Vol. 11, No. 12
MOLECULAR AND CELLULAR BIOLOGY, Dec. 1991, p. 5910-5918
0270-7306/91/125910-09$02.00/0 Copyright C 1991, American Society for Microbiology
Properties of the DNA-Binding Domain of the Saccharomyces cerevisiae STE12 Protein YI-LU
0.
YUAN1 AND STANLEY FIELDS2*
Program in Genetics' and Department of Microbiology,2 State University of New York at Stony Brook, Stony Brook, New York 11794 Received 22 July 1991/Accepted 4 September 1991
The STE12 protein of the yeast Saccharomyces cerevisiae binds to the pheromone response element (PRE) present in the upstream region of genes whose transcription is induced by pheromone. Using DNase I footprinting assays with bacterially made STE12 fragments, we localized the DNA-binding domain to 164 amino acids near the amino terminus. Footprinting of oligonucleotide-derived sequences containing one PRE, PREs in head-to-tail or tail-to-tail orientation, showed that the N-terminal 215 amino acids of STE12 has similar binding affinity to either of the dimer sites and a binding affinity 5- to 10-fold lower for the monomer site. This binding cooperativity was also evident on a fragment from the MFA2 gene, which encodes the a-factor pheromone. On this fragment, the 215-amino-acid STE12 fragment protected both a consensus PRE as well as a degenerate PRE containing an additional residue. Mutation of the degenerate site led to a 5- to 10-fold decrease in binding; mutation of the consensus site led to a 25-fold decrease in binding. The ability of PREs to function as pheromone-inducible upstream activation sequences in yeast correlated with their ability to bind the STE12 domain in vitro. The sequence of the STE12 DNA-binding domain contains similarities to the homeodomain, although it is highly diverged from other known examples of this motif. Moreover, the alignment between STE12 and the homeodomain postulates loops after both the putative helix 1 and helix 2 of the STE12 sequence. or two
The yeast Saccharomyces cerevisiae exists as two different haploid cell types, a and at. Mating between these two cell types to form the a/a diploid cell type is facilitated by the exchange of the peptide pheromones a-factor and a-factor (for a review, see references 4, 15, and 33). Cells respond to the appropriate pheromone with a variety of intracellular and cell surface changes, including the increased transcription of inducible genes encoding products involved in the mating process. Transduction of the pheromone signal involves a pathway including the pheromone receptor (STE2 or STE3), a trimeric G protein (composed of GPA1, STE4, and STE18), four putative protein kinases (STE7, STE11, FUS3, and KSS1), the STE5 protein, and the STE12 protein. STE12 is the transcriptional activator that binds to the pheromone response element (PRE), the DNA sequence conferring induction by pheromone (5, 6). STE12 appears to be the ultimate target of the pheromone response pathway for changes in gene expression; it is rapidly phosphorylated in cells treated with pheromone, and this modification correlates with its ability to mediate increased transcription (32). Pheromone-responsive transcription has been demonstrated for genes expressed only in a cells (a-specific genes), genes expressed only in a cells (a-specific genes), and certain genes expressed only in a and a, but not in diploid a/a cells (haploid-specific genes) (2, 12, 13, 20, 22, 37, 38). The PRE (defined here as the sequence ATGAAACA) is required for a-factor induction of a-specific genes (20, 38) and a-factor or a-factor induction of haploid-specific genes (11). The PRE alone can function as an inducible upstream activation sequence (UAS); although one report indicated that the PRE is preferentially responsive to a-factor in a cells (29), an analysis of sequences regulating the expression of the hap*
loid-specific gene FUSJ indicated that PREs can mediate induction by either pheromone (11). The sequence required for a-factor induction of a-specific genes corresponds to the same sequence responsible for a-specific expression (18) and does not closely resemble the PRE. STE12, like other members of the signal pathway except the receptor, plays a role in both the basal (uninduced) as well as the induced level of pheromone-responsive genes (7, 8, 13, 22). Its binding to the PRE was demonstrated by gel mobility shift assays with probes containing two copies of the PRE (5) or a single copy adjacent to a binding site for the transcriptional activator MCM1 (6). A direct role for STE12 in gene induction was shown by fusion of this protein to the GAL4 DNA-binding domain, which resulted in a hybrid protein that converts the GAL4 binding site into a pheromone-responsive sequence (32). Analysis of other eukaryotic transcriptional activators indicates they are often composed of separable domains for site-specific DNA binding and transcriptional activation (for a review, see reference 14). The DNA-binding function can be carried out by protein sequences forming at least four distinct motifs: helix-turn-helix, zinc finger, leucine zipper, and helix-loop-helix. The homeodomain, containing a helixturn-helix motif similar to that found in various prokaryotic repressors (24), was originally defined as a highly conserved 60-amino-acid sequence shared by several Drosophila homeotic proteins (28). This domain was then identified in proteins from many other eukaryotes, including yeasts (30). We characterize here the DNA-binding domain of STE12, localizing the minimal region for this function to 164 amino acids near the amino terminus. Additionally, we find that an N-terminal domain of STE12 can bind cooperatively to two copies of the PRE in a manner largely independent of the orientation or spacing of these elements. Binding of this STE12 domain in vitro correlates with the ability of the binding sites to function as inducible UAS elements in vivo.
Corresponding author. 5910
VOL . 1 l, 1991
STE12 DNA-BINDING DOMAIN
MFA2 fragments
left-hand right-hand
Wild type
AlTTTrCAG1TFCATCATTACT- - - - - 32bp - - - - - AGCAGCATG 1TrCATGAAACAAATCATA
Mutant 1
A1T1TMCAGTTTCATCATTACT- - - - - 32bp ----- AGCAGCATGTCATTGAACAAATCATA
Mutant 2
ATITTCAG1TFCATCATTACT----- 32bp ----- AGCAGCATG1TTTCATTTGcocCAAATCATA 1
5911
5
10
15
60
55
20
65
70
75
80
Oligonucleotides Single site
GTCGACCA1TTGAAACAAATGTCGAC 1
Tail-to-tall double site
5*
10
15
20
25
GTCGACA1TTG1TTCAAATGGTCGACCATTTGAAACAAATGTCGAC 1
5
10
155
20
2
30
35
40
45
Head-o-tail double site GTCGACCATTGAAACAAATGTCGACCAMGAAACAAATGTCGAC 1
5
10
15
20
25
30
35
40
45
FIG. 1. .DNA fragments containing PREs. The wild-type MFA2 fragment is a 209-bp EcoRI-RsaI fragment from the upstream region of the MFA2 gene, which encodes a-factor. This fragment contains a single PRE (nucleotides 8 to 15) and two adjacent PREs, in which the right-hand site (nucleotides 71 to 78) is a consensus site and the left-hand site (nucleotides 62 to 70) is degenerate. Mutants 1 and 2 are derived from the wild-type MFA2 fragment and contain mutations in either the left-hand PRE (mutant 1) or right-hand PRE (mutant 2). The oligonucleotides represent DNA fragments derived from 14 bp of MFA2 sequence (nucleotides 68 to 81) and contain either a single PRE or two PREs in tail-to-tail or head-to-tail orientation separated by a Sall site.
