Fish & Shellfish Immunology 42 (2015) 316e324

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Prostaglandin E receptor 4 (PTGER4) involved in host protection against immune challenge in oyster, Crassostrea hongkongensis Fufa Qu a, b, 1, Zhiming Xiang a, 1, Fuxuan Wang a, b, Lin Qi c, Fengjiao Xu a, b, Shu Xiao a, Ziniu Yu a, * a

Key Laboratory of Marine Bio-resource Sustainable Utilization, Laboratory of Applied Marine Biology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, 164 West Xingang Road, Guangzhou 510301, China University of Chinese Academy of Sciences, 19A Yuquan Road, Beijing 100049, China c School of Life Sciences, Sun Yat-Sen University, Guangzhou 510275, China b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 21 September 2014 Received in revised form 16 November 2014 Accepted 17 November 2014 Available online 25 November 2014

Prostaglandin E receptor 4 (PTGER4) is an essential receptor that can detect various physiological and pathological stimuli and has been implicated in a wide variety of biological processes, including the regulation of immune responses, cytokine production, and apoptosis. In this report, the first mollusk PTGER4, referred to as ChPTGER4, was cloned and characterized from the Hong Kong oyster Crassostrea hongkongensis. Its full-length cDNA is 1734 bp in length, including 50 - and 30 -untranslated region (UTRs) of 354 bp and 306 bp, respectively, and an open reading frame (ORF) of 1074 bp. ChPTGER4 comprises 357 amino acids and shares significant homology with its vertebrate homologs. The results of phylogenetic analysis revealed that ChPTGER4 clusters with PTGER4 from the Pacific oyster. In addition, quantitative real-time PCR analysis revealed that ChPTGER4 was constitutively expressed in all tissues examined and that its expression was significantly up-regulated in hemocytes and gills following challenge by pathogens (Vibrio alginolyticus, Staphylococcus haemolyticus and Saccharomyces cerevisiae) and pathogen-associated molecular patterns (PAMPs: lipopolysaccharide (LPS) and peptidoglycan (PGN). Moreover, fluorescence microscopy analysis revealed that ChPTGER4 localized to the membrane, and its overexpression significantly enhanced NF-kB reporter gene activation in the HEK293T cell line. In summary, this study provides the first experimental evidence of a functional PTGER4 in mollusks, which suggests its involvement in the innate immune response in oyster. © 2014 Elsevier Ltd. All rights reserved.

Keywords: Crassostrea hongkongensis Prostaglandin E receptor 4 (PTGER4) NF-kB pathway Innate immunity

1. Introduction Prostanoids are a group of lipid mediators that include prostaglandins (PGs) and thromboxanes (TXs). These mediators are synthesized from arachidonic acid via the cyclooxygenase (COX) pathway in a variety of tissues and cells after various physiological and pathological stimuli [1,2]. Upon production, prostanoids are rapidly released from cells and act as local hormones in the vicinity of their production site to maintain whole-body homeostasis [2,3]. Prostaglandin E2 (PGE2), one of the best known and most wellstudied prostanoids, is a proinflammatory mediator that is ubiquitously expressed [4,5] and plays important roles in mediating many inflammatory responses in mammals [6]. The biological

* Corresponding author. Tel./fax: þ86 20 8910 2507. E-mail address: [email protected] (Z. Yu). 1 These authors contributed equally to the work. http://dx.doi.org/10.1016/j.fsi.2014.11.023 1050-4648/© 2014 Elsevier Ltd. All rights reserved.

actions of PGE2 are mediated by four distinct prostanoid E receptors (EP), termed PTGER1-4 (also known as EP1-4), all of which have seven transmembrane-spanning domains [7,8] and are coupled to a variety of intracellular signal transduction pathways including those that induce increases in cAMP (PTGER2 and PTGER4), decreases in cAMP (PTGER3) and of Ca2þ mobilization (PTGER1) [8,9]. Among the PTGERs, PTGER4 is the most abundantly expressed EP subtype in a variety of immune cell types, and its functional responses have been reported in B- and T-lymphocytes, eosinophils, monocytes and macrophages [10,11]. It was reported that the PTGER4 has several sites, including S103, T168, Y186, F191, L195, S285, and D311, which were identified as being essential of the interaction of PGE2 [12]. Activation of PTGER4 by PGE2 has been implicated in a wide variety of biological processes, including the regulation of immune responses and cytokine production [13,14]. PGE2 has been shown to exert anti-inflammatory effects via interactions with different receptor subtypes in mammals, and

