Neuroscience 286 (2015) 27–36
PROHIBITIN 1 GENE DELIVERY PROMOTES FUNCTIONAL RECOVERY IN RATS WITH SPINAL CORD INJURY L. LI, J.-D. GUO, H.-D. WANG, Y.-M. SHI, Y.-L. YUAN AND S.-X. HOU *
of SCI and might provide a therapeutic target to promote recovery from SCI. Ó 2014 Published by Elsevier Ltd. on behalf of IBRO.
Department of Orthopaedics, The First Affiliated Hospital of General Hospital of the People’s Liberation Army, Beijing 100048, China
Key words: prohibitin 1, spinal cord injury, endoplasmic reticulum stress, mitochondria, apoptosis.
Abstract—Spinal cord injury (SCI) represents a severe health problem worldwide usually associated with severe disability and reduced quality of life. The aim of this work was to investigate the role of prohibitin 1 (PHB1) in the progression of SCI in rats. Firstly, we observed that expression of PHB1 was downregulated following SCI in rats. Then, we hypothesized that PHB1 overexpression by delivery of AdPHB1 could result in neuroprotection and promote functional recovery following SCI. Briefly, Wistar rats received a 35-g clip-compression injury and were administered AdPHB1 or Ad immediately following SCI. It was found that Ad-PHB1 administration significantly improved locomotor function and increased pain tolerance in rats with SCI. Furthermore, Ad-PHB1 administration following SCI attenuated axonal degradation and increased neuron sparing. Ad-PHB1 administration following SCI reduced apoptosis through inhibiting the Bcl-2/Bax/caspase-3 pathway. Ad-PHB1 administration following SCI suppressed endoplasmic reticulum stress, evidenced by reduced mRNA levels of CCAAT enhancer binding protein homologous protein, chaperone-ucose-regulated protein 78, and X-box protein 1. Ad-PHB1 administration following SCI restored mitochondrial adenosine triphosphate formation, reduced reactive oxygen species formation, and improved mitochondrial respiration rates. Finally, Ad-PHB1 administration following SCI activated downstream signals including phosphatidylinositol-3-kinase (PI3K)/Akt, extracellular signal-regulated kinase (ERK1/2), and nuclear factor-kappaB. These data indicate that the PHB1 plays an important role in the development
INTRODUCTION Spinal cord injury (SCI) occurs predominantly in young people as a result of traffic or sports-related accidents and not only imposes high physical and psychological effects on the individual but also places a big financial burden on society (Paul et al., 2013). Traumatic SCI evolves through two phases: normally, the primary insult (mechanical injury) and the secondary injury which includes disturbances in ionic homeostasis, local edema, ischemia, focal hemorrhage, oxidative stress, inflammation, and activation of necrotic and apoptotic cell death signaling events (Norenberg et al., 2004; Swartz et al., 2009). Incomplete understanding of how secondary events evolve and contribute to pathology is a major impediment to the development of treatments for SCI. It is well-documented that mitochondrial function is significantly compromised within hours following SCI (Jin et al., 2004; McEwen et al., 2007; Sullivan et al., 2007). In fact, mitochondria have been shown to play an important role in the ensuing neuronal death cascade (Duchen, 2012), and mitochondrial dysfunction have been directly linked to increased excitotoxicity following SCI (Luo et al., 2004; Sullivan et al., 2005). Early preservation of mitochondrial bioenergetics with antioxidants supported both structural and functional recovery after SCI (Semple, 2014; Patel et al., 2014). Given that the predominant subcellular localization of prohibitin 1 (PHB1) is in the mitochondria in most cell types studied to date, emerging data suggest that PHB1 is involved in maintaining mitochondrial function and morphology (Artal-Sanz and Tavernarakis, 2009). In fact, PHB1 acts as a chaperone in mitochondria and interacts with complex I and subunits of cytochrome c oxidase of the respiratory chain and regulates their assembly (Schleicher et al., 2008; Merkwirth and Langer, 2009; Tsutsumi et al., 2009). It is therefore conceivable that loss of PHB1 in mitochondria could lead to dysfunction of the mitochondrial respiratory chain. Recently, it was reported that PHB overexpression reduced mitochondrial reactive oxygen (ROS) production and protected brain cells from
*Corresponding author. Address: Department of Orthopaedics, The First Affiliated Hospital of Chinese People’s Liberation Army General Hospital, 51 Fucheng Road, Beijing 100048, China. Tel: +86-01066848830; fax: +86-01068989121. E-mail address: [email protected] (S.-X. Hou). These authors contributed equally to the work. Abbreviations: ATP, adenosine triphosphate; BBB, Basso, Beattie, and Bresnahan; C3, caspase-3; CHOP, CCAAT enhancer binding protein homologous protein; CRP78, chaperone-ucose regulated protein 78; ER, endoplasmic reticulum; ERK, extracellular signal-regulated kinase; NF200, neurofilament protein; NFjB, nuclear factor-kappaB; MOMP, mitochondrial outer membrane permeabilization; PHB1, prohibitin 1; PI3K, phosphatidylinositol-3-kinase; ROS, reactive oxygen; RT-PCR, real-time polymerase chain reaction; SCI, spinal cord injury; XBP-1, Xbox protein 1. http://dx.doi.org/10.1016/j.neuroscience.2014.11.037 0306-4522/Ó 2014 Published by Elsevier Ltd. on behalf of IBRO. 27
28
L. Li et al. / Neuroscience 286 (2015) 27–36
different injury modalities (Zhou et al., 2012), and PHB viral gene transfer protected hippocampal CA1 neurons from ischemia and ameliorated postischemic hippocampal dysfunction (Kurinami et al., 2014). Our earlier research revealed that PHB1 expression was downregulated following SCI in rats. To address the role of PHB1 in the pathway to the cascade of secondary damage following SCI, PHB1 was overexpressed by intraspinal microinjection of adenoviral vectors immediately following SCI in rats.
EXPERIMENTAL PROCEDURE Animals and ethical statement Female Wistar rats (2 months old) were purchased from the Weitonglihua Lab Animal Ltd (Beijing, China). All the rats used in this work received humane care in compliance with institutional animal care guidelines. All the surgical and experimental procedures were approved by the Local Institutional Committee, and all efforts were made to minimize suffering. All experiments were carried out in accordance with the EU Directive 2010/63/EU on the protection of animals used for scientific purposes, or with the Guidelines laid down by the NIH in the US regarding the care and use of animals for experimental procedures. All efforts were made to minimize the number of animals used and their suffering. Generation of recombinant adenoviral vectors Briefly, the rat PHB1 cDNA was subcloned into the multiple cloning site of the shuttle plasmid pAdTrackCMV. The purified recombinant plasmids were linearized and co-electroporated with pAdEasy-1 adenoviral backbone vector into Escherichia coli BJ5183. The complete adenovectors (Ad-PHB1) and empty adenovectors (Ad) were packaged by transfecting 293 cells, where viral particles were further amplified, purified, and titered.
Ad-PHB1) forming units were injected into the dorsal spinal cord immediately following SCI. Total 10 ll of intraspinal injections were made bilaterally at 2 mm rostral and caudal of the injury site. The injection rate was 0.6 ll/min and when the injection was completed, the capillary needle was left in the cord for at least 2 min to allow diffusion of the virus from the injection site and to prevent back-flow. The incision was closed in layers using standard silk sutures and animals were given a single dose of buprenorphine (50 lg/kg). Rats were allowed to recover in the cage under a heat-lamp and, subsequently, were housed in a temperaturecontrolled warm room (25 ± 2 °C) with free access to food and water. Postoperative care involved manual urinary bladder empty twice daily. Quantitative real-time polymerase chain reaction analysis (qRT-PCR) Portions of spinal cord tissues from perilesional zone were collected 5 days after SCI. Total RNA was isolated according to the manufacturer’s protocol. RT-PCR analysis was performed with a QuantiTectTM SYBRÒ Green PCR (Tiangen, Shanghai, China) according to the manufacturer’s instructions. The RT-PCR data were based on SYBR green amplification. The sequences of primers are listed in Table 1. The highly specific measurement of mRNA was carried out for PHB1, chaperone-ucose-regulated protein 78 (CRP78), C/EBP homologous protein (CHOP), X-box protein 1 (XBP-1) and b-actin using the LightCycler system (Bio-Rad, Carlsbad, USA). Each sample was run and analyzed in duplicate. Target mRNA levels were adjusted as the values relative to b-actin, which was used as the endogenous control to ensure equal starting amounts of cDNA. The fold-change relative to control values were obtained and used to express the experimental change in gene expression. Western blot analysis
Rats were subject to a compressive SCI using a modified aneurysm clip, which has been extensively characterized by our laboratory and previously described (Fehlings and Tator, 1995). Briefly, rats were anesthetized by an intraperitoneal injection of 10% chloralic hydras (3.5 ml/kg). The skin was incised along the midline of back, and the vertebral column was exposed and rats received a twolevel laminectomy of mid-thoracic vertebral segments T6–T7. A modified clip calibrated to a closing force of 35 g was applied extradurally to the cord for 1 min and then removed. Control group animals received the same surgical procedures, but impaction was not applied to the spinal cord.
Equal amounts of protein preparations (3 lg/ll) were run on sodium dodecyl sulfate–polyacrylamide gels, electrotransferred to polyvinylidine difluoride membranes, and blotted with primary antibodies against cleaved caspase-3 (C3), pro-C3, Bax, Bcl-2, p-AKT, AKT, p-extracellular signal-regulated kinase (p-ERK1/2), ERK1/2, phosphatidylinositol-3-kinase (PI3K), neurofilament protein (NF200), and NFjB p65 (Santa Cruz Biotechnology, Inc., CA, USA) overnight at 4 °C using slow rocking. Then, they were blotted with HRP-conjugated secondary antibody (1:10,000) and HRP-conjugated monoclonal antibody against b-actin (1:8000). Immunoreactive bands were detected by a chemiluminescent reaction (ECL kit, Amersham Pharmacia, NJ, USA).