The N-terminal DNA-binding domain contains certain similarities to the homeodomain, although it is highly diverged from other characterized homeodomains. MATERIALS AND METHODS
Plasnmid constructions. The sequence flanking the ATG codon of the STE12 gene (5) was changed by site-directed mutagenesis (40) to produce an NdeI site, and the NdeI site at codon 195 was removed. Neither change altered the STE12 protein sequence. The resultant complete gene was inserted into the T7 expression vector pET-3c (34) as an NdeI-HindIII fragment to generate plasmid pY6. Deletion of the XbaI-HindIII fragment of the STE12 gene in pY6 yielded pYE1, which encodes amino acids 1 to 215 of STE12 (plus 4 additional amino acids) under the control of the T7 promoter.
N-terminal deletions were generated from pYE1 by the polymerase chain reaction (PCR) (17) with the following oligonucleotides (with BamHI sites at their 5' ends to facilitate cloning): 5' CGGCGGATCCGAAAACGATGAA GTCAG 3', corresponding to amino acids 21 to 26; 5' CG GCGGATCCGGCGATCTAAAATTCTTT 3', corresponding to amino acids 41 to 46; 5' CGGCGGATCCATAAGGC GATACTATCTG 3', corresponding to amino acids 61 to 66; and 5' CGGCGGATCCTACTATATTACAGGTAC 3', corresponding to amino acids 81 to 86. Each reaction used the same 3' oligonucleotide, 5' CTTACCGCTGTTGAG 3', corresponding to a region in the ,B-lactamase gene. The PCR products were ligated as BamHI-EcoRI fragments into pET-3a (34), at a position following amino acid 11 of the T7 gene 10 protein. C-terminal deletions were constructed by Bal 31 exonuclease digestion (25) of pYE1, beginning at a unique EcoRI site 3' to the STE12 sequence. The termination
codon for the C-terminal deletions was provided by the vector backbone, resulting in the following additional vector-encoded amino acids at the C terminus: 2 amino acids for 1 to 210; 3 amino acids for 1 to 204; 25 amino acids for 1 to 200; 6 amino acids for 1 to 189; and 13 amino acids for 1 to 181. The exonuclease reactions were terminated by addition of EDTA to 100 mM and heating at 65°C for 5 min, followed by treatment with the Klenow fragment of DNA polymerase I and four deoxynucleotide triphosphates (25). Deletions were initially sized by restriction fragment analysis and the endpoints determined by DNA sequencing (26). Plasmid pRR6 (5) carried the EcoRI-RsaI fragment from the upstream region of the MFA2 gene. Mutants 1 and 2 were generated by PCR. For mutant 1, the oligonucleotides used were 5' TTCATTT-GAAACAAAT 3', corresponding to the wild type nucleotides 66 to 81 (Fig. 1), and 5' AACATGCT GClTTTAAC 3', corresponding to nucleotides 65 to 50. The PCR product, after blunt end ligation, regenerated the entire plasmid, although there was some variability in the number of T residues at the junction between the two priming sites. While the wild-type sequence contains four T residues, plasmids that contain only 1, 2, or 3 of these residues were identified by DNA sequencing. The plasmid with a single T residue contains the mutant 1 sequence. For mutant 2, the oligonucleotides used were 5' TTCATTTGCCCCAAATA CT 3', corresponding to nucleotides 66 to 84, but with the AAA in the right-hand PRE (Fig. 1) changed to CCC, and 5' AACATGCTGCTTTAAC 3', corresponding to nucleotides 65 to 50. Plasmid pGK40 contains the STE12 gene under the control of the GAL,110 promoter. It was constructed by ligating the SaII-HindIII fragment of pGS3 (3) containing the galactoseinducible STE12 gene into YEp351 (16).
