As part of a xenotransplantation project where SCNT is scheduled, we developed a system to quickly select bovine GGTA1 knockout colonies produced with CRISPR/Cas9 technology. Using Zhang’s expression system (pX330), 10 gRNAs targeting sequences were tested for bovine GGTA1 (exon6) gene. Primary bovine fibroblasts cultured in DMEM + M199 (1:1) + 10 % FCS in 5 %CO2, 5 %O2, were transfected using Nucleofector (V-024 program). Each sequenced verified expression vector (2 lg) was transiently transfected (1 9 106 cells) and after 72 h the resulting pools were analysed using the Surveyor assay. All guides for GGTA1 gene were ineffective. To overcome the low efficiency of CRISPR/Cas9 system for bovine GGTA1 gene, we decided to use 2 gRNAs targeting sequences overlapping for 17 nucleotides and 2 9 106 bovine fibroblasts were co-transfected with pX330-btGGTA 1cr6 + pX330btGGTA1cr7. Transfected cells were plated in a 60 mm Petri dish and cultured for 4 days when they were sub-cultured 1 to 3. On day 7, about 4.2 9 103 (0.06 %) Galnegative cells were selected from total 6.5 9 106 cells using biotin-conjugated IB4 lectin (Sigma) attached to streptavidincoated magnetic beads (Dynabeads M-280, Thermo Scientific). This result confirmed the data obtained with Surveyor assay, demonstrating that the use of 2 overlapping GGTA1-gRNAs targeting sequences is not effective in increasing the GGTA1 editing efficiency (0.02 %). However, we obtained 41 well growing colonies that were analysed for gene specific PCR in order to select the suitable ones for SCNT (Lagutina et al., 2006). Gel electrophoresis of resulting bovine GGTA1-PCR products on high-resolution agarose (3 %, Alfa Aesar), revealed that in all colonies different mutations (Insertions and/or Deletions) occurred. Further RFLP analysis (HinfI) on 13 randomly chosen GGTA1-PCR products showed us that the HinfI restriction site, existing between the two cutting sites, was deleted confirming the solid reliability of beads selection

123

previously done. Finally, sequencing results validated that all 13 colonies were knockout for the bovine GGTA1 gene. In conclusion, combining beads-mediated selection with tergeted molecular analyses, we developed an express assay that could be easily followed to efficiently detect desired GGTA1mutated colonies suitable for the SCNT. This work is supported by by European FP7 grants Translink (n 603049) and Xenoislet (n 601827). Keywords: CRISPR/Cas9, Gal-KO, bovine

Generation of genome-modified mice by various procedures of CRISPR/Cas9 system 1

Karolina Piotrowska-Nitsche, 1Teresa Quackenbush, Yao Huang, 1,2Tamara Caspary

1 1

Transgenic Mouse/Gene Targeting Core Facility, Emory University School of Medicine, Atlanta, USA; 2Department of Human Genetics, Emory University School of Medicine, Atlanta, USA As the popularity of generating mouse models using CRISPR/ Cas9 has grown, it is critical for core facilities to be able to generate animals using the most streamlined approach. Towards that end, Emory’s Transgenic Mouse Core Facility has compared a number of delivery methods including pronuclear injection, cytoplasmic injection and electroporation of zygotes. Additionally, we have used CRISPR RNAs that were in vitro transcribed and purified as well as synthetic sgRNA (tracr RNA and crRNA) reagents. We used Cas9 protein in conjunction with the synthetic RNA reagents. Finally, we tested culturing the injected zygotes to blastocyst stage and using a non-surgical embryo transfer device, which greatly lowers our labor costs and mouse usage. Here we present our projects on several classes of genetic modifications (editing, point mutations, large deletions) using each of these methods and reagents. Our Core is partnered with Sigma so our customers work first with Sigma who design, validate and produce the CRISPR reagents. Sigma also provides donor design and in the case of oligo donors, synthesis. The Emory Integrated Genomics Core produces any plasmid donors and prepares the plasmid using a RNase-free kit to ensure the integrity of the CRISPR reagents. This workflow enables our mouse core to work with validated, high quality reagents. We compared the efficiency of CRISPR/Cas9-mediated genome editing using pronuclear injection, cytoplasmic injection and electroporation of zygotes. Our pronuclear injections resulted in 28 % of NHEJ mutations. To improve the throughput of generating mice carrying targeted mutation, we used cytoplasmic injection along with a higher concentration of CRISPR/Cas9 reagents. Based on the publication of the electroporation procedure published by Qin et al. (Genetics, 2015), we electroporated zygotes with several steps adjusted to improve the embryo survival. Our data show higher rate of embryo implantation and birth following the electroporation when compared to pronuclear injection procedure. Additionally, electroporation requires a higher concentration of CRISPR reagents relative to injection and switched to synthetic sgRNA (tracr RNA and crRNA) as it was faster and more costeffective than purified CRISPR RNA. We used sgRNA in

Transgenic Res (2016) 25:195–270 combination with Cas9 protein or synthetic Cas9 RNA. When we used protein, we pre-incubated it with the sgRNA to form a complex that we then electroporated in zygotes. Here we present our results to date along with the relative cost of each. The cost-benefit analysis enables us to optimize the approach and successful generation of novel mouse allele for Investigators. Keywords: Mouse, CRISPR/Cas9, protein, synthetic sgRNA, injection, electroporation

Dopamine beta hydroxylase as a determinant of hemodynamic and metabolic traits in the spontaneously hypertensive rats Michal Pravenec1, Vladimı´r Landa1, Vaćlav Zı´dek1, Petr Mlejnek1, Jan Sˇilhavy´1, Sucheta M. Vaingankar2, Theodore W. Kurtz3 1 Institute of Physiology, Czech Academy of Sciences, Prague, Czech Republic; 2University of California, San Francisco, U.S.A.; 3University of California, San Diego, U.S.A

The spontaneously hypertensive rat (SHR) is the most widely used animal model of essential hypertension, left vetricular hypertrophy and metabolic disturbances. Catecholamines play important role in the pathogenesis of essential hypertension and lipid and glucose metabolism. Recently, we used integration of transcriptional, biochemical and linkage analyses in the adrenal tissue of the BXH/HXB recombinant inbred strains, derived from the spontaneously hypertensive rat (SHR) and Brown Norway (BN) progenitors and obtained evidence for cis-regulated decrease in transcription of dopamine beta hydroxylase (Dbh) gene in the SHR (Jirout et al., Hum Mol Genet 19:2567–80, 2010). In the current study, we used Sleeping Beauty transgenic technique to test the hypothesis that genetically determined reduced expression of Dbh gene represents the primary genetic mechanism for regulation of catecholamine action, blood pressure and metabolic traits in the SHR. We derived a new transgenic SHR-Dbh strain expressing Dbh cDNA under control of the BN endogenous promoter. We found that increased expression of Dbh in transgenic rats versus SHR controls was associated with reduced adrenal dopamine while levels of epineprine and norepineprine were similar in the adrenals, increased plasma epineprine and norepineprine, but not dopamine, and reduced levels of norepinephrine in the brainstem. These changes in catecholamine metabolism were associated with increased blood pressure and increased left ventricular weight. In addition. SHR-Dbh transgenic rats exhibited higher norepinephrine stimulated oxidation of glucose in the heart measured ex vivo. SHR-Dbh transgenic rats versus SHR controls also showed increased glycemia, reduced serum triglycerides and increased levels of ketone bodies. Skeletal muscle of transgenic rats contained significantly lower triglyceride and higher glycogen levels. These findings strongly suggest that genetically determined reduced levels of dopamine beta hydroxylase transcription and protein levels protect the SHR against hypertension. In addition, our results provide compelling evidence for important role of Dbh expression in

257 regulation of glucose and lipid metabolism in the SHR. Thus mutant Dbh exhibits pleiotropic effects by affecting several components of metabolic syndrome in the SHR. Keywords: spontaneously hypertensive rat, dopamine beta hydoxylase, catecholamines, transgenic, hypertension, glucose and lipid metabolism

Generation of transgenic and CRISPR/Cas9 KO/KI rat and mouse models at the UAT Ana Arbo´s, Sandra Turoń, Miquel Garcia, Fa`tima Bosch and Anna Pujol Transgenic Animal Unit (UAT), Center for Animal Biotechnology and Gene Therapy Center (CBATEG), Universitat Auto`noma de Barcelona (UAB), Spain Since the CRISPR/Cas9 system was described as a tool for genome editing, it has become a revolution in the field of animal transgenesis. CRISPR/Cas9 is part of the immune system of bacteria and archaea. It is a RNA guided DNA endonuclease system which targets specific DNA sequences generating double strand breaks. The DNA repair mediated by NHEJ or HDR leads to the introduction of mutations in the target site. The specificity of the system relies only on the sequence of a 20nt guide RNA (gRNA) that is easy to be designed and obtained. Moreover the very high efficiency of this system allows the generation of mutant animals by direct injection in one-cell embryos, avoiding the need of embryonic stem cells. This makes the process of KO and KI animal generation straightforward and available to species other than mouse. Due to the benefits of using rats as animal models for several studies like on neurological sciences or toxicology, our unit has set up the generation of transgenic models in this specie. Here we present the generation of conventional transgenic rats by pronuclear injection and the use of CRISPR/Cas9 system to generate knockout (KO) and knockin (KI) mouse and rat models in the Transgenic Animal Unit (UAT). Keywords: Transgenic rats, CRISPR/Cas9, rat models, mouse models, Knockout, knockin, genome editing

Use of CRISPR/Cas9 technology combined with ssODNs to obtain a specific mono-allelic amino acid substitution in the TDP43 protein for the generation of a swine model of Amyotrophic Lateral Sclerosis (ALS) Corinne Quadalti1,2, Andrea Perota1, Irina Lagutina1, Giovanna Lazzari1,3, Paola Crociara4, Maria Novella Chieppa4, Cristina Casalone4, Cristiano Corona4, Valentina Bonetto5, Cesare Galli1,2 1

Avantea-Laboratorio di Tecnologie della Riproduzione, Cremona, Italy; 2Dept.of Veterinary Medical Science, University of Bologna, Ozzano Emilia, Italy; 3Avantea Foundation, Cremona, Italy. 4Istituto Zooprofilattico Sperimentale PLV, Torino, Italy; 5Istituto Di Ricerche Farmacologiche Mario Negri, Milano, Italy The TAR DNA-binding Protein 43 (TDP43) was found to be the major constituent of the characteristic intracellular