F. Qu et al. / Fish & Shellfish Immunology 42 (2015) 316e324

PTGER4 has been demonstrated to be the key mediator of the antiinflammatory effects of PGE2 [15,16]. It was shown that PGE2PTGER4 signaling in mammalian macrophages suppressed the stimulus-induced expression of certain proinflammatory genes, including tumor necrosis factor (TNF)-a, interferon (IFN)-b and macrophage inflammatory protein (MIP)-1b [14,17]. Reportedly, in the setting of LPS stimulation, PGE2 signaling via PTGER4 decreased the levels of interleukin-1beta (IL-1b) [18] and inducible nitric oxide synthase (iNOS) [19] in microglia. Additionally, overexpression of PTGER4, as well as PTGER2, resulted in a significant reduction in the LPS-induced mRNA expression of proinflammatory chemokine monocyte chemotactic protein-1 (MCP1) in glomerulonephritis [20]. Moreover, the anti-inflammatory effect of PTGER4 was also observed in LPS-treated BV-2 cells in which PTGER4 activation decreased the phosphorylation of IKKa/b subunits and decreased nuclear translocation of the NF-kappa B subunits p65 and p50, ultimately reducing the transcription of proinflammatory genes [21]. Beyond its key role in anti-inflammatory processes, PTGER4 has also been shown to function as a regulator of pro-inflammatory cellular signaling pathways. For example, it is believed that PTGER4 may be involved in the biosynthesis of matrix metalloproteinases (MMPs) from plaque macrophages that then exert pro-inflammatory effects in the late phase of atherosclerosis [22,23]. A previous study in RAW 264.7 macrophages demonstrated that activation of PTGER4 and PTGER2 by peptidoglycan (PGN) stimulation resulted in increased cAMP levels and activation of protein kinase A (PKA), which in turn increased NF-kB activation and finally induced IL-6 production [24]. Recently, it was reported that IL-8 is an important mediator of the acute host inflammatory response and is produced in response to PGE2 via the activation of a cAMP-dependent mechanism that is mediated exclusively by activation of PTGER4 in colonic inflammation [25]. In recent years, PTGER4 has been attracting significant attention due to its crucial roles in immunity, and its homologs have been identified in various vertebrates, such as Homo sapiens [26], Mus musculus [27], Gallus gallus [28], Danio rerio [29]and Salmo salar [30]. Many putative PTGER4 have been found in invertebrates, including Crassostrea gigas (EKC40150.1), Aplysia californica (XP_005095886.1) and Camponotus floridanus (EFN71431.1) [31], and subsequently reported in the NCBI database. However, to the best of our knowledge, no experimental evidence of a functional PTGER4 in invertebrates has been provided until now. Therefore, isolation and functional research on the oyster PTGER4 may contribute to a better understanding of its immune function in invertebrates and provide new insight into the immune defense mechanism of oysters. With this in mind, we have cloned a mollusk PTGER4 homolog from Crassostrea hongkongensis (designated ChPTGER4) and investigated its expression levels in both hemocytes and gills in response to challenge with pathogens and PAMPs. In addition, the subcellular localization and functional role of ChPTGER4 in the NF-кB signaling pathway were also analyzed in HeLa and HEK293T cells, respectively. Taken together, these data contribute to clarifying the possible biological functions of PTGER4 in mollusks.

2. Materials and methods 2.1. Animals, tissue collection and immune challenge Healthy C. hongkongensis individuals, averaging 100 mm in shell height, were collected from Zhanjiang, Guangdong province, China and kept in aerated seawater (salinity, 20‰) at 25  C. The animals were fed with 0.8% Tetraselmis suecica and Isochrysis galbana for a

