Biochunica et Biophysica Acre, I 130 (1992) 139-148 ~.7)1992 Elsevier Science Publishers B.V. All rights reserved 0167-4"hq/92/$05.00

139

BBAEXP 92349

Promoter regions of the human X-linked housekeeping genes PRPS1 and PRPS2 encoding phosphoribosylpyrophosphate synthetase subunit I and II isoforms T o s h i h a r u I s h i z u k a , T a i z o lizasa, M a s a n o r i T a i r a , S u m i o Ishijima, T o m o k o S o n o d a , Hideaki Shimada, Naomi Nagatake and Masamiti Tatibana Department of Biochenlisto', Chiba Unicersity School of Medicine, Chiha (Japan) (Received 20 June It~lgl) (Revised manuscript received 24 Oclober It;91 )

Key words: Nucleolide synthesis; Plmsphoril~t~sylpyrophosphate synthetase; Rilx~se-pho.~phatepyrophosphokitmsc; Cell-specific expression: Promoter region: l lousekecping gone; (! luman) The 5' regions of the human phosphoribosylpyrophosphate synthctasc subunit I and !I genes (PRPSI and PRPS2, rcspcctivcly) were isolated and scquenccd. A comparison of the nuclcotide sequences bctwcen human and rat PRPSI genes revealcd that the sequences around the transcription initiation sites were conserved over 56 nucleotidcs, and that a TATA-likc sequence, a CCAAT box and three putative Spl binding sites were present at almost the samc positions in the GC-rich sequences. Two major transcription initiation sites were localized in the human PRPS1, one of the two was located 27 nucleotidcs downstream from the TATA-likc sequence, while the upstrcam initiation site was in the TATA-likc scquence. The promoter region of the human PRPS2 gone was also GC-rich and contained a TATA-likc sequence, four Spl binding sites and a homopyrimidine stretch. The initiation sites were localized at 90 nucleotidcs upstrcam from the ATG initiation codon. Chloramphcnicol acetyltransferase ( C A T ) / p r o m o t c r fusion assays showed that a 2.0 kb region (human PRPSI) find a !.1 kb region (human PRPS2) possessed the promoter activities in four ccll lines. Thc CAT activities in the three human cell lines tended to correlate with the steady-state m R N A levels of the PRPSI and PRPS2 genes. These results suggcst that the 5' flanking regions cloned contribute to the cell-differential expression of these two genes.

Introduction

Phosphoribosylpyrophosphate (PPRibP) synthetase (ATP:o-ribose-5-phosphate pyrophosphotransferase, EC 2.7.6.1) catalyzes the formation of PPRibP by a pyrophosphoryl transfer from ATP to ribose 5-phosphate. PPRibP synthetase is an indispensable enzyme, since PPRibP serves as the primary precursor of the ribose monophosphate moiety of all nucleotides [1,2] and is a critical control factor for de novo synthesis of purines [3] and pyrimidines [4]. PPRibP synthetase has

Abbreviations: PPRibP, 5-phosphoribosyl l-pyrophosphate; PRS ! and PRS ii, phosphoribosylpyrophosphate synthetase subunit I and Ii, respectively; bp, base pair(s): kb, kilobase(s): CAT, chloramphenicol acetyltransferase. Correspondence: M. Tatibana, Department of Biochemistry, Chiba University School of Medicine 1-8-1 lnohana, Chiba 280. Japan.

been purified from bacteria [5,6] and mammalian tissues [7-9]. The enzyme exists in many aggregated forms of various molecular masses. We reported that the rat liver enzyme is present as complex aggregates of 34, 38 and 40 kDa components, the 34 kDa species being the catalytic subunit [9]. Mammalian PPRibP synthetase has several isoform genes. As a result of rat eDNA cloning experiments and the amino acid sequencing of the purified enzyme, we obtained evidence for the presence of the two highly homologous isoforms, PRS I and PRS II [9,10]. We cloned the human eDNA homologous to the rat PRS I and PRS II eDNA [l 1,12]. Roessler et al. also cloned the two human cDNAs homologous to the rat PRS ! and PRS II cDNAs [13]. The PRS ! and PRS ll mRNAs are encoded by the two distinct genes, designated as PRPSI and PRPS2, respectively. The human PRPSI and PRPS2 are located in different regions of the X chromosome [14]. Furthermore, we tound a testis-specific transcript in humans, rats and mice [15].