Intraspinal microinjection of adenoviral vectors
Behavioral tests
Using a stereotaxic frame and glass capillary needle (diameter, 60 lm) connected to a Hamilton microsyringe, a total of 3 108 viral plaque (Ad or
In order to examine the locomotor function after injury, behavioral analyses were performed by trained investigators who were blind to the experimental
SCI model
L. Li et al. / Neuroscience 286 (2015) 27–36 Table 1. Sequences of oligonucleotides used as primers. Sequence (50 –30 )
Target gene PHB1 CHOP CRP78 XBP-1 b-actin
Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
GTCGACCATGGCTGCCAAAGT AAGCTTGGGGTGGGAGCAGAAGGAA CCTTCACTACTCTTGACCCTG GACCACTCTGTTTCCGTTTC GATAATCAGCCCACCGTAA TCCTGTCCCTTTGTCTTCA GAATGCCCTGGTTACTGAAGAG CCAAAAGGATATCAGACTCAGAATC AAGTCCCTCACCCTCCCAAAAG AAGCAATGCTGTCACCTTCCC
PHB1, prohibitin 1; CHOP, CCAAT enhancer binding protein homologous protein; CRP78, chaperone-ucose regulated protein 78; XBP-1, X-box protein 1.
conditions. Locomotor recovery of the rats was assessed by using the 21 point Basso, Beattie, and Bresnahan (BBB) open-field locomotor score (Basso et al., 1995) from 1 to 8 weeks following trauma. BBB is a 22-point scale (scores 0–21) that systematically and logically follows recovery of hindlimb function from a score of 0, indicative of no observed hindlimb movements, to a score of 21, representative of a normal ambulating rodent. The assessment was performed by two physicians independently within 5 min, using a double-blind method, and the average values of the two test results were taken as the recording values. Mechanical and thermal allodynia Rats were acclimatized for 30 min in an isolated room for 30 min prior to pain testing. Mechanical allodynia was determined by quantifying the pain threshold of the hindpaws. Animals were placed in stance on a raised grid, allowing von Frey filaments to be applied to the plantar surface of the hindpaw. Increasing monofilaments were used (2, 4, 8, 10, 16, 21, and 26 g) until the rats displayed an adverse response (vocalization, licking, biting and immediate movement to the other side of the cage). The weight of the von Frey filament that elicited the response was recorded as the pain threshold value, with lower threshold values indicating increased sensitivity to mechanical stimuli. Thermal allodynia was assessed using the tail flick method. A 50 °C thermal stimulus was applied to the distal portion of the animals’ tail by a Tail Flick Analgesia Meter (IITC Inc. Life Science, CA, USA), and the time for the rats to remove its tail from the stimulus was recorded. The latency time was graphed for each treatment group, and decreased latency times were associated with the development of thermal allodynia. Quantification of neurons Five days following SCI, rats were transcardially perfused with 4% paraformaldehyde. Then, the tissues were cryoprotected in 20% sucrose. A 10-mm length of the spinal cord centered at the injury site was fixed in tissue-embedding medium. Tissue sections were used for immunofluorescence staining with a monoclonal
29
antibody specific for NeuN (Neuronal Nuclei, 1:100; Santa Cruz, CA, USA). Neuron quantification was made only in the gray matter under 25 magnification. The number of NeuN-positive cells was calculated at 1, 2 and 3 mm, both rostral and caudal from the epicenter, as well as at the epicenter. Measurement of mitochondrial adenosine triphosphate (ATP) production and ROS formation Mitochondria were isolated by differential centrifugation of tissue homogenates as the method described previously (Mariappan et al., 2007). Mitochondrial protein concentration was determined using a DC Protein Assay Kit (BioRad, Hercules, CA, USA). Rates of ATP formation were quantified using a commercially available kit (BioVision, Mountain View, CA, USA). Mitochondrial ROS production was evaluated by lucigenin chemiluminescence. The results were corrected for protein content. Mitochondrial function Mitochondrial respiration was assessed using a miniature Clark-type electrode (Hansatech Instruments, Norfolk, England) in a sealed, thermostatically controlled chamber at 37 °C as described previously (Sullivan et al., 2003; Patel et al., 2009). Mitochondria were added to the chamber to yield a final protein concentration of 200–300 lg/ml respiration buffer (125 mM KCl, 2 mM MgCl2, 2.5 mM KH2PO4, 20 mM HEPES and 0.1% BSA, pH 7.2). Respiration was initiated by the addition of oxidative substrates pyruvate (5 mM) and malate (2.5 mM) which is designated as State II respiration. This was followed by the addition of 120-nmol ADP (State III respiration) and the addition of 1 lM oligomycin to induce State IV respiration. The mitochondrial uncoupler carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP; 1 lM) was added to the chamber to asses NADH dehydrogenase (complex I) driven maximum electron transport, which is designated as State V–Complex I respiration. The mitochondrial respiration rates were calculated as nmols oxygen/min/mg protein. Mitochondrial DNA quantification Total DNA was extracted from the tissue using a QIAamp DNA extraction kit (Qiagen, Shanghai, China). In total, 10 ng of genomic DNA was used for amplifying mtDNA and nuclear DNA markers. The mtDNA was amplified using primers specific for the mitochondrial cytochrome b (Cyt B) gene (Forward primer: 50 -TCCTGCATACTT CAAAACAACG-30 ; Reverse primer: 50 -AACATTCCGC CCAATCACCCAAA-30 ; Probe: AACATTCCGCCCAAT CACCCAAA), and the mitochondrial DNA copy number was normalized to the nuclear DNA copy number by the amplifying the b-actin nuclear gene (Forward primer: 50 CTATGTTGCCCTAGACTTCGAGC-30 ; Reverse primer: 50 -TTGCCGATAGTGATGACCTGAC-30 ; Probe: CACTG CCGCATCCTCTTCCTCCC). The oligonucleotides (probes) for TaqMan PCR were labeled with the fluorescent reporter dye FAM (6-carboxyfluorescein) at the 50 end and with fluorescent BHQ-1 dye at the 30
30
L. Li et al. / Neuroscience 286 (2015) 27–36
end. RT-PCR amplification was performed using a LightCyclerä 480 II Probes Master kit (Roche Applied Science, Mannheim, Germany). The fluorescence threshold (Ct) value was calculated using LightCyclerä 480 II Probes system software (Roche Applied Science, Germany), and the 2DDCt method was used to calculate the relative levels of expression.
expression (Fig. 1B) in perilesional tissues and isolated mitochondria. Ad-PHB1 administration enhanced PHB1 mRNA levels and protein expression in perilesional tissues and isolated mitochondria of rats, which indicated the successful delivery of a localized gene therapy to the injured spinal cord. Locomotor function
Statistical analysis All data are expressed as mean ± SD. Comparison among groups was analyzed using a two-way analysis of variance followed by Bonferroni t-test. P < 0.05 was considered statistically significant. Statistical analysis was performed using SPSS 11.0.0 software (SPSS Inc., Chicago, IL, USA).
All rats had a BBB score of 21 pre-injury. The BBB locomotor rating scores of rats were assessed weekly
RESULTS PHB1 expression Five days after trauma, SCI resulted in a significant reduction in PHB1 mRNA levels (Fig. 1A) and protein Fig. 2. Ad-PHB1 improved locomotion function following SCI. Openfield locomotion was assessed using the 21-point BBB scale. Rats were assessed weekly for 8 weeks following injury by blinded observers. BBB, Basso, Beattie, and Bresnahan; PHB1, prohibitin 1; SCI, spinal cord injury; values are means ± SD. n = 8 in each group; ⁄P < 0.05 versus Control + Ad rats; #P < 0.05 versus SCI + Ad rats.
Fig. 1. PHB1 expression. Graphs show the mRNA levels (A) of PHB1 at 5 days post-SCI. Western blotting results and responding quantification (B) of PHB1 in tissue homogenates and isolated mitochondria are shown. The protein levels of tissue homogenates and mitochondria were adjusted as relative values to b-actin and Cox II, respectively. PHB1, prohibitin 1; Cox II, cytochrome c oxidase subunit II; SCI, spinal cord injury; values are means ± SD. n = 12 in each group; ⁄P < 0.05 versus Control + Ad rats; #P < 0.05 versus SCI + Ad rats.
Fig. 3. Ad-PHB1 reduced mechanical and thermal allodynia at 8 weeks post-SCI. Mechanical (A) and thermal (B) allodynia, as two outcome measures of neuropathic pain, was monitored by von Frey monofilaments and tail-flick tests, respectively. PHB1, prohibitin 1; SCI, spinal cord injury; values are means ± SD. n = 9 in each group; ⁄ P < 0.05 versus Control + Ad rats; #P < 0.05 versus SCI + Ad rats.
L. Li et al. / Neuroscience 286 (2015) 27–36
31
Fig. 4. Neuroprotection of Ad-PHB1. The sections in the animals at 5 days after SCI were immuno-stained with an anti-NeuN (general neuronal marker, green) antibody. Picture (A) showed the section 3 mm rostral to the epicenter. Graph (B) showed quantification of the NeuN-positive cell counts at 5 days after SCI. Western blotting results and responding quantification (C) of NF200 were shown. PHB1, prohibitin 1; SCI, spinal cord injury; values are means ± SD. n = 9 in each group; ⁄P < 0.05 versus Control + Ad rats; #P < 0.05 versus SCI + Ad rats.
32
L. Li et al. / Neuroscience 286 (2015) 27–36
Fig. 5. Ad-PHB1 reduced apoptosis at 5 days after SCI. Western blotting results and responding quantification of cleaved C3, pro-C3, Bax, and Bcl2 were shown. C3, caspase-3; PHB1, prohibitin 1; SCI, spinal cord injury; values are means ± SD. ⁄P < 0.05 versus Control + Ad rats; #P < 0.05 versus SCI + Ad rats.