123

258 inclusions present in ALS and different studies linked the presence of missense dominant mutation in the TARDBP gene with the onset of the pathology [Janssens and Van Broeckhoven 2013]. One of the most characterized mutation is the A382T [Lattante et al. 2013]. The aim of this study is to generate a swine fibroblast cell line carrying the A382T specific mono-allelic substitution on the swine corresponding TARDBP gene. The CRISPR/Cas9 system is used in association with ssODNs to direct the repair in a strictly specific manner [Aarts and te Riele, 2011]. Due to the known low repair efficiency of this system [Bialk et al. 2015], we designed three ssODNs characterized by the presence of the mutations of interest and an additional restriction site (MunI) that for the colonies screening. The ssODN S is 90 bp long, shifted of 10 bp from the codon of interest; ssODN C is identical to S, but centred with the codon of interest; ssODN CL is 100 bp long and centred. All ssODNs being complementary to the translated strand. Experiments using ssODN S produced a total of 135 colonies in 3 replicates, 13 out of 135 (10 %) positive for MunI screening. Sequencing analysis showed that only one colony out of 13 (8 % of selected, 1 % of tot) have the correct insertion of the ssODN and is a biallelic insertion. Other colonies have additional mutations probably due to the insertion/repair mechanism. Preliminary experiment were done for ssODN C and CL: C produced 30 colonies, 3 (10 %) were selected after MunI screening and 2 (66 % of selected, 7 % of tot) out of 3 selected resulted to be homozygous for the correct insertion of the oligo after sequencing. The ssODN CL produced 30 colonies, none of which positive after MunI screening. The preliminary results obtained with the co-trasfection of our CRISPR/Cas9 system and ssODN C showed a significantly higher repair efficiency (10 %) compared with the other ssODNs tested (0–1 %), which are in line with the current literature. To date, the number of ssODN C colonies analysed is not statistically significant and further replicates are needed to confirm these results. We are confident that this system could improve the probability to find the mono-allelic substitution of interest. Acknowledgment: Bando Progetti di Ricerca Giovani Ricercatori Ricerca Finalizzata 2010 GR-2010-2312522 Keywords: ALS animal model, ssODN, CRISPR/Cas9

Gene edited rats by delivery of Cas9 protein using electroporation Se´verine Remy1,2, Vanessa Quillaud-Chenouard1,2, Laurent Tesson1,2, Se´verine Meńoret1,2, Claire Usal1,2, Lucas Brusselle1,2, Tuan Huan Nguyen1,3, Anne De Cian 4, Carine Giovannangeli4, Jean-Paul Concordet4, and Ignacio Anegon1,2 INSERM UMR 1064-ITUN, CHU de Nantes, Nantes F44093, France; 2 Platform Transgenic Rats and ImmunoPhenomics; F44093 Nantes, France; 3 Platform GenoCellEdit Nantes; F44093 Nantes, France; 4 INSERM U565, CNRS UMR7196, Museum National d’Histoire Naturelle, F75005 Paris, France The development of highly specific gene-specific nucleases, especially CRISPRs/Cas9 system, represents a unique tool to

123

Transgenic Res (2016) 25:195–270 induce targeted modifications. However, even if the efficiency of these techniques is high, the delivery into embryos of DNA or messenger RNA encoding nucleases, alone or in combination with donor DNA, is time consuming and demands high technical skills. Electroporation emerges as a simple and a promising alternative for the efficient introduction of DNA/ RNA into embryos. In this work, we aimed to deliver, by this method, purified recombinant Cas9 protein and sgRNA mRNA complexes with short or long donor DNAs, into rat zygotes with an intact zona pellucida. Two loci, previously targeted using microinjection, were chosen to evaluate mutations by non-homologous end joining (NHEJ) and insertion by homology-directed repair (HDR) of either ssODNs or an expression cassette encoding GFP (*3 kb) flanked by homology arms (0.8 kb each). Concentration of the delivered components and parameters of electroporation, including voltage, pulse duration and number of pulses were optimised to allow the maximum efficiency with minimum negative impact on embryo development. On the 6 tested parameters, embryo survival rates (up to 60 electroporated simultaneously) varied from 60 to 100 % one hour after electroporation and from 45 to 90 % after 5 days culture in vitro. We noted no impact on the development in utero since we obtained live birth rates (from 20 to 40 %) similar as those observed from microinjected embryos. Cas9 protein electroporation caused mutations, including NHEJ and HDR events, in 5 to 25 % of electroporated embryos (1.2 to 3 fold more than using microinjection), depending on the applied voltage, pulse duration and dose of Cas9, sgRNA and donor DNA. Importantly, ssODNs generated precise heterozygous and homozygous knock-in mutations in 3.33 to 10.5 % of electroporated embryos with DNA concentrations varying between 100 and 200 ng/ll. The same electroporation conditions did not allow HDR of the long expression cassette despite high NHEJ (from 10 to 24 %) and successful HDR we previously observed (1.7 %) when the same components were microinjected. In conclusion, our results demonstrate that electroporation of CRISPR/Cas9 component, in the form of a protein/RNA complex, enabled both gene-inactivating mutations by NHEJ and targeted insertion of ssODNs with high efficiency, 1.5 to 3-fold more than using microinjection and in a large number of embryos processed simultaneously, considerably shortening the procedure and thus increasing productivity. Further optimization should be realised to obtain HDR for long doublestrand DNA donors in rat zygotes. Keywords: genome editing, Cas9 protein, electroporation, HDR, rats

Inquiring the genome: the use of CRISPR-Cas technique in a transient transgenic strategy to interrogate regulatory element function I. Rollań, M. Go´mez, T. Rayoń, C. Badıá and M. Manzanares Department of Functional Genomics, Centro Nacional de Investigaciones Cardiovasculares, Madrid, Spain The main question in Developmental Biology is to understand how a single cell becomes a complex multicellular organism.

Transgenic Res (2016) 25:195–270 For this purpose, gene expression must be tightly controlled in time and space. This control can be carried out by regulatory elements lying throughout the genome. Regulatory elements can be clustered with the genes they regulate and remain relatively near from them, but sometimes they are located few megabases away. In such case, it is necessary for the genome to adapt a three-dimensional form in order to get both elements into contact. The functioning of these regulatory elements is complex and strictly dependent on the interactions that each element has with other proximal and distal sequences within a genomic locus. For this reason, targeting the endogenous locus is the tool of choice to study such elements in their original chromosomal context. We use the CRISPR-Cas9 technique in our laboratory in order to unravel the tangle of this genomic organization. To do this, we interrogated two different locus: Cdx2 and IrxA. We performed our screening at three different levels by: •

•

•

Generating Cdx2 KO blastocyst, targeting the first exon of the gene. In this case, we reached a deletion efficiency of almost 90 %. Deleting a CTCF binding site between Irx2 and Irx4 This deletion gave rise to same phenotype obtained in the CTCF KO in the embryonic heart: downregulation of Irx4. Directing targeted integration of a ‘‘regulatory domain reader’’ cassette (RDR-cassette), in order to elucidate the regulatory landscape, which is acting in a particular region of the genome.

The goal of this approach is to apply these questions in a transient transgenic manner. Keywords: CRSIPR-Cas, regulatory elements, transient transgenic

A vector with a single promoter for in vitro transcription and mammalian cell expression of CRISPR gRNAs Peter J. Romanienko1, Joseph Giacalone, Joanne Ingenito, Yijie Wang, Mayumi Isaka, Thomas Johnson, Yun You1 and Willie H. Mark1 Mouse Genetics Core Facility, 1 Developmental Biology Program, Sloan Kettering Institute, Memorial Sloan Kettering Cancer Center, New York, NY USA The genomes of more than 50 organisms have now been manipulated due to rapid advancement of the gene editing technology. To perform gene editing in mice, the CRISPR/CAS system is commonly used. In most cases, guide RNA (gRNA) and CAS9 mRNA transcribed in vitro are microinjected into fertilized eggs, the injected zygotes are allowed to develop to term, and founder animals obtained are examined for the appropriate genetic modification. As a rule, our Core Facility first test the gRNAs in tissue culture cells and the one with the highest locus-specific cleavage activity is chosen for microinjection. For cell transfections, gRNAs are typically expressed from the human U6 promoter (hU6) in a plasmid vector. However, gRNAs for microinjection are synthesized by in vitro transcription from the bacteriophage T7 promoter using a separate expression vector. To eliminate this two step process, we have constructed a vector containing a U6T7 fusion promoter from which the same gRNA sequence can be expressed. This vector with the combined

259 U6 and T7 promoters can now be used to generate gRNA for testing in mammalian cells as well as for microinjection into mouse zygotes to produce the desired gene edited animal. Data will be presented to show that gRNAs expressed and transcribed from this vector cleave target loci efficiently in cells as well as in mice (PLOS One, manuscript under revision; plasmids deposited in Addgene). We will also share our Core Facility’s overall experience in gene editing using such gRNAs to generate different types of genetic alterations at various target loci in the mouse genome. Data will be shown and compared for TALEN and CRISPR promoted gene editing in mice by microinjection of RNAs into the mouse pronucleus. Keywords: CRISPR Gene Editing U6 T7 Promoter Cas9 indel microinjection mice gRNA

Optimisation and high-throughput production of CRISPR/Cas9-mediated knockout mouse strains Ed Ryder, Brendan Doe, Barry Rosen, Joanna Bottomley, Graham Duddy, Mark Thomas, Ellen Brown, Diane Gleeson, Dominique Von Schiller, Debarati Sethi, Michael Woods, Sanger Mouse Genetics Project, Ramiro Ramirez-Solis Wellcome Trust Sanger Institute, Hinxton, Cambridge, CB10 1SA, UK The creation of targeted mutations by the use of CRISPR/Cas9 gene editing has revolutionised the process and possibilities of altering the function of genes in a wide variety of animals and plants. We describe the challenges of transitioning this technology into a high-throughput mouse production environment with the generation and characterisation of over one hundred new mutant mouse strains. The majority of our CRISPR-mediated knockout strains are the result of whole exon deletions in which two guide RNAs are designed per flanking region to maximise the chance of a successful double-strand break. The gRNAs and Cas9 mRNA are introduced into 1-cell mouse zygotes by cytoplasmic injection and the G0 mice screened by a rapid PCR/qPCR method to determine the level of mosaicism and the percentage of putative deletion events. The mutation is then sequence-verified in the next generation to ensure that complete deletion of the exon has occurred. We have found that the use of the CRISPR/Cas9 system has significant advantages in both the speed and level of generation of new strains, and has allowed us to significantly reduce the numbers of animals needed to achieve germline transmission. Keywords: Mouse, gene editing, CRISPR/Cas9, high-throughput

In vivo correction of an infertility disease by CRISPRCas9-mediated genome editing of the adult mouse germline Manuel Sańchez-Martıń1, Ignacio Garcıá-Tunõń2, Natalia Felipe2, Laura Gomez-H2, Hiroki Shibuya4, Jose Luis Barbero6, John C. Schimenti7, Guillermo Montoya5, Yoshi Watanabe4, Elena Llano3, Alberto M. Pendas2 1

Department of Medicine and Transgenic Facility, University of Salamanca, 37007 Salamanca, Spain.

