International Immunology, Vol. 4, No. 8, pp.

875-887

© 1992 Oxford University Press

Properties of B cell stage specific and ubiquitous nuclear factors binding to immunoglobulin heavy chain gene switch regions Liangzhong X u \ Moon Gyo Kim2-4, and Kenneth B. Marcu1"3 'Molecular and Cellular Biology and 2Genetics Graduate Programs, Departments of Biochemistry and Cell Biology, Microbiology and 3Pathology, SUNY at Stony Brook, Stony Brook, NY 11794-5215, USA

Key words. CH gene switching, mobility shifts, S, region binding factors

Abstract The Ig heavy chain (IgH) constant region (CH) class switch is manifested by DNA deletions which exchange the C, gene of a functional VDJ - CH rearrangement for a CT, C, or C a gene. Repetitive sequences (S regions) 5' of each CH gene mediate CH gene switch recombination by an illegitimate mechanism. S, can be subdivided Into S,5' (non-repetitive) and S,3' (repetitive) components with recombination occurring in either part. Here, we describe the properties of ubiquitous and B cell stage specific S, binding factors NFS,-U, and NFS,-B, respectively. U, only bound to S,5' sequences, and B, to S,5', S_3' sequences and to other S regions with varying affinities. DMS and OP-Cu footprintlng revealed the sequence AAAAAGCATGGCTGA In the U, site while the B, S,5' site overlapped the 3' end of the U, binding site and also contained additional 3' flanking S, repeat motifs (GAGCTGAGATGGGTGGGCT). Binding site competition assays reveal that NFS,-B, Is either very related or Identical to SaBP (described by Waters et a/., Mol. Cell Blol. 9:5594, 1989) and BSAP (identified by Barberls ef al., Genes Devi. 4:849, 1990) which were shown to bind to two sequences upstream of the S a repeats and within the promoters of sea urchin histone genes respectively. Preincubatlon of B cell nuclear extracts at 37°C or treatment with protein dissociating agents such as NP-40, formamide or urea strongly enhanced NFS,-B, binding to switch repeat motifs but abrogated NFS,-U, binding. The DNA binding properties of NFS,-B,/Sa BP/BSAP Invokes provocative roles In B cell specific CH switch recombination and transcription.

Introduction Ig genes undergo a progressive series of rearrangements during the differentiation of B lymphoid cells. Following assembly of a functional variable (V) region gene, subsequent recombinations determine the heavy chain isotype of the expressed antibody (IgM, IgG, IgE and IgA). Heavy chain class switches are manifested by the rearrangement of constant region (CH) gene segments (reviewed in refs 1-4) which result in the deletion and replacement of the C, gene with a downstream CH gene (Cr3, C T 1, C^b, C^a, C, or CJ. These recombinations are mediated by switch (S) regions which are positioned about 2 kb 5' of every CH gene segment with the exception of C4. The decision to

rearrange to a particular CH gene is believed to be differentially regulated by the accessibility of S segments to a B cell specific switch recombinase activity (reviewed in refs 1 and 3). S regions consist of short tandemly repetitive sequences of varying length and homology. GAGCT and GGGGT sequences are found in all S regions in addition to three other commonly observed pentamers: ACCAG, GCAGC and TGAGC (reviewed in refs 1 and 4). A heptamer consensus motif, YAGGTTG (where Y indicates pyrimidine), has also been found nearby the majority of switch recombination sites in plasma cell tumors and hybridoma lines (2,5,6) and is also repeated in various S

Correspondence to: K. B. Marcu Transmitting editor: P. Tucker

Received 3 March 1992, accepted 20 April 1992

Downloaded from http://intimm.oxfordjournals.org/ at Princeton University on July 26, 2015

"Present address- Genetics and Biochemistry Branch, NIDDK, NIH, Building 10, Bethesda, MD 20892, USA

876

Switch region binding factors

segments. The 5' portion of the S,, region contains interspersed GAGCT, GGGGT and YAGGTTG sequences (2) while the 3' portion is composed of a simple repetitive block of (GAGCT)nGGGGT motifs where n = 1 - 7 (7). The S,, S£ and Sa sequences display considerable homology, particularly in areas containing repeats of GAGCT sequences, while the S7 regions contain a lower density of these pentamers but are typified by 49mer or 52mer (S^a) repeats and TGGGG, GCAGC and ACCAG motifs (8). The overall homology of the ST regions correlates with their distance from S, (e.g. S r 3>S T 1 >S 7 2b> S^a) (9,10). Switch recombination occurs at widely spaced positions within S, and other downstream S regions, and only limited sequence homology between S sequences may be present near the site of recombination (1,11).

Methods

Nuclear extracts All nuclear extracts were prepared according to Dignam et al. (28) without modification except for the inclusion of five additional protease inhibitors for the preparation of extracts from J558 and MPC-11 plasma cell tumor lines as descnbed (29) to avoid protein degradation. Nuclear extracts from the P3X and M603 lines were a gift from Dr K. Calame (Columbia University) and MEL and NIH3T3 extracts were kindly provided by Dr C. Asselin.

Cell lines A variety of murine cell lines were used for the preparation of crude nuclear extracts including: FL5.12 and 162303.1 (IL-3 dependent and independent pro-B lines) (12; J.McKearn, personnel communication), S7 (an A-MuLV pre-B line derived from a sad mouse) (13), 300-18 and 300-19 (A-MuLV pre-B lines) (14,15), 70Z3.B (late stage pre-B line) (16), K46 and WEHI 231 (surface IgM positive matuTe B lymphomas) (17,18), 22D6 (an IgA positive subline of the I-29 B lymphoma) (19), MPC-11 and J558L (plasma cell tumor lines) (20,21), S49 and EL4 (mature T cell lymphomas) (ATCC), and MEL (mouse erythroleukemia line DS19) (22). DNA probes and competitors S,, region DNA probes were isolated from plasmid pBKS, 1.2 which contains a 1.2 kb H/ndlll fragment of the BALB/c S, region (23) in pBluescript SK(-) (Stratagene). The S,96 probe was a 96 bp H/ndlll -Hha\ fragment from the 5' end of the pBKS,1.2 insert and S,120 a 120 bp Hha\ -H/ndlll fragment from the 3' end of the same vector. In some experiments (Figure 2) the S,96 probe was prepared as a 126 bp fragment by cleaving at the BamHI site in the pBluescript polylinker. All competitor DNAs were gel purified and quantitated by ethidium

Table 1. Summary of S,, oligo competitions Oligos"

SM motifs5

DNA probes0 S,96 U,

S,15 S,20 S,20A S^OB S^O YAG15 AUB19 U17 UB30 UB48 YUB65

S,120 B,

B,

A2G A2GA A3G (AG)2 (A2G)2

"Nucleotide sequences of S oligos are either presented in Fig. 5 or in Methods (AUB19 and YAG15). b A refers to one GAGCT pentamer and G to one GGGGT pentamer. C U and B are the ubiquitous and B cell specific S, binding factors: ( - ) indicates no competition for binding to the probes at 103 molar excess, ( + , + + and + + +) represent competition at 103, 102 and 10 times molar excess respectively.