Human cDNA cloning revealed that this transcript is encoded by another gene present on chromosome 7, designated as PRPS3 and that the transcript uses a non-AUG codon, ACG, as the translation initiation codon [ 16]. PRPS1 and PRPS2 are among the housekeeping genes, expressed in almost all cells, while the levels of their mRNAs vary in a tissue-differential manner [15]. In rats, the PRPS1 mRNA level is high in the brain and adrenal gland, whereas the PRPS2 mRNA level is high in the lung and spleen. Little is known of mechanisms of this tissue-differential expression. To study regulation of the PRPS genes, we isolated the entire rat PRPSI [17]. The promoter region of this gene contains a TATA box-like sequence, a CCAAT box and several GC boxes. In addition, X-linked human diseases with the elevated level of PPRibP synthetase activity have been reported [18-21]. As some of these might be caused by abnormal promoter activities of these genes, knowledge of the regulation of the human PRPS genes is indispensable. We now report the isolation of the promoter regions of human PRPSi and PRPS2 and we determined the sequences of the promoter regions and the transcription initiation sites. Chloramphenicol acetyltransferase (CAT)/ promoter fusion assays with the 5' flanking regions of the genes were carried out. The chimeric genes produced CAT activities in the transfected cells. The CAT activities tended to correlate with the mRNA levels in three human cell lines. These results suggest that the 5' flanking sequences contribute to the celldifferential expression of the human PRPSI and PRPS2 genes. Materials and Methods

Isolation of genomic clones An EMBI~ genomic library was constructed from a human female leukocyte DNA partially digested with Mbol [22]. This library was screened by plaque hybridization with the 32P-labeled fragments of the rat PRPSI eDNA (Sacl 1.25 kb, Ref. 15) and human PRPS2 eDNA (EcoRl/Bglll 1.0 kb, Ref. 11) as probes. The phage DNAs of the positive clones were isolated and analyzed by restriction enzyme mapping and Southern blot analysis, as described [17]. The DNA fragments, containing the exons, were subcloned into pUCIIS, pUCIi9 (Takara Shuzo, Kyoto) or pGEM-I (Promega Biotec, Madison) for further analysis. DNA sequencing Restriction fragments were subcloned into either M13mpl8 or Ml3mpl9. Nucleotide sequences of both strands were determined by the dideoxy chain termination method [23].

RNA isolation Total RNAs were isolated from the human testis or cultured cells by guanidinium thiocyanate extraction [24]. Poly(A) + RNA was selected with oligo(dT)-ceilulose [24] or oligo(dT)-Latex (Daiichi Pure Chemicals,

Tokyo). SI nuclease mapping Genomic DNA fragments (BstNI 0.9 kb of the PRPSI and SacI/EcoOl091 341 bases of the PRPS2 in Fig. IB) were 5' end-labeled with [y-32p]ATP (ICN Biomedicals, Costa Mesa) and T4 polynucleotide kinase (Takara Shuzo) to a specific activity of 8.107 cpm//zg. The DNA fragments were strand-separated by electrophoresis, as described [17] and the endlabeled antisense strand DNAs were used as S 1 probes (probe 1 and probe 3). The SI probe was also generated by the polymerase chain reaction with an endlabeled primer [25]. An antisense primer, TGGCCAACTACCCTAAGCAC (primer 1, sequence from nucleotide +96 to + 115 adjacent to BstNI site in the PRPSI), was end-labeled to a specific activity of 3.10 s cpm//~g. The polymerase chain reaction mixture contained 230 pmol of end-labeled primer 1, 23 pmol of sense primer, TAAAAAAGCAGGCATGGTTGA (primer 2, sequence from nucleotide -316 to -296 in the PRPSI), 100 #g of BstNI 0.9 kb fragment of the PRPSI, and 2.5 units of Thermus aquaticus DNA polymerase (Perkin Elmer Cetus, Norwalk) in a final volume of 100/~l. 30 amplification cycles were carried out with a DNA th~mal cycler (IWAKI GLASS, Tokyo). Each cycle consisted of a step program (94°C, 2 min; 52°C, 2 min; 73°C, 2 min). The product of the reaction was strand-separated as described above, and the endlabeled antisense strand DNA (probe 2 in Fig. IB, 431 bases from position -316 to + 115 in the PRPSl) was used as an S1 probe. SI nuclease protection assay was performed as described [17,26]. The protected fragments were analyzed by electrophoresis on a 7 M urea/5% polyacrylamide-sequencing gel alongside the genomic nucleotide sequence ladder initiated from the 5' end-labeled primer 1 or primer 3 (GTCCTGATGCGAGCTGCCGC, sequence from nucleotide + 113 to + 132 adjacent to EcoOl09I site in the PRPS2), which were labeled at the same positions as the S I probes. Primer extension analysis Primer extension analysis was performed with the end-labeled antisense primers (primer 1 of the "PRPSI and primer 3 of the PRPS2) as described [17,27]. The extension products were analyzed by electrophoresis as described above for S1 nuclease mapping. Piasmid construction for CA T/promoter fusion analysis The Sacl/PstI 2.0 kb fragment of PRPS1 and the Sall/BssHII 1.1 kb fragment of PRPS2 (see Figs. 1B