Fig. 6. Ad-PHB1 improved mitochondrial function at 5 days after SCI. Graphs showed mitochondrial ATP (A) and ROS (B) formation, mitochondrial respiration rates (C), and mitochondrial DNA content (D). Respiration rates from mitochondria were calculated as nmols oxygen/min/mg protein. Mitochondrial DNA was normalized with nuclear DNA content. ATP, adenosine triphosphate; ROS, reactive oxygen; PHB1, prohibitin 1; SCI, spinal cord injury; values are means ± SD. n = 9 in each group; ⁄P < 0.05 versus Control + Ad rats; #P < 0.05 versus SCI + Ad rats.
for 8 weeks following injury (Fig. 2). Ad-PHB1 administration significantly improved locomotor function of SCI rats. Mechanical and thermal allodynia A devastating post-SCI condition is neuropathic pain. Rats were tested for pain at 8 weeks following SCI, and here we observed that SCI rats were sensitive to the mechanical (Fig. 3A) and thermal (Fig. 3B) allodynia and a significant increase in pain tolerance in rats receiving Ad-PHB1. Neuroprotection To further confirm the protective effect of PHB1, we investigated the survival of neurons directly by immunofluorescence staining. The positive staining cells
decreased significantly after SCI at 5 days, and increased by Ad-PHB1 administration (Fig. 4A, B). NF200, a hallmark protein lost following neurodegeneration, was quantified in the injured region. It was observed that SCI reduced the NF200 expression and Ad-PHB1 administration upregulated the NF200 expression in SCI rats (Fig. 4C). All of these data indicated the neuroprotective effect of PHB1 against SCI. Apoptosis Five days after trauma, apoptosis in perilesional tissue was assessed by determining the proteins expression of Bcl-2 and Bax and ratio of cleaved C3 to pro-C3. Compared to control rats, spinal cord trauma elevated ratio of cleaved C3 to pro-C3 and protein expression of Bax and reduced Bcl-2 protein expression (Fig. 5),
L. Li et al. / Neuroscience 286 (2015) 27–36
33
indicating increased apoptosis at injury site after trauma. However, the SCI rats receiving Ad-PHB1 showed a lower ratio of cleaved C3 to procaspase-3 and reduced protein expression of Bax and increased protein expression of Bcl-2, indicating that SCI-induced proapoptotic Bcl-2/Bax/C3 signaling was attenuated by PBH1 administration. Mitochondrial function Five days after trauma, mitochondria in perilesional tissue were collected for measurement of mitochondrial function. It was observed that mitochondrial ATP formation (Fig. 6A) was reduced and mitochondrial ROS formation (Fig. 6B) was enhanced in SCI rat than that in Control rats. Ad-PHB1 administration restored mitochondrial ATP formation and suppressed mitochondrial ROS formation in the injured region. Quantification of mitochondrial respiration rates showed a significant decrease in state III and State V–Complex I respiration rates in the SCI rats compared to Control rats (Fig. 6C). Ad-PHB1 administration following SCI significantly maintained State III and State V–Complex I respiration rates. No significant difference of mitochondrial DNA content (D) was found among groups. Endoplasmic reticulum (ER) stress
Fig. 7. Ad-PHB1 suppressed ER stress at 5 days after SCI. Graphs showed mRNA levels of CHOP (A), CRP78 (B), and XBP-1 (C). ER, endoplasmic reticulum; CHOP, CCAAT enhancer binding protein homologous protein; CRP78, chaperone-ucose regulated protein 78; XBP-1, X-box protein 1; PHB1, prohibitin 1; SCI, spinal cord injury; Values are means ± SD. n = 9 in each group; ⁄P < 0.05 versus Control + Ad rats; #P < 0.05 versus SCI + Ad rats.
Five days after trauma, ER stress was analyzed by investigating three ER stress markers’ expression, including CHOP, XBP-1, and CRP78. SCI rats showed a significant augmentation of mRNA levels of CHOP (Fig. 7A), CRP78 (Fig. 7B), and XBP-1 (Fig. 7C), confirming the presence of ER stress in the injured region. Ad-PHB1 administration reduced the mRNA levels of CHOP, CRP78, and XBP-1, indicating that PHB1 overexpression prevented ER stress induction against SCI. Signaling pathways We next detected whether the protective effect of PHB1 in the recovery of SCI was associated with the activation of signal pathways of PI3K/AKT, ERK1/2, and nuclear factor-kappaB (NFjB). Western blot analysis
Fig. 8. PI3K/Akt, ERK1/2, and NFjB signals were involved in the protective effect of PHB1 in SCI rats. Western blotting results and responding quantification of PI3K, p-Akt, Akt, p-ERK1/2, ERK1/2, and NFjB p65 at 5 days after SCI were shown. ERK, extracellular signal-regulated kinase; PI3K, phosphatidylinositol-3-kinase; PHB1, prohibitin 1; SCI, spinal cord injury; values are means ± SD. ⁄P < 0.05 versus Control + Ad rats; # P < 0.05 versus SCI + Ad rats.
34
L. Li et al. / Neuroscience 286 (2015) 27–36
demonstrated that the expressions of PI3K and the phosphorylations of AKT (p-AKT) and ERK1/2 (p-ERK1/ 2) decreased and expression of NFjB p65 increased 5 days after SCI contusion (Fig. 8). Ad-PHB1 administration following SCI enhanced PI3K expression and phosphorylations of AKT and ERK1/2 and reduced NFjB p65 expression. These data indicated that the PI3K/AKT, ERK1/2, and NFjB signals might be associated with the effect of PHB1 in the recovery of SCI.
DISCUSSION The pathophysiological occurrence of SCI initiates a cascade of biochemical changes that includes necrotic and apoptotic cell death (McEwen and Springer, 2005). Although cell death occurs within minutes in the gray matter of the injury epicenter, apoptotic death of oligodendroglia is apparent in distal white matter tracts several days after trauma, which contributes to sensorimotor deficits through demyelination of intact neural pathways which survived the initial injury (Crowe et al., 1997; Shuman et al., 1997). Previously published experimental observations (Chowdhury et al., 2007, 2011) suggested that PHB may be a cell survival or anti-apoptotic factor that is likely to play an important role in cell fate decision and in mitochondrial integrity/cellular homeostasis. Mitochondria are involved in the so-called intrinsic pathway of apoptosis where they release soluble proteins, including cytochrome c, from the intermembrane space to initiate caspase activation in the cytosol (Kroemer et al., 2007; Vaux, 2011). The release of these proteins is a consequence of the integrity of the mitochondrial outer membrane being compromised, a process called mitochondrial outer membrane permeabilization (MOMP). In vertebrates, MOMP is under the control of the Bcl-2 family members, including antiapoptotic Bcl-2-like proteins (e.g. Bcl-2, Bcl-xL, Bcl-w, Mcl-1 and A1/Bfl-1) and proapoptotic Bax-like proteins (e.g. Bax, Bak and Bok/ Mtd) (Martinou and Youle, 2011). It was reported that PHB1 inhibited apoptosis in rat granulosa cells through activating the ERK1/2/Bcl-2 pathway (Chowdhury et al., 2013). In agreement with these published observations, SCI in rats in this work led to reduced phosphorylation of ERK1/2 and Bcl-2 expression and enhanced expression of Bax, which was reversed by PHB1 overexpression. Following SCI, mice deficient in CHOP signaling showed reduced apoptosis, increased spared white matter and enhanced locomotor recovery, which indicated the central role of ER stress in SCI (Fassbender et al., 2012). It is widely accepted that ER stress induces mitochondrial dysfunction and mitochondria-related apoptosis (Csordas and Hajnoczky, 2009; Egnatchik et al., 2014). However, it has been shown that mitochondrial dysfunction increased the level of ER stress markers in adipocytes and pancreatic beta cells (Kim et al., 2008; Lee et al., 2010) through enhanced ROS species formation. Mitochondria-targeted antioxidants MitoTempol or MitoQ protected pancreatic b-cells against ER stress in glucotoxicity and glucolipotoxicity (Lowes et al., 2008). It was reported that abrogation of PHB
induced ER stress and apoptosis in human hepatoma cells in a mechanism dependent on NFjB signaling (Sa´nchez-Quiles et al., 2010). Excess ROS activate the redox-sensitive transcription factor NF-jB, resulting in enhancement of its expression and activity (JanssenHeininger et al., 2000). In this work, PHB1 overexpression reduced levels of ER stress markers in rats with SCI, which might be contributed to the suppressed ROS/NFjB pathway. PI3K/Akt activation also inhibited ER stress-induced apoptosis (Dai et al., 2010). In addition, PI3K/Akt activation was found to contribute to the spinal cord protection afforded by ischemic postconditioning (Jiang et al., 2009) and exercise training (Jung et al., 2014). Yu et al. found that SOD1 overexpression reduced ROS formation, which contributed to PI3K/Akt activation and subsequent motor neuron survival after SCI (Yu et al., 2005). Our work found that PHB1 activated the PI3K/Akt pathway, which might be secondary to the reduction of mitochondrial ROS formation. In addition to those signaling pathways associated with apoptosis, there was a progressive increase in mitochondrial oxidative damage that preceded the loss of mitochondrial bioenergetics, suggesting that free radical damage and diminution of ATP may be important to mitochondrial secondary injury process (Sullivan et al., 2007; Hall, 2011; Jia et al., 2012). PHB1 overexpression following SCI reduced mitochondrial ROS formation and enhanced ATP production through restoring electron transport system in this work. Emerging data suggest that PHB1 plays a role in combating oxidative stress in multiple cells types. PHB1 knockdown in endothelial cells increased production of ROS in mitochondria via decreased activity of complex I and partial blockade of the electron transport chain (Schleicher et al., 2008). PHB1 overexpression protected the cardiomyocytes from oxidative stress-induced damage (Liu et al., 2009). Based on the findings thus far, downregulation of PHB1 following SCI in rats contributed to mitochondrial dysfunction, and subsequent apoptosis and oxidative damage. However, we cannot yet exclude a role of PHB1, localized in other cellular compartment, in the implication of it, which requires further investigation.
CONCLUSION The protective role of PHB1 in the recovery of SCI is related to the suppression of ROS formation via the restoration of electron transport chain and inhibition of cell death via the activation of downstream signals. PHB1 could thus be envisaged as a novel therapeutic target for improving outcome after SCI.