317

week before processing. The tissue distribution experiment was performed according to our previous work [32]. For the pathogen challenge, 200 oysters were randomly divided into 4 groups and placed in 4 tanks for challenge: the Vibrio alginolyticus group, Staphylococcus haemolyticus group, Saccharomyces cerevisiae group and the control group. Individuals in the pathogen challenge groups were challenged by injecting 100 mL of S. haemolyticus, V. alginolyticus or S. cerevisiae (1.0  109 cells per liter of PBS) into the adductor muscles, and the individuals in the control groups were injected with an equal volume of PBS (0.14 M sodium chloride, 3 mM potassium chloride, 8 mM disodium hydrogenphosphate dodecahydrate, 1.5 mM potassium phosphate monobasic, pH 7.4). After treatment, the oysters were returned to water tanks, and 5 individuals were randomly sampled at 0, 3, 6, 12, 24, 48, and 72 h post-injection. The gills and hemocytes from both challenged and control groups were collected for total RNA extraction. For the PAMP challenge, hemocyte monolayers were prepared as described in previous reports [33] and challenged as follows: the experimental cultures were incubated with 10 mg/mL LPS (Invivogen) or 10 mg/mL PGN (Invivogen). Control cultures were incubated with an equal volume of PBS. Hemocytes from three replicates were harvested at different time points (0, 1, 3, 6 and 12 h after challenge) for RNA extraction. 2.2. Cloning the full-length cDNA of ChPTGER4 and sequence analysis One 850 bp EST sequence showing high similarity with invertebrate PTGER4 was obtained from a C. hongkongensis hemocyte EST library by BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Based on the identified EST sequence, gene-specific primers (Table 1) were designed to amplify the full sequence of ChPTGER4 using the rapid amplification of cDNA ends (RACE) approach. The 50 -Full Race Kit and 30 -Full RACE Core Set Ver.2.0 (TaKaRa, Japan) were employed to construct the 50 and 30 RACE cDNA libraries, respectively, using mixed RNAs from hemocytes and gills of C. hongkongensis. PCR amplification to clone the 50 and 3'ends of ChPTGER4 was carried out using the gene-specific primers ChPTGER4-R1/ChPTGER4-R2 and ChPTGER4-F1/ChPTGER4-F2 (Table 1), respectively. The PCR products were separated by 1.2% agarose gel/TAE electrophoresis and then purified with a TaKaRa Agarose Gel DNA Purification Kit Ver.2.0 (TaKaRa, Japan). After purification, the DNA fragments were ligated into the pMD18-T vector (TaKaRa) and transformed into competent E. coli DH5a cells. Randomly selected clones were sequenced on a 3730 Applied

Table 1 Sequences of the primers used in this study. Primer

Sequence (50 e30 )

Comment

Takara5P Takara5NP Takara3P Takara3NP ChPTGER4-R1 ChPTGER4-R2 ChPTGER4-F1 ChPTGER4-F2 ChPTGER4-F3 ChPTGER4-R3 GAPDH-F GAPDH-R ChPTGER4-F4 ChPTGER4-R4 ChPTGER4-F5 ChPTGER4-R5

CATGGCTACATGCTGACAGCCTA CGCGGATCCACAGCCTACTGATGATCAGTCGATG TACCGTCGTTCCACTAGTGATTT CGCGGATCCTCCACTAGTGATTTCACTATAGG AAAGTCGTATGTAAAGTCCGTGGCA CCAGAGGAGTTCGTTTCCGTGTCAT ATTCTGTTGACGACGATTGGGCTAA CCAGAATCTACTCCAAACGAGGTCA GATTTCTTCGGCGATGATTGTGT GAGCTGATCCTGTCCATTGTTGTG GGATTGGCGTGGTGGTAGAG GTATGATGCCCCTTTGTTGAGTC AAAAAGCTTCCATGGATGACACGGAA GGGCTCGAGAAGTTTGTACAAAACAGTC AAACTCGAGATGGATGACACGGAAA TCCAAGCTTAAGTTTGTACAAAACAGTCG

50 Adaptor 30 Adaptor 50 RACE 30 RACE qPCR of ChPTGER4 qPCR of GAPDH ChPTGER4-His ChPTGER4-GFP

318

F. Qu et al. / Fish & Shellfish Immunology 42 (2015) 316e324

Biosystems (ABI) DNA sequencer using the universal primers M1347 and RV-M. The full-length cDNA sequences were obtained by combining ESTs with the 50 and 30 end sequences. The cDNA and deduced amino acid sequences of ChPTGER4 were analyzed using the BLAST tool available from the National Center for Biotechnology Information (NCBI) (http://blast.ncbi.nlm.nih. gov/Blast.cgi). The amino acid sequence was deduced using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/orfig.cgi). The theoretical isoelectric point and molecular weight were p pI/Mw tool (http://web.expasy.org/compute_pi/). The protein domains were predicted by the Simple Modular Architecture Research Tool (SMART) (http://smart.cmbl-heidelberg.de/). Multiple sequence alignments were analyzed using the MegAlign program (DNAstar software), which is based on the Clustal W method. A neighborjoining (NJ) phylogenetic tree was constructed based on the multiple sequence alignment using the MEGA 5.1 package with 1000 bootstrap repetitions [34]. The GenBank accession numbers corresponding to the PTGER4 protein sequences examined are as follows: AAA36438.1 [H. sapiens], XP_001085257.1 [Macaca mulatta], NP_001129551.1 [M. musculus], NP_001074972.1 [Gallus gallus], NP_001120554.1 [Xenopus tropicalis], NP_001121839.1 [D. rerio], NP_001167426.1 [S. salar], CAG09586.1 [Tetraodon nigroviridis], XP_002123907.1 [Ciona intestinalis], XP_002606876.1 [Branchiostoma floridae], XP_005095886.1 [A. californica], EKC40150.1 [C. gigas], KM014657 [C. hongkongensis]. 2.3. Isolation of total RNA and real-time quantitative RT-PCR analysis of ChPTGER4