Downloaded from http://intimm.oxfordjournals.org/ at Princeton University on July 26, 2015

To define the molecular requirements for class switching, we previously employed retroviral vectors to introduce switch recombination substrates into cells. These studies demonstrated that: (i) portions of two S regions are sufficient for efficient switch recombinant; 00 switch recombination is B cell specific; (iii) switch repeat motifs may mediate DNA rearrangements but only limited sequence homology resides at the precise sites of recombination; and (iv) switch recombination is regulated by multiple factors (presumably contributed in part by the degree of switch region accessibility) in addition to the presence of a B cell specific switch recombinase. Here, we have taken a more biochemical approach to dissecting the switch recombination process by identifying nuclear factors that bind to S region sequences. NFS^-U, only binds to sequences in the non-repetitive, 5' portion of S,, and is ubiquitously expressed. NFS^-B, binds to S, repeat motifs in conjunction with adjacent flanking sequences and to other S regions, and is only expressed by pre-B and immature surface Ig positive B cells.

bromide staining in comparison to molecular size markers and consisted of the following S region sequences: S,,5' and S,,3' (350 bp H/ndlll -Sstt and 850 bp Ssrl-H/ndlll fragments respectively from p8KS,1.2 in Fig 1), S r 3 (a 0.8 kb EcoRI-H/ndlll fragment from pS73 0.8), Sa (a 2.5 kb Xba\ fragment from p64 -101) (24), S72a (a 1.8 kb H/ndlll fragment from pSr2a-1) (18), S ^ b and 3'S^b (a 650 bp EcoRI -Xba\ fragment from pBR1.4 and its 3' adjacent 550 bp Xba\ -EcoRI fragment respectively) (10), and ST1 (a 2.1 kb SamHI fragment from pS71/B.Y (25). All switch region competitor DNAs only contained their repetitive sequences except for S ^ ' and 3'S72b. Complementary single stranded synthetic oligonucleotides were annealed overnight in 50 mM NaCI, 10 mM Tns(CI), pH 8.0, 1 mM EDTA. A 5' SQ probe, aS-2, was kindly provided in pBluescript by Dr Janet Stavnezer (University of Massachusetts) (26) which was isolated as a 66 bp EcoRI-SamHI fragment. Sequences of switch region synthetic oligonucleotides are provided in Figure 5 except for AUB19 (GGCTGAGCTGAGATGGGGT) and YAG15 (TCGAGTTAGGTTGGCAGGTTGC) employed in Table 1. Synthetic ohgonucleotide corresponding to wild-type and mutant sea urchin histone H2A-2.2 gene promoter sequences are as follows: 5'-TGTGACGCAGCGGTGGGTGACGACT-3' and 5'-TGTGACGAAGCGGTGGGTGACGACT-3' (27). Annealing of duplexes was verified on a 20% polyacrylamide gel and quantitated by ethidium bromide staining in comparison to known amounts of marker DNAs.

Switch region binding (actors 877 Gel retardation assays

temperature with freshly prepared 1,10-phenanthroline (OP) - C/x reagent which cleaves DNA in situ (31). DNAs were subsequently isolated by electroelution onto DE81 cellulose paper as described for methylation interference. The de-proteinated DNAs were analyzed on a sequencing gel along with a G/A ladder.

Gel mobility shifts were performed as described (30) with minor modifications. A standard binding reaction contained 1 ng of ^P-end-labeled DNA fragment, 5 /ig of nuclear extract and 5 ng of poly(dA-dT) - poly(dA-dT) (Sigma) as a non-specific carrier DNA. Binding reactions with partially purified protein were supplemented with 100 /ig/ml bovine serum albumin and 0.1% NP-40 in 20 /J. After 20 min at room temperature, samples were loaded on a 4 % polyacrylamide gel (30:1, acrylamide:bisacrylamide) run in 0.5 x TBE at 20 V/cm. For competition experiments, appropriate competitor DNAs were included in the binding reaction prior to addition of nuclear extract.

Results Identification of S binding proteins

DNA footpnntmg For methyiation interference, the standard binding reaction was scaled up 20-fold. 5' a-^P-end-labeled DNA fragments were partially methylated with dimethyisulfoxide (DMS) prior to nuclear factor binding and DNA-protein complexes were separated from the free form DNA probe on a 25 cm 4% gel. Shifted bands and free DNA were excised from the gel and electroeluted onto DE81 cellulose paper. DNAs were extracted in 400 y\ of 1M NaCI, 10 mM Tris(CI), pH 8.0,1 mM EDTA at 65°C for 30 min. Proteins were removed by several rounds of phenokchloroform extraction and DNAs were ethanol precipitated twice. Dried DNA pellets were resuspended in 20 /J of 10 mM sodium phosphate, pH 7.2, 1 mM EDTA, heated to 90°C for 15 min followed by the addition of 100 /d of 0.1 M NaOH, 1 mM EDTA and further incubated at 90°C for 30 min to enhance the A bands (29). Samples were ethanol precipitated twice before analysis on a 6 or 8% DNA sequencing gel. OP-Cu footprinting was performed according to a protocol provided by Dr K. Calame (Columbia University). The standard band shift reaction was scaled up 20-fold and applied to a 25 cm 4% gel. Gel slices were treated for 7-8.5 min at room

XZZA TANDEM REPEATS OF S/t MOTIF (GAGCT-T6G66)

H 50 bp I

Hh QJ S/i96

( D IgH ENHANCER • S/il20

S/i MOTIF

o * RECOMBINATION SITES [ Z N t S / i / S j ^ ) t k i SWITCH-RETROVECTOR] » — RECOMBINATION SITES [END06EN0US S/i RE6I0N]

Fig. 1 . Map of the S,, region. Locations of DNA probes S,96 and S,120 are indicated. S^ motif sequences (GAGCT and GGGGT) of varying length are represented by a stippled box and as a long tandem block by a hashed box. Switch recombination sites found in endogenous C H gene switches in ceil lines are represented by an arrow highlighted with an X and those found in exogenously introduced retroviral substrates in pre-B cell lines by a squiggled arrow ending in a circle. R, EcoRI; H, H/ndlll; S, Sst\; X, Xba\; Hh, Hha\.