REFERENCES Artal-Sanz M, Tavernarakis N (2009) Prohibitin and mitochondrial biology. Trends Endocrinol Metab 20:394–401. Basso DM, Beattie MS, Bresnahan JC (1995) A sensitive and reliable locomotor rating scale for open field testing in rats. J Neurotrauma 12:1–21. Chowdhury I, Branch A, Olatinwo M, Thomas K, Matthews R, Thompson WE (2011) Prohibitin (PHB) acts as a potent survival
L. Li et al. / Neuroscience 286 (2015) 27–36 factor against ceramide induced apoptosis in rat granulosa cells. Life Sci 89:295–303. Chowdhury I, Thompson WE, Welch C, Thomas K, Matthews R (2013) Prohibitin (PHB) inhibits apoptosis in rat granulosa cells (GCs) through the extracellular signal-regulated kinase 1/2 (ERK1/2) and the Bcl family of proteins. Apoptosis 18:1513–1525. Chowdhury I, Xu W, Stiles JK, Zeleznik A, Yao X, Matthews R, Thomas K, Thompson WE (2007) Apoptosis of rat granulosa cells after staurosporine and serum withdrawal is suppressed by adenovirus-directed overexpression of prohibitin. Endocrinology 148:206–217. Crowe MJ, Bresnahan JC, Shuman SL, Masters JN, Beattie MS (1997) Apoptosis and delayed degeneration after spinal cord injury in rats and monkeys. Nat Med 3:73–76. Csordas G, Hajnoczky G (2009) SR/ER-mitochondrial local communication: calcium and ROS. Biochim Biophys Acta 1787:1352–1362. Dai RY, Chen SK, Yan DM, Chen R, Lui YP, Duan CY, Li J, He T, Li H (2010) PI3K/Akt promotes GRP78 accumulation and inhibits endoplasmic reticulum stress-induced apoptosis in HEK293 cells. Folia Biol (Praha) 56:37–46. Duchen MR (2012) Mitochondria, calcium-dependent neuronal death and neurodegenerative disease. Pflugers Arch 464:111–121. Egnatchik RA, Leamy AK, Jacobson DA, Shiota M, Young JD (2014) ER calcium release promotes mitochondrial dysfunction and hepatic cell lipotoxicity in response to palmitate overload. Mol Metab 3:544–553. Fassbender JM, Saraswat-Ohri S, Myers SA, Gruenthal MJ, Benton RL, Whittemore SR (2012) Deletion of endoplasmic reticulum stress-induced CHOP protects microvasculature post-spinal cord injury. Curr Neurovasc Res 9:274–281. Fehlings MG, Tator CH (1995) The relationships among the severity of spinal cord injury, residual neurological function, axon counts, and counts of retrogradely labeled neurons after experimental spinal cord injury. Exp Neurol 132:220–228. Hall ED (2011) Antioxidant therapies for acute spinal cord injury. Neurotherapeutics 8:152–167. Janssen-Heininger YMW, Poynter ME, Baeuerle PA (2000) Recent advances towards understanding redox mechanisms in the activation of nuclear factor jB. Free Radic Biol Med 28:1317–1327. Jia Z, Zhu H, Li J, Wang X, Misra H, Li Y (2012) Oxidative stress in spinal cord injury and antioxidant-based intervention. Spinal cord 50:264–274. Jiang X, Ai C, Shi E, Nakajima Y, Ma H (2009) Neuroprotection against spinal cord ischemia-reperfusion injury induced by different ischemic postconditioning methods: roles of phosphatidylinositol 3-kinase-Akt and extracellular signalregulated kinase. Anesthesiology 111:1197–1205. Jin Y, McEwen ML, Nottingham SA, Maragos WF, Dragicevic NB, Sullivan PG, Springer JE (2004) The mitochondrial uncoupling agent 2,4-dinitrophenol improves mitochondrial function, attenuates oxidative damage, and increases white matter sparing in the contused spinal cord. J Neurotrauma 21:1396–1404. Jung SY, Kim DY, Yune TY, Shin DH, Baek SB, Kim CJ (2014) Treadmill exercise reduces spinal cord injury-induced apoptosis by activating the PI3K/Akt pathway in rats. Exp Ther Med 7:587–593. Kim PK, Hailey DW, Mullen RT, Lippincott-Schwartz J (2008) Ubiquitin signals autophagic degradation of cytosolic proteins and peroxisomes. Proc Natl Acad Sci U S A 105:20567–20574. Kroemer G, Galluzzi L, Brenner C (2007) Mitochondrial membrane permeabilization in cell death. Physiol Rev 87:99–163. Kurinami H, Shimamura M, Ma T, Qian L, Koizumi K, Park L, Klann E, Manfredi G, Iadecola C, Zhou P (2014) Prohibitin viral gene transfer protects hippocampal CA1 neurons from ischemia and ameliorates postischemic hippocampal dysfunction. Stroke 45:1131–1138.
35
Lee JW, Kim WH, Yeo J, Jung MH (2010) ER stress is implicated in mitochondrial dysfunction-induced apoptosis of pancreatic beta cells. Mol Cells 30:545–549. Liu X, Ren Z, Zhan R, Wang X, Wang X, Zhang Z, Leng X, Yang Z, Qian L (2009) Prohibitin protects against oxidative stress-induced cell injury in cultured neonatal cardiomyocyte. Cell Stress Chaperones 14:311–319. Lowes DA, Thottakam BM, Webster NR, Murphy MP, Galley HF (2008) The mitochondria-targeted antioxidant MitoQ protects against organ damage in a lipopolysaccharide-peptidoglycan model of sepsis. Free Radic Biol Med 45:1559–1565. Luo J, Borgens R, Shi R (2004) Polyethylene glycol improves function and reduces oxidative stress in synaptosomal preparations following spinal cord injury. J Neurotrauma 21:994–1007. Mariappan N, Soorappan RN, Haque M, Sriramula S, Francis J (2007) TNF-a-induced mitochondrial oxidative stress and cardiac dysfunction: restoration by superoxide dismutase mimetic Tempol. Am J Physiol Heart Circ Physiol 293:H2726–H2737. Martinou JC, Youle RJ (2011) Mitochondria in apoptosis: Bcl-2 family members and mitochondrial dynamics. Dev Cell 21:92–101. McEwen ML, Springer JE (2005) A mapping study of caspase-3 activation following acute spinal cord contusion in rats. J Histochem Cytochem 53:809–819. McEwen ML, Sullivan PG, Springer JE (2007) Pretreatment with the cyclopsorin derivative, NIM811, improves the function of synaptic mitochondria following spinal cord contusion in rats. J Neurotrauma 24:613–624. Merkwirth C, Langer T (2009) Prohibitin function within mitochondria: essential roles for cell proliferation and cristae morphogenesis. Biochim Biophys Acta 1793:27–32. Norenberg MD, Smith J, Marcillo A (2004) The pathology of human spinal cord injury: defining the problems. J Neurotrauma 21:429–440. Patel SP, Sullivan PG, Pandya JD, Goldstein GA, VanRooyen JL, Yonutas HM, Eldahan KC, Morehouse J, Magnuson DS, Rabchevsky AG (2014) N-acetylcysteine amide preserves mitochondrial bioenergetics and improves functional recovery following spinal trauma. Exp Neurol 257:95–105. Patel SP, Sullivan PG, Pandya JD, Rabchevsky AG (2009) Differential effects of the mitochondrial uncoupling agent, 2,4dinitrophenol, or the nitroxide antioxidant, Tempol, on synaptic or nonsynaptic mitochondria after spinal cord injury. J Neurosci Res 87:130–140. Paul C, Derrett S, McAllister S, Herbison P, Beaver C, Sullivan M (2013) Socioeconomic outcomes following spinal cord injury and the role of no-fault compensation: longitudinal study. Spinal cord 51:919–925. Sa´nchez-Quiles V, Santamarı´ a E, Segura V, Sesma L, Prieto J, Corrales FJ (2010) Prohibitin deficiency blocks proliferation and induces apoptosis in human hepatoma cells: molecular mechanisms and functional implications. Proteomics 10:1609–1620. Schleicher M, Shepherd BR, Suarez Y, Fernandez-Hernando C, Yu J, Pan Y, Acevedo LM, Shadel GS, Sessa WC (2008) Prohibitin-1 maintains the angiogenic capacity of endothelial cells by regulating mitochondrial function and senescence. J Cell Biol 180:101–112. Semple BD (2014) Early preservation of mitochondrial bioenergetics supports both structural and functional recovery after neurotrauma. Exp Neurol 261C:291–297. Shuman SL, Bresnahan JC, Beattie MS (1997) Apoptosis of microglia and oligodendrocytes after spinal cord contusion in rats. J Neurosci Res 50:798–808. Sullivan PG, Dube C, Dorenbos K, Steward O, Baram TZ (2003) Mitochondrial uncoupling protein-2 protects the immature brain from excitotoxic neuronal death. Ann Neurol 53:711–717. Sullivan PG, Krishnamurthy S, Patel SP, Pandya JD, Rabchevsky AG (2007) Temporal characterization of mitochondrial bioenergetics after spinal cord injury. J Neurotrauma 24:991–999.
36
L. Li et al. / Neuroscience 286 (2015) 27–36
Sullivan PG, Rabchevsky AG, Waldmeier PC, Springer JE (2005) Mitochondrial permeability transition in CNS trauma: cause or effect of neuronal cell death? J Neurosci Res 79:231–239. Swartz KR, Scheff NN, Roberts KN, Fee DB (2009) Exacerbation of spinal cord injury due to static compression occurring early after onset. J Neurosurg Spine 11:570–574. Tsutsumi T, Matsuda M, Aizaki H, Moriya K, Miyoshi H, Fujie H, Shintani Y, Yotsuyanagi H, Miyamura T, Suzuki T, Koike K (2009) Proteomics analysis of mitochondrial proteins reveals overexpression of a mitochondrial protein chaperon, prohibitin,
in cells expressing hepatitis C virus core protein. Hepatology 50:378–386. Vaux DL (2011) Apoptogenic factors released from mitochondria. Biochim Biophys Acta 1813:546–550. Yu F, Sugawara T, Maier CM, Hsieh LB, Chan PH (2005) Akt/Bad signaling and motor neuron survival after spinal cord injury. Neurobiol Dis 20:491–499. Zhou P, Qian L, D’Aurelio M, Cho S, Wang G, Manfredi G, Pickel V, Iadecola C (2012) Prohibitin reduces mitochondrial free radical production and protects brain cells from different injury modalities. J Neurosci 32:583–592.