5912
YUAN AND FIELDS
Bacterial expression of the STE12 fragment. Cultures of Escherichia coli BL21 (DE3) (34) carrying pYE1 or its derivatives were grown at 37°C in medium containing 32 g of tryptone and 20 g of yeast extract per liter, 1 x M9 salts, 0.1 mM MgSO4, and 100 ,ug of ampicillin per ml. When the optical density at 600 nm of the culture reached 1.0, isopropyl-p-D-thiogalactopyranoside (IPTG) was added to a concentration of 0.4 mM and incubation was continued for an additional 2 h. Bacteria were harvested by centrifugation and resuspended in lysis buffer (50 mM Tris Cl [pH 8.0], 100 mM NaCl, 10 mM MgCl2, 3.5 mM ,B-mercaptoethanol, 2 mM dithiothreitol, 1 mM EDTA, 10% glycerol, 0.5 mM phenylmethylsulfonyl fluoride). The suspension was lysed in a French press at 12,000 lb/in2. After centrifugation at 27,000 x g for 1 h, the clarified extract was precipitated by 40% (NH4)2SO4 for 90 min followed by centrifugation at 12,000 x g for 1 h. The protein extract was resuspended in a solution containing 20 mM Tris-Cl (pH 8.5), 5 mM EDTA, 7 mM P-mercaptoethanol, 20% glycerol, and 0.5 mM phenylmethylsulfonyl fluoride. Protein concentrations were determined by Bio-Rad Protein Assay by following the directions of the manufacturer, using bovine serum albumin as the protein standard. Footprinting reaction. Fragments used in the footprinting reactions were excised by restriction digestion of pUC18 (39) derivatives and labeled with [a-32P]dATP by DNA polymerase I (Klenow fragment) (25). STE12 was bound to the DNA in a volume of 40 ,ul of a solution containing 8 mM Trisacetate (pH 8.0), 100 mM potassium acetate, 2 mM magnesium acetate, 2 mM dithiothreitol, 0.1% Triton X-100, 2 mM CaCl2, 8% glycerol, and 0.5 ,ug of poly(dI-dC) (Pharmacia) for 15 min at room temperature. The protein-DNA complexes were treated with 8 x 10' U of DNase I (Sigma) for 3 min at room temperature. The reaction was terminated by the addition of 40 [lI of 1 M ammonium acetate-0.2% sodium dodecyl sulfate-0.1 M EDTA, followed by phenol extraction and ethanol precipitation. The DNA was then fractionated on 6 or 12% polyacrylamide gels containing 7 M urea, followed by exposure of the gels to Kodak XRP1 film. Gels were scanned by an AMBIS Radioanalytic Imaging System. ,-Galactosidase assays. Plasmids carrying PREs upstream of the CYCI-lacZ gene were transformed into the yeast strain W303-1A (36) (MATa ade2 trpl leu2 his3 ura3 cani), either alone or with plasmid pGK40, which contains the galactose-inducible STE12 gene. Transformants carrying the lacZ reporter plasmid only were grown in SD-Ura media (31), and those carrying both the reporter plasmid and pGK40 were grown in 2% raffinose-Ura-Leu media (3). Overnight cultures were diluted 10-fold into fresh media and grown for an additional 3 h. Overexpression of STE12 was induced by addition of 2% galactose followed by growth for an additional 2 h. Cultures treated with pheromone were incubated with 1 ,uM a-factor (Sigma) for 2 h. 1-Galactosidase assays were carried out as previously described (3).
RESULTS The N-terminal 215 amino acids of STE12 bind to the PRE. Full-length STE12 from yeast was previously shown to bind specifically to the PRE (5). To obtain sufficient protein for DNA-binding analyses, we overexpressed different regions of STE12 in E. coli under the control of the T7 promoter (34). After induction of T7 polymerase by IPTG, expression was allowed to proceed for 2 h, followed by preparation of a crude protein extract. As probes for DNase I protection studies, we used a fragment from the upstream region of the
MOL. CELL. BIOL.
a-factor gene MFA2 (Fig. 1, wild type), shown previously to bind STE12 (5), as well as three fragments that contain a single PRE or two PREs and that were derived from oligonucleotides (Fig. 1, oligonucleotides). In initial experiments with bacterially made STE12, we found that the full-length protein was made in very small amounts and could not be used for further analysis. However, footprinting studies with STE12 truncated after amino acid 474 (not shown) or 215 indicated that the DNA-binding domain is at the amino terminus. Figure 2 shows the protection for the N-terminal 215 amino acid fragment on four probes. In Fig. 2A, an EcoRIRsaI fragment of MFA2, containing two consensus PREs, shows two areas of protection (lanes 3 to 5). In the upper region, a consensus PRE of ATGAAACA (indicated by arrow), corresponding to nucleotides 8 to 15 of Fig. 1, is protected. On the 5' side of this upper PRE (5' and 3' refer to the orientation in Fig. 1) is a T-rich stretch not cleaved by DNase I, such that the border of protection on this side is not well defined. Three additional bases 3' of the PRE are protected, and immediately adjacent to the protected region are two hypersensitive sites (nucleotides 19 and 20). In the lower region, 22 bases are protected, which include a consensus PRE (downward arrow) at nucleotides 71 to 78 and a directly adjacent degenerate PRE (upward arrow) at nucleotides 62 to 70. The consensus site (the right-hand site of Fig. 1) is TTGAAACA and the degenerate site (the left-hand site in Fig. 1) is ATGAAAACA, which contains an additional central A residue. The two sites are in a tail-to-tail orientation with no nucleotides separating them. The two PREs in the double site show similar binding affinity: full protection with 1.0 and 0.1 ,ug of protein extract and loss of protection at 0.01 ,ug. Binding at the double site can occur at 5- to 10-fold-lower protein concentrations than can binding at the single site (Fig. 2A, compare protection corresponding to the upper arrow and lower two arrows in lane 4). Complementary oligonucleotides were synthesized corresponding to the wild-type right-hand site of the MFA2 fragment and three flanking bases on each side (nucleotides 68 to 81), along with SalI restriction sites at each end. These oligonucleotides were cloned into pUC18, generating plasmids containing either a single PRE or two PREs in tail-totail or head-to-tail orientation (Fig. 1). DNase I footprinting analysis using restriction fragments carrying these sequences indicated that either one PRE (Fig. 2B, lane 9) or two PREs (Fig. 2C, lanes 15 and 16 and D, lanes 21 and 22) showed protection by the STE12 fragment over the sequences containing the PREs. In all cases, the protected region extended to the 3' side of the 'TGAAACA by approximately five bases and to the 5' side by only one base. The single site showed less affinity than either orientation of the two sites; approximately 5- to 10-fold-more STE12 fragment was required for equivalent binding to the single site. Strong DNase I hypersensitive sites are apparent between the two PREs, particularly in the tail-to-tail arrangement (Fig. 2C, lanes 15 and 16), which binds slightly better than the head-to-tail arrangement. These hypersensitive sites suggest that the protein-protein interactions between the STE12 fragments might alter the conformation of the DNA. These results indicate that the N-terminal 215 amino acid fragment of STE12 is capable of site-specific binding to the PRE. In addition, they provide evidence that a nonconsensus PRE can be bound when it is adjacent to a consensus one and that binding to two PREs may occur cooperatively. The minimal binding domain is located between amino acids
STE12 DNA-BINDING DOMAIN
VOL. 11, 1991
A
C
B
5913
D
'G
Extract (ug)
G 0 1 .1 .01 1
G 0 1 .1 .01 1
G
0
1 .1 .01 1
G 0 1 .1 .01 1
4-
4 dp--
.
w SW
_
_
9o VV
*~~~.*
*
4_
z
_
44-
^~~~~4
7 8 9 10 1112
131 14 15 16 17 18
19 20 21 22 23 24
1 2 3 4 5 6 FIG. 2. DNase I footprinting of the STE12 N-terminal 215-amino-acid domain on PRE-containing DNA fragments. The relevant sequences of the four fragments are indicated in Fig. 1. The amount of protein extract used is indicated on top. (A) Protection pattern for the MFA2 fragment. The upper arrow represents a single consensus PRE. The lower two arrows represent two PREs, the downward arrow represents a consensus PRE, and the upward arrow represents a degenerate PRE containing an additional nucleotide. (B to D) Protection patterns for a fragment containing a single PRE (B), two PREs in tail-to-tail orientation (C), and two PREs in head-to-tail orientation (D). Arrows indicate the PREs. Lanes 1, 7, 13, and 19, G ladders; lanes 6, 12, 18, and 24, induced extracts from bacteria containing the vector only.