Downloaded from http://intimm.oxfordjournals.org/ at Princeton University on July 26, 2015

We focused our attention to S, binding factors since these would be expected to play a genera) role in class switch recombination. Gel retardation assays were performed with crude nuclear extracts prepared from a variety of lymphoid and nonlymphoid cell lines and DNA probes were derived from the repetitive and non-repetitive portions of the S, region. The locations of DNA probes S,96 and S,120 within the S, region in relation to sites of switch recombination are shown in Fig. 1. S/I20 is a 120 bp Hha\ -/-//ndlll fragment containing S, tandem repeat motifs which generated a fairly complex pattern of DNA - protein complexes with crude nuclear extracts prepared from different cell types (Fig. 2A). However, the gel shift complex of greatest mobility, designated NFS^-B,, was only detected in nuclear extracts prepared from cell lines representative of pre-B and immature surface Ig positive B cells. 3^96 is a 96 bp /-//ndlll -Hha\ fragment derived from the 5' non-repetitive portion of S, which also gave a fairly complex gel shift pattern. One of the two major S,96 gel shift complexes of highest mobility exhibited the same B cell stage specificity as 3,,120-B, while the other more retarded band (3,96-11!) was S,96 specific and found in lymphoid and norvlymphoid cell types. The intensities of other bands migrating below 3,,96-B, and above S-U, were not reproducible with different batches of crude extracts and their presence did not correlate with the degree of B, or U, binding indicating they are neither degradation products nor aggregated

878

Switch regior

K; w;

"

"^ t

A

B

300-18

S/il20

Pre-B

Fig. 2. S binding factors revealed by gel mobility shift assays with crude nuclear extracts derived from various cell lines. Panels A and C are gel mobility shifts with 8,120 and 3,96 probes respectively. Panel B is a comparison of DNA-protein complex mobiities observed with S,96 and S,120 probes with 300-18 pre-B cell nuclear extract. The size of the S,96 probe in panels B and C was 126 bp due to the inclusion of 30 bp of pBluescnpt polylinker sequences (see Methods). The names of the cell lines and their cell types are indicated below panel C. B and T are mature B and T lymphocyte lines. E, PC and Fb are abbreviations for erythroid, plasma cell tumor and fibroblast lines respectively The positions of migration of two S,, D N A - protein complexes are labeled to the left of panel C- S^-U, and S,-B,. The S,-B, complex is also shown with the S,120 probe in panels A and B.

forms of these binding activities. S,96-B, was also detected in nuclear extracts from 18-8 and 38B9 pre-B lines (data not shown). The 5,,96-B, and S,120-B, complexes co-migrated, implying, along with their identical B cell stage specific expression patterns, that they are generated by the same DNA binding activity (Fig. 2B). We will refer to the B cell stage specific binding activity shared by 3,96 and 5,120 as NFSP-B,, and to the ubiquitous S,96 specific band as NFS^-U,, and will employ nuclear extracts from 300-18 pre-B cells for all subsequent experiments. Other S regions bind NFS,-B, but A/FS.-U, binds best to 5' S, sequences We investigated the binding site specificities of NFS,-U, and B, proteins for other switch regions by performing competition binding assays. The gel shifts in Fig. 2 were performed with 7.5 /xg of nuclear extract but only the major S,96 U, and B, band shifts were detected with 5 jig of crude extract in Fig. 3. S,120 and S,,96 probes were incubated with 5 /*g of 300-18 crude nuclear

extract along with a 200-fold molar excess of a restriction fragment derived from either ST3, S T 1, S^b, S ^ a or Sa (Fig. 3). The S,U, band was abolished by an S,5' fragment and only diminished in intensity with other S region competitor DNAs indicating that strong U, binding sites may uniquely reside in the 5' non-repetitive portion of S,. In contrast, all the repetitive S region fragments competed well for B, binding to the S,96 and S,120 probes (Fig. 3, data not shown). S,5', S,3', Sa, S^a and S^1 sequences were comparable competitors for B, binding to S,96 while ST3 and ST2b DNAs were less efficient (Fig. 3). A DNA fragment originating from the 3' portion of ST2b, which lacks tandem S repeats, did not show significant competition. Footprinting protein - DNA interaction sites in the Sf96 probe DNA footprinting assays were employed to determine nuclear factor binding sites. No clear footprint was observed for the B, factor with the S,120 probe by either DNasel, OP-Cu nuclease protection or DMS interference. This was presumably due to the

Downloaded from http://intimm.oxfordjournals.org/ at Princeton University on July 26, 2015

Pro-B

Switch region binding factors 879

300-18 COMPETITOR

"in ro ro _ e\j ,£" -. >*. >-*. X- o COCA)C/5COCOrOoOCO

I

technique revealed three pairs of hypersensitive sites with a spacing of 1 1 - 1 3 b p (Fig. 4A and C) which roughly encompasses three turns of a DNA helix. This could represent multiple abutting B, binding sites or alternatively suggests that the S,96 probe wraps around S,-B, resulting in localized distortions of DNA structure detected by OP-Cu nuclease. Molecular requirements for U1 and B, complex formation

Fig. 3. Different S region fragments compete for S,-B, binding. S,96 probe mobility shifts performed with 300-18 crude nuclear extract and a 200-fold excess of various unlabeled switch region competitor DNAs as indicated. S,5' and S,3' represent the non-repetitive and repetitive portions of the S, region. All other S fragments originate from the repetitive portions of the indicated S regions except for 3'S r 2b which resides 3' of the S72b 49mer repeats The first lane of each panel contains no extract and ( - ) contains extract without an S DNA competitor The positions of the U, and B, bands are indicated.

reduced affinity of S,-B, for 5,120 in comparison with S,96 and the more repetitive nature of the 8,120 probe (data not shown). However, clear footprints were obtained with the 3,96 probe. DMS interference and OP-Cu nuclear protection footprinfjng with the S,96 probe and 300-18 nuclear extract revealed different binding sites for the U, and B, band shifts (Fig. 4A and B). The U, band footprinted the sequence AAAAAGCATGGCTGA by methylation interference, the last two bases of which define the beginning of the S, motif. OP-Cu footprmting revealed a slightly larger footprint for the U, band extending its 3' side into the first four bases of the S, repeat. The (A)5 run at the 5' end of the S,U, binding site is of some potential interest since runs of As can be involved in DNA bending (32,33). Mobility shifts performed with smaller DNA probes containing less DNA 5' of the (A)5 run (see UB48 in Fig. 5) gave a faster moving U, shift implying that U, binding may indeed induce a DNA bend (data not shown). The S,-B, band displayed a weaker footprint encompassing a larger portion of the 8,96 probe which overlapped a portion of the S,-U, footprint (Fig. 4B). Due to the weak nature of some of the B1 - D N A contacts, the S,96 footprints were reproduced several times. The 3' end of the B, footprint encompassed 10 bp of the 5' portion of an S, repeat motif (GAGCTGAGAT) and weakly extended to its 3' side. Weak footprinting was also apparent on the (A)5 motif and other 5' flanking sequences including two pentamer sequences, GAGGC and GAGAG. Hypersensitive sites were observed at two bases in the DMS interference pattern: (i) the second G of the sequence GGCT which is also contained within the U, footprint and (li) the second G of the sequence AAGGTTG which represents a six out of seven match of a YAGGTTG consensus sequence found in S, and other S segments. The OP-Cu nuclease footprinting