(Accepted 6 November 2014) (Available online 26 November 2014)
PROHIBITIN 1 GENE DELIVERY PROMOTES FUNCTIONAL RECOVERY IN RATS WITH SPINAL CORD INJURY L. LI, J.-D. GUO, H.-D. WANG, Y.-M. SHI, Y.-L. YUAN AND S.-X. HOU *
of SCI and might provide a therapeutic target to promote recovery from SCI. Ó 2014 Published by Elsevier Ltd. on behalf of IBRO.
Department of Orthopaedics, The First Affiliated Hospital of General Hospital of the People’s Liberation Army, Beijing 100048, China
Key words: prohibitin 1, spinal cord injury, endoplasmic reticulum stress, mitochondria, apoptosis.
Abstract—Spinal cord injury (SCI) represents a severe health problem worldwide usually associated with severe disability and reduced quality of life. The aim of this work was to investigate the role of prohibitin 1 (PHB1) in the progression of SCI in rats. Firstly, we observed that expression of PHB1 was downregulated following SCI in rats. Then, we hypothesized that PHB1 overexpression by delivery of AdPHB1 could result in neuroprotection and promote functional recovery following SCI. Briefly, Wistar rats received a 35-g clip-compression injury and were administered AdPHB1 or Ad immediately following SCI. It was found that Ad-PHB1 administration significantly improved locomotor function and increased pain tolerance in rats with SCI. Furthermore, Ad-PHB1 administration following SCI attenuated axonal degradation and increased neuron sparing. Ad-PHB1 administration following SCI reduced apoptosis through inhibiting the Bcl-2/Bax/caspase-3 pathway. Ad-PHB1 administration following SCI suppressed endoplasmic reticulum stress, evidenced by reduced mRNA levels of CCAAT enhancer binding protein homologous protein, chaperone-ucose-regulated protein 78, and X-box protein 1. Ad-PHB1 administration following SCI restored mitochondrial adenosine triphosphate formation, reduced reactive oxygen species formation, and improved mitochondrial respiration rates. Finally, Ad-PHB1 administration following SCI activated downstream signals including phosphatidylinositol-3-kinase (PI3K)/Akt, extracellular signal-regulated kinase (ERK1/2), and nuclear factor-kappaB. These data indicate that the PHB1 plays an important role in the development
INTRODUCTION Spinal cord injury (SCI) occurs predominantly in young people as a result of traffic or sports-related accidents and not only imposes high physical and psychological effects on the individual but also places a big financial burden on society (Paul et al., 2013). Traumatic SCI evolves through two phases: normally, the primary insult (mechanical injury) and the secondary injury which includes disturbances in ionic homeostasis, local edema, ischemia, focal hemorrhage, oxidative stress, inflammation, and activation of necrotic and apoptotic cell death signaling events (Norenberg et al., 2004; Swartz et al., 2009). Incomplete understanding of how secondary events evolve and contribute to pathology is a major impediment to the development of treatments for SCI. It is well-documented that mitochondrial function is significantly compromised within hours following SCI (Jin et al., 2004; McEwen et al., 2007; Sullivan et al., 2007). In fact, mitochondria have been shown to play an important role in the ensuing neuronal death cascade (Duchen, 2012), and mitochondrial dysfunction have been directly linked to increased excitotoxicity following SCI (Luo et al., 2004; Sullivan et al., 2005). Early preservation of mitochondrial bioenergetics with antioxidants supported both structural and functional recovery after SCI (Semple, 2014; Patel et al., 2014). Given that the predominant subcellular localization of prohibitin 1 (PHB1) is in the mitochondria in most cell types studied to date, emerging data suggest that PHB1 is involved in maintaining mitochondrial function and morphology (Artal-Sanz and Tavernarakis, 2009). In fact, PHB1 acts as a chaperone in mitochondria and interacts with complex I and subunits of cytochrome c oxidase of the respiratory chain and regulates their assembly (Schleicher et al., 2008; Merkwirth and Langer, 2009; Tsutsumi et al., 2009). It is therefore conceivable that loss of PHB1 in mitochondria could lead to dysfunction of the mitochondrial respiratory chain. Recently, it was reported that PHB overexpression reduced mitochondrial reactive oxygen (ROS) production and protected brain cells from
*Corresponding author. Address: Department of Orthopaedics, The First Affiliated Hospital of Chinese People’s Liberation Army General Hospital, 51 Fucheng Road, Beijing 100048, China. Tel: +86-01066848830; fax: +86-01068989121. E-mail address: [email protected] (S.-X. Hou). These authors contributed equally to the work. Abbreviations: ATP, adenosine triphosphate; BBB, Basso, Beattie, and Bresnahan; C3, caspase-3; CHOP, CCAAT enhancer binding protein homologous protein; CRP78, chaperone-ucose regulated protein 78; ER, endoplasmic reticulum; ERK, extracellular signal-regulated kinase; NF200, neurofilament protein; NFjB, nuclear factor-kappaB; MOMP, mitochondrial outer membrane permeabilization; PHB1, prohibitin 1; PI3K, phosphatidylinositol-3-kinase; ROS, reactive oxygen; RT-PCR, real-time polymerase chain reaction; SCI, spinal cord injury; XBP-1, Xbox protein 1. http://dx.doi.org/10.1016/j.neuroscience.2014.11.037 0306-4522/Ó 2014 Published by Elsevier Ltd. on behalf of IBRO. 27
28
L. Li et al. / Neuroscience 286 (2015) 27–36
different injury modalities (Zhou et al., 2012), and PHB viral gene transfer protected hippocampal CA1 neurons from ischemia and ameliorated postischemic hippocampal dysfunction (Kurinami et al., 2014). Our earlier research revealed that PHB1 expression was downregulated following SCI in rats. To address the role of PHB1 in the pathway to the cascade of secondary damage following SCI, PHB1 was overexpressed by intraspinal microinjection of adenoviral vectors immediately following SCI in rats.
EXPERIMENTAL PROCEDURE Animals and ethical statement Female Wistar rats (2 months old) were purchased from the Weitonglihua Lab Animal Ltd (Beijing, China). All the rats used in this work received humane care in compliance with institutional animal care guidelines. All the surgical and experimental procedures were approved by the Local Institutional Committee, and all efforts were made to minimize suffering. All experiments were carried out in accordance with the EU Directive 2010/63/EU on the protection of animals used for scientific purposes, or with the Guidelines laid down by the NIH in the US regarding the care and use of animals for experimental procedures. All efforts were made to minimize the number of animals used and their suffering. Generation of recombinant adenoviral vectors Briefly, the rat PHB1 cDNA was subcloned into the multiple cloning site of the shuttle plasmid pAdTrackCMV. The purified recombinant plasmids were linearized and co-electroporated with pAdEasy-1 adenoviral backbone vector into Escherichia coli BJ5183. The complete adenovectors (Ad-PHB1) and empty adenovectors (Ad) were packaged by transfecting 293 cells, where viral particles were further amplified, purified, and titered.
Ad-PHB1) forming units were injected into the dorsal spinal cord immediately following SCI. Total 10 ll of intraspinal injections were made bilaterally at 2 mm rostral and caudal of the injury site. The injection rate was 0.6 ll/min and when the injection was completed, the capillary needle was left in the cord for at least 2 min to allow diffusion of the virus from the injection site and to prevent back-flow. The incision was closed in layers using standard silk sutures and animals were given a single dose of buprenorphine (50 lg/kg). Rats were allowed to recover in the cage under a heat-lamp and, subsequently, were housed in a temperaturecontrolled warm room (25 ± 2 °C) with free access to food and water. Postoperative care involved manual urinary bladder empty twice daily. Quantitative real-time polymerase chain reaction analysis (qRT-PCR) Portions of spinal cord tissues from perilesional zone were collected 5 days after SCI. Total RNA was isolated according to the manufacturer’s protocol. RT-PCR analysis was performed with a QuantiTectTM SYBRÒ Green PCR (Tiangen, Shanghai, China) according to the manufacturer’s instructions. The RT-PCR data were based on SYBR green amplification. The sequences of primers are listed in Table 1. The highly specific measurement of mRNA was carried out for PHB1, chaperone-ucose-regulated protein 78 (CRP78), C/EBP homologous protein (CHOP), X-box protein 1 (XBP-1) and b-actin using the LightCycler system (Bio-Rad, Carlsbad, USA). Each sample was run and analyzed in duplicate. Target mRNA levels were adjusted as the values relative to b-actin, which was used as the endogenous control to ensure equal starting amounts of cDNA. The fold-change relative to control values were obtained and used to express the experimental change in gene expression. Western blot analysis
Rats were subject to a compressive SCI using a modified aneurysm clip, which has been extensively characterized by our laboratory and previously described (Fehlings and Tator, 1995). Briefly, rats were anesthetized by an intraperitoneal injection of 10% chloralic hydras (3.5 ml/kg). The skin was incised along the midline of back, and the vertebral column was exposed and rats received a twolevel laminectomy of mid-thoracic vertebral segments T6–T7. A modified clip calibrated to a closing force of 35 g was applied extradurally to the cord for 1 min and then removed. Control group animals received the same surgical procedures, but impaction was not applied to the spinal cord.
Equal amounts of protein preparations (3 lg/ll) were run on sodium dodecyl sulfate–polyacrylamide gels, electrotransferred to polyvinylidine difluoride membranes, and blotted with primary antibodies against cleaved caspase-3 (C3), pro-C3, Bax, Bcl-2, p-AKT, AKT, p-extracellular signal-regulated kinase (p-ERK1/2), ERK1/2, phosphatidylinositol-3-kinase (PI3K), neurofilament protein (NF200), and NFjB p65 (Santa Cruz Biotechnology, Inc., CA, USA) overnight at 4 °C using slow rocking. Then, they were blotted with HRP-conjugated secondary antibody (1:10,000) and HRP-conjugated monoclonal antibody against b-actin (1:8000). Immunoreactive bands were detected by a chemiluminescent reaction (ECL kit, Amersham Pharmacia, NJ, USA).