41 and 204. To define the minimal STE12 domain sufficient for site-specific DNA binding, we made both C-terminal and N-terminal deletions of the 215-amino-acid fragment. Plasmids encoding these deletions were used for E. coli expression as described above, and protein extracts were prepared and analyzed by SDS-polyacrylamide gel electrophoresis to ensure that comparable amounts of the STE12 fragments were made (data not shown). The extracts were tested for
DNase I protection on the oligonucleotide-derived fragment containing two PREs in tail-to-tail orientation. Protection by the N-terminal deletions is shown in Fig. 3A. Deletion of the N-terminal 20 amino acids does not have a noticeable effect on binding affinity (lanes 4 and 5), but deletion of 40 amino acids results in some loss of binding affinity (lanes 6 and 7). Deletion of the N-terminal 60 amino acids (lanes 8 and 9) causes an approximate 10-fold decrease in binding affinity.
5914
MOL. CELL. BIOL.
YUAN AND FIELDS
B
A N-tenninal
residue
- 1
21
41
61
81
r-i r1 ri ri r I
C-terminal
-
215 210
residue
204
200
ri r1 ri
189 181 -r i X
.*.
no. . . 8
417 Aw.fttf__ .,
4wdo
-
~
~
-
F-
_
j--:
-w~~~~._ .;..
..
......-.
-
-e
*'-
._
.,.
.s*X v.
1 2 3 4 5 6 7 8 9 10 11 ..
s,,* . ..I4
1 2 3 4 5 6 7 8 9 10 11 12 FIG. 3. The boundaries for the STE12 DNA-binding domain are localized to amino acid 41 and amino acid 204. The probe is the oligonucleotide-derived fragment containing two PREs in tail-to-tail orientation, indicated by arrows. Truncated STE12 derivatives of the N-terminal 215-amino-acid domain (indicated on top) were synthesized in E. coli and assayed for DNA binding by DNase I footprinting. (A) N-terminal deletion series. (B) C-terminal deletion series. For both panels, lane 1 contained no protein extract; each succeeding two lanes contained 1 and 0.1 ,ug of protein extract, except for the 1 to 215 fragment (panel B), which was assayed only at 1 ,ug.
Deletion of the N-terminal 80 amino acids (lanes 10 and 11) abolishes the binding of the STE12 fragment to this probe. The C-terminal boundary (Fig. 3B) is located between amino acids 204 and 200 (compare lanes 5 and 6 with lanes 7 and 8). A fragment containing only amino acids 41 to 204 is capable of site-specific DNA-binding (data not shown), but with approximately two- to fivefold reduced affinity relative to the 1 to 215 fragment. The STE12 DNA-binding domain can bind cooperatively to two copies of the PRE. Comparison of the binding affinity of the 215-amino-acid STE12 fragment to DNA containing one versus two PREs, present on either the MFA2 fragment or
on fragments derived from oligonucleotides, suggests cooperative binding to two PREs. We tested this cooperativity directly by mutating either copy of the two adjacent PREs (the left-hand and right-hand sites) present in the MFA2 fragmnent (Fig. 1, mutants 1 and 2). Equivalent amounts of the STE12 fragment were used in DNase I protection experiments with the wild-type probe and the two mutants (Fig. 4). In mutant 1, the left-hand site has been changed to delete three T residues, and this change eliminated binding over this site (Fig. 4B, dashed arrow, lanes 8 to 11). Binding to the consensus right-hand site decreased approximately 5- to
VOL . 1 l, 1991
STE12 DNA-BINDING DOMAIN
A
B
C l'~
N
.E;4 Extract (utg)
5915
0 1 .1.04.01 1
egOl
4
0 1 .1.04.01 1 -w r
as.
0 1 .1.04.01 1
Mr
+
+
"a
*w
-_
4
-
4
4
.w
Ay-
dip-
41MIP
m
U U
1 2 3 4 5 6 7 8 9 10 11 12 131415161718 FIG. 4. The STE12 DNA-binding domain can bind cooperatively to two copies of the PRE. Footprinting assays were carried out with the N-terminal 215-amino-acid domain of STE12 with the amounts of protein indicated on top. Probes were the wild-type MFA2 fragment (A), mutant 1 (B), and mutant 2 (C). The DNA sequences are indicated in Fig. 1. Solid arrows indicate PREs present in the wild-type sequence; dashed arrows indicate the mutated nucleotides.
10-fold (compare wild type sites in lanes 2 to 4 with mutant 1 sites in lanes 8 to 10). In mutant 2, the right-hand site is changed by the replacement of the three A residues with C residues. This change nearly abolished binding to the mutant site (Fig. 4C, dashed arrow), and reduced binding to the left-hand nonconsensus site approximately 25-fold (lanes 14 to 17). Thus, binding to the nonconsensus PRE is highly
dependent on the presence of the adjacent consensus site. We also changed the left-hand site to a consensus site, and found that binding to two adjacent consensus PREs is similar to that of the consensus and nonconsensus sites found in the wild-type MFA2 sequence (data not shown). These wildtype sites may therefore allow the maximum amount of
cooperative binding.
5916
YUAN AND FIELDS
MOL. CELL. BIOL.
TABLE 1. UAS activities of PREs in CYCI-lacZ plasmida P-Galactosidase activity' Insert
None Single-site oligonucleotide Tail-to-tail double-site
oligonucleotide Head-to-tail double-site oligonucleotide Wild-type MFA2 fragment Mutant 1 of MFA2 fragment Mutant 2 of MFA2 fragment
DISCUSSION
b
No treatment
a-Factor induction
pGAL-STE12
MOLECULAR AND CELLULAR BIOLOGY, Dec. 1991, p. 5910-5918
0270-7306/91/125910-09$02.00/0 Copyright C 1991, American Society for Microbiology
Properties of the DNA-Binding Domain of the Saccharomyces cerevisiae STE12 Protein YI-LU
0.