141 and 4A) were treated with T4 DNA polymerase ( T O Y O B O , Osaka) or Klenow enzyme (BoehringerMannheim). The blunt-ended fragments were ligated with H i n d l l l linker and digested with Hindlll. Excess linkers were removed with a Quick Spin Column (Sephadex G-50, Boehringer-MannheimL The 2.0 and 1.1 kb fragments were ligated into a unique Hindlll site of pSV00CAT (a gift from Dr. Y. Ebina, Tokushima University, Ref. 28) to construct p h i - C A T and ph2CAT, as shown in Fig. 4A. p h l R - C A T and p h 2 R - C A T have the same insert as p h i - C A T and ph2-CAT, respectively, in the opposite orientation. The orientation of the inserts was verified b~ D N A sequence analysis. DNA transfection and CA T assay C H O cells (Chinese hamster ovary, a gift from Dr. Y. E b i n a ) w e r e grown in F12 medium supplemented with 10% fetal calf serum. M G C 1 cells (human glioblastoma, a gift from Dr. N. Suzuki of this department, Ref. 29), RSa cells (ultraviolet-sensitive human clonal cells, a gift from Dr. N. Suzuki, Ref. 30), and U251-SP cells (human astrocytoma, a gift from Dr. J. Yoshida of Nagoya University, Ref. 31) were grown in minimal essential medium supplemented with 10% calf serum. Cells were transfected by the calcium phosphate co-precipitation technique [32,33], with 10 ~ g of the plasmids, along with 4 ~ g of p C H l l 0 (Pharmacia LKB Biotechnology, Sweden), a /3-galactosidase expression vector driven by an SV40 promoter and en-

A

5i

0i

I,o

15i

2p

25i (kb)

hancer, as an internal control to normalize transfection efficiency. In each transfection experiment, a positive control, pSV2CAT (CAT driven by an SV40 promoter and enhancer, Ref. 33), and a negative control, pSV00CAT (vector alone), were included. Cells were harvested at 48 h after the addition of DNA. Cell lysates were obtained by three cycles of freezing and thawing and assayed for C A T activity according to the method of Gorman [33]. /3-Galactosidase assay was performed according to the method of Miller [34]. Determination o f the 5' ends o f the CA T mRNAs Total R N A were purified from the CHO cells transfected with p h i - C A T or ph2-CAT, and the 5' ends of CAT m R N A s were determined by primer extension analysis with a CAT specific primer, G C C A T T G G G A TATATCAACGGTGG (position 4921-4944 in pSV2CAT, Ref. 33). The extension products were analyzed as described above. Northern blot analysis Northern blot analysis was performed as described [10], with 10/.tg of the total R N A from MGC 1 cells, U251-SP cells, and RSa cells. The 3' noncoding regions of the human PRPS1 e D N A (583 bp, sequence from nucleotide 1483 to 2075, Ref. 12) and PRPS2 eDNA (583 bp, sequence from nucleotide 1710 to 2292, Ref. l l ) were amplified by polymerase chain reaction (see Fig. 5). Each of the amplified DNAs were labeled

B PRPS1

PRPS1

Exon 1

!