NFSj-B, is related or identical to two other B cell stage specific DNA binding factors, S^P and BSAP Waters and colleagues reported the identification of SOBP, a nuclear factor with the analogous B cell stage specific expression pattern as NFS,-B, which bound to at least two different

Downloaded from http://intimm.oxfordjournals.org/ at Princeton University on July 26, 2015

S/i96

We next performed mobility shift competition assays with 5 /*g of 300-18 crude extract and synthetic oligonucleotides representing different portions of the U, and B, footprints and related sequences to better define their factor binding requirements (Fig. 5 and Table 1). U17, an oligonucleotide containing the S,-U, footprint (U, box), competed for U, binding to S,96 as well as the B, shift with both S,96 and S,120 but only at a lO^-fold molar excess. The S,120 probe lacks a U, binding site. The ability of the U17 oligo to compete for S,-B, binding even at a IC^-fold molar excess is surprising since U17 only contains the 5' 2 bp of the S, motif in the B, footprint. The AUB19 oligo contains the S, motif in the S,-B, footprint and the 3' portion of the U box site without its (A)5 motif, and failed to show competition for U, and B, binding even at a lOAfold molar excess (Table 1). UB30 contains the major portions of the U, and B, binding sites, and competed for U, and B, binding at a 100-fold molar excess. These results clearly demonstrate that sequences encompassing the U-, binding site are required in addition to an S, repeat motif (3' of the U, site) for B, binding to S,5' sequences. YUB65 contains the S,96 YAGGTTG motif and flanking sequences in addition to the UB30 sequence but was only 2-to 3-fold more efficient than UB30. Inaddition, YAG15 (an oligo consisting of two tandem YAGGTTG sequences) failed to show any competition for B, binding indicating that the YAGGTTG motif does not play an essential role in the 3,96-B, complex. UB48, which contains 12 bp more at its 3' end than UB30, was the most effective competitor and abolished B, and U, binding at a 5- to 10-fold molar excess. The single S, motif would appear to be a more effective component of the B, binding site if it does not reside at the end of the DNA molecule. Synthetic oligonucleotides containing three or four copies of S, motifs failed to compete for S,-B, binding even at a 103-!old molar excess (Fig. 5). Although an S, motif repeat corresponding in size to oligos S,20A and S,20B is a major part of the S,-B, binding site, perfect S, repeat motifs of this length are inadequate competitors for B, binding. S,30, the longest S, repeat motif oligo consisting of two tandem repeats of an S,15 mer, only competed for S,-B, binding at a ICP-fold molar excess. The latter result and the ability of an 850 bp fragment of tandem S, motifs to completely compete for S^-B, binding at a 200-fold excess (see S,3' lane in Fig. 3) would argue that numerous tandem repeats of the S, motif are more effective competitors for B, binding. S,30 was not an efficient competitor simply due to its length because the UB30 oligo was a most effective competitor for B1 binding.

880

Switch region binding factors

A

B

OP-Cu

DMS GA Fr U, B, Fr

GAFr UiFr B.Fr

U, Bi • t

Illii ice

t

n

gri

Hindm

YA66TT6

PENTAMER

MOTIF

Hhol

IAA6ttflGCT6A6CAAAATTAA6GGAACAA6GTT6fl6A6CCCTAGTAA6C6AG6CTCTAAAAAGCAT66CTGA6CTGAGAT6GGTG6GCTTCTCT6AgtGTl

u, Rg. 4. Footprinting of S,, region binding factors wrth 300-18 crude nuclear extract. (A) OP-Cu nuclease footprints of S^-U, and B,, (B) DMS interference footprints of S^-U, and B,, and (C) summary of footprinting results with the S^.96 probe. DMS interference and OP-Cu nuclease footprints are represented by open and stippled boxes, weak footprints by dashed boxes and hypersensitive sites by solid dots. The S^96 sequence footprints are displayed 5' to 3' from bottom to top. Fr is free DNA probe and GA is a Maxam and Gilbert G/A sequencing reaction.

sequences upstream of the S, switch repeats (26). Sequences derived from other switch regions competed to varying degrees for SaBP binding and one of these sites was upstream of the S, tandem repeat motifs. In light of these similarities, we compared the binding site specificities of NFS,-B, and SaBP for their respective target sequences. aS-2, an SaBP binding site oligonucleotide, specifically competed for S,-B, binding to S,96 (Fig. 6A) and S,96 competed for binding of SJ3P to a labeled aS-2 site (Fig. 6B). This cross competition assay also indicates that NFS,-B,/SaBP preferentially bound to the aS-2 site under these binding conditions. SOBP bound with similar specificity to two different sequences upstream of Sa, aS-1 and aS-2, which exhibited about 50% sequence homology (26). Figure 7 indicates

that Sj.96 and aS-2 contain homologous core sequences but aS-2 possesses only limited similarity with the latter two binding sites. Subsequent to the identification of SaBP, Barberis et al. (27) described the properties of BSAP, another mammalian B cell stage specific nuclear factor which bound to a conserved sequence motif within sea urchin histone 2A and 2B gene promoters. We became interested in BSAP because it has a B cell stage expression pattern similar to NFSp-B, and SaBP; and the BSAP consensus binding site bore some resemblance to the NFS(1-B,/SaBP binding sites (see Rg. 10). Barberis et al. had also shown the mutation of an invariant C residue in the histone promoter consensus sequence to an A abrogated BSAP binding

Downloaded from http://intimm.oxfordjournals.org/ at Princeton University on July 26, 2015

I:: : U

Switch region binding factors 881

B COMPETITORS-*

UI7

-

IO IO2 IO3

UB30

UB48

S/i20A

YU665

- IO IO 2 IO 3 - IO IO 2 IO3 - IO IO 2 IO 3

S^20B

- IO IO2 IO 3 - IO IO 2 IO 3

S/i30

- IO IO 2 IO3 - IO IP 2 IO 3

GATCCTAAAAAGCATGGCTGA GATTTTTCGTACCGACTCTAS

GATCCGAGCTCA£CTGGGGTGAGCTG GCTCGACTCGACCCCACTCGATCCTAC

UB30:

CTAAAAAGCATGGCT6A6CT6ACATGGCGT 6ATTTTTCGTACCG«TCG«TCTACCCCA

GACC TGAK TGA« TGG6GT CTCGACTCGACTCGACCCCA

UB48-

CATCCCAfiGtTCTAAAAA6CATGtCTGA6tTGACATGGGTG6GCTTCTCTGAG GCTCtGACATTTTTCCTACCGACTCG«KTACCCACCCGAA6AGACTCCTM

GAGCTGGGGTGA6CTGG6ST CTCGACCCCACTCGACCCCA

YUB65:

GATCO>CAA£GTT6AGACCCCTAGTAASCGAGCCTCTAAAAAGCATGGCTGAGCTGACATGGtTGGtCTG GTGTTCCAACTCTCGGGATCATTCGCTCCGAGATTTTTCGTACCGACTCGACTCTACCCACCCGACCTAG