YUAN1 AND STANLEY FIELDS2*
Program in Genetics' and Department of Microbiology,2 State University of New York at Stony Brook, Stony Brook, New York 11794 Received 22 July 1991/Accepted 4 September 1991
The STE12 protein of the yeast Saccharomyces cerevisiae binds to the pheromone response element (PRE) present in the upstream region of genes whose transcription is induced by pheromone. Using DNase I footprinting assays with bacterially made STE12 fragments, we localized the DNA-binding domain to 164 amino acids near the amino terminus. Footprinting of oligonucleotide-derived sequences containing one PRE, PREs in head-to-tail or tail-to-tail orientation, showed that the N-terminal 215 amino acids of STE12 has similar binding affinity to either of the dimer sites and a binding affinity 5- to 10-fold lower for the monomer site. This binding cooperativity was also evident on a fragment from the MFA2 gene, which encodes the a-factor pheromone. On this fragment, the 215-amino-acid STE12 fragment protected both a consensus PRE as well as a degenerate PRE containing an additional residue. Mutation of the degenerate site led to a 5- to 10-fold decrease in binding; mutation of the consensus site led to a 25-fold decrease in binding. The ability of PREs to function as pheromone-inducible upstream activation sequences in yeast correlated with their ability to bind the STE12 domain in vitro. The sequence of the STE12 DNA-binding domain contains similarities to the homeodomain, although it is highly diverged from other known examples of this motif. Moreover, the alignment between STE12 and the homeodomain postulates loops after both the putative helix 1 and helix 2 of the STE12 sequence. or two
The yeast Saccharomyces cerevisiae exists as two different haploid cell types, a and at. Mating between these two cell types to form the a/a diploid cell type is facilitated by the exchange of the peptide pheromones a-factor and a-factor (for a review, see references 4, 15, and 33). Cells respond to the appropriate pheromone with a variety of intracellular and cell surface changes, including the increased transcription of inducible genes encoding products involved in the mating process. Transduction of the pheromone signal involves a pathway including the pheromone receptor (STE2 or STE3), a trimeric G protein (composed of GPA1, STE4, and STE18), four putative protein kinases (STE7, STE11, FUS3, and KSS1), the STE5 protein, and the STE12 protein. STE12 is the transcriptional activator that binds to the pheromone response element (PRE), the DNA sequence conferring induction by pheromone (5, 6). STE12 appears to be the ultimate target of the pheromone response pathway for changes in gene expression; it is rapidly phosphorylated in cells treated with pheromone, and this modification correlates with its ability to mediate increased transcription (32). Pheromone-responsive transcription has been demonstrated for genes expressed only in a cells (a-specific genes), genes expressed only in a cells (a-specific genes), and certain genes expressed only in a and a, but not in diploid a/a cells (haploid-specific genes) (2, 12, 13, 20, 22, 37, 38). The PRE (defined here as the sequence ATGAAACA) is required for a-factor induction of a-specific genes (20, 38) and a-factor or a-factor induction of haploid-specific genes (11). The PRE alone can function as an inducible upstream activation sequence (UAS); although one report indicated that the PRE is preferentially responsive to a-factor in a cells (29), an analysis of sequences regulating the expression of the hap*
loid-specific gene FUSJ indicated that PREs can mediate induction by either pheromone (11). The sequence required for a-factor induction of a-specific genes corresponds to the same sequence responsible for a-specific expression (18) and does not closely resemble the PRE. STE12, like other members of the signal pathway except the receptor, plays a role in both the basal (uninduced) as well as the induced level of pheromone-responsive genes (7, 8, 13, 22). Its binding to the PRE was demonstrated by gel mobility shift assays with probes containing two copies of the PRE (5) or a single copy adjacent to a binding site for the transcriptional activator MCM1 (6). A direct role for STE12 in gene induction was shown by fusion of this protein to the GAL4 DNA-binding domain, which resulted in a hybrid protein that converts the GAL4 binding site into a pheromone-responsive sequence (32). Analysis of other eukaryotic transcriptional activators indicates they are often composed of separable domains for site-specific DNA binding and transcriptional activation (for a review, see reference 14). The DNA-binding function can be carried out by protein sequences forming at least four distinct motifs: helix-turn-helix, zinc finger, leucine zipper, and helix-loop-helix. The homeodomain, containing a helixturn-helix motif similar to that found in various prokaryotic repressors (24), was originally defined as a highly conserved 60-amino-acid sequence shared by several Drosophila homeotic proteins (28). This domain was then identified in proteins from many other eukaryotes, including yeasts (30). We characterize here the DNA-binding domain of STE12, localizing the minimal region for this function to 164 amino acids near the amino terminus. Additionally, we find that an N-terminal domain of STE12 can bind cooperatively to two copies of the PRE in a manner largely independent of the orientation or spacing of these elements. Binding of this STE12 domain in vitro correlates with the ability of the binding sites to function as inducible UAS elements in vivo.
Corresponding author. 5910
VOL . 1 l, 1991
STE12 DNA-BINDING DOMAIN
MFA2 fragments
left-hand right-hand
Wild type
AlTTTrCAG1TFCATCATTACT- - - - - 32bp - - - - - AGCAGCATG 1TrCATGAAACAAATCATA
Mutant 1
A1T1TMCAGTTTCATCATTACT- - - - - 32bp ----- AGCAGCATGTCATTGAACAAATCATA
Mutant 2
ATITTCAG1TFCATCATTACT----- 32bp ----- AGCAGCATG1TTTCATTTGcocCAAATCATA 1
5911
5
10
15
60
55
20
65
70
75
80
Oligonucleotides Single site
GTCGACCA1TTGAAACAAATGTCGAC 1
Tail-to-tall double site
5*
10
15
20
25
GTCGACA1TTG1TTCAAATGGTCGACCATTTGAAACAAATGTCGAC 1
5
10
155
20
2
30
35
40
45
Head-o-tail double site GTCGACCATTGAAACAAATGTCGACCAMGAAACAAATGTCGAC 1
5
10
15
20
25
30
35
40
45
FIG. 1. .DNA fragments containing PREs. The wild-type MFA2 fragment is a 209-bp EcoRI-RsaI fragment from the upstream region of the MFA2 gene, which encodes a-factor. This fragment contains a single PRE (nucleotides 8 to 15) and two adjacent PREs, in which the right-hand site (nucleotides 71 to 78) is a consensus site and the left-hand site (nucleotides 62 to 70) is degenerate. Mutants 1 and 2 are derived from the wild-type MFA2 fragment and contain mutations in either the left-hand PRE (mutant 1) or right-hand PRE (mutant 2). The oligonucleotides represent DNA fragments derived from 14 bp of MFA2 sequence (nucleotides 68 to 81) and contain either a single PRE or two PREs in tail-to-tail or head-to-tail orientation separated by a Sall site.