ChPTGER4 and pcDNA3.1-ChPTGER4 recombinant vectors were transfected into mammalian cells for subcellular localization and luciferase reporter assays, respectively. The primers used for the construction of various expression vectors are listed in Table 1. The PCR program was as follows: 94  C for 3 min, followed by 30 cycles of 94  C for 30 s, 55  C for 30 s, and 72  C for 2 min, followed by a final extension at 72  C for 10 min. The target PCR products and the empty vector were digested with restriction enzymes, purified from an agarose gel, ligated, and transformed to E. coli DH5a cells. DNA from the resulting colonies was screened by restriction enzyme analysis, and inserts were further verified by sequencing. 2.5. Cell culture and transient transfection Because there are no established cell lines available for marine bivalves, HeLa and HEK293T cells were used for subcellular localization and luciferase reporter analysis of ChPTGER4, respectively. Cell culture was performed as described previously [32]. In brief, cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Gibco, USA) supplemented with 10% FBS (fetal bovine serum, Gibco BRL) and antibiotic (100 mg/L streptomycin and 105 U/L penicillin, Gibco) in a humidified incubator with 5% CO2 at 37  C. Prior to transfection, the cells were seeded overnight, and plasmids were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. All plasmids used for transfection were prepared from overnight bacterial cultures using the EndoFree Plasmid Mini Kit (OMEGA, USA) according to the manufacturer's protocol. 2.6. Subcellular localization and luciferase reporter assays

Total RNA was isolated from the collected hemocyte samples and other oyster tissues using TRIzol (Invitrogen, USA), and the RNA samples were subjected to DNase I treatment (Promega, USA) according to the manufacturer's protocols. The RNA quality was assessed by electrophoresis on a 1.0% agarose gel, and the concentration and purity were examined at 260 nm and 280 nm, respectively, in a Biophotometer. Reverse transcription (RT) was carried out using SYBR Premix Ex Taq™ (TOYOBO, Japan) with1 mg of total RNA as a template according to the manufacturer's instructions. The mRNA expression levels of ChPTGER4 in various tissues and during immune challenge were determined by quantitative realtime PCR (qRT-PCR) using a pair of gene-specific primers: ChPTGER4-F3 and ChPTGER4-R3 (Table 1). The GAPDH gene was used as a reference gene to normalize the initial quantity of RNA. The qRTPCR reactions were carried out with the Light-Cycler 480 II System (Roche, USA) in a volume of 20 mL containing 10 mL of 2  SYBR Green PCR Master Mix (TOYOBO, Japan), 1 mL of 10 mM primers, 8 mL of PCRgrade water, and 1 mL of cDNA template. The PCR cycling procedure was as follows: an initial denaturation at 95  C for 5 min, followed by 40 cycles of 95  C for 15 s, 57  C for 15 s and 72  C for 15 s. To assess the specificity of the PCR amplification, a melting curve was obtained at the end of the reaction, and a single peak was observed. For each sample, experimental and control reactions were run in triplicate. Data were produced with LightCycler 480 software (Version 1.5). The relative expression level of ChPTGER4 was calculated according to the 2DDCt method with GAPDH as a reference gene [35]. The amplification efficiencies of the target and reference genes were verified and found to be approximately equal. All qRT-PCR data were analyzed by SPSS 13.0 software for Windows. Differences were considered significant at p < 0.05 and p < 0.01.