S.3O:

GAeCTGAUTGeeeTGMCTCAeCTGGeGT CTCGACTCGACCCCACTCGACTCGACCCCA

AACCTTCCTGAGCAAAATTAACCGAACAACCTTCACAGCCCTACTAAGCGAGGCTCfAAAAACCATCncTGAGCTCACATnGnTCnr.rTTrTrTnACrnr TTCCAACCACTCGTTTTAATTCCCTTGTTCCAACTCTCCGGATCATTCCCTCCCAGATTTTTCGTACCCACTCGACTCTACCCACCCGAAGACACTCGCC

Fig. 5. S^96 mobility shifts wrth 300-18 nuclear extract (5 ^g) competed by synthetic oligonucleotides denved from the S^96 sequence and SM repeat motifs. The competitor oligos are indicated at the top of the figure along wrth their molarities and their sequences are shown at the bottom of the figure in comparsjon with the S,,96 probe.

and promoter function in mammalian B cell lines (27). In Fig. 6(C), we show that a 25 bp synthetic oligonucleotide corresponding to the H2A-2.2 promoter wild-type sequence is a very effective, specific competitor for B, binding to the S,96 probe while a mutant H2A-2.2 site is a much poorer competitor. Band shifts with an H2A-2.2 wild-type probe were also competed by aS-2 and switch region DNAs (data not shown). Furthermore, the S^B,/SaBP/BSAP DNA complexes migrated with similar RF values (Figs 6A - C and 7A, and data not shown). Taken together, these cross-competition assays strongly suggest that NFS^-B,, SaBP and BSAP represent the same B cell specific DNA binding activity. aS-1, aS-2 and the H2A-2.2 promoter sequences appear to be stronger binding sites for NFS,-B,/SaBP/BSAP than S_ probes under these in vitro conditions. A concensus sequence derived from the H2A and H2B gene promoters (27) bears homology to portions of the aS-2 and S,96 probes (Fig. 7). Enhanced SyB/SJlP binding to DNA probes with S, repeat motifs: effects of elevated temperature and protein denaturants DNA binding assays were performed at slightly elevated temperatures to further investigate the molecular basis for S,B,/SaBP to recognize different DNA sequences with varying specificity. Gel retardations of B cell specific DNA-protein complexes formed with S,96 at 37°C displayed enhanced B, and abrogated U, binding activity respectively (Fig. 8A). This effect was also demonstrable by preinajbating the nuclear extract at 37°C for 15 min (but not at 22°C) prior to the addition of the

DNA probe (Fig. 8B). The effects of the 37°C preincubation were irreversible since enhanced B, binding and loss of U, activity were equally apparent if the binding reactions were performed at 22°C, after preincubating without probe at 37°C (data not shown). In agreement with the data in Fig. 8{A), cross-competition binding assays also revealed that S^96 and aS-2 became comparable binding sites for the B cell stage specific factor at 37 °C (data not shown). In light of the alterations in DNA binding specificity observed at 37°C, gel mobility shifts were also performed in the presence of compounds known to dissociate protein complexes. Treatment with the ionic detergent sodium deoxycholate (DOC) inhibited U, and B, complex formation. However, U, was considerably more sensitive to DOC with most U, binding abrogated at 0.20% DOC while B, binding was only inhibited at greater than 0.4% DOC (Fig. 8C). DOC can be efficiently sequestered by an excess of non-ionic detergent like NP-40 which probably acts by the inclusion of DOC in micelles. Indeed, an initial treatment of crude nuclear extract with up to 0.60% DOC followed by the addition of 1.2% NP-40 resulted in enhanced B, complex formation while U, complexes were not rescued (Fig. 8C). The effects of DOC and NP-40 on enhanced B, binding were additive since NP-40 aJone had little if any effect on the B cell specific band shift (data not shown). DNA binding assays were next performed with formamide or urea to determine the effects of other protein dissociating compounds. Inclusion of up to 40% formamide or 4 M urea enhanced S,96/SaBP binding to either

Downloaded from http://intimm.oxfordjournals.org/ at Princeton University on July 26, 2015

U17:

882

Switch region binding factors

B

300-18 NE (2.5 jig)

aS-2

S/*96

300-18 NE (2.5/ig) S/i96 I

x

x o

aS-2 II

x

x

X (\J

1

X (O

X O rO

X N

X (C

-COMPETITORS X O IO

COMPETITORS x o

I

Sa-BP-»-

aS-2-*

S/A96-»

H2A-2.2

H2A-2.2M £

X

O

_Bi

Fig. 6. Cross-competition gel retardation assays reveal that NFS,-B,, SaBP and BSAP represent the same DNA binding activities. (A) Comparisons of mobility shift assays with S,96 probe and 300-18 nuclear extract with varying amounts of unlabeled homologous competitor or aS-2 as competitor which corresponds to the binding site of the SaBP B cell specific binding factor (26). (B) Comparisons of mobility shift essays with aS-2 probe and 300-18 nuctea; extract with the indicated amounts of homologous or S^96 competitor DNAs. (C) Gel retardation performed with 5,96 probe and 300-18 nuclear extract with synthetic oligonucleotide competitor DNAs corresponding to wHd type (H2A-2.2) and mutant (H2A-2.2M) histone H2A gene promoters. The H2A-2.2 sequence has been reported to generate a novel B cell specific band shift complex which was not apparent with the site directed mutant (27). The use of poly(dA-dT) as non-specific competitor instead of poly(dldC) (27) could in part explain the ability of the mutated htstone promoter to compete for S^96 binding. The sequences of the synthetic oligonucleotides are provided in Methods and the aS-2 probe was recovered from a pBluescript vector by EcoRI - BamH\ digestion (26).

Downloaded from http://intimm.oxfordjournals.org/ at Princeton University on July 26, 2015

-Bi

Switch region binding factors 883 aS-1

C T~1A C T TGCTACA C

Sn96

T GA GCT G

GATGGGTGG

aS-2

T G G G C TAG

G[T]T G G A T G G GTGQGRRR AA 5 C A t c t

H2A/H2B Con.

N

NF-SuBl Con.

NGRGCNRNGRTG

Sn Repeat Motif

T

t fHf ° tec

A AC

DT

GAGCTGGGGTG

RRNN G C T G AGC

Fig. 7. Comparisons of the Sf-B^ISaBPIBSAP factor binding sequences aS-1 and aS-2 sequences are derived from Waters et al. (26) and a consensus sequence of four sea urchin H2A and H2B gene promoters was obtained from Barberis et al. (27). Upper case letters indicate the predominant nucleotides and lower case letters are only observed once. R = purine and N = all nucleotides observed.