The N-terminal DNA-binding domain contains certain similarities to the homeodomain, although it is highly diverged from other characterized homeodomains. MATERIALS AND METHODS
Plasnmid constructions. The sequence flanking the ATG codon of the STE12 gene (5) was changed by site-directed mutagenesis (40) to produce an NdeI site, and the NdeI site at codon 195 was removed. Neither change altered the STE12 protein sequence. The resultant complete gene was inserted into the T7 expression vector pET-3c (34) as an NdeI-HindIII fragment to generate plasmid pY6. Deletion of the XbaI-HindIII fragment of the STE12 gene in pY6 yielded pYE1, which encodes amino acids 1 to 215 of STE12 (plus 4 additional amino acids) under the control of the T7 promoter.
N-terminal deletions were generated from pYE1 by the polymerase chain reaction (PCR) (17) with the following oligonucleotides (with BamHI sites at their 5' ends to facilitate cloning): 5' CGGCGGATCCGAAAACGATGAA GTCAG 3', corresponding to amino acids 21 to 26; 5' CG GCGGATCCGGCGATCTAAAATTCTTT 3', corresponding to amino acids 41 to 46; 5' CGGCGGATCCATAAGGC GATACTATCTG 3', corresponding to amino acids 61 to 66; and 5' CGGCGGATCCTACTATATTACAGGTAC 3', corresponding to amino acids 81 to 86. Each reaction used the same 3' oligonucleotide, 5' CTTACCGCTGTTGAG 3', corresponding to a region in the ,B-lactamase gene. The PCR products were ligated as BamHI-EcoRI fragments into pET-3a (34), at a position following amino acid 11 of the T7 gene 10 protein. C-terminal deletions were constructed by Bal 31 exonuclease digestion (25) of pYE1, beginning at a unique EcoRI site 3' to the STE12 sequence. The termination
codon for the C-terminal deletions was provided by the vector backbone, resulting in the following additional vector-encoded amino acids at the C terminus: 2 amino acids for 1 to 210; 3 amino acids for 1 to 204; 25 amino acids for 1 to 200; 6 amino acids for 1 to 189; and 13 amino acids for 1 to 181. The exonuclease reactions were terminated by addition of EDTA to 100 mM and heating at 65°C for 5 min, followed by treatment with the Klenow fragment of DNA polymerase I and four deoxynucleotide triphosphates (25). Deletions were initially sized by restriction fragment analysis and the endpoints determined by DNA sequencing (26). Plasmid pRR6 (5) carried the EcoRI-RsaI fragment from the upstream region of the MFA2 gene. Mutants 1 and 2 were generated by PCR. For mutant 1, the oligonucleotides used were 5' TTCATTT-GAAACAAAT 3', corresponding to the wild type nucleotides 66 to 81 (Fig. 1), and 5' AACATGCT GClTTTAAC 3', corresponding to nucleotides 65 to 50. The PCR product, after blunt end ligation, regenerated the entire plasmid, although there was some variability in the number of T residues at the junction between the two priming sites. While the wild-type sequence contains four T residues, plasmids that contain only 1, 2, or 3 of these residues were identified by DNA sequencing. The plasmid with a single T residue contains the mutant 1 sequence. For mutant 2, the oligonucleotides used were 5' TTCATTTGCCCCAAATA CT 3', corresponding to nucleotides 66 to 84, but with the AAA in the right-hand PRE (Fig. 1) changed to CCC, and 5' AACATGCTGCTTTAAC 3', corresponding to nucleotides 65 to 50. Plasmid pGK40 contains the STE12 gene under the control of the GAL,110 promoter. It was constructed by ligating the SaII-HindIII fragment of pGS3 (3) containing the galactoseinducible STE12 gene into YEp351 (16).