For subcellular localization analysis of ChPTGER4, the endofree plasmids pEGFP-N1-ChPTGER4 and pEGFP-N1 (negative control), were transfected into HeLa cells using Lipofectamine 2000 (Invitrogen). At 48 h after transfection, the cells were washed with PBS buffer for 5 min and fixed with 4% paraformaldehyde at room temperature for 10 min. The nuclei were then stained with 40 , 6diamidino-2-phenylindole hydrochloride (DAPI, 1 mg/ml). Subsequently, the cells transfected with fluorescent vectors were directly observed using fluorescence microscopy (Leica Microsystems Heidelberg GmbH, Germany). For the dual-luciferase reporter assays, HEK293T cells were cotransfected with pRL-TK and NF-кB-Luc reporter plasmids as well as pcDNA3.1-ChPTGER4 and pcDNA3.1 to investigate the effect of ChPTGER4 on the transcriptional activity of NF-кB. All assays were performed with three independent transfections. Forty-eight hours after transfection, firefly and Renilla luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega, USA) according to the manufacturer's instructions. Briefly, transfected cells in 48-well plates were washed twice with 100 mL of PBS and subsequently treated with 30 mL of 1  passive lysis buffer at room temperature for 10 min. Cell lysates were transferred to a plate, and 50 mL of luciferase assay reagent II and 50 mL of 1  stop & glo reagent were added in sequence. Next, firefly and Renilla luciferase activities were measured. Each experiment was performed in triplicate and each assay was repeated at least three times at the different time and under the similar conditions. Values were expressed as mean relative stimulations for a representative experiment from three separate experiments with each performance in duplicate. 3. Results

2.4. Construction of expression plasmids 3.1. Cloning and sequence analysis of ChPTGER4 For construction of the recombinant vectors, a fragment of the ChPTGER4 cDNA ORF was amplified and subcloned into the expression vectors pEGFP-N1 and pcDNA3.1. The pEGFP-N1-

Based on the EST sequence from the Hong Kong oyster EST databases, one novel full-length ChPTGER4 cDNA sequence was

F. Qu et al. / Fish & Shellfish Immunology 42 (2015) 316e324

obtained by RACE in combination with RT-PCR. This sequence was deposited in GenBank with the accession number KM014657. The complete nucleotide and deduced amino acid sequences are shown in Fig. 1. The full-length ChPTGER4 cDNA is 1734 bp in length, containing an open reading frame of 1074 bp, a 5'-untranslated region (UTR) of 354 bp and a 30 -UTR of 306 bp with a poly (A) tail. The ORF encoded a putative protein of 357 amino acids, which has a predicted molecular weight of 39.97 kDa and pI of 9.27. SMART program analysis revealed that similar to other PTGER4 family proteins, the putative mature ChPTGER4 protein contained a 7TM_GPCR_Srsx domain (positions 29e280). The multiple sequence alignment revealed that the deduced amino acid sequence of ChPTGER4 shares a relatively low similarity with the sequences of known PTGER4s (Fig. 2). The phylogenetic tree was constructed by the neighbor-joining method using

319

PTGER4 amino acid sequences from the Hong Kong oyster and other species. This tree revealed that the PTGER4 sequences are divided into two major clusters (Fig. 3): the ChPTGER4 clustered together with the PTGER4 sequences from other invertebrates to form a single branch, while the sequences from vertebrates PTGER4 were grouped in a distinct branch. Owing to the lack of information about mollusk PTGER4s, it is difficult to predict an exact phylogenetic relationship at present. Overall, the relationships displayed in the phylogenic tree are generally in agreement with traditional taxonomy. 3.2. Tissue distribution and subcellular localization of ChPTGER4 The qRT-PCR was employed to investigate the distribution of ChPTGER4 mRNA transcripts in different tissues using GAPDH as

Fig. 1. The complete cDNA and deduced amino acid sequences of ChPTGER4. The initiation and stop codons are in bold. The polyadenylation signal sequence (AATAAA) is in bold and underlined. The predicted 7TM_GPCR_Srsx domain is shaded.