Discussion We have identified two DNA binding activities which recognize target sequences in the S, region: NFS^-U, and NFS,-B, which exhibited ubiquitous and B cell stage specific patterns of expression respectively. The ubiquitously expressed S,-U, factor preferentially bound to the 5' non-repetitive part of S, and more weakly to other S regions. Methylation interference and OP-Cu nuclease footprinting revealed that S,-U, interacts with the sequence AAAAAGCATGGCTGAGC. An oligonucleotide containing the 5' 15 bp of this sequence (U17) only functioned as a competitor

In addition to the S^-l^ factor, a B cell stage specific binding activity, S,-B, was also found to interact with a portion of the U, binding site and 3' flanking S, motif sequences. However, DMS interference and OP-Cu nuclear footprinting revealed a more complex type of DNA sequence interaction for S^-B,. The most prominent sequences in the S^-B, footprint consisted of a GAGGC pentamer motif and the (A)5 run of the U, site, which are also both found in the SV40 on and a 3' adjacent S, motif repeat GAGCTGAGATGGGTGGGCT. The protected sequences spanned at least 36 bp, which is roughly equivalent to three turns of the DNA helix. B, also bound to tandem repeats of S,, motifs without a U, binding site. ST and Sa sequences competed for S,-B, binding to either the 5' non-repetitive or 3' repetitive portions of S,. Waters and colleagues characterized a B cell stage specific nuclear factor, SaBP, which bound 5' of the Sa repeat region (26). DMS protection footprinting revealed that SQBP bound to two different sequences 5' of Sa and other S region fragments differentially competed for its binding. The SaBP binding sites did not contain S repeats and the S_ repeat motifs did not compete for its binding to 5' Sa sequences (26). However, we have shown that SaBP and NFS,-B, are very likely the same DNA binding factor. SaBP recognized the S, repeat motifs in 3,96 implying that different flanking sequences alter the factor's binding site specificity. Barberis ef al. also identified a DNA binding activity, BSAP, with essentially the same B cell stage expression pattern as NFS,-B,/SaBP which bound to a conserved sequence in sea urchin H2A and H2B gene promoters (27). Mobility shift assays also demonstrate that BSAP is probably identical to NFS^-B^S^BP. However, we did not detect an S,B,/SOBP band shift in the FL5.12 murine pro-B cell line while BSAP complexes were present in other pro-B lines of murine and human origin (27). The reasons for the latter discrepancy remain unclear but could reflect cell line variation especially since the binding activity first appears at the pro-B cell stage. A consensus sequence of the known binding sites for S,-B,/SaBP/BSAP reveals a striking similarity to an S, repeat motif (Fig. 7). We have provided compelling evidence that a variety of protein dissociating agents dramatically enhanced the interaction of S,B,/SaBP with DNA probes consisting of tandemly repeated S region sequences. Preincubation of B cell nuclear extracts at 37°C improved S)l-B1/SaBP's specificity for binding sites containing S, repeat motifs. This effect was even more dramatic

Downloaded from http://intimm.oxfordjournals.org/ at Princeton University on July 26, 2015

the SP96 or aS-2 probes (Fig. 9 A - D ) while U, binding was inhibited. Low concentrations of formamide were as effective as high concentrations in enhancing S)1-B1/S(IBP complex formation while increased binding to the S,,96 probe was always more dramatic. The UB48 oligonucleotide lacks the 5' 48 bp of the S,96 sequence, competed well for B, binding to S,96 but failed to yield a B, band shift under standard binding conditions (Fig. 5, Table 1, and data not shown). However, UB48 did generate a B, band shift in the presence of 40% formamide suggesting that protein dissociating agents enhance the factor's target sequence affinity (data not shown). Activation of S(l-B,/SaBP binding to Sa96 was strongest with several human B cell nuclear extracts since the S_-B,/SaBP B cell specific complex with S,,96 was barely if at all detectable in these extracts under standard binding conditions (Fig. 10A and B). However, activation of S,,B,/SaBP by protein dissociating agents was only demonstrable with pre-B and immature B cell lines (Fig. 10B), indicating that latent inactive forms of S ^ - B ^ B P are not present in fully mature B cells or non-lymphoid cells. Latent inactive forms of S,-B,/SaBP were also not found in cytostolic extracts (data not shown). Additional evidence for enhanced binding of S,B,/SaBP to switch repeat motifs was obtained with the S,120 3' S,, repeat probe which was a poorer S^B, binding site than S^.96 under standard conditions (see Fig. 2) while these probes became equally efficient upon formamide treatment (Fig. 10C). DMS interference footprinting revealed a number of faint contacts throughout the 8,120 probe under formamide binding conditions presumably due to its repetitive sequence characteristics.

for U, binding at a 1000-fold molar excess while another oligo (UB30) with an additional 11 bp to the 3' side of this footprinted sequence competed for U, binding at a 10- to 100-fold excess and also bound U r Gfigos lacking the 5' (A)5 run (AUB19) were ineffective competitors. Several features of the S,-U, binding site are interesting and invoke potential role(s) in switch recombination. First, the 3' portion of the binding site consists of an S, repeat motif which directly participates in most switch recombinations. Second, A runs have been observed in DNA replication origins in lambda bacteriophage (34), SV40 (35,36), and in yeast autonomous replicating sequences (HRS) (37,38), and are known to contribute to the formation of altered secondary structures leading to protein induced DNA bending (34,36). Sites of protein induced DNA bending nearby switch motifs could conceivably facilitate the interaction or alignment of two distant S regions as a prelude to switch recombination. Preliminary results suggest that NFS,-U, binding may induce an altered DNA conformation (data not shown).

884

Switch region binding factors

B PREINCUBATE

l i s a

i l f i

Bi—» .

45

BINDING TIME 30' 15' 5 0

PREEVOJBATE BINDING TIME 46' 30 15 5' 0

SuBP

NP40 (1J2 %) + DOC (%) • 1

0

0.08

0.20 0.40 0.60

1

0

0.08

050 0.40 0.60

Bl

Fig. 8. Comparisons of gel mobility shifts performed at 22 and 37°C and effects of DOC and NP-40 detergents. (A) Gel mobifity shifts were performed with the S,96 and aS-2 DNA probes with 300-18 and EL-4 nuclear extracts at room temperature (RT) or 37°C. (B) 300-18 nuclear extracts were prefncubated for 15 min at either 22 or 37°C in the absence of DNA probe followed by the addition of labeled S^96 probe for the indicated times prior to gel fractionation. (C) Gel mobility shifts with S,96 probe and 300-18 nuclear extract were performed in the presence of increasing amounts of DOC for 15 min at 22°C and then incubated an additional 15 min at 22°C with or without 1.2% NP-40 prior to gel fractionation.

upon inclusion of DOC and NP-40, formamide or urea. Given the ability of these conditions and compounds to disrupt protein protein interactions, these treatments may a'ther be altering S,B,/SaBP conformation or removing an inhibitory factor which modifies the factor's binding site specificity. The NFxB and AP-1

transcription factors have been documented to associate with other proteins which inhibit their DNA binding activities (39,40). Activation of their DNA binding activities by treatment with agents like DOC and NP-40 or formamide resulted in the dissociation of inhibitory polypeptides. Indeed, experiments with partially