5912
YUAN AND FIELDS
Bacterial expression of the STE12 fragment. Cultures of Escherichia coli BL21 (DE3) (34) carrying pYE1 or its derivatives were grown at 37°C in medium containing 32 g of tryptone and 20 g of yeast extract per liter, 1 x M9 salts, 0.1 mM MgSO4, and 100 ,ug of ampicillin per ml. When the optical density at 600 nm of the culture reached 1.0, isopropyl-p-D-thiogalactopyranoside (IPTG) was added to a concentration of 0.4 mM and incubation was continued for an additional 2 h. Bacteria were harvested by centrifugation and resuspended in lysis buffer (50 mM Tris Cl [pH 8.0], 100 mM NaCl, 10 mM MgCl2, 3.5 mM ,B-mercaptoethanol, 2 mM dithiothreitol, 1 mM EDTA, 10% glycerol, 0.5 mM phenylmethylsulfonyl fluoride). The suspension was lysed in a French press at 12,000 lb/in2. After centrifugation at 27,000 x g for 1 h, the clarified extract was precipitated by 40% (NH4)2SO4 for 90 min followed by centrifugation at 12,000 x g for 1 h. The protein extract was resuspended in a solution containing 20 mM Tris-Cl (pH 8.5), 5 mM EDTA, 7 mM P-mercaptoethanol, 20% glycerol, and 0.5 mM phenylmethylsulfonyl fluoride. Protein concentrations were determined by Bio-Rad Protein Assay by following the directions of the manufacturer, using bovine serum albumin as the protein standard. Footprinting reaction. Fragments used in the footprinting reactions were excised by restriction digestion of pUC18 (39) derivatives and labeled with [a-32P]dATP by DNA polymerase I (Klenow fragment) (25). STE12 was bound to the DNA in a volume of 40 ,ul of a solution containing 8 mM Trisacetate (pH 8.0), 100 mM potassium acetate, 2 mM magnesium acetate, 2 mM dithiothreitol, 0.1% Triton X-100, 2 mM CaCl2, 8% glycerol, and 0.5 ,ug of poly(dI-dC) (Pharmacia) for 15 min at room temperature. The protein-DNA complexes were treated with 8 x 10' U of DNase I (Sigma) for 3 min at room temperature. The reaction was terminated by the addition of 40 [lI of 1 M ammonium acetate-0.2% sodium dodecyl sulfate-0.1 M EDTA, followed by phenol extraction and ethanol precipitation. The DNA was then fractionated on 6 or 12% polyacrylamide gels containing 7 M urea, followed by exposure of the gels to Kodak XRP1 film. Gels were scanned by an AMBIS Radioanalytic Imaging System. ,-Galactosidase assays. Plasmids carrying PREs upstream of the CYCI-lacZ gene were transformed into the yeast strain W303-1A (36) (MATa ade2 trpl leu2 his3 ura3 cani), either alone or with plasmid pGK40, which contains the galactose-inducible STE12 gene. Transformants carrying the lacZ reporter plasmid only were grown in SD-Ura media (31), and those carrying both the reporter plasmid and pGK40 were grown in 2% raffinose-Ura-Leu media (3). Overnight cultures were diluted 10-fold into fresh media and grown for an additional 3 h. Overexpression of STE12 was induced by addition of 2% galactose followed by growth for an additional 2 h. Cultures treated with pheromone were incubated with 1 ,uM a-factor (Sigma) for 2 h. 1-Galactosidase assays were carried out as previously described (3).
RESULTS The N-terminal 215 amino acids of STE12 bind to the PRE. Full-length STE12 from yeast was previously shown to bind specifically to the PRE (5). To obtain sufficient protein for DNA-binding analyses, we overexpressed different regions of STE12 in E. coli under the control of the T7 promoter (34). After induction of T7 polymerase by IPTG, expression was allowed to proceed for 2 h, followed by preparation of a crude protein extract. As probes for DNase I protection studies, we used a fragment from the upstream region of the
MOL. CELL. BIOL.
a-factor gene MFA2 (Fig. 1, wild type), shown previously to bind STE12 (5), as well as three fragments that contain a single PRE or two PREs and that were derived from oligonucleotides (Fig. 1, oligonucleotides). In initial experiments with bacterially made STE12, we found that the full-length protein was made in very small amounts and could not be used for further analysis. However, footprinting studies with STE12 truncated after amino acid 474 (not shown) or 215 indicated that the DNA-binding domain is at the amino terminus. Figure 2 shows the protection for the N-terminal 215 amino acid fragment on four probes. In Fig. 2A, an EcoRIRsaI fragment of MFA2, containing two consensus PREs, shows two areas of protection (lanes 3 to 5). In the upper region, a consensus PRE of ATGAAACA (indicated by arrow), corresponding to nucleotides 8 to 15 of Fig. 1, is protected. On the 5' side of this upper PRE (5' and 3' refer to the orientation in Fig. 1) is a T-rich stretch not cleaved by DNase I, such that the border of protection on this side is not well defined. Three additional bases 3' of the PRE are protected, and immediately adjacent to the protected region are two hypersensitive sites (nucleotides 19 and 20). In the lower region, 22 bases are protected, which include a consensus PRE (downward arrow) at nucleotides 71 to 78 and a directly adjacent degenerate PRE (upward arrow) at nucleotides 62 to 70. The consensus site (the right-hand site of Fig. 1) is TTGAAACA and the degenerate site (the left-hand site in Fig. 1) is ATGAAAACA, which contains an additional central A residue. The two sites are in a tail-to-tail orientation with no nucleotides separating them. The two PREs in the double site show similar binding affinity: full protection with 1.0 and 0.1 ,ug of protein extract and loss of protection at 0.01 ,ug. Binding at the double site can occur at 5- to 10-fold-lower protein concentrations than can binding at the single site (Fig. 2A, compare protection corresponding to the upper arrow and lower two arrows in lane 4). Complementary oligonucleotides were synthesized corresponding to the wild-type right-hand site of the MFA2 fragment and three flanking bases on each side (nucleotides 68 to 81), along with SalI restriction sites at each end. These oligonucleotides were cloned into pUC18, generating plasmids containing either a single PRE or two PREs in tail-totail or head-to-tail orientation (Fig. 1). DNase I footprinting analysis using restriction fragments carrying these sequences indicated that either one PRE (Fig. 2B, lane 9) or two PREs (Fig. 2C, lanes 15 and 16 and D, lanes 21 and 22) showed protection by the STE12 fragment over the sequences containing the PREs. In all cases, the protected region extended to the 3' side of the 'TGAAACA by approximately five bases and to the 5' side by only one base. The single site showed less affinity than either orientation of the two sites; approximately 5- to 10-fold-more STE12 fragment was required for equivalent binding to the single site. Strong DNase I hypersensitive sites are apparent between the two PREs, particularly in the tail-to-tail arrangement (Fig. 2C, lanes 15 and 16), which binds slightly better than the head-to-tail arrangement. These hypersensitive sites suggest that the protein-protein interactions between the STE12 fragments might alter the conformation of the DNA. These results indicate that the N-terminal 215 amino acid fragment of STE12 is capable of site-specific binding to the PRE. In addition, they provide evidence that a nonconsensus PRE can be bound when it is adjacent to a consensus one and that binding to two PREs may occur cooperatively. The minimal binding domain is located between amino acids
STE12 DNA-BINDING DOMAIN
VOL. 11, 1991
A
C
B
5913
D
'G
Extract (ug)
G 0 1 .1 .01 1
G 0 1 .1 .01 1
G
0
1 .1 .01 1
G 0 1 .1 .01 1
4-
4 dp--
.
w SW
_
_
9o VV
*~~~.*
*
4_
z
_
44-
^~~~~4
7 8 9 10 1112
131 14 15 16 17 18
19 20 21 22 23 24
1 2 3 4 5 6 FIG. 2. DNase I footprinting of the STE12 N-terminal 215-amino-acid domain on PRE-containing DNA fragments. The relevant sequences of the four fragments are indicated in Fig. 1. The amount of protein extract used is indicated on top. (A) Protection pattern for the MFA2 fragment. The upper arrow represents a single consensus PRE. The lower two arrows represent two PREs, the downward arrow represents a consensus PRE, and the upward arrow represents a degenerate PRE containing an additional nucleotide. (B to D) Protection patterns for a fragment containing a single PRE (B), two PREs in tail-to-tail orientation (C), and two PREs in head-to-tail orientation (D). Arrows indicate the PREs. Lanes 1, 7, 13, and 19, G ladders; lanes 6, 12, 18, and 24, induced extracts from bacteria containing the vector only.