320

F. Qu et al. / Fish & Shellfish Immunology 42 (2015) 316e324

internal control. For the ChPTGER4 and GAPDH genes, there was only one peak at the corresponding melting temperature in the dissociation curve analysis, indicating that specific products were amplified (data not shown). The ChPTGER4 transcript was ubiquitously detected in all the tissues tested, including the gill, mantle, heart, adductor muscle, digestive gland, gonads and hemocytes. The qRT-PCR analyses suggested that ChPTGER4 is abundantly expressed in hemocytes; moderately expressed in the gill, gonad, digestive gland, mantle and heart; and weakly expressed in the adductor muscle (Fig. 4). Confocal microscopy analysis revealed that ChPTGER4-GFPtransfected cells exhibited a punctate pattern of GFP fluorescence in the membrane, while the control cells (harboring the pEGFP-N1 plasmid) showed uniform green fluorescence in both the cytoplasm and nucleus (Fig. 5). These results suggest that ChPTGER4 is a membrane-localized protein in HeLa cells. 3.3. Temporal pattern of ChPTGER4 expression in response to PAMP and pathogen challenge The expression of ChPTGER4 in hemocytes was significantly increased in response to LPS and PGN challenge as determined by qRT-PCR. Upon challenge with LPS, the expression level of ChPTGER4 increased significantly at 1 h postechallenge (3.5-fold) and peaked at 3 h postechallenge (8.5-fold) compared to treatment with PBS (Fig. 6A). Upon challenge with PGN, the expression peaked at 3 h postechallenge (5.7-fold) and subsequently declined to 2.2fold at 12 h postechallenge (Fig. 6B). As shown in Fig. 7A-B, the expression levels of ChPTGER4 in both hemocytes and gills were significantly increased in a time-

dependent manner upon pathogen (V. alginolyticus, S. haemolyticus or S. cerevisiae) challenge. In hemocytes, the level was significantly increased upon microorganism challenge, and the highest expression levels were reached at 72 h, 24 h and 12 h postechallenge in response to V. alginolyticus, S. haemolyticus and S. cerevisiae cultures (42.4-fold, 27.5-fold and 73.9-fold, respectively), respectively. Additionally, the expression of ChPTGER4 in the gills was also up-regulated after stimulation with microorganisms, reaching peak values in V. alginolyticus and S. cerevisiae cultures (5.0-fold and 8.2-fold, respectively) at 6 h and in the S. haemolyticus culture (14.2-fold) at 3 h compared to the control group. 3.4. Dual-luciferase reporter assays To determine whether oyster ChPTGER4 can modulate the activation of immune signaling pathways, HEK293T cells harboring reporter plasmids were transfected with either a plasmid expressing ChPTGER4 or an empty control plasmid. The results showed that expression of recombinant ChPTGER4 enhances transcriptional activation of NF-кB-Luc in a dose-dependent manner compared to expression of the empty vector pcDNA3.1 (a negative control); the greatest increase was approximately 4.2-fold over the control levels (p < 0.05; Fig. 8). These results suggest that ChPTGER4 could trigger the activation of the NF-кB signaling pathway in HEK293T cells. 4. Discussion PTGER4 has been shown to function as a key regulator in host defense and the immune response in vertebrates [13,14]. However,

Fig. 2. Multiple alignment analysis of ChPTGER4 amino acid sequences and other known PTGER4 proteins. The blue shaded sequences indicate residues that exactly match the consensus sequence. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

F. Qu et al. / Fish & Shellfish Immunology 42 (2015) 316e324

321

Fig. 2. (continued).

Fig. 3. Phylogenetic analysis of PTGER4 homologs from invertebrates and vertebrates using MEGA5.1 with the neighbor-joining method based on the alignment of the complete amino acid sequences. Node values represent the percent bootstrap confidence level derived from 1000 replicates. The bar shows the genetic distance (0.1).

information regarding PTGER4 homologs in invertebrates remains limited. In this study, a novel PTGER4 homolog was cloned from C. hongkongensis (ChPTGER4). To the best of our knowledge, this is the first PTGER4 sequence identified in mollusks. The full-length ChPTGER4 cDNA encodes a polypeptide of 357 amino acids. The structural characteristics of ChPTGER4 are highly conserved among its homologs invertebrates. The structural analysis revealed that ChPTGER4 shares a 7TM_GPCR_Srsx domain, suggesting that it is similar to other PTGER4s belonging to the 7-transmembrane Gprotein-coupled receptor class. The subsequent phylogenetic analysis indicated that the ChPTGER4 had the highest homology with another bivalve mollusk PTGER4 from C. gigas. These results confirmed that ChPTGER4 belongs to the PTGER4 family. Earlier evidence suggested that PTGER4 mRNA is ubiquitously expressed in a variety of tissues and in most immune cell types [10,11]. In our study, it was shown that ChPTGER4 was ubiquitously expressed in all tested C. hongkongensis tissues including the gill, mantle, heart, adductor muscle, digestive gland, gonad and hemocytes, which is consistent with previous reports in mammals. The universal distribution of ChPTGER4 may indicate that is has a broader, more generalized role in numerous physiological

322

F. Qu et al. / Fish & Shellfish Immunology 42 (2015) 316e324

Fig. 4. The distribution of ChPTGER4 expression in the hemocytes, heart, gill, mantle, adductor muscle, digestive gland and gonad. Each bar represents the mean of the normalized expression levels of replicates (N ¼ 3).