2

123

260


Instituto de Biologıá Molecular y Celular del Cańcer (CSIC-USAL), 37007 Salamanca, Spain. 3 Departamento de Fisiologıá y Farmacologıá, Universidad de Salamanca, 37007 Salamanca, Spain. 4 Laboratory of Chromosome Dynamics, Institute of Molecular and Cellular Biosciences, University of Tokyo, Tokyo, Japan. 6 Centro de Investigaciones Biolo´gicas (CSIC), Madrid 28040, Spain 7 Center for Vertebrate Genomics, Cornell University, Ithaca, NY 14850, USA Recent studies in mice and humans have shown that targeted genome-editing technologies can correct disease-causing genetic mutations, offering a powerful approach to treat many somatic human diseases. Human infertility is a prevalent disease with a solid genetic basis and for which the identification of the germline disease-causing mutation is now increasingly growing. So far, the germline of the mouse has been directly edited either in zygotes/embryos or by the use of cultured stem cells. In this work, we explore the use of genome editing procedures in adult un-cultured testis to correct a genetic-causing infertility in the meiotic cohesin REC8. We show that CRISPR/CAS9 are able to induce DSBs efficiently when delivered directly into the adult testis by in vivo electroporation, and that when co-delivered with a DNA template, they can induce gene correction in the mutated REC8 gene. The level of gene targeting, although low, was sufficient to evade the meiotic arrest of the REC8-deficient spermatocytes leading to the generation of cytological differentiated spermatids. Thus, CRISPR/CAS9 driven gene correction of the germline can be achieved in vivo, opening up the possibility for the treatment of genetic infertilities.

Keywords: Infertility, ‘‘in vivo electroporation’’, genome editing, mouse model

Improvement of GONAD (genome-editing via oviductal nucleic acids delivery), one of the zygote injection-free genome editing systems targeted to preimplantation embryos 1

2

Masahiro Sato , Channabasavaiah B. Gurumurthy , Satoshi Watanabe3, Masato Ohtsuka4 1 Section of Gene Expression Regulation, Frontier Science Research Center, Kagoshima University, Kagoshima, Japan; 2Mouse Genome Engineering Core Facility, Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, Omaha, NE, USA; 3 Animal Genome Research Unit, Division of Animal Science, National Institute of Agrobiological Sciences, Ibaraki, Japan; 4Division of Basic Molecular Science and Molecular Medicine, School of Medicine, Tokai University, Kanagawa, Japan

Recent advances in genome editing technology—as exemplified by zinc-finger nuclease (ZFN), transcription activator-like effector nucleases (TALEN), and clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPRassociated (Cas) (CRISPR/Cas9)—enable us to knockout a specific gene through the direct introduction of mRNA for

123

genome editing-related components into the cytoplasm of a mammalian zygote. However, this requires expensive micromanipulator systems and a high level of skill to operate the equipment. Therefore, more convenient methods for creating genome-edited animals are required. In 2014, successful genome editing in isolated rat zygotes was first reported by Kaneko et al. (Sci Rep 2014; 4: 6382) who employed an in vitro electroporation (EP)-mediated gene delivery system for inducing mutations in the target loci. This finding encouraged us to explore other ways to create genome-edited animals. One of these methods is the genome-editing via oviductal nucleic acids delivery (GONAD) system, an in vivo transfection system that was very recently reported by Takahashi et al. (Sci Rep 2015; 5: 11406). It can be simply performed by the insertion of mRNA into the internal area of the oviduct and subsequent in vivo EP. This method was originally targeted to the 2-cell embryos, since our previous study demonstrated that gene delivery towards zygotes failed (Sato, Mol Reprod Dev 2005; 71: 321–330). This failure may be solely due to the presence of cumulus cells that surround the oocyte, which might have hampered transfection of embryos. Unfortunately, GONAD at 2-cell embryos often caused mosaic pattern of mutations at a target locus, which will make researchers difficult to analyze the results of mutations in their offspring. The most desirable approach is to perform genome editing at zygote stage. In this report, we attempted to improve GONAD, in which introduction of nucleic acids into oviducts of females was performed at Days 0.4 to 0.7 of pregnancy, corresponding to the early to late zygotic stages. As for gene delivery at Day 0.4 of pregnancy, a solution containing a high concentration of hyaluronidase was first injected towards ampulla and then injected with nucleic acids. After injection, the entire oviduct was subjected to in vivo EP. As for gene delivery at Day 0.7 of pregnancy, oviducts were injected with nucleic acids alone, prior to in vivo EP. In both cases, the in vivo gene delivery was found to be successful. Keywords: in vivo electroporation, genome-editing, oviductal nucleic acids delivery, CRISPR/Cas9, zygote injection

CRISPR/Cas9 genome editing pipeline for mice and rats Thomas Saunders1,2, Wanda Filipiak1, Galina Gavrilina1, Anna LaForest1, Corey Ziebell1, Michael Zeidler1, Elizabeth Hughes1 1 Biomedical Research Core Facilities, Transgenic Animal Model Core; 2Department of Internal Medicine, Division of Molecular Medicine and Genetics, University of Michigan Medical School, Ann Arbor, USA

CRISPR/Cas9 is a RNA guided nuclease that produces double strand breaks DNA. Zygotes with chromosome breaks may repair the breaks with non-homologous endjoining (NHEJ) or homology directed repair (HDR). Repair by often produces deletions and insertions in critical regions for gene expression and gene knockouts result. When the zygote copies new DNA sequence from a DNA donor template during HDR a new DNA sequence will be expressed from the targeted locus. Pipeline are identified and sgRNA targeting critical regions are identified with online algorithms. High scoring sgRNAs are cloned for in vitro sgRNA transcription. Activity of sgRNA is

Transgenic Res (2016) 25:195–270 validated in two steps: 1) cleavage of PCR templates in vitro after mixture with Cas9 protein and 2) microinjection into mouse zygotes and testing blastocysts for NHEJ repair. Rat gene sgRNAs are tested by transection of rat cells and identification of NHEJ mutations. Results will presented on 1) producing gene knockouts in mouse and rat strains, 2) introducing coding SNPs knockins with oligonucleotide in mice and rats, 3) producing reporter gene knockins in mice and rats, 4) producing floxed genes with a novel one-cut strategy in mice, and 5) use of novel ‘‘stitching’’ oligonucleotides to knock genes into the ROSA26 locus. Analysis shows that mosaic founders occur frequently. Mutations observed in founders vary from deletion/insertion of a few nucleotides to the deletion of several hundred base pairs. These patterns are observed in gene knockouts in both mouse and rat models. The efficiency of CRISPR/Cas9 targeting was lower in inbred C57BL/6 J mice than in hybrid mice. NHEJ inhibitors such as SCR7 were ineffective in a series of reporter knockin experiments. Experiments are underway to determine if the Cfp1 system, which produces a staggered cut instead of a blunt cut, will increase reporter and cDNA knockin efficiencies. Gene targeting with CRISPR/Cas9 is highly efficient, we guarantee to production of mouse and rat gene knockouts with reagents designed and cloned in our Core facility. The efficiency of oligonucleotide knockins is lower, the majority of SNP succeed. ROSA26 knockins also have good efficiency. The introduction of complex alleles such as multi-reporter knockins (e.g. iCre-P2A-mCherry) are least efficient and can not always be guaranteed. Compared to preceding technologies, CRISPR/Cas9 technology has significantly increased access to mouse and rat genomes for the generation of biomedical research models. Keywords: CRISPR/Cas9, knockout, knockin, Cfp1, SNP, SCR7, mice, rats, ROSA26

Impaired pregnancy and birth rates in Swiss Webster mice used for embryo transfer Geraldine Schlapp, Marıá Noel Meikle, Gabriel Fernańdez, Martina Crispo Transgenic and Experimental Animal Unit, Institut Pasteur de Montevideo, Montevideo, Uruguay In our Unit, the same stock of Swiss Webster females has been used as embryo recipients during the last seven years. In the past months these females have shown a pronounced reduction in pregnancy and birth rates and cannibalism episodes. The aim of this work was to compare the reproductive performance of our Swiss Webster stock with B6D2 F1 Hybrid females when used as foster mothers. A total of 11 Swiss and 9 B6D2 pseudopregnant females at 0.5 dpc were transferred into both oviducts with an average of 17 unmanipulated B6D2 F2 embryos per female. Pregnancy rate (pregnant/transferred recipients) and birth rate (pups born/transferred embryos) were analyzed by Chi square test. In addition, macroscopic examination of endometrium was randomly performed in both Swiss and hybrid foster females after weaning. Pregnancy rate in

261 Swiss foster females was lower than B6D2 females, 54.5 % (6/ 11) versus 77.8 % (7/9), respectively, although no significant differences were found (P = 0.28). Cannibalism was observed in 27.3 % (3/11) of Swiss females and in 0 % (0/9) of B6D2 females. Birth rate was 7.5 % (14/186) and 32.7 % (53/162) in Swiss and B6D2 females respectively, showing significant differences (P \ 0.01). Macroscopic inspection of Swiss endometrium revealed endometrial cysts and some abnormal implantation sites (hemorrhagic and bigger than normal). Normal endometrium was observed in foster B6D2 mothers. Our results showed a reproductive problem in the Swiss Webster stock which affected the overall efficiency of transgenic technologies. Switching to a hybrid strain could be a solution for small transgenic facilities where the proper maintenance of an outbred stock is difficult to achieve. Keywords: Embryo transfer, pseudopregnant females, pregnancy rate, birth rate