41 and 204. To define the minimal STE12 domain sufficient for site-specific DNA binding, we made both C-terminal and N-terminal deletions of the 215-amino-acid fragment. Plasmids encoding these deletions were used for E. coli expression as described above, and protein extracts were prepared and analyzed by SDS-polyacrylamide gel electrophoresis to ensure that comparable amounts of the STE12 fragments were made (data not shown). The extracts were tested for
DNase I protection on the oligonucleotide-derived fragment containing two PREs in tail-to-tail orientation. Protection by the N-terminal deletions is shown in Fig. 3A. Deletion of the N-terminal 20 amino acids does not have a noticeable effect on binding affinity (lanes 4 and 5), but deletion of 40 amino acids results in some loss of binding affinity (lanes 6 and 7). Deletion of the N-terminal 60 amino acids (lanes 8 and 9) causes an approximate 10-fold decrease in binding affinity.
5914
MOL. CELL. BIOL.
YUAN AND FIELDS
B
A N-tenninal
residue
- 1
21
41
61
81
r-i r1 ri ri r I
C-terminal
-
215 210
residue
204
200
ri r1 ri
189 181 -r i X
.*.
no. . . 8
417 Aw.fttf__ .,
4wdo
-
~
~
-
F-
_
j--:
-w~~~~._ .;..
..
......-.
-
-e
*'-
._
.,.
.s*X v.
1 2 3 4 5 6 7 8 9 10 11 ..
s,,* . ..I4
1 2 3 4 5 6 7 8 9 10 11 12 FIG. 3. The boundaries for the STE12 DNA-binding domain are localized to amino acid 41 and amino acid 204. The probe is the oligonucleotide-derived fragment containing two PREs in tail-to-tail orientation, indicated by arrows. Truncated STE12 derivatives of the N-terminal 215-amino-acid domain (indicated on top) were synthesized in E. coli and assayed for DNA binding by DNase I footprinting. (A) N-terminal deletion series. (B) C-terminal deletion series. For both panels, lane 1 contained no protein extract; each succeeding two lanes contained 1 and 0.1 ,ug of protein extract, except for the 1 to 215 fragment (panel B), which was assayed only at 1 ,ug.
Deletion of the N-terminal 80 amino acids (lanes 10 and 11) abolishes the binding of the STE12 fragment to this probe. The C-terminal boundary (Fig. 3B) is located between amino acids 204 and 200 (compare lanes 5 and 6 with lanes 7 and 8). A fragment containing only amino acids 41 to 204 is capable of site-specific DNA-binding (data not shown), but with approximately two- to fivefold reduced affinity relative to the 1 to 215 fragment. The STE12 DNA-binding domain can bind cooperatively to two copies of the PRE. Comparison of the binding affinity of the 215-amino-acid STE12 fragment to DNA containing one versus two PREs, present on either the MFA2 fragment or
on fragments derived from oligonucleotides, suggests cooperative binding to two PREs. We tested this cooperativity directly by mutating either copy of the two adjacent PREs (the left-hand and right-hand sites) present in the MFA2 fragmnent (Fig. 1, mutants 1 and 2). Equivalent amounts of the STE12 fragment were used in DNase I protection experiments with the wild-type probe and the two mutants (Fig. 4). In mutant 1, the left-hand site has been changed to delete three T residues, and this change eliminated binding over this site (Fig. 4B, dashed arrow, lanes 8 to 11). Binding to the consensus right-hand site decreased approximately 5- to
VOL . 1 l, 1991
STE12 DNA-BINDING DOMAIN
A
B
C l'~
N
.E;4 Extract (utg)
5915
0 1 .1.04.01 1
egOl
4
0 1 .1.04.01 1 -w r
as.
0 1 .1.04.01 1
Mr
+
+
"a
*w
-_
4
-
4
4
.w
Ay-
dip-
41MIP
m
U U
1 2 3 4 5 6 7 8 9 10 11 12 131415161718 FIG. 4. The STE12 DNA-binding domain can bind cooperatively to two copies of the PRE. Footprinting assays were carried out with the N-terminal 215-amino-acid domain of STE12 with the amounts of protein indicated on top. Probes were the wild-type MFA2 fragment (A), mutant 1 (B), and mutant 2 (C). The DNA sequences are indicated in Fig. 1. Solid arrows indicate PREs present in the wild-type sequence; dashed arrows indicate the mutated nucleotides.
10-fold (compare wild type sites in lanes 2 to 4 with mutant 1 sites in lanes 8 to 10). In mutant 2, the right-hand site is changed by the replacement of the three A residues with C residues. This change nearly abolished binding to the mutant site (Fig. 4C, dashed arrow), and reduced binding to the left-hand nonconsensus site approximately 25-fold (lanes 14 to 17). Thus, binding to the nonconsensus PRE is highly
dependent on the presence of the adjacent consensus site. We also changed the left-hand site to a consensus site, and found that binding to two adjacent consensus PREs is similar to that of the consensus and nonconsensus sites found in the wild-type MFA2 sequence (data not shown). These wildtype sites may therefore allow the maximum amount of
cooperative binding.
5916
YUAN AND FIELDS
MOL. CELL. BIOL.
TABLE 1. UAS activities of PREs in CYCI-lacZ plasmida P-Galactosidase activity' Insert
None Single-site oligonucleotide Tail-to-tail double-site
oligonucleotide Head-to-tail double-site oligonucleotide Wild-type MFA2 fragment Mutant 1 of MFA2 fragment Mutant 2 of MFA2 fragment
DISCUSSION
b
No treatment
a-Factor induction
pGAL-STE12