Downloaded from http://intimm.oxfordjournals.org/ at Princeton University on July 26, 2015

DOC (%)

Switch region binding factors 885

A

B FORMAMIDE I". >

FORMAMIDE

0

1 2

3

4

40

SaBP

aS-2

Fig. 9. Gel retardations performed wrth increasing concentrations of formamide or urea. (A) and (B) Mobility shifts of S 96 and aS-2 probes with 300-18 nuclear extract and increasing formamide concentration. (C) and (D) Mobility shifts of S,96 and aS-2 probes with 300-18 nuclear extracts in the presence of increasing amounts of urea. A gel shift wrth formamide and S,96 is shown in (C) for comparison.

purified preparations of S,-B,/SaBP indicated that formamide treatment reduced the apparent molecular weight of the native DNA binding activity suggesting that inhibitory factors could be responsible (data not shown). DMS footprinting performed on the NFS,-B, complex with the S,96 probe in the presence of 40% formamide revealed no clear differences with the original footprint in the absence of the protein denaturant (Fig. 4 and data not shown). The formamide induced enhancement of S,-B, binding activity for S, motif probes was a property of both murine and human B cell nuclear extracts implying that this intrinsic feature of S,-B,/SOBP/BSAP is functionally significant. Two other S region binding activities have been described but appear unrelated to S,-B,/SaBP/BSAP. Wuerffe) et al. (41) have described another S, repeat motif DNA binding activity, NFS,,

which appears after mitogen stimulation of splenic lymphocytes. NFS, generated a single band shift with a GAGCTGGGGT(GAGCT)3 25 mer and DMS interference indicated that binding centered on the (G)4 run. However, no data are available on the B cell specificity of NFS,. Nevertheless, S,-B,/SaBP only bound to large (>100 bp) S, motif fragments and this binding was enhanced by protein dissociating agents. Recently, Williams and Maizels (42) reported the identification of LR1 an LPS responsive S region binding factor whose activity is dependent on phosphorylation. S,-B,/SOBP binding activity was present in primary splenic lymphocytes without mitogenic stimulation and phosphatase treatments of B cell nuclear extracts did not inhibit S^-B, binding (26, data not shown). We envisage several possible functions for S,-B,/SaBP/BSAP

Downloaded from http://intimm.oxfordjournals.org/ at Princeton University on July 26, 2015

aS-2

886

Switch region binding factors A

FORMAMIDE 0

20

40

40

0

RAMOS

2 0 4 0

300-18

FORMAMIDE (%) 0 2 0 4 0

0 2 0 4 0

0

20

40

0

40

Bl Ui

Sul20

RAJI

FL5.12

HELA

Su96

1

300-18

Fig. 10. Formamide treatment reveals S -B, binding activity in human B cell lines and enhances binding to an S^ repeat probe. (A) S,,96 mobility shifts reveal S f -U, complexes in human BJAB lymphoblastoid and Ramos Burkitt lymphoma cells and S^-B, complexes upon formamide addition, (B) S^96 mobility shrfts only reveal S -U, complexes in Raji Burkitt lymphoma, FL5.12 murine pro-B, and HeLa human cervical carcinoma cells. cells Formamide treatment abrogates most nuclear factor binding with FL5.12 and HeLa extracts, and only activates S,-B, binding in Raji. (C) Formamide Form treatment dramatically enhances the formation of an S^-B, complex with the tandemly repeated S^120 probe.

in class switching which need not be mutually exclusive. Given the ability of S,-B,/SaBP to preferentially bind to an essential sequence required for sea urchin histone promoter function in mammalian B cells, this DNA binding activity may initially participate in establishing the transcriptional competence and/or accessibility of the CH locus for switch recombination. The conversion of SaBP/BSAP into the S,-B, switch region binding activity could be regulated by inhibitory factors. In the absence of such inhibitory factors, S^-B, would then facilitate the synapsis or alignment of distantly separated switch regions prior to their recombination. This might involve the opening or melting of DNA

sequences as a prelude to strand breakage; and the existence of multiple, adjacent S^-B, binding sites amongst the tandemly repetitious sequences in S regions may be involved in its mechanism of action. S,-B,/SaBP/BSAP could represent the first connection between transcription and Ig gene recombination.

Acknowledgements We thank Dr J. Stavnezer for providing a clone of the aS-2 SaBP binding site, Drs W. Dunnick and M. Julius for providing Sa1 and SjJa plasmids respectively, Drs K. Calame and C. Asselin for their generous gifts of

Downloaded from http://intimm.oxfordjournals.org/ at Princeton University on July 26, 2015

BJAB

0

Switch region binding (actors 887 nuclear extracts, Dr David 08 for helpful suggestions, and Drs K. Calame and P. Tegtmeyer for protocols and helpful discussions. We acknowledge Dr Anthony Cutry's suggestion to perform band shift's at 37°C, for performing some of the S^SJS and S^120 probe footprinting under formamide binding conditions, and for critical reading of the manuscript We thank Karin Bondarchuk for technical assistance, C.Hetmke and J.Schirmir for photography and illustration work, and Margarita Reyes for manuscript and figure preparation. This work was supported by NIH grant GM26939 awarded to K.B.M.

20

21 22 23

Abbreviations DMS DOC

dimethyl sulfoxide sodium deoxycholate 24

References 25 26

27 28 29 30 31

32 33 34 35

36 37 38 39 40 41 42

Downloaded from http://intimm.oxfordjournals.org/ at Princeton University on July 26, 2015