processes in oyster. Previously, it was shown that hemocytes are the main immune tissue in invertebrates, especially in lower mollusks, and play a key role in the recognition of and defense against bacterial invasion and exogenous agents [36]. Thus, the high expression level of ChPTGER4 in hemocytes may suggest its potential function in the immune system of the Hong Kong oyster. It is generally believed that PTGER4 is a seven-transmembrane protein that recognizes PGE2 as its natural binding ligand and subsequently exerts effects on various physiological and pathological processes by activating downstream signaling pathways [7e9]. In this study, fluorescence microscopy showed that ChPTGER4 was localized in the membrane, suggesting that ChPTGER4, similar to its homologs in mammals [7,8], is a membrane-localized protein under normal circumstances. Combined with the results from the structural analysis of ChPTGER4 mentioned above, we hypothesize that the highly conserved seven transmembrane helices of ChPTGER4 may play a key role in the membrane localization of oyster PTGER4. However, further work is needed to clarify this issue. Many studies have demonstrated that PTGER4 exerts both proinflammatory and anti-inflammatory effects in the immune system of mammals [14,17e19,24,25]. In response to PGN stimulation,

Fig. 6. The expression of ChPTGER4 in hemocytes upon LPS (A) and PGN (B) challenge. The values are shown as the means ± S.D (N ¼ 3). Significant differences are indicated by an asterisk (* and ** represent p < 0.05 and p < 0.01, respectively).

PTGER4 could increase cAMP levels and induce IL-6 production in RAW 264.7 macrophages [24]. In colonic inflammation, IL-8, an important mediator of the acute host inflammatory response, was induced by PGE2-PTGER4 signaling via a cAMP-dependent mechanism [25]. Additionally, the activation of PTGER4 may also regulate anti-inflammatory responses in certain cell types by inhibiting stimulus-induced expression of proinflammatory genes, including

Fig. 5. Subcellular localization analysis of ChPTGER4. In contrast to pEGFP-N1 (control), ChPTGER4-GFP is localized in the membrane of HeLa cells.

F. Qu et al. / Fish & Shellfish Immunology 42 (2015) 316e324

Fig. 7. Quantitative PCR analysis of ChPTGER4 in hemocytes (A) and gills (B) of oysters challenged with V.alginolyticus, S. haemolyticus or S. cerevisiae. The values are shown as the means ± S.D (N ¼ 3). Significant differences are indicated by an asterisk (* and ** represent p < 0.05 and p < 0.01, respectively).

TNF-a, IFN-b, IL-1b and iNOS [14,17e19]. In our study, the qRT-PCR results showed that ChPTGER4 mRNA levels increased in a significant, time-dependent manner in hemocytes after exposure to LPS and PGN, indicating the potential role of ChPTGER4 in the defense response of oyster against gram-negative (G-) and gram-positive (Gþ) bacteria. The expression patterns of ChPTGER4 in response to PAMP challenge suggested that similar to its mammalian homologs,