Selecting guide RNAs with high on-target and low offtarget activity using CRISPOR Maximilian Haeussler1, Kai Scho¨nig2, He´le`ne Eckert3, Alexis Eschstruth4, Sylvie Schneider-Maunoury4, Alena Shkumatava3, Jim Kent1, Jean-Stephane Joly5 and Jean-Paul Concordet6 Santa Cruz Genomics Institute, MS CBSE, 1156 High Street, University of California, Santa Cruz CA, USA; 2 Central Institute of Mental Health, Medical Faculty Mannheim, Heidelberg University, Mannheim, Germany; 3 Institut Curie, CNRS UMR3215, INSERM U934, Paris Cedex 05, France; 4 CNRS UMR 7622, INSERM U1156, Sorbonne Universite´ Paris 06, Paris, France; 5 TEFOR Infrastructure, Gif-sur-Yvette, France; 6 INSERM U1154, CNRS UMR 7196, Museúm National d’Histoire Naturelle, Paris, France While many tools and scoring models exist to evaluate the specificity and efficiency of CRISPR/Cas9 guide RNAs, the optimal parameters for an individual experimental setup are not clear. In this first meta-evaluation of CRISPR guide scoring models, we collected cleavage efficiency data from twelve recent CRISPR/Cas9 studies and looked for the parameters associated with low off-target cleavage and high on-target efficiency. In contrast to previous reports, we found that most off-targets can be predicted in silico and we suggest the best efficiency prediction models for different experimental assays. On this basis, we built the online tool CRISPOR (http:// crispor.tefor.net) to help select optimal guide sequences for more than 110 genomes and ten scoring models. Experimentally, we confirmed the correlation between a predicted high score of gRNAs and high cleavage activity in zebrafish embryos after microinjections (Moreno-Mateos score) as well as in a cell culture activity assay (Fusi score). Taken together our analysis shows that using the appropriate prediction model of guide activity can significantly reduce the effort spent on screening for functional guides. Keywords: CRISPR/Cas, gRNA design, CRISPR design, gRNA finder, on-target efficiency

123

262 Targeting RPS19 revisited: a new mouse model for Diamond-Blackfan Anemia Bjo¨rn Schuster1*, Ivan Kanchev1*, Karel Chalupsky1,2*, Jesus Ruberte3,4,5, Jan Prochazka1,2, Zuzana Maceckova6, Dagmar Pospisilova6, Marian Hajduch6, Milan Reinis1,2, Anna Lastuvkova1, Henrieta Palesova1, Frantisek Spoutil1,2, Jana Kopkanova1, Inken M. Beck1, and Radislav Sedlacek1,2 1

Czech Centre for Phenogenomics, Institute of Molecular Genetics of the ASCR, Prague, Czech Republic; 2Dept. of transgenic models of diseases, Institute of Molecular Genetics of the ASCR, Prague, Czech Republic; 3 Department of Anatomy and Animal Health, School of Veterinary Medicine, Universitat Auto`noma de Barcelona, Bellaterra, Spain; 4Center of Animal Biotechnology and Gene Therapy, Universitat Auto`noma de Barcelona, Bellaterra, Spain; 5Centro de Investigacioń Biome´dica en Red de Diabetes y Enfermedades Metabo´licas Asociadas (CIBERDEM), Barcelona, Spain; 6Faculty of Medicine and Dentistry, Palacky University and University Hospital in Olomouc, Czech Republic Diamond-Blackfan anemia (DBA) is a rare erythroid hypoplasia, accompanied by growth retardation, congenital craniofacial and limb abnormalities, caused by haploinsufficient ribosomal proteins (RP) loss-of-function. RPS19 is the most affected gene in DBA with more than 60 mutations described. In contrast, mouse models with disturbed RPS19 showed only limited phenotypes. Most common were white belly spotting, growth retardation and anaemia to varying degrees. A compensatory effect of the wild-type allele was suggested to be responsible for the incomplete DBA phenotype, while homozygous mice were embryonically lethal. In this study we describe a TALEN-mediated approach targeting RPS19 resulting in deletion of arginine 67. In contrast to previous RPS19 DBA models, the novel mutation was not embryonically lethal in homozygous state, thus eliminating compensation by the wild-type allele. The mice exhibited craniofacial, skeletal, and brain anomalies, in addition to the aforementioned phenotypes, although with a shorter lifespan (6–10 weeks). Congenital erythroid hypoplasia together with cardiac dilatation, diaphragm dystrophy and hydrocephalus were found as a plausible cause for early exitus. Our novel DBA model links for the first time murine RPS19 to additional phenotypes, concomitant to the human syndrome and may also be a template for studying the function of essential proteins in vivo. Keywords: Rare Disease, Anemia, Diamond-Blackfan, DBA, RPS19, TALEN, murine disease model

AHNAK deficiency promotes browning and lipolysis in mice via increased responsiveness to b-adrenergic signaling Jae Hoon Shin1, Seo Hyun Lee1, Kim Il Yong1, Kim Yo Na1, Jae-Hoon Choi2, Hyoung-Chin Kim3, Je Kyung Seong1* Korea Mouse Phenotyping Center, Laboratory of Developmental Biology and Genomics, College of

123

Transgenic Res (2016) 25:195–270 Veterinary Medicine, Seoul National University, Seoul, South Korea 2Department of Life Science, College of Natural Sciences, Research Institute for Natural Sciences, Hanyang University, Seoul, Republic of Korea 3Laboratory Animal Resource Center, Korea Research Institute of Bioscience and Biotechnology, Cheongju, South Korea Changes in adipose tissue activity and energy expenditure through thermogenesis would be a promising therapeutic strategy against obesity. In adipose tissue, agonists of the b3-adrenergic receptor (ADRB3) regulate lipolysis, lipid oxidation, and thermogenesis. The deficiency in neuroblast differentiation-associated protein AHNAK induced thermogenesis in white adipose tissue (WAT) of mice fed high-fat diet, suggesting that AHNAK may stimulate energy expenditure via the development of beige fat. Here, we report that AHNAK deficiency promoted browning and thermogenic gene expression in WAT but not in brown adipose tissue of mice stimulated with the ADRB3 agonist CL-316243. Consistent with increased thermogenesis, Ahnak-/- mice exhibited an increase in energy expenditure, accompanied by elevated mitochondrial biogenesis in WAT depots in response to CL-316243. Interestingly, in WAT of Ahnak-/- mice, the expression of ADRB3 and tyrosine hydroxylase was upregulated, indicating increased sympathetic tone in WAT in response to b-adrenergic activation. CL-316243 activated PKA signaling and enhanced lipolysis, as evidenced by increased phosphorylation of hormone sensitive lipase and release of free glycerol in Ahnak-/- mice compared to the wild-type mice. Overall, these findings suggest an important role of AHNAK in the regulation of thermogenesis and lipolysis in WAT via adrenergic signaling. Keywords: AHNAK, browning, lipolysis

Specific domain knockout of murine DNA damageinducible protein homolog 2 (Ddi2) Monika Siva´1,2,3, Kallayanee Chawengsaksophak4, Michal Svoboda1,2, Petr Kasˇpa´rek4, Jan Procha´zka4, Radislav Sedlaćˇek4, Jan Konvalinka1,2, Kla´ra Grantz Sˇasˇkova´1,2 Institute of Organic Chemistry and Biochemistry AS CR,v.v.i., Prague, Czech Republic; 2 Faculty of Science, Charles University in Prague, Prague, Czech Republic; 3 First Faculty of Medicine, Charles University in Prague, Prague, Czech Republic; 4 Institute of Molecular Genetics AS CR,v.v.i., Prague, Czech Republic Ddi1-like proteins are considered to belong to a family of shuttling proteins, such as Rad23 and Dsk2, that are responsible for regulation of protein degradation in ubiquitin– proteasome system. The function of protein shuttles is mediated by conserved domains—ubiquitin-like domain (UBL) targeting the proteasome and ubiquitin-associated domain (UBA) bound to the polyubiquitin chain on the substrate. In contrast to other family members, Ddi1-like proteins harbor a retroviral protease-like domain (RVP), structurally similar to HIV protease, which contains a catalytic triad DT/SG typical for aspartic proteases. This suggests an additional role, which has not been sufficiently studied yet. Ddi1-like proteins are highly conserved throughout eukaryotes and have an important role, as knockout experiments in

Transgenic Res (2016) 25:195–270 yeast, worms and fruit flies propose. In S. cerevisiae, the deficiency of DDI1 gene results in deregulation of exocytosis. Disruption of C. elegans Ddi1 gene causes defects in synaptogenesis. Ddi1 knockout in D. melanogaster induces germline cell development failure. There are two human homologs of Ddi1-like proteins, homolog 1 (Ddi1) and homolog 2 (Ddi2), which are encoded on chromosome 11 and 1, respectively. Our project is focusing on revealing the biological role of the human Ddi2 and as it shares 96 % sequence identity with murine Ddi2, a gene knockout in mouse is an ideal model for studying the function. We successfully generated mice with defect in the Ddi2 gene that results in embryonic lethality of homozygous individuals. This specific truncation of the protein in the RVP domain causes severe developmental defects in embryo, yolk sac and early placenta. Keywords: ubiquitin, aspartic protease, embryonic lethality, shuttling protein

263 down-regulated depending on the genotype and the diet, and to compare them to the variants identified in human clinic. In addition, the mouse model with a duplication of the [Atp6V1B2-Crtc1] genetic interval on chromosome 8 was characterized for its physiological and metabolic traits upon challenge with a diet enriched in cholesterol. This model showed an important decrease in fat mass and in body weight, but with a higher food intake, and a significant decrease in blood lipids. In addition, no changes could be observed in aortic cholesterol levels, while atherosclerotic plaques of various sizes were induced in the aorta, the carotid, and the abdominal and renal arteries. All these results taken together, associated to molecular analysis and combined to the genetic variants observed in the human population will allow to better understand the pathophysiological mechanisms of CVDs and to identify markers of risk factors to improve the prevention and treatment of these diseases. Keywords: Cardiovascular diseases, atherosclerosis

CARDIOGENE: Deciphering the genetic mechanisms of cardiovascular diseases Sorg Tania 1, Bou-About Ghina 1, Champy Marie-France 1, Ma¨rz Winfried 2, Runz Heiko 3, Selloum Mohammed 1, Spitz François 4, Velt Amandine 1, Herault Yann 1 Institut Clinique de la Souris-ICS-MCI, PHENOMIN, CNRS UMR7104, INSERM U964, Universite´ de Strasbourg, 1 rue Laurent Fries BP 10142 Parc d’Innovation 67404 Illkirch, France; 2 University of Heidelberg – Mannheim; 3 University-Clinic of Heidelberg; 4 EMBL, Heidelberg Cardiovascular diseases (CVD) are multifactorial and highly inheritable (60 %) diseases suggesting a major role of genetic factors, and their complications are a leading cause of death. Our main objective is to gain a better understanding of the genetic mechanisms that influence the incidence of cardiovascular diseases in humans, particularly in order to better understand the factors contributing to their development and to identify markers allowing to improve the prevention and appropriate treatments of CVDs. Our approach combines a detailed genetic analysis of a large cohort of patients (*3800) from Baden-Wuerttemberg and Rhineland-Palatinate (Germany) followed longitudinally for many clinical and metabolic parameters (LURIC project) to identify genetic variants associated to CVDs. To study more precisely the effects of these variants, we generated several mouse models carrying the genomic changes found in these loci (including the MAU-2, Crtc1, Rfxank and Cope genes, as well as the genetic interval [Atp6V1B2-Crtc1]) and characterized their effects on multiple molecular, metabolic and physiological parameters. In a first attempt, we deeply characterized the ApoE knockout (KO) model widely used in atherosclerosis studies. We were able to follow the progression of the plaques by echography, which was in correlation with the measurement of the aortic cholesterol post-mortem. We also compared the liver and fat mass RNA profiles in ApoE KO versus wildtype mice, whether fed with a chow or atherogenic diet. These analysis will allow us to identify the genes that are up- or