Intraspinal microinjection of adenoviral vectors
Behavioral tests
Using a stereotaxic frame and glass capillary needle (diameter, 60 lm) connected to a Hamilton microsyringe, a total of 3 108 viral plaque (Ad or
In order to examine the locomotor function after injury, behavioral analyses were performed by trained investigators who were blind to the experimental
SCI model
L. Li et al. / Neuroscience 286 (2015) 27–36 Table 1. Sequences of oligonucleotides used as primers. Sequence (50 –30 )
Target gene PHB1 CHOP CRP78 XBP-1 b-actin
Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
GTCGACCATGGCTGCCAAAGT AAGCTTGGGGTGGGAGCAGAAGGAA CCTTCACTACTCTTGACCCTG GACCACTCTGTTTCCGTTTC GATAATCAGCCCACCGTAA TCCTGTCCCTTTGTCTTCA GAATGCCCTGGTTACTGAAGAG CCAAAAGGATATCAGACTCAGAATC AAGTCCCTCACCCTCCCAAAAG AAGCAATGCTGTCACCTTCCC
PHB1, prohibitin 1; CHOP, CCAAT enhancer binding protein homologous protein; CRP78, chaperone-ucose regulated protein 78; XBP-1, X-box protein 1.
conditions. Locomotor recovery of the rats was assessed by using the 21 point Basso, Beattie, and Bresnahan (BBB) open-field locomotor score (Basso et al., 1995) from 1 to 8 weeks following trauma. BBB is a 22-point scale (scores 0–21) that systematically and logically follows recovery of hindlimb function from a score of 0, indicative of no observed hindlimb movements, to a score of 21, representative of a normal ambulating rodent. The assessment was performed by two physicians independently within 5 min, using a double-blind method, and the average values of the two test results were taken as the recording values. Mechanical and thermal allodynia Rats were acclimatized for 30 min in an isolated room for 30 min prior to pain testing. Mechanical allodynia was determined by quantifying the pain threshold of the hindpaws. Animals were placed in stance on a raised grid, allowing von Frey filaments to be applied to the plantar surface of the hindpaw. Increasing monofilaments were used (2, 4, 8, 10, 16, 21, and 26 g) until the rats displayed an adverse response (vocalization, licking, biting and immediate movement to the other side of the cage). The weight of the von Frey filament that elicited the response was recorded as the pain threshold value, with lower threshold values indicating increased sensitivity to mechanical stimuli. Thermal allodynia was assessed using the tail flick method. A 50 °C thermal stimulus was applied to the distal portion of the animals’ tail by a Tail Flick Analgesia Meter (IITC Inc. Life Science, CA, USA), and the time for the rats to remove its tail from the stimulus was recorded. The latency time was graphed for each treatment group, and decreased latency times were associated with the development of thermal allodynia. Quantification of neurons Five days following SCI, rats were transcardially perfused with 4% paraformaldehyde. Then, the tissues were cryoprotected in 20% sucrose. A 10-mm length of the spinal cord centered at the injury site was fixed in tissue-embedding medium. Tissue sections were used for immunofluorescence staining with a monoclonal
29
antibody specific for NeuN (Neuronal Nuclei, 1:100; Santa Cruz, CA, USA). Neuron quantification was made only in the gray matter under 25 magnification. The number of NeuN-positive cells was calculated at 1, 2 and 3 mm, both rostral and caudal from the epicenter, as well as at the epicenter. Measurement of mitochondrial adenosine triphosphate (ATP) production and ROS formation Mitochondria were isolated by differential centrifugation of tissue homogenates as the method described previously (Mariappan et al., 2007). Mitochondrial protein concentration was determined using a DC Protein Assay Kit (BioRad, Hercules, CA, USA). Rates of ATP formation were quantified using a commercially available kit (BioVision, Mountain View, CA, USA). Mitochondrial ROS production was evaluated by lucigenin chemiluminescence. The results were corrected for protein content. Mitochondrial function Mitochondrial respiration was assessed using a miniature Clark-type electrode (Hansatech Instruments, Norfolk, England) in a sealed, thermostatically controlled chamber at 37 °C as described previously (Sullivan et al., 2003; Patel et al., 2009). Mitochondria were added to the chamber to yield a final protein concentration of 200–300 lg/ml respiration buffer (125 mM KCl, 2 mM MgCl2, 2.5 mM KH2PO4, 20 mM HEPES and 0.1% BSA, pH 7.2). Respiration was initiated by the addition of oxidative substrates pyruvate (5 mM) and malate (2.5 mM) which is designated as State II respiration. This was followed by the addition of 120-nmol ADP (State III respiration) and the addition of 1 lM oligomycin to induce State IV respiration. The mitochondrial uncoupler carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP; 1 lM) was added to the chamber to asses NADH dehydrogenase (complex I) driven maximum electron transport, which is designated as State V–Complex I respiration. The mitochondrial respiration rates were calculated as nmols oxygen/min/mg protein. Mitochondrial DNA quantification Total DNA was extracted from the tissue using a QIAamp DNA extraction kit (Qiagen, Shanghai, China). In total, 10 ng of genomic DNA was used for amplifying mtDNA and nuclear DNA markers. The mtDNA was amplified using primers specific for the mitochondrial cytochrome b (Cyt B) gene (Forward primer: 50 -TCCTGCATACTT CAAAACAACG-30 ; Reverse primer: 50 -AACATTCCGC CCAATCACCCAAA-30 ; Probe: AACATTCCGCCCAAT CACCCAAA), and the mitochondrial DNA copy number was normalized to the nuclear DNA copy number by the amplifying the b-actin nuclear gene (Forward primer: 50 CTATGTTGCCCTAGACTTCGAGC-30 ; Reverse primer: 50 -TTGCCGATAGTGATGACCTGAC-30 ; Probe: CACTG CCGCATCCTCTTCCTCCC). The oligonucleotides (probes) for TaqMan PCR were labeled with the fluorescent reporter dye FAM (6-carboxyfluorescein) at the 50 end and with fluorescent BHQ-1 dye at the 30
30
L. Li et al. / Neuroscience 286 (2015) 27–36
end. RT-PCR amplification was performed using a LightCyclerä 480 II Probes Master kit (Roche Applied Science, Mannheim, Germany). The fluorescence threshold (Ct) value was calculated using LightCyclerä 480 II Probes system software (Roche Applied Science, Germany), and the 2DDCt method was used to calculate the relative levels of expression.
expression (Fig. 1B) in perilesional tissues and isolated mitochondria. Ad-PHB1 administration enhanced PHB1 mRNA levels and protein expression in perilesional tissues and isolated mitochondria of rats, which indicated the successful delivery of a localized gene therapy to the injured spinal cord. Locomotor function
Statistical analysis All data are expressed as mean ± SD. Comparison among groups was analyzed using a two-way analysis of variance followed by Bonferroni t-test. P < 0.05 was considered statistically significant. Statistical analysis was performed using SPSS 11.0.0 software (SPSS Inc., Chicago, IL, USA).
All rats had a BBB score of 21 pre-injury. The BBB locomotor rating scores of rats were assessed weekly
RESULTS PHB1 expression Five days after trauma, SCI resulted in a significant reduction in PHB1 mRNA levels (Fig. 1A) and protein Fig. 2. Ad-PHB1 improved locomotion function following SCI. Openfield locomotion was assessed using the 21-point BBB scale. Rats were assessed weekly for 8 weeks following injury by blinded observers. BBB, Basso, Beattie, and Bresnahan; PHB1, prohibitin 1; SCI, spinal cord injury; values are means ± SD. n = 8 in each group; ⁄P < 0.05 versus Control + Ad rats; #P < 0.05 versus SCI + Ad rats.
Fig. 1. PHB1 expression. Graphs show the mRNA levels (A) of PHB1 at 5 days post-SCI. Western blotting results and responding quantification (B) of PHB1 in tissue homogenates and isolated mitochondria are shown. The protein levels of tissue homogenates and mitochondria were adjusted as relative values to b-actin and Cox II, respectively. PHB1, prohibitin 1; Cox II, cytochrome c oxidase subunit II; SCI, spinal cord injury; values are means ± SD. n = 12 in each group; ⁄P < 0.05 versus Control + Ad rats; #P < 0.05 versus SCI + Ad rats.
Fig. 3. Ad-PHB1 reduced mechanical and thermal allodynia at 8 weeks post-SCI. Mechanical (A) and thermal (B) allodynia, as two outcome measures of neuropathic pain, was monitored by von Frey monofilaments and tail-flick tests, respectively. PHB1, prohibitin 1; SCI, spinal cord injury; values are means ± SD. n = 9 in each group; ⁄ P < 0.05 versus Control + Ad rats; #P < 0.05 versus SCI + Ad rats.
L. Li et al. / Neuroscience 286 (2015) 27–36
31
Fig. 4. Neuroprotection of Ad-PHB1. The sections in the animals at 5 days after SCI were immuno-stained with an anti-NeuN (general neuronal marker, green) antibody. Picture (A) showed the section 3 mm rostral to the epicenter. Graph (B) showed quantification of the NeuN-positive cell counts at 5 days after SCI. Western blotting results and responding quantification (C) of NF200 were shown. PHB1, prohibitin 1; SCI, spinal cord injury; values are means ± SD. n = 9 in each group; ⁄P < 0.05 versus Control + Ad rats; #P < 0.05 versus SCI + Ad rats.
32
L. Li et al. / Neuroscience 286 (2015) 27–36
Fig. 5. Ad-PHB1 reduced apoptosis at 5 days after SCI. Western blotting results and responding quantification of cleaved C3, pro-C3, Bax, and Bcl2 were shown. C3, caspase-3; PHB1, prohibitin 1; SCI, spinal cord injury; values are means ± SD. ⁄P < 0.05 versus Control + Ad rats; #P < 0.05 versus SCI + Ad rats.