XH4

Sc

Bt

L

t

Ps

ATG Hindlll

c

I

I I

II;

I

~

5c

~ Ptoll)e 1 ' Probe 2

I

PRPS2

subcl¢l~te

Sl

PRPS2

6t

'~

I

Sacl

~

Exon 1

I

EcoRI

.L._

Hindlll

I

l

,

,

II

H !

(Bs)EO(Sm)

.~.1 ~;

:

ATG BomHI

II

~,

~

XH15-

Bm SC

EO

.

I -

: Probe 3 E

1

c

J

Sail O.5 kb subclonel

b

I

Fig. I. Physical maps of human PRPSI and PRPS2 clones. (A) Upper (AH4) and middle (,~HI5) lines represent the genomic clones, containing 5' nortions of human PRPSI and PRPS2, respectively. The solid boxes indicate location of the exons with the exon numbers. The positions of the ATG initiation codon are marked by vertical arrows. Below the gene structures, Hindlll, Sacl, BamHl, EcoRi and Sa/l sites are shown. The AH4 clone does not have Bar.,Hl, EcoRI and Sail sites. In the lower portion of each clone, the fragments a through c indicate regions subcloned into pUCII8 (a), pGEM-I (b) and Ml3mpl8 and - 19 (c). (B) Fine mapping and the sequencing strategy. The fragme,ts a through c indicate the regions subcloned as described in A. Restriction enzyme designations are: Bm, BamHl; Bs, BssHil; Bt, BstNl: E EcoRl; EO, EcoOlOgh !t. Hindlll; Ps, Pstl; Sc, Sacl; Si, Sail; Sin, Sinai. The Sail site (SI) in b was derived from phage vector. BssHii site was not fully examined except for the positions indicated by (Bs). The horizontal arrows indicate the direction and extent of nucleotide sequencing from the universal primer (closed circles) or from the specific synthetic primers (open circles). In the lower portions of fragment a and b, probes !, 2 and 3 indicate the probes for the SI nuclease mapping(see Fig. 3).

142 by the random primed labeling method [35]. The labeled DNAs with the same specific activities and total counts were used as a mixed probe. The ratio of the steady-state mRNA level of the PRPSI to that of the PRPS2 was determined by densitometry with a Hoefer GS300 densitometer. Areas under the absorbance peaks were calculated with a Shimadzu C-R1A Chromatopac. Results

Isolation of the 5' regions of human PRPSI and PRPS2 About 5.5.105 recombinant phages from a human

female leukocyte genomic library were screened with the 32p-labeled rat PRPS! and human PRPS2 cDNA fragments as probes. 16 positive recombinant phages were obtained. Since humans have three gene loci strongly hybridized with the PRPS! probe [14], several clones were analyzed by restriction enzyme mapping. One of two promising clones, AH4, was further analyzed by nucleotide sequencing (Fig. 1). A partial sequence of the Sac i 2.3 kb region (fragment a) was compared with the sequences of rat and human PRPSI cDNAs [10,12,13] and rat genomic gene [17], thereby revealing that this clone contained exon 1 of the human PRPSI gene (Figs. 1 and 2). Other regions of AH4

A huian ~

AAATAAAAAAGCAGGCATG -3OI

.

.

.

.

, eRE

.

Spl

h

a'rro,vr'rrccGc'r,~ca~M^c~,~'rcva~ccv~AcoTc~cA6~Tcccvcc~ccc

-~4,

h

,~a'rcc,~,ca'r~:'rcc'rerccc~:~,~c^~cc'rA~c'rAcAaaG~cc~cTAT~aoTT^~TcT

-,8,

h

(:GCCCCCGTTCATGCTCTTCACCCAATACCiGAGAGAATC~aGAAGGAGGCAGAGC'rACAC - | 2 !

r

I II I I I I I I I I I I . . . TGGCTGTCTTTGTGATGTGAAAGTGCTTTAATTTAACCCCTCTCATGCCTTTGCACA

• h

.

Spl

.

. , CCAAT

.

.

r

CGAGGACCAAJACCCCGCCCI~rCGCTCCCTCT~AGCTAATC~TTGCCAGCGGGGTGTGGA-C -61 :1:' :lssl:i' : : I:ll :::si :: : : : : : :: : ATGCTGGAAqACTCCGCCCq-CACCCGGGTCClAGCCAATqCGGAAAGGCTGGGTGGAGAAC

h

• . SJ?l • VVVVVV . . l