An inducible Infrared Fluorescent Protein transgenic mouse line offers alternative in vivo reporting for analysis of genetically modified models of cancer David Stevenson, Andreas K. Hock, Sheila J. Bryson, Farah Ghaffar, Seren Stedman, Karen H. Vousden and Douglas Strathdee Beatson Institute for Cancer Research, Transgenic Technologies Group, Glasgow, G61 1BD, Scotland GFP and luciferase are used widely as reporters both in vitro and in vivo, though both have limitations. The utility of GFP fluorescence is restricted by high background signal and poor tissue penetrance. Luciferase is limited in vitro by the requirement for cell lysis, while in vivo, luciferase readout is complicated by the need for substrate injection and a dependence on endogenous ATP. In searching for an alternative to these reporters, we have investigated the utility of infrared fluorescent protein and have previously shown it to allow the accurate determination of cell number in vitro and in sub-cutaneous HeLa tumours in vivo [Hock et al., Cell Cycle 13, 220–226 (2014)]. Here we describe the generation of a Cre-inducible iRFP reporter mouse to allow accurate assessment of tumour mass and confirm the cell origin of metastases in transgenic models of tumourigenesis. Keywords: iRFP, imaging

Birth of normal live mice derived mouse spermatozoa vacuum-dried and preserved at room temperature for long term Norihiro Tada1,2, Eri Nakamura1 1

Division of Genome Research, Research Institute for Diseases of Old Age,and 2Division of Genome Research, Atopy Research Center,Juntendo University Graduate School of Medicine, Tokyo, Japan

123

264 In general, mammalian spermatozoa have been preserved in liquid nitrogen (LN2) by freezing. However, this method requires elaborate and expensive protocols of freezing. Although freeze-dried spermatozoa can be stored at ambient temperature or in a refrigerator, and transportation of freezedried sperm samples is much easier than cryopreservation in LN2, expensive freeze-drying equipment and its complicated manipulation are needed. Therefore, vacuum-drying of mouse spermatozoa for desiccation offers a simpler and less expensive alternative to freeze drying without the requirement of any specialized equipment. In this study, we report the fertilizing and developmental abilities of spermatozoa vacuum-dried and then stored in the vacuum-desiccator at room temperature. Materials and methods: Spermatozoa were collected from BDF1 mice and treated with a-hemolysin solution for 30 min at room temperature. They were then suspended in 4 kinds of stock solutions containing 1 M trehalose (Tr), 100 lM epicatechin (EC) and 100 lM ascorbic acid (Asc) in Tris-EGTA (TE), respectively. The sperm suspension was transferred in microtube and then evaporated in the vacuum-desiccator overnight at room temperature. The microtubes containing vacuum-dried spermatozoa were preserved for 7 days in the vacuum-desiccator at room temperature until intracytoplasmic sperm injection (ICSI) to assess their fertilizing and developmental ability. After rehydration, spermatozoa were injected into oocytes from the same strain using ICSI, and then embryonic development was followed. Moreover, spermatozoa vacuum-dried and preserved for more than 1 year at room temperature were injected into oocytes and transferred into the oviducts of recipients to assess their genetic integrity. Results and conclusion: There is no significantly difference among 4 kinds of stock solutions (Tr ? EC ? Asc/TE, Tr/TE, EC ? Asc/TE, TE) in fertilization rates of oocytes injected with vacuum-dried spermatozoa. The percentages of blastocysts that developed from spermatozoa stored with 4 kinds of stock solutions in the microtube were 30, 34, 15 and 10 %, respectively, which was significantly higher than spermatozoa without Tr. Surprisingly, 2-cell embryos from spermatozoa stored with Tr ? EC ? Asc/TE stock solution in microtube for more than 1 year at room temperature developed to normal 17 live offspring. These live offspring showed normal fertility. These results indicate that Tr has a significant beneficial effect in preserving the developmental potential of mouse spermatozoa desiccated and stored at room temperature for long term. Keywords: Preservation, Mouse spermatozoa, Vacuum-dry, ICSI, Room temperature

Novel superovulation technique using inhibin antiserum and equine chorionic gonadotropin in C57BL/6 mice Toru Takeo, Ayumi Mukunoki, Naomi Nakagata Division of Reproductive Engineering, Center for Animal Resources and Development (CARD), Kumamoto University, Kumamoto, Japan Mouse reproductive technology has been used to produce genetically engineered mice. Superovulation is a useful technique to artificially increase the number of ovulated oocytes by hormone injection. The administration of equine chorionic gonadotropin (eCG) to promote follicle growth,

123

Transgenic Res (2016) 25:195–270 followed by human chorionic gonadotropin (hCG) to facilitate ovulation, has been accepted to induce superovulation in mice since 1957. Two previous reports described how the neutralization of inhibin by the administration of inhibin antiserum (IAS) induced superovulation in mammals. The effect was also confirmed in ddY and wild-derived strains of mice. However, the effect of IAS on C57BL/6 mice, which are the most common inbred strain used to produce genetically engineered mice, has not been investigated. In addition, the combined effect of IAS and eCG (IASe) on the efficacy of superovulation has not been examined. In this study, we investigated the effect of IAS and eCG on the number of ovulated oocytes in C57BL/ 6 female mice during superovulation treatment. Furthermore, we evaluated the quality of IASe-derived oocytes by in vitro fertilization (IVF). The developmental ability of embryos was examined by embryo transfer. The number of ovulated oocytes increased by approximately three-fold by the administration of IASe compared with the administration of IAS or eCG alone. Oocytes derived from superovulation using IASe normally developed into two-cell embryos by IVF. The two-cell embryos produced by IVF normally developed into live pups following embryo transfer. These results suggest that IAS and eCG additively increased the number of ovulated oocytes and that the quality of oocytes derived from IASe treatment was well maintained. In summary, a novel technique of superovulation using IASe contributes to the efficient production of oocytes and offspring of genetically engineered mice and the decrease in the number of oocyte donors in animal experiments. Keywords: sperovulation, inhibin antiserum, equine chorionic gonadotropin, C57BL/6 mouse

Strain-specific epigenetic regulation of a rat angiotensinogen transgene in mice Olga Taryma-Lesniak, Nadea Todiras, Mihail Todiras, Luiza Rabelo, Valeria Nunes, Natalia Alenina, Michael Bader Max-Delbru¨ck-Center for Molecular Medicine, Berlin, Germany The renin-angiotensin system (RAS) is the most important system regulating blood pressure and, therefore, the major target for the treatment of hypertension. Angiotensinogen (AOGEN) is the only precursor of all peptides of the RAS. In 1992, Kimura and colleagues generated a transgenic mouse overexpressing rat AOGEN under the control of its own promoter (TGM(rAOGEN)123). These mice exhibit increased angiotensin II levels, and, consequently high blood pressure and endorgan damage as early as at 8 weeks of age. We backcrossed this mouse, originally generated on the outbred genetic background, NMRI, to two distinct genetic backgrounds, FVB/N and C57BL/6. Similar to the NMRI background, 123FVBN mice showed a drastic increase in blood pressure (158.3 ± 3.2 vs 110.1 ± 0.9 mmHg in FVBN wildtype). However, 123C57BL/6 mice lost the hypertensive phenotype and showed only a mild increase in blood pressure (113.2 ± 0.3 vs 106 ± 0.4 mmHg in C57BL/6 wildtype mice), indicating that the C57BL/6 background has a protective effect. Analysis of the rat AOGEN mRNA levels revealed a drastic


265

downregulation of transgene expression on the C57BL/6 background. To understand the mechanisms leading to transgene silencing we studied epigenetic modifications of the transgene promoter. Indeed, several CpG islands in the 800 bp regulatory region of the rat AOGEN gene were hypomethylated on the FVBN background in comparison to C57BL/6. Further studies are required to identify the genetic factors differentially expressed between the two backgrounds, which contribute to the epigenetic silencing of the AOGEN transgene and, thus, may play a protective role in hypertension. Keywords: hypertension, epigenetics, transgene

Effect of leptin on derivation rate of mouse embryonic stem (ES) cell line

have a positive effect on derivation of mouse embryonic stem cell lines.

Leptin (ng/ml) Blastocyst Attachment (n) (%)

mESCs (%)

0 ng/ml

60.61 %b (40/66) ± 12.08

Koc University, College of Sciences, Istanbul, Turkey; Koc University, College of Medicine, Istanbul, Turkey

2

Leptin is a hormone-like protein of 167 amino acids. As an adipocyte-related hormone it has an important role in weightregulation and physical fitness, but also has effects on reproductive and other physiological mechanisms. Stem cells have important roles in reproduction biotechnology. In this study, the number and rates of embryonic stem cell (mESCs) line derivation were investigated from the blastocysts developing in different leptin-supplemented embryo culture media. Embryos at pronuclear stage were obtained by superovulation of mice of 7–10 weeks and cultured in embryo culture mediums with different Leptin concentrations (10 ng/ml, 50 ng/ml and 100 ng/ml and 0 ng/ml) in 5 % CO2 incubators until the blastocyst stage. The data were analysed using SPSS program by ANOVA and indipendent T Test (p \ 0.05). One day before the procedure; mitomycin C-inactivated mouse embyro fibroblast (MEF) were seeded onto petri dishes coated with 0.1 % gelatin. On the day of embryo collection, the MEF medium was replaced with KOSR-2i ESC derivation medium (Knock Out DMEM supplemented with 15 % (vol/vol) KOSR, 1 % NEAA, 1 % penicilin streptomicin, 1 % L-Glutamine, 0.1 mM 2-Mercaptoethanol (ll/100 ml), 1000 IU/ml LIF, 1 lM PD0325901, 3 lM CHIR99021). After 7 days of culture embryos attachment and outgrowth of trofectoderm cells were observed. To establish mESCs lines, attached ICM were isolated by 0.025 % Tyripsin/EDTA treatment. Each ICM was passaged onto a freshly plated MEF layer. 3 days after plating, half of the medium were replaced with fresh medium and this procedure was repeated for 4–5 days. Emerging colonies were identified as mESC colonies through SSEA1 immunostaining and alkaline phosphatase activity. In this study, we observed that the mESC line derivation rate for leptin-treated and control embryos (10 ng/ml, 50 ng/ml and 100 ng/ml and 0 ng/ml) were 80 % (32/40), 82.93 % (47/56), 90.7 % (29/37) and 60.61 % (40/61), respectively. In conclusion, leptin treatment