Fig. 6. Ad-PHB1 improved mitochondrial function at 5 days after SCI. Graphs showed mitochondrial ATP (A) and ROS (B) formation, mitochondrial respiration rates (C), and mitochondrial DNA content (D). Respiration rates from mitochondria were calculated as nmols oxygen/min/mg protein. Mitochondrial DNA was normalized with nuclear DNA content. ATP, adenosine triphosphate; ROS, reactive oxygen; PHB1, prohibitin 1; SCI, spinal cord injury; values are means ± SD. n = 9 in each group; ⁄P < 0.05 versus Control + Ad rats; #P < 0.05 versus SCI + Ad rats.
for 8 weeks following injury (Fig. 2). Ad-PHB1 administration significantly improved locomotor function of SCI rats. Mechanical and thermal allodynia A devastating post-SCI condition is neuropathic pain. Rats were tested for pain at 8 weeks following SCI, and here we observed that SCI rats were sensitive to the mechanical (Fig. 3A) and thermal (Fig. 3B) allodynia and a significant increase in pain tolerance in rats receiving Ad-PHB1. Neuroprotection To further confirm the protective effect of PHB1, we investigated the survival of neurons directly by immunofluorescence staining. The positive staining cells
decreased significantly after SCI at 5 days, and increased by Ad-PHB1 administration (Fig. 4A, B). NF200, a hallmark protein lost following neurodegeneration, was quantified in the injured region. It was observed that SCI reduced the NF200 expression and Ad-PHB1 administration upregulated the NF200 expression in SCI rats (Fig. 4C). All of these data indicated the neuroprotective effect of PHB1 against SCI. Apoptosis Five days after trauma, apoptosis in perilesional tissue was assessed by determining the proteins expression of Bcl-2 and Bax and ratio of cleaved C3 to pro-C3. Compared to control rats, spinal cord trauma elevated ratio of cleaved C3 to pro-C3 and protein expression of Bax and reduced Bcl-2 protein expression (Fig. 5),
L. Li et al. / Neuroscience 286 (2015) 27–36
33
indicating increased apoptosis at injury site after trauma. However, the SCI rats receiving Ad-PHB1 showed a lower ratio of cleaved C3 to procaspase-3 and reduced protein expression of Bax and increased protein expression of Bcl-2, indicating that SCI-induced proapoptotic Bcl-2/Bax/C3 signaling was attenuated by PBH1 administration. Mitochondrial function Five days after trauma, mitochondria in perilesional tissue were collected for measurement of mitochondrial function. It was observed that mitochondrial ATP formation (Fig. 6A) was reduced and mitochondrial ROS formation (Fig. 6B) was enhanced in SCI rat than that in Control rats. Ad-PHB1 administration restored mitochondrial ATP formation and suppressed mitochondrial ROS formation in the injured region. Quantification of mitochondrial respiration rates showed a significant decrease in state III and State V–Complex I respiration rates in the SCI rats compared to Control rats (Fig. 6C). Ad-PHB1 administration following SCI significantly maintained State III and State V–Complex I respiration rates. No significant difference of mitochondrial DNA content (D) was found among groups. Endoplasmic reticulum (ER) stress
Fig. 7. Ad-PHB1 suppressed ER stress at 5 days after SCI. Graphs showed mRNA levels of CHOP (A), CRP78 (B), and XBP-1 (C). ER, endoplasmic reticulum; CHOP, CCAAT enhancer binding protein homologous protein; CRP78, chaperone-ucose regulated protein 78; XBP-1, X-box protein 1; PHB1, prohibitin 1; SCI, spinal cord injury; Values are means ± SD. n = 9 in each group; ⁄P < 0.05 versus Control + Ad rats; #P < 0.05 versus SCI + Ad rats.
Five days after trauma, ER stress was analyzed by investigating three ER stress markers’ expression, including CHOP, XBP-1, and CRP78. SCI rats showed a significant augmentation of mRNA levels of CHOP (Fig. 7A), CRP78 (Fig. 7B), and XBP-1 (Fig. 7C), confirming the presence of ER stress in the injured region. Ad-PHB1 administration reduced the mRNA levels of CHOP, CRP78, and XBP-1, indicating that PHB1 overexpression prevented ER stress induction against SCI. Signaling pathways We next detected whether the protective effect of PHB1 in the recovery of SCI was associated with the activation of signal pathways of PI3K/AKT, ERK1/2, and nuclear factor-kappaB (NFjB). Western blot analysis
Fig. 8. PI3K/Akt, ERK1/2, and NFjB signals were involved in the protective effect of PHB1 in SCI rats. Western blotting results and responding quantification of PI3K, p-Akt, Akt, p-ERK1/2, ERK1/2, and NFjB p65 at 5 days after SCI were shown. ERK, extracellular signal-regulated kinase; PI3K, phosphatidylinositol-3-kinase; PHB1, prohibitin 1; SCI, spinal cord injury; values are means ± SD. ⁄P < 0.05 versus Control + Ad rats; # P < 0.05 versus SCI + Ad rats.
34
L. Li et al. / Neuroscience 286 (2015) 27–36
demonstrated that the expressions of PI3K and the phosphorylations of AKT (p-AKT) and ERK1/2 (p-ERK1/ 2) decreased and expression of NFjB p65 increased 5 days after SCI contusion (Fig. 8). Ad-PHB1 administration following SCI enhanced PI3K expression and phosphorylations of AKT and ERK1/2 and reduced NFjB p65 expression. These data indicated that the PI3K/AKT, ERK1/2, and NFjB signals might be associated with the effect of PHB1 in the recovery of SCI.
DISCUSSION The pathophysiological occurrence of SCI initiates a cascade of biochemical changes that includes necrotic and apoptotic cell death (McEwen and Springer, 2005). Although cell death occurs within minutes in the gray matter of the injury epicenter, apoptotic death of oligodendroglia is apparent in distal white matter tracts several days after trauma, which contributes to sensorimotor deficits through demyelination of intact neural pathways which survived the initial injury (Crowe et al., 1997; Shuman et al., 1997). Previously published experimental observations (Chowdhury et al., 2007, 2011) suggested that PHB may be a cell survival or anti-apoptotic factor that is likely to play an important role in cell fate decision and in mitochondrial integrity/cellular homeostasis. Mitochondria are involved in the so-called intrinsic pathway of apoptosis where they release soluble proteins, including cytochrome c, from the intermembrane space to initiate caspase activation in the cytosol (Kroemer et al., 2007; Vaux, 2011). The release of these proteins is a consequence of the integrity of the mitochondrial outer membrane being compromised, a process called mitochondrial outer membrane permeabilization (MOMP). In vertebrates, MOMP is under the control of the Bcl-2 family members, including antiapoptotic Bcl-2-like proteins (e.g. Bcl-2, Bcl-xL, Bcl-w, Mcl-1 and A1/Bfl-1) and proapoptotic Bax-like proteins (e.g. Bax, Bak and Bok/ Mtd) (Martinou and Youle, 2011). It was reported that PHB1 inhibited apoptosis in rat granulosa cells through activating the ERK1/2/Bcl-2 pathway (Chowdhury et al., 2013). In agreement with these published observations, SCI in rats in this work led to reduced phosphorylation of ERK1/2 and Bcl-2 expression and enhanced expression of Bax, which was reversed by PHB1 overexpression. Following SCI, mice deficient in CHOP signaling showed reduced apoptosis, increased spared white matter and enhanced locomotor recovery, which indicated the central role of ER stress in SCI (Fassbender et al., 2012). It is widely accepted that ER stress induces mitochondrial dysfunction and mitochondria-related apoptosis (Csordas and Hajnoczky, 2009; Egnatchik et al., 2014). However, it has been shown that mitochondrial dysfunction increased the level of ER stress markers in adipocytes and pancreatic beta cells (Kim et al., 2008; Lee et al., 2010) through enhanced ROS species formation. Mitochondria-targeted antioxidants MitoTempol or MitoQ protected pancreatic b-cells against ER stress in glucotoxicity and glucolipotoxicity (Lowes et al., 2008). It was reported that abrogation of PHB
induced ER stress and apoptosis in human hepatoma cells in a mechanism dependent on NFjB signaling (Sa´nchez-Quiles et al., 2010). Excess ROS activate the redox-sensitive transcription factor NF-jB, resulting in enhancement of its expression and activity (JanssenHeininger et al., 2000). In this work, PHB1 overexpression reduced levels of ER stress markers in rats with SCI, which might be contributed to the suppressed ROS/NFjB pathway. PI3K/Akt activation also inhibited ER stress-induced apoptosis (Dai et al., 2010). In addition, PI3K/Akt activation was found to contribute to the spinal cord protection afforded by ischemic postconditioning (Jiang et al., 2009) and exercise training (Jung et al., 2014). Yu et al. found that SOD1 overexpression reduced ROS formation, which contributed to PI3K/Akt activation and subsequent motor neuron survival after SCI (Yu et al., 2005). Our work found that PHB1 activated the PI3K/Akt pathway, which might be secondary to the reduction of mitochondrial ROS formation. In addition to those signaling pathways associated with apoptosis, there was a progressive increase in mitochondrial oxidative damage that preceded the loss of mitochondrial bioenergetics, suggesting that free radical damage and diminution of ATP may be important to mitochondrial secondary injury process (Sullivan et al., 2007; Hall, 2011; Jia et al., 2012). PHB1 overexpression following SCI reduced mitochondrial ROS formation and enhanced ATP production through restoring electron transport system in this work. Emerging data suggest that PHB1 plays a role in combating oxidative stress in multiple cells types. PHB1 knockdown in endothelial cells increased production of ROS in mitochondria via decreased activity of complex I and partial blockade of the electron transport chain (Schleicher et al., 2008). PHB1 overexpression protected the cardiomyocytes from oxidative stress-induced damage (Liu et al., 2009). Based on the findings thus far, downregulation of PHB1 following SCI in rats contributed to mitochondrial dysfunction, and subsequent apoptosis and oxidative damage. However, we cannot yet exclude a role of PHB1, localized in other cellular compartment, in the implication of it, which requires further investigation.
CONCLUSION The protective role of PHB1 in the recovery of SCI is related to the suppression of ROS formation via the restoration of electron transport chain and inhibition of cell death via the activation of downstream signals. PHB1 could thus be envisaged as a novel therapeutic target for improving outcome after SCI.