1 Gntzmacher, C A 1989 Molecular aspects of heavy chain class switching. Crit. Rev Immunol. 9:173. 2 Marcu, K B., Lang, R. B , Stanton, L. W., and Harris, L. J. 1982 A model for the molecular requirements of immunoglobulin heavy chain class switching Nature 298:87 3 Radbruch, A., Burger, C , Klein, S., and Muller, W 1986 Control of immunoglobulin class switch recombination. Immunol. Rev. 89:69. 4 Shimizu, A. and Honp, T 1984 Immunoglobulin class switching. Cell 36.801. 5 Petrmi, J. and Dunnick, W. 1989. Products and implied mechanism of H chain switch recombination J. Immunol 142:2932. 6 Winter, E., Krawinkel, U., and Radbruch, A. 1987. Directed Ig class switch recombination in activated murine B cells. EMBO J. 6:1663 7 Nikaido, T., Nakai, S., and Honjo, T. 1981 Switch region of immunoglobulin C mu gene is composed of simple tandem repetitive sequences. Nature 292845. 8 Kataoka, T , Miyata, T , and Honjo, T 1982 Repetitive sequences in class-switch recombination regions of immunoglobulin heavy chain genes. Cell 23:357. 9 Shimizu, A , Takahashi, N., Yaorta, Y , and Honjo.T 1982. Organization of the constant-region gene family of the mouse immunoglobulin heavy chain. Cell 24.499. 10 Stanton, L. and Marcu, K. B. 1982. Nucleotide sequence and properties of the murine gamma 3 immunoglobulin heavy chain gene switch region- implications for successive C gamma gene switching Nucleic Acids Res. 105993. 11 Ott, D E. and Marcu, K. B. 1989. Molecular requirements for immunoglobulin heavy chain constant region gene switchrecombination revealed with switch substrate retroviruses. Int. Immunol. 1:582. 12 McKearn, J. P., McCubrey, J., and Fagg, B. 1985 Enrichment of hematopoietic precursor cells and cloning of multipotential B lymphocyte precursors. Proc. Natl Acad. Sci. USA 82:7414. 13 Kim M. G., Schuler, W., Bosma, M. J., and Marcu, K. B. 1988. Abnormal recombination of Igh D and J gene segments in transformed pre-B cells of scid mice. J. Immunol 141:1341. 14 Art, F. W., Rosenberg, N., Casanova, R. J., Tomas, E., and Baltimore, D. 1982. Immunoglobulin heavy-chain expression and class switching in a murine leukemia cell line. Nature 296325. 15 Reth, M. G., Amirati, P., Jackson, S., and Alt, F W. 1985. Regulated progression of a cultured pre-B cell line to the B cell stage. Nature 317.353. 16 Paige, C. J., Kincade, P. W., and Ralph, P. 1981. Independent control of immunoglobulin heavy and light chain expression in a murine pre-B cell line Nature 292:631. 17 Boyd, A. and Schrader, J. W. 1981. The regulation of growth and differentiation of a murine B cell tympnoma: II. The inhibition of WEH1231 by anti-lg antibodies. J. Immunol. 126:2466. 18 Kim K. J., Kaneflopoulous-Langevin, C , Merwin, R. M., Sachs, D. H., and Asofsky, R. 1979. Establishment and characterization of BALB/c rymphoma lines with B cell properties. J. Immunol. 122:549. 19 Stavnezer, J., Raddiff, G., Lin, Y.-C., Nietupski, J., Berggren, L, Sitia, R., and Severinson, E. 1988. Immunoglobulin heavy-chain switching

may be directed by prior induction of transcripts from constant-region genes. Proc. Natl Acad. Sci. USA 85:7704. Laskov, R. and Scharff, M. D. 1970. Synthesis, assembly and secretion of gamma globulin by mouse myeloma cells. I. Adaptation of the MPC-11 tumor to culture, cloning and characterization of gamma globulin subunits. J. Exp. Med. 131:515. Oi, V. T., Morrison, S. L., Herzenberg, L. A., and Berg, P. 1983. Immunoglobuin gene expression in transformed lymphoid cefls. Proc. Natl Acad. Sci USA 80:825. Lachman, H. and Skoultchi, A. I. 1984. Expression of C-mycchanges during differentiation of mouse erythroteukemia cefls. Nature 310: 592. Marcu, K. B , Banerji, J., Penncavage, N., Lang, R., and Arnheim N. 1980. The 5' flanking region of immunoglobulin heavy chain constant region genes displays length heterogeneity in the germ fines of inbred mouse strains. Cell 22.179. Harris, L. J., Rammers, E. F., Brodeur, P., Ribtet, R., D'Eustachio, P., and Marcu, K B. 1983. C-myc gene rearrangements involving gamma immunoglobulin heavy chain gene switch regions in murine plasmacytoms. Nucleic Acids Res. 11.8303 Mowatt, M. R. and Dunnick, W. 1986. DNA sequence of the murine gamma 1 switch segment reveals novel structural elements. J. Immunol. 136.2674. Waters, S. H., Saikh, K. U., and Stavnezer, J. 1989. A B-ceD-specific nuclear protein that binds to DNA sites 5' to immunoglobulin S alpha tandem repeats is regulated during differentiation. Mol Cell Biol. 9: 5594 Barberis, A., Widenhorn, K Vrtelli, L, and Busslinger, M. 1990. A novel B-cell lineage-specific transcription factor present at early but not late stages of differentiation. Genes Devi. 4849 Dignam, J. D., Lebovrtz, Ft M , and Roeder, R. G. 1983. Accurate transcnption initiation by RNA pdymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475. Peterson, C. L. and Calame, K. L. 1987 Complex protein binding within the mouse immunoglobulin heavy chain enhancer. Mol. Cell. Biol. 7:4194. Singh, H.,Sen, R., Battimore, D., and Sharp, P. 1986. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes. Nature 319:154. Kuwabara, M. D. andSigman, D S 1987. Footprinting DNA-protein complexes in situ following gel retardation assays using 1,10-phenanthroline- copper ion: Escherichia coh RNA pdymerase - Lac promoter complexes. Biochemistry 26.7234. Koo, H -S., Wu, H.-M., and Crothers, D. M. 1986. DNA bending at adenine-thymme tracts. Nature 320:501. Radic, M. Z., Lundgren, K , and Hamkalo, B A. 1987. Curvature of mouse satellite DNA and condensation of hetercchromatin. Ceil 50:1101. Zahn, K. and Balttner, F. R. 1985. Binding and bending of the lambda replication origin by the phage O protein. EMBO J 4:3605. Deb, S., DeLucia, A. L, Koff, A , Tsui, S., and Tegtmeyer, P. 1986. The ademne-thymidine domain of the simian virus 40 core origin directs DNA bending and coordinatety regulates DNA replication. Mol. Cell. Bid. 6:4578. Ryder, K , Silver, S., DeLucia, A. L., Fanning, E., and Tegtmeyer, P. 1986. An altered DNA conformation in origin region I is a determinant for the binding of SV40 large T antigen. Cell 44:719. Snyder, M., Buchman, A. R., and Davis, R. W. 1986. Bent DNA at a yeast automously replicating sequence. Nature 324:87. Williams, J. S., Eckdahl, T. T., and Anderson, J. N. 1988. Bent DNA functions as a replication enhancer in Saccharomyces cerevisiae. Mol. Cell. Biol. 8:2763. Baeuerie, P. A. and Baltimore, D. 1988. Activation of DNA-binding activity in an apparently cytoplasmic precursor of the NF-xB transcnption factor. Cell 53.211. Auwerx.J. and Sassone-Corsi.P. 1991. IP-1: a dominant inhibitor of fosljun whose activity is modulated by phosphorytation. Cell 64:983. Wuertfel, R. A., Nathan, A. T., and Kenter, A. L. 1990. Detection of an immunoglobulin switch-region specific DNA binding protein in mitogen-stimulated mouse splenic B cells. Mol. Cell. Biol. 10:1714. Williams, M. and Maizels, N. 1991. LRI, Bpopolysaccnaride-responsive factor with binding sites in the immunoglobulin switch regions and heavy-chain enhancer. Genes Devi. 5:2353.

Downloaded from http://intimm.oxfordjournals.org/ at Princeton University on July 26, 2015