81.82 % (54/66) ± 21.02

10 ng/ml

40

92.5 %

50 ng/ml

56

89.29 %

80 %b

(37/40) ± 10.10 (32/40) ± 1.09 83.93 %a (47/56) ± 4.72

(50/56) ± 7.21 100 ng/ml

Ali Cihan Taskin1, Ahmet Kocabay1, Tevfik Tamer Onder2, Ayyub Ebrahimi2 1

66

43

100 %

90.7 %a

(43/43) ± 0

(39/43) ± 0.25

Supported by TUBITAK-113O223. Keywords: Leptin, Mouse, Stem Cell

What about the ones we don’t use? Kevin Taylor Technical and Scientific Services Manager, Australian BioResources, Australian BioResources, 9-11 Lackey Road, Moss Vale, NSW 2577 Recent advances in the field have allowed the transgenic community to both generate and also archive an incredible number of genetically modified lines. Worldwide, facilities are creating more mouse lines and freezing more mouse lines than ever, but how much of what we do goes unused? As a result of a recent discussion at the 2nd Oceania symposium, I have wondered how many mice are born from CRISPR microinjection sessions that, while carrying an altered genetic code, are not used for further breeding. The large scale CRISPR service provided by Garvan and Australian BioResources shows that CRISPR technology can lead to a variety of outcomes, some unexpected. For many projects there are mice generated with an imperfect HR event, perhaps the HR event is also neighbouring an insertion/deletion; in other cases we have seen an indel of a multiple of 3-base pairs which does not lead to a frame-shift mutation. Sometimes, there are more mice carrying indels than are needed. I will present these numbers, and also those of a survey intended to get an indication of the pattern across multiple facilities throughout the world. The cryopreservation service at ABR has been in operation for over five years, and in that time we have archived a considerable number of GM lines (over 300), yet very few have been used for re-animation of a live breeding colony. Is this a pattern seen elsewhere? What should be done with the burgeoning archives as researchers move away or retire? Keywords: CRISPR/Cas9, cryopreservation, survey

123

266 The use of heteroduplex mobility assay for screening genome-edited animals Vanessa Chenouard, Lucas Brusselle, Se´verine Remy, Se´verine Meńoret, Claire Usal, Laure-He´le`ne Ouisse, Ignacio Anegon and Laurent Tesson INSERM UMR 1064-ITUN, CHU de Nantes, Nantes F44093, France; Platform Transgenic Rats and ImmunoPhenomics; F44093 Nantes, France Genome editing had been recently revolutionized by the emergence of engineered endonucleases, especially for species where ES cells are not available for KO or KI. ZFNs, TALENs, meganucleases and CRISPRs lead to double-stranded DNA breaks which are repaired by non-homologous end joining(NHEJ) or homology-directed repair (HDR).Within a short period of time, these new tools have become easier to handle and have resulted in an increase of the number of feasible projects. The labs involved in this area have had to adapt their working methods to accelerate the flow-through. Typically, the genotyping was done on purified gDNA by a specific PCR around the target sequence, agarose gel electrophoresis followed by an enzyme mismatch cleavage test (asT7 endonuclease I) and sequencing.The T7EI assayis not easy to handle with a high number of samples. To address this problem, we developed a Heteroduplex Mobility Assay (HMA) on an automated capillary electrophoresis system (Caliper LabChip GX, Perkin Elmer). The heteroduplexes (HD) are formed by PCR-amplified DNA strands which are not fully complementary. Because of this opened single-strand configuration surrounding the mismatched region, HD migrate slower than the specific PCR product. The advantages of this method are : PCR were performed directly on diluted gDNA in proteinase K-lysis buffer without purification and the amplification with specific primers are done with a proof-reading Taq polymerase. PCR products are run on chip without any treatment and by a simple electrophoresis. NHEJ or HDR occurrence is detected and samples sequenced to define precisely the edition. In less than 2 h, 96 samples are amplified and analyzed with less than 1 microliter. HD are visible with a sensitivity of around 1 % and differences as small as 1 base pair (indels or substitution) are discriminated. Finally, when homozygous mutated animal lines are established (F2 state), it is easy with the HD pattern to follow the mutation and to genotype samples as WT, heterozygous or homozygous without need of sequencing. In case of small indels, it is difficult to discriminate homozygous mutated animals from WT with T7EI assay. With HMA, those samples were easily identified by simply mixing undetermined amplified DNA with WT amplified DNA. In conclusion, although this method demands buying special equipment, it is inexpensive in the long run, easy to use, fast and sensitive. Keywords: genome editing, genotyping, HMA, capillary electrophoresis

123

Transgenic Res (2016) 25:195–270 Rapid generation of knockout mice by pronuclear injection of a circular plasmid expressing Cas9 and a single guided RNA Cecilia Tomni, Katrin Schorr, Christian Hu¨bner, Ingo Kurth Jena University Hospital, Institute of Human Genetics, Jena, Germany Background: Clustered regulatory interspaced short palindromic repeats/Cas9 (CRISPR-Cas9) technology provides a powerful tool for genome engineering. However, variable activity across different single guide RNAs (sgRNAs) remains a significant limitation to the technique. It has been recently described that the nucleotide composition of the sgRNA affects their stability, activity and loading into Cas9 in vivo and several online tools have been generated in order to select the most efficient sgRNAs. Moreover, cytoplasmic co-injection of sgRNA and Cas9 mRNA into zygotes is the preferred method for CRISPR/Cas9-mediated genome engineering for the generation of transgenic mice. Yet, the process of sgRNA generation by in vitro transcription (IVT) is both complex and costly and the injection of high concentrations of RNA results in low embryo survival rate. Thus, we decided to address the feasibility of pronuclear injection of plasmid DNA expressing Cas9 and sgRNAs to generate a knock out (KO) mouse model for DENN/ MADD as this gene produces a neonatal lethal phenotype enabling rapid evaluation CRISPR/Cas9 mutagenesis efficiency. Materials and Methods: Different N20 seed sequences targeting DENN/MADD with an extra 5´GG were directionally cloned into pX330 plasmids, which simultaneously expresses a humanized Streptococcus pyogenes Cas9 (hSpCas9) and sgRNA under the chicken beta-actin hybrid (CBh) and human U6 promoters, respectively. As for the validation of the sgRNAs, we transfected a pX330 plasmid that also expresses GFP into Neuro-2a (N2A) cells. Transfected cells were isolated by Fluorescence-activated cell sorting (FACS) and plated into 96 well plates to generate clonal cell lines. Indel detection was performed by genotyping PCR and subsequent sequencing. Px330 plasmids containing validated sgRNAs were injected into fertilized zygotes at different concentrations (2.5 ng/ll, 5 ng/ll and 10 ng/ll) to optimize the method, cultured overnight in potassium simplex optimization medium (KSOM) and 2 cell-stage embryos were transferred into the oviducts of pseudopregnant females. Pups were genotyped by PCR and subsequent sequencing. Results: We successfully generated a KO mouse model for the DENN/MADD gene using CRISPR/Cas9. Our results suggest that injection of 2.5 ng/ll of DNA into the pronucleus is the most efficient concentration to achieve targeted mutagenesis with a high embryo survival rate, although with low efficiency compared to RNA injection. In addition, the nucleotide composition of the sgRNA seems to be a crucial determinant of the hSpCas9/sgRNA complex efficiency for indel generation. The pronuclear injection of circular plasmid expressing hCas9/sgRNA complex is a rapid, simple, and reproducible method. Keyword: CRISPR

Transgenic Res (2016) 25:195–270 Generation and basic characterization of glutamate carboxypeptidase II knock-out mice Barbora Vorlova1,2, Petr Kasparek3, Pavel Sacha1,4, Radislav Sedlacek3, Jan Konvalinka1,4 1

Gilead Sciences and IOCB Research Center, Institute of Organic Chemistry and Biochemistry AS CR, v.v.i., Prague, Czech Republic; 2First Faculty of Medicine, Charles University, Prague, Czech Republic; 3Institute of Molecular Genetics AS CR, v.v.i., Prague, Czech Republic; 4 Department of Biochemistry, Faculty of Science, Charles University, Prague, Czech Republic Glutamate carboxypeptidase II (GCPII), also known as prostate specific membrane antigen (PSMA), is type II transmembrane glycoprotein with short intracellular and transmembrane domain and large extracellular part possessing carboxypeptidase activity. GCPII is expressed predominantly in the brain, kidney, small intestine and prostate. In the brain, it cleaves the most abundant peptide neurotrasmitter, N-acetyl-L-aspartyl-Lglutamate (NAAG), to yield N-acetyl-L-aspartate and an important neurotransmitter L-glutamate. In small intestine, it cleaves poly-gamma-glutamylated folates and thus enables folate absorption. Nevertheless, the biological role of GCPII in other tissues remains to be elucidated. To date, four different attempts to generate GCPII KO mice have been reported. The results are rather controversial. While deletion of exons 1 and 2 or exons 9 and 10 was reported to be embryonic lethal, other groups reported that adding 3 stop codons between exon 1 and 2 or deletion of exons 3 to 5 resulted in generation of viable GCPII KO mice with no obvious phenotype. Further characterization of these viable KO mice revealed their decreased susceptibility to peripheral neuropathies and stroke as well as severe impairment of angiogenesis. Interestingly, residual NAAG peptidase activity has been observed suggesting compensatory expression of a homolog of GCPII also capable of NAAG cleavage— GCPIII—in the brain. To shed the light on this controversy as well as to decipher other potential roles of GCPII, we attempted to generate GCPII KO mice using TALEN technology by targeting exon 11 of GCPII encoding gene (FolhI) and established reliable genotyping method based on nested PCR. The GCPII KO mice are viable, breed normally and do not show any obvious phenotype. Here, we present basic characterization of these mice using qPCR, Western blot and enzymatic activity analysis. Keywords: GCPII, PSMA, FolhI, knock-out mice

Heritable gene disruption in goats with CRISPR/Cas9 results in expected phenotypes Xiaolong Wang1, Yiyuan Niu1, Bei Cai1, Baohua Ma2, Xingxu Huang3, Lei Qu4, Yulin Chen1* 1 College of Animal Science and Technology, Northwest A&F University, Yangling 712100, China; 2College of Veterinary Medicine, Northwest A&F University, Yangling 712100, China; 3School of Life Science and Technology, ShanghaiTech University, Shanghai 201210, China; 4Yulin University, Life Science Research Center, Yulin, China