REFERENCES Artal-Sanz M, Tavernarakis N (2009) Prohibitin and mitochondrial biology. Trends Endocrinol Metab 20:394–401. Basso DM, Beattie MS, Bresnahan JC (1995) A sensitive and reliable locomotor rating scale for open field testing in rats. J Neurotrauma 12:1–21. Chowdhury I, Branch A, Olatinwo M, Thomas K, Matthews R, Thompson WE (2011) Prohibitin (PHB) acts as a potent survival
L. Li et al. / Neuroscience 286 (2015) 27–36 factor against ceramide induced apoptosis in rat granulosa cells. Life Sci 89:295–303. Chowdhury I, Thompson WE, Welch C, Thomas K, Matthews R (2013) Prohibitin (PHB) inhibits apoptosis in rat granulosa cells (GCs) through the extracellular signal-regulated kinase 1/2 (ERK1/2) and the Bcl family of proteins. Apoptosis 18:1513–1525. Chowdhury I, Xu W, Stiles JK, Zeleznik A, Yao X, Matthews R, Thomas K, Thompson WE (2007) Apoptosis of rat granulosa cells after staurosporine and serum withdrawal is suppressed by adenovirus-directed overexpression of prohibitin. Endocrinology 148:206–217. Crowe MJ, Bresnahan JC, Shuman SL, Masters JN, Beattie MS (1997) Apoptosis and delayed degeneration after spinal cord injury in rats and monkeys. Nat Med 3:73–76. Csordas G, Hajnoczky G (2009) SR/ER-mitochondrial local communication: calcium and ROS. Biochim Biophys Acta 1787:1352–1362. Dai RY, Chen SK, Yan DM, Chen R, Lui YP, Duan CY, Li J, He T, Li H (2010) PI3K/Akt promotes GRP78 accumulation and inhibits endoplasmic reticulum stress-induced apoptosis in HEK293 cells. Folia Biol (Praha) 56:37–46. Duchen MR (2012) Mitochondria, calcium-dependent neuronal death and neurodegenerative disease. Pflugers Arch 464:111–121. Egnatchik RA, Leamy AK, Jacobson DA, Shiota M, Young JD (2014) ER calcium release promotes mitochondrial dysfunction and hepatic cell lipotoxicity in response to palmitate overload. Mol Metab 3:544–553. Fassbender JM, Saraswat-Ohri S, Myers SA, Gruenthal MJ, Benton RL, Whittemore SR (2012) Deletion of endoplasmic reticulum stress-induced CHOP protects microvasculature post-spinal cord injury. Curr Neurovasc Res 9:274–281. Fehlings MG, Tator CH (1995) The relationships among the severity of spinal cord injury, residual neurological function, axon counts, and counts of retrogradely labeled neurons after experimental spinal cord injury. Exp Neurol 132:220–228. Hall ED (2011) Antioxidant therapies for acute spinal cord injury. Neurotherapeutics 8:152–167. Janssen-Heininger YMW, Poynter ME, Baeuerle PA (2000) Recent advances towards understanding redox mechanisms in the activation of nuclear factor jB. Free Radic Biol Med 28:1317–1327. Jia Z, Zhu H, Li J, Wang X, Misra H, Li Y (2012) Oxidative stress in spinal cord injury and antioxidant-based intervention. Spinal cord 50:264–274. Jiang X, Ai C, Shi E, Nakajima Y, Ma H (2009) Neuroprotection against spinal cord ischemia-reperfusion injury induced by different ischemic postconditioning methods: roles of phosphatidylinositol 3-kinase-Akt and extracellular signalregulated kinase. Anesthesiology 111:1197–1205. Jin Y, McEwen ML, Nottingham SA, Maragos WF, Dragicevic NB, Sullivan PG, Springer JE (2004) The mitochondrial uncoupling agent 2,4-dinitrophenol improves mitochondrial function, attenuates oxidative damage, and increases white matter sparing in the contused spinal cord. J Neurotrauma 21:1396–1404. Jung SY, Kim DY, Yune TY, Shin DH, Baek SB, Kim CJ (2014) Treadmill exercise reduces spinal cord injury-induced apoptosis by activating the PI3K/Akt pathway in rats. Exp Ther Med 7:587–593. Kim PK, Hailey DW, Mullen RT, Lippincott-Schwartz J (2008) Ubiquitin signals autophagic degradation of cytosolic proteins and peroxisomes. Proc Natl Acad Sci U S A 105:20567–20574. Kroemer G, Galluzzi L, Brenner C (2007) Mitochondrial membrane permeabilization in cell death. Physiol Rev 87:99–163. Kurinami H, Shimamura M, Ma T, Qian L, Koizumi K, Park L, Klann E, Manfredi G, Iadecola C, Zhou P (2014) Prohibitin viral gene transfer protects hippocampal CA1 neurons from ischemia and ameliorates postischemic hippocampal dysfunction. Stroke 45:1131–1138.
35
Lee JW, Kim WH, Yeo J, Jung MH (2010) ER stress is implicated in mitochondrial dysfunction-induced apoptosis of pancreatic beta cells. Mol Cells 30:545–549. Liu X, Ren Z, Zhan R, Wang X, Wang X, Zhang Z, Leng X, Yang Z, Qian L (2009) Prohibitin protects against oxidative stress-induced cell injury in cultured neonatal cardiomyocyte. Cell Stress Chaperones 14:311–319. Lowes DA, Thottakam BM, Webster NR, Murphy MP, Galley HF (2008) The mitochondria-targeted antioxidant MitoQ protects against organ damage in a lipopolysaccharide-peptidoglycan model of sepsis. Free Radic Biol Med 45:1559–1565. Luo J, Borgens R, Shi R (2004) Polyethylene glycol improves function and reduces oxidative stress in synaptosomal preparations following spinal cord injury. J Neurotrauma 21:994–1007. Mariappan N, Soorappan RN, Haque M, Sriramula S, Francis J (2007) TNF-a-induced mitochondrial oxidative stress and cardiac dysfunction: restoration by superoxide dismutase mimetic Tempol. Am J Physiol Heart Circ Physiol 293:H2726–H2737. Martinou JC, Youle RJ (2011) Mitochondria in apoptosis: Bcl-2 family members and mitochondrial dynamics. Dev Cell 21:92–101. McEwen ML, Springer JE (2005) A mapping study of caspase-3 activation following acute spinal cord contusion in rats. J Histochem Cytochem 53:809–819. McEwen ML, Sullivan PG, Springer JE (2007) Pretreatment with the cyclopsorin derivative, NIM811, improves the function of synaptic mitochondria following spinal cord contusion in rats. J Neurotrauma 24:613–624. Merkwirth C, Langer T (2009) Prohibitin function within mitochondria: essential roles for cell proliferation and cristae morphogenesis. Biochim Biophys Acta 1793:27–32. Norenberg MD, Smith J, Marcillo A (2004) The pathology of human spinal cord injury: defining the problems. J Neurotrauma 21:429–440. Patel SP, Sullivan PG, Pandya JD, Goldstein GA, VanRooyen JL, Yonutas HM, Eldahan KC, Morehouse J, Magnuson DS, Rabchevsky AG (2014) N-acetylcysteine amide preserves mitochondrial bioenergetics and improves functional recovery following spinal trauma. Exp Neurol 257:95–105. Patel SP, Sullivan PG, Pandya JD, Rabchevsky AG (2009) Differential effects of the mitochondrial uncoupling agent, 2,4dinitrophenol, or the nitroxide antioxidant, Tempol, on synaptic or nonsynaptic mitochondria after spinal cord injury. J Neurosci Res 87:130–140. Paul C, Derrett S, McAllister S, Herbison P, Beaver C, Sullivan M (2013) Socioeconomic outcomes following spinal cord injury and the role of no-fault compensation: longitudinal study. Spinal cord 51:919–925. Sa´nchez-Quiles V, Santamarı´ a E, Segura V, Sesma L, Prieto J, Corrales FJ (2010) Prohibitin deficiency blocks proliferation and induces apoptosis in human hepatoma cells: molecular mechanisms and functional implications. Proteomics 10:1609–1620. Schleicher M, Shepherd BR, Suarez Y, Fernandez-Hernando C, Yu J, Pan Y, Acevedo LM, Shadel GS, Sessa WC (2008) Prohibitin-1 maintains the angiogenic capacity of endothelial cells by regulating mitochondrial function and senescence. J Cell Biol 180:101–112. Semple BD (2014) Early preservation of mitochondrial bioenergetics supports both structural and functional recovery after neurotrauma. Exp Neurol 261C:291–297. Shuman SL, Bresnahan JC, Beattie MS (1997) Apoptosis of microglia and oligodendrocytes after spinal cord contusion in rats. J Neurosci Res 50:798–808. Sullivan PG, Dube C, Dorenbos K, Steward O, Baram TZ (2003) Mitochondrial uncoupling protein-2 protects the immature brain from excitotoxic neuronal death. Ann Neurol 53:711–717. Sullivan PG, Krishnamurthy S, Patel SP, Pandya JD, Rabchevsky AG (2007) Temporal characterization of mitochondrial bioenergetics after spinal cord injury. J Neurotrauma 24:991–999.
36
L. Li et al. / Neuroscience 286 (2015) 27–36
Sullivan PG, Rabchevsky AG, Waldmeier PC, Springer JE (2005) Mitochondrial permeability transition in CNS trauma: cause or effect of neuronal cell death? J Neurosci Res 79:231–239. Swartz KR, Scheff NN, Roberts KN, Fee DB (2009) Exacerbation of spinal cord injury due to static compression occurring early after onset. J Neurosurg Spine 11:570–574. Tsutsumi T, Matsuda M, Aizaki H, Moriya K, Miyoshi H, Fujie H, Shintani Y, Yotsuyanagi H, Miyamura T, Suzuki T, Koike K (2009) Proteomics analysis of mitochondrial proteins reveals overexpression of a mitochondrial protein chaperon, prohibitin,
in cells expressing hepatitis C virus core protein. Hepatology 50:378–386. Vaux DL (2011) Apoptogenic factors released from mitochondria. Biochim Biophys Acta 1813:546–550. Yu F, Sugawara T, Maier CM, Hsieh LB, Chan PH (2005) Akt/Bad signaling and motor neuron survival after spinal cord injury. Neurobiol Dis 20:491–499. Zhou P, Qian L, D’Aurelio M, Cho S, Wang G, Manfredi G, Pickel V, Iadecola C (2012) Prohibitin reduces mitochondrial free radical production and protects brain cells from different injury modalities. J Neurosci 32:583–592.
(Accepted 6 November 2014) (Available online 26 November 2014)