267 Precision genetic engineering will accelerate the genetic improvement of livestock for agriculture and biomedicine. Recent advances in the study of the CRISPR/Cas9 system have provided a precise and versatile approach for genome editing in various species. However, the applicability and efficiency of this method in large animal models, such as the goat, have not been extensively studied. Here, we successfully generated gene-modified goats with either one or both genes disrupted through co-injection of one-cell-stage embryos with Cas9 mRNA and sgRNAs targeting two genes (MSTN and FGF5) with well-known function. The targeting efficiency of MSTN and FGF5 in cultured primary fibroblasts was as high as 60 %, while the efficiency of disrupting MSTN and FGF5 in 98 tested animals was 15 and 21 % respectively, and targeting two genes simultaneously was 10 %. The on- and off-target mutations of the target genes in fibroblasts, as well as in somatic tissues and testis of founder animals, were carefully analyzed, indicating that simultaneous editing of several sites can be achieved in large animals. We further show that the utility of the CRISPR/ Cas9 system by disrupting MSTN and FGF5 resulting in expected phenotypes, for instance, higher body weight in MSTN-disrupted animals and increased fiber length in FGF5disurpted animals. We provided adequate evidence to illustrate that the gene modifications induced by the disruption of FGF5 did occurred at both morphological and genetic levels. In addition, the knockout alleles were capable of germline transmitted. Together with studies carried out in other genemodified livestock species such as pigs, our results demonstrate that the CRISPR/Cas9 system has the potential to become a robust and efficient gene engineering tool in farm animals, and therefore will be critically important and applicable to breeding purposes. Keywords: CRISPR/Cas9, MSTN, genetic engineering, genome editing, goat, animal breeding

Using an shRNA allele of Rictor mouse model to generate novel cancer models Fiona Warrander, Laurence Cadalbert, William Faller, Nicola Laprano, Sheila Bryson, Owen Sansom, Douglas Strathdee Beatson Institute for Cancer Research TOR is a highly conserved kinase exerting a wide number of functions in all the organisms ranging from yeast to mammals. In mammalian cells, mTOR can be found as a part of two complexes: mTORC1 and mTORC2. While the functions of the first complex are currently well understood, mTORC2 pathway represents an important and yet poorly characterized signalling way in both normal and tumour cells. The complex has been linked to several cellular and tissue specific processes, such as cytoskeleton reorganization, migration and metastasis. However, the early embryonic mortality of mTORC2 null mice and the lack of pathway-specific inhibitors complicate greatly the work necessary to dissect the complex’s activity in vivo. RNAi can be used to generate conditional gene knockdown mice, through the use of short hairpin RNA (shRNA). These can be inserted to stably express from the genome, in a conditional manner through the use of Cre/loxP systems, and also alongside doxycycline controlled vectors.

123

268 A site-specific insertion of shRNA into the Col1a1 locus allows for a reproducible knockdown system. Depending on the Cre/loxP system used, this can be used to drive a wholebody, or cell type-specific knockdown. This is useful where a complete knockout is lethal, and can allow for double knockdown, e.g. in cancer models where a mouse has a Creconditional transgene, the shRNA can then activated through doxycycline treatment at a later timepoint to modify the phenotype. In this way the shRNA can mimic drug delivery and allow temporal control. Initial characterisation of the model is aimed to determine the level of knockdown of the Rictor gene and to determine to what extent the shRNA allele is able to phenocopy the complete knockout allele of Rictor. A Rictor inducible knock-down mouse model will help us to overcome the hurdles connected to the study of the pathway in vivo and will ultimately contribute to shed a light on the activities of mTORC2 in established murine tumour models. Using both general and tissue specific expression of the transgene, the model will also allow us to characterize the physiologic functions of the complex in the adult organism and it may lead to a better understanding of the role of mTORC2 in embryogenesis and tissue differentiation. Keywords: shRNA, RNAi, Rictor, cancer, mTOR, mTORC2, mouse

Caspase3 defendant BRET mouse model for test of efficacy and toxicity in new developing drugs Hee-Young Yang1, Sung-Gon Kim1, Byeong-Jin Park1, Sang-Kyoon Kim1, Sang-Joon Park2, Choong-Yong Kim1 and Gabbine Wee1 1

Laboratory Animal Center, Daegu-Gyeongbuk Medical innovation Foundation, Daegu, Republic of Korea, 2 Colleage of Veterinary medicine, Kyungpook National University, Daegu, Republic of Korea BRET (Bioluminescence Resonance Energy Transfer transfer) is a form of radiation-free energy transfer that can be occurred by molecular proximity between a bioluminescent ‘‘donor’’ molecules (luciferase) and a fluorescent ‘‘acceptor’’ molecule. The BRET system have been used for the monitoring of protein–protein interaction in real time in living cells. Here, we tried to construct a new mouse model containing BRET system that is programmed to cut a recognizable site (DEVD amino acid sequence) by caspase3 during cell apoptosis. BRET expression vector was composed of a bioluminescent luciferase and a red fluorescent protein (tdTomato) under CMV promoter, and DEVD sequence was inserted into the vector between their proteins. First, cloned vector was transfected into PC3, human prostatic cancer cells and established as a stable cell line to test whether BRET system is working or not. Luciferase and tdTomato expressed normally in BRET-PC3 cells, and red fluorescence was observed under radiation-free status. During drug inducible apoptosis, bioluminescence rate catalyzed by luciferase rapidly increased whereas red fluorescent intensity decreased slightly. Next, The BRET vector was microinjected into pronucleus to produce BRET mouse and two transgenic pups were identified successfully. Two optical probes were also showed in the whole body, and expectable events occurred after treatment of apoptotic drugs like as BRET-PC3 cells. In

123

Transgenic Res (2016) 25:195–270 this study, we developed a new mouse model with BRET system that can detect apoptotic reagents, and suggest the possibility as a teat model for drug discovery and development. Acknowledgment: This research was supported by a grant of the Medical Cluster R&D support project through the DaeguGyeongbuk Medical Innovation Foundation(DGMIF), funded by the Ministry of Health &Welfare, Republic of Korea(grant number: HT13C0008) Keywords: BRET, Bioluminescence, Fluorescence, mouse model, apoptosis

Function of RTEL1 in protecting cerebellar stem cells from the formation of medulloblastoma Xiaoli Wu, Sumit Sandhu, Wenjun Liu, Hao Ding Department of Biochemistry and Medical Genetics, University of Manitoba, Winnipeg, Canada RTEL1 (Regulator of Telomere Length 1) is a DNA helicase which has been shown to be required for the maintenance of telomere integrity and genomic stability. Dysfunction of RTEL1 has also been found to be associated with a variety of human tumors/cancers. In order to uncover the role of RTEL1 dysfunction in tumorigenesis, we have applied mouse ES cell-mediated transgenic approaches to establish several transgenic mice, including the conditional RTEL1 knockout allele, the knock-in alleles with the disruption of RTEL1/ PCNA interaction, an RTEL1-CreCRT2 allele in which a inducible Cre is tightly controlled by the endogenous RTEL1 regulatory elements, and a transgenic mouse strain overexpressing RTEL1. Using these mouse models, we were able to demonstrate that RTEL1 is specifically expressed in several types of stem cells, including cerebellar stem cells, during development. Conditionally knocking out RTEL in cerebellar stem cells can induce medulloblastoma formation, implicating that RTEL1 could be a key molecule essential for the maintenance of telomeres and genomic stability in cerebellar stem cells, and this function could be important for preventing these stem cells being transformed. Keywords: RTEL1, mouse models, telomere maintenance, cerebellar stem cells, medulloblastoma

Development of integrase-based TARGATTTM method for generating site-specific transgenic rat models Qi Zheng, Lin Yan, Jimmy Tai, Lingjie Kong, Jinling Li and Ruby Yanru Chen-Tsai Applied StemCell, Inc The laboratory rat is a central experimental animal in several fields of biomedical research, such as cardiovascular diseases, aging, infectious diseases, autoimmunity, cancer models, transplantation biology, inflammation, cancer risk assessment, industrial toxicology, pharmacology, behavioral and addiction studies, and neurobiology. Up till recently, the ability of creating genetically modified rats has been limited compared to that in the mouse mainly due to lack of genetic manipulation tools and technologies in the rat. Establishment of rat embryonic stem (rES) cells by Drs. Ying and Smith’s groups

Transgenic Res (2016) 25:195–270 at the end of 2008 enhanced the capability of making genetically modified rat models. Recent advances in nucleases such as ZFNs, TALENs, and particularly, CRISPR have been successfully used to generate ‘knockout’ rat models by directly injection into an embryo. However these nuclease-based methods are not efficient in generating site-specific ‘‘knockin’’ rats. It is therefore critical to develop systems that enable fast, efficient and precise introduction of exogenous genetic elements into the rat genome. We have previously developed an integrase-based TARGATTTM system for making site-specific transgenic mice. Here, we applied the same TARGATTTM approach to direct transgene integration at transcriptionally active locus of the rat genome. Integrases such as phiC31 carry out efficient, unidirectional recombination between two non-identical sites, attP and attB. We first identified a transcriptionally active locus in the rat genome and inserted attP sites at the locus using CRISPR. These attP-containing rats can be used as embryo donors for pronuclear injection of the transgene on an attB-containing plasmid. In the presence of integrase, recombination between attP and attB results in an insertion of the transgene precisely at the attP site in the rat genome. This technology allows a fast, efficient generation of knockin rat models containing any gene of interest with consistent, stable, guaranteed gene expression. Advantages of this integrasebased technology are: (1) Transgene integration happens at pre-selected and transcriptionally active locus; (2) Site-specific knockin rat models are made by direct injection of the DNA into the rat zygotes, bypassing rES cells; (3) Gene integration efficiency is higher, but off-target events are lower compared to CRISPR. This TARGATTTM rat system offers a cost-effective method and valuable resources for the bio-medical community who employ rat models for their studies of human diseases. Keywords: Rat, phiC31, site-specific, knock in

Generation of inducible cas9 knock in mouse embryonic stem cell and transgenic mouse for in vivo gene targeting Kyung-Jun Uh1, Yeong-Hee Jeong1, Woo-Sung Hwang1, Ji-Hyun Bae1, Da-Eun Jang2, In-Yeong Choi1, Su-Cheong Yeom 2 1

Designed Animal and Transplantation Research Institute, Greenbio Research and Technology, Seoul National University, 1447 Pyeongchang-Ro, Daewha, Pyeongchang, Kangwon, 232-916, Korea; 2Graduate School of International Agricultural Technology, Seoul National University, 1447 Pyeongchang-Ro, Daewha, Pyeongchang, Kangwon, 232-916, Korea Gene engineering is a valuable technology in generating animal models for human disease and elucidating molecular mechanism of genetic diseases. Recently, in vivo gene targeting with cas9/CRISPR system was reported, and it could be used disease model and gene therapy research. Time and tissue specific gene targeted mouse model could be generated by creERT and loxp system, but it need too much time and efforts. Thus in vivo gene targeting might be alternative method. We established inducible cas9 knock in mESc and transgenic mice. At first, cas9 knock in vector was designed as

269 5-homologous arm of Rosas26 locus_pCMV-Tet3G_loxP_ PGK-neo_loxp2272_SV40pA_mCherry-TRE3G-3XFLAG_ NLS_Spcas9_NLS-SV40pA_30 homologous arm, and its size is about 15 kb. Inducible cas9 knock-in mESCs were generated by electroporation of cas9 knock-in vector with site specific 3 Rosa26 sgRNAs and cas9 expression plasmid. After selection with G418 and DTA, knock in mESc was screened by PCR. After 24 h of doxycycline treatment, knock-in mESCs showed mCherry expression regulated by TRE3G promoter, and western blot analysis also validated tetracycline-dependency by detection of Cas9 protein only in doxycycline-treated cells. Function of cas9 was verified through T7 endonuclease I assay by showing gene mutations in mESCs transfected with plasmids coding Ctbp2 and Elovl4 sgRNAs. In addition, inducible cas9 transgenic mouse was generated by microinjection. This mESc can be valuable tools for interrogating complex genetic interactions and pleiotropic gene functions, and be used for human disease animal generation with viral vector and nano particles. Furthermore, inducible Cas9 transgenic mouse would be powerful tools for in vivo study circumventing problems of vector delivery and lethality. Keywords: cas9, in vivo, inducible

A rapid and efficient one-step approach to generate sgRNA template for producing genetic modified mice I-Shing Yu1,2, Sheng-Kai Chang1,3, Zu-Shan Huang1, Feng-Lin Pu1, Po-Yueh Wu1, Huang-Yi Ling1, Sheng-Wen Wang1, Wei-Jou Lin1, Cheng-Ju Wang1, Wei-Nien Chen1, Chien-Hui Wu1, and Shu-Wha Lin1,2,3 1

Transgenic Mouse Models Core Facility, Ministry of Science and Technology, Taiwan; 2Laboratory Animal Center, College of Medicine, National Taiwan University, Taipei, Taiwan; 3Department of Clinical Laboratory Sciences and Medical Biotechnology, College of Medicine, National Taiwan University, Taipei, Taiwan The CRISPR-Cas9 system, which mainly composed of Cas9 protein and sgRNA, is a powerful tool to generate genetic modified mice models. Here, we showed a cloning-free, rapid and efficient one-step approach based on synthetic PCR to generated sgRNA templates containing T7-promoter sequences for in vitro transcription. This approach was firstly applied to generate point mutation knock-in mice. We injected Cas9 RNA, sgRNA and single-strand oligodeoxynucleotide (ssODN) as the donor template into cytoplasm of zygotes. In 15 cases, we all successfully obtained point mutation knock-in mice, and the average knock-in rate is 35.5 ± 28.8 %. This result confirmed that the sgRNA derived from this approach was functional to induce DNA double-strand break and homologydirected recombination (HDR) repair mechanism of mouse zygotes. Subsequently, we tested this approach to generate conditional knockout mice. We used two ssODN as templates to knock-in loxP sequences flanking the targeted exons. Of 15 cases, 9 cases were successful to generate conditional knockout alleles. Moreover, we found that 13 of 15 cases have simultaneously generated conventional knockout alleles from the break points of two sgRNA recognition sites and the frequency was 24.5 ± 15.8 %. The maximum deleted region

123

270 was 41.1 kb. However, we can’t find a correlation between the deletion rates and the deleted distances. Surprisingly, the inversion alleles were also detected in 9 cases and the frequency was 6.9 ± 7.0 %. Interestingly, the deletion frequencies were significantly associated with inversion. In conclusion, this is a cloning-free and efficient approach to robustly generate sgRNA templates in 2 h. This approach significantly improved the efficiency in preparing sgRNA while applying CRISPR/Cas9 technology in generating genetic modified mouse model. Keywords: CRISPR/Cas9, Genetic modified mouse model

Enhance genome editing in mammalian cells with a modified dual-fluorescent surrogate system Yan Zhou1, Yong Liu1, Dianna Hussmann1, Peter Brøgger1, Rasha Abdelkadhem Al-Saaidi2, Shuang Tan1,3, Lin Lin1, Trine Skov Petersen1, Guang Qian Zhou3, Peter Bross2, Lars Aagaard1, Tino Klein5, Sif Groth Rønn6, Henrik Duelund Pedersen6, Lars Bolund1,4,7, Anders Lade Nielsen1, Charlotte Brandt Sørensen2, Yonglun Luo1,6,7,* Department of Biomedicine, Aarhus University, Aarhus C, DK-8000, Denmark;2 Department of Clinical Medicine, Aarhus University, Aarhus N, DK-8200, Denmark; 3 Shenzhen Key Laboratory for Anti-aging and Regenerative Medicine, Health Science Center, Shenzhen University, 518060, Shenzhen, China; 4 BGI-Shenzhen, 518083, Shenzhen, China; 5 Department of Histology, Gubra A/S., Hørsholm, 2970, Denmark; 6 Department of GLP and Obesity Pharmacology, Novo Nordisk A/S., Ma˚løv, 2760, Denmark; 7 The Danish Regenerative Engineering Alliance for Medicine (DREAM), Aarhus University, Aarhus, Denmark. * Corresponding author: Yonglun Luo ([email protected]) Programmable DNA nucleases such as TALENs and CRISPR/ Cas9 are emerging as powerful tools for genome editing. Dualfluorescent surrogate systems have been demonstrated by several studies to recapitulate DNA nuclease activity and enrich genetically edited cells. In this study, we generated a single-strand annealing-directed, dual-fluorescent surrogate reporter system, referred to as C-Check to facilitate gene editing. To fully demonstrate the utility of the C-Check system, we used the C-Check in combination with CRISPR/Cas9 in different scenarios of gene editing experiments. First, we performed gene-editing on MAPT and SORL1 in PPFs using C-Check-validated CRISPR/Cas9 vectors with efficiencies of

123

Transgenic Res (2016) 25:195–270 9.0–20.3 % and 4.9 %, respectively. Next, endogenous genes (MYH6 and COL2A1) were efficiently modified with fluorescent tagging in human fibroblasts by C-Check-validated CRISPR/Cas9 vectors (up to 10.0 % frequency). We further demonstrated that the C-Check reporter system could be applied to enrich for IGF1R null HEK293T cells and CBX5 null MCF-7 cells with frequencies of nearly 100.0 and 86.9 %, respectively. Most importantly, we further showed that the C-Check system is compatible with multiplexing and for studying CRISPR/Cas9 mismatch tolerance. The C-Check system may serve as a sensitive surrogate tool for measuring DNA nuclease activity and enriching gene-edited cells, and may thereby aid in streamlining programmable DNA nucleasemediated genome editing and biological research. Keywords: Dual-fluorescent surrogate reporter; CRISPR/ Cas9; genome engineering; homologous recombination

ISWI ATPase Smarca5 knockout induced chromatin defects and cell cycle progression blockade during T-cell development Tomas Zikmund1, Juraj Kokavec1, Filipp Savvulidi1, Tereza Turkova1, Helena Paszekova1, Christian Lanctot1, Arthur I. Skoultchi2, and Tomas Stopka1 Department of Pathological Physiology, 1st Faculty of Medicine, Charles University in Prague, Czech Republic; Department of Cell Biology, Albert Einstein College of Medicine, Bronx, NY

2

Chromatin structure is a major prerequisite of proper developmental processes as well as the genome integrity. Chromatin remodeling ISWI ATPase has been proposed to regulate the thymic development although the particular mechanisms of its activity were elusive. We herein report that conditional deletion of Smarca5 in mouse in early thymic progenitor lead to multiple and interlinked developmental blockades that are not mediated through the defective T-cell receptor (TCR) rearrangement or gene repair dysfunction but rather by activation of the pathways sensing chromatin integrity disruption. The mutant thymocytes progressively accumulate chromatin defects and subsequently cease from cycling and this is marked by activation of p53-dependent pathway. Manipulating with the p53 released mutant cells from cell cycle blockade however did not restore chromatin structure or thymocyte development. Keywords: Chromatin remodeling, thymocyte development, Smarca5 conditional knock-out

22nd European Congress on Obesity (ECO2015), Prague, Czech Republic, May 6-9, 2015: Abstracts.

Abstracts of the 8th ELITA-ELTR, 18-19 September 2014, Prague, Czech Republic.

4th Immunotherapy of Cancer Conference (ITOC4), March 20-22, 2017, Prague, Czech Republic.

International Joint Meeting EuroMISE 2015 Prague, Czech Republic, June 16-18, 2015.

Radon program of the Czech Republic.

2015 Diabetes Technology Meeting Abstracts.

Third Conference on Methods and Applications of Fluorescence spectroscopy, Prague, Czech Republic, October 18-21, 1993.

Third conference on methods and applications of fluorescence spectroscopy, prague, czech republic, october 18-21, 1993.

Type specimens of centipedes (Myriapoda, Chilopoda) in the National Museum, Prague (Czech Republic).

Deutsche Physiologische Gesellschaft. Abstracts of the 51. meeting (spring meeting) March 27--30, 1979, Kiel.

13th congress of the European Society for Surgical Research. Scientific abstracts.

WFC'S 13th Biennial Congress Proceedings Athens, Greece, 10-13, 2013: Abstracts of the Scientific Sessions.

The 11th Central European Congress of Rheumatology: Prague, December 8-10, 2016.

2016 Canadian Society of Surgical Oncology Annual Scientific Meeting Abstracts.

2016 Trauma Association of Canada Annual Scientific Meeting Abstracts.

Program and Abstracts from the Canadian Digestive Diseases Week™ 2016.

Abstracts of the SIR 2014 Annual Scientific Meeting Program Convergence, 22–27 March 2014, San Diego, CA.

Human genome meeting 2016 : Houston, TX, USA. 28 February - 2 March 2016.

13th FAOBMB Congress in Bangkok.

Abstracts of the RCOG World Congress 2014, 28-30 March 2014, Hyderabad, India.

Abstracts of the 12th International Congress on Obesity, 17-20 March 2014, Kuala Lumpur, Malaysia.

Abstracts of the Annual Meeting of the Danish Pathology Society, 13-15 March 2014, Herlev, Denmark.

Isolation of the highly pathogenic and zoonotic agent Burkholderia pseudomallei from a pet green Iguana in Prague, Czech Republic.

Abstracts from the 10th Palliative Care Congress, 12–14 March, 2014, Harrogate, UK.