323

ChPTGER4 may play a role in regulating the inflammatory process in oyster. To obtain more clues regarding the role of ChPTGER4 in the oyster immune response, the temporal expression of ChPTGER4 in hemocytes and gills was determined using qRT-PCR upon stimulation by the three microorganisms. The results revealed that the mRNA expression of ChPTGER4 was significantly up-regulated both in hemocytes and gills after challenge with V. alginolyticus (G)and S. haemolyticus (Gþ), further indicating its potential role in the defense response of oyster against bacterial pathogens. Similar results were also observed in C. gigas, where both Vibrio vulnificus and Vibrio parahaemolyticus stimulation could significantly upregulate PTGER4 mRNA expression [37]. Additionally, significant stimulatory effects on ChPTGER4 expression were also observed upon S. cerevisiae (fungus) challenge at all points examined, indicating that ChPTGER4 may exert an anti-fungal role in mollusks. Taken together, these data strongly suggest that ChPTGER4 may be involved in the related pathways of oyster immune defense against bacterial and fungal pathogens. Previous studies revealed that NF-kB is an essential component in the ancient innate host defense system, which is phylogenetically conserved and has been demonstrated to exist in bivalve mollusks [38e40]. It has been reported that PTGER4-induced NF-kB activation plays a key role in diverse biological processes, including the pro-inflammatory and pro-survival responses [25,41]. For example, the activation of the NF-kB signaling pathway mediated by PGERT4, as well as PTGER2, could induce IL-6 production in PGN-treated RAW 264.7 macrophages [25]. Additionally, PGERT4 was also shown to promote survival pathways and impair intrinsic apoptotic pathways by activating the NF-kB signaling pathway in human endometriotic cells [41]. Our data from the luciferase reporter assay indicated that ChPTGER4 could significantly activate the NF-kB reporter gene in HEK293T cells, suggesting that ChPTGER4 may act as a regulator of the NF-kB signaling pathway involved in immune-related processes in the Hong Kong oyster. In conclusion, we first identified and characterized a molluscan PTGER4 homolog in C. hongkongensis. Sequence characterization and phylogenetic analysis indicated that the ChPTGER4 protein has typical characteristic features similar to those of other PTGER4 family proteins. Additionally, qRT-PCR analysis indicated that ChPTGER4 mRNA is ubiquitously expressed in all selected tissues, and its transcript level could be significantly up-regulated by challenge with pathogens and PAMPs. Furthermore, ChPTGER4 is a membrane-localized protein, and it was capable of enhancing NFkB reporter gene activation in HEK293 cells. Taken together, these results indicate that ChPTGER4 may be involved in immune defense against pathogens and PAMPs in C. hongkongensis. However, further study is required to elucidate the ChPTGER4 involvement in the innate immune response pathways in mollusks, particularly its roles in regulating NF-кB signaling pathway post pathogen challenge.

Acknowledgments This research was supported by funding from the Joint Funds of NSFC-Guangdong of China (U1201215), a National Basic Research Program of China (No. 2010CB126404), the Program of Administration of Ocean and Fisheries of Guangdong Province, China (No. A201301B08), the National Science Foundation of China (No. 41176150).

Fig. 8. Effects of ChPTGER4 expression on the activity of the NF-кB reporter gene. The cells were transiently co-transfected with an NF-kB reporter vector, pRL-TK, and the pcDNA3.1-ChPTGER4 expression vector. The pcDNA3.1 vector was used as a control. Significant differences are indicated by different letters (p < 0.05).

References [1] Needleman P, Jakschik B, Morrison A, Lefkowith J. Arachidonic acid metabolism. Annu Rev Biochem 1986;55:69e102.

324

F. Qu et al. / Fish & Shellfish Immunology 42 (2015) 316e324

[2] Ushikubi F, Hirata M, Narumiya S. Molecular biology of prostanoid receptors; an overview. J lipid Mediat Cell Signal 1995;12:343e59. [3] Negishi M, Sugimoto Y, Ichikawa A. Molecular mechanisms of diverse actions of prostanoid receptors. Biochim Biophys Acta (BBA)-Lipids Lipid Metab 1995;1259:109e19. [4] Phipps RP, Stein SH, Roper RL. A new view of prostaglandin E regulation of the immune response. Immunol Today 1991;12:349e52. [5] Smith WL, Marnett LJ, DeWitt DL. Prostaglandin and thromboxane biosynthesis. Pharmacol Ther 1991;49:153e79. [6] Hata AN, Breyer RM. Pharmacology and signaling of prostaglandin receptors: multiple roles in inflammation and immune modulation. Pharmacol Ther 2004;103:147e66. [7] Nagai H. Prostaglandin as a target molecule for pharmacotherapy of allergic inflammatory diseases. Allergol Int 2008;57:187e96. [8] Sugimoto Y, Narumiya S. Prostaglandin E receptors. J Biol Chem 2007;282: 11613e7. [9] Matsuoka T, Narumiya S. Prostaglandin receptor signaling in disease. Sci World J 2007;7:1329e47. [10] Norel X. Prostanoid receptors in the human vascular wall. Sci World J 2007;7: 1359e74. [11] Kalinski P. Regulation of immune responses by prostaglandin E2. J Immunol 2012;188:21e8. [12] Margan D, Borota A, Mracec M, Mracec M. 3D homology model of the human prostaglandin E2 receptor EP4 subtype. Rev Roum Chim 2012;57:39e44. [13] Nataraj C, Thomas DW, Tilley SL, Nguyen M, Mannon R, Koller BH, et al. Receptors for prostaglandin E 2 that regulate cellular immune responses in the mouse. J Clin Investig 2001;108:1229e35. ~ a G, Sukhova GK, Comander J, Gimbrone MA, [14] Takayama K, Garcıa-Carden Libby P. Prostaglandin E2 suppresses chemokine production in human macrophages through the EP4 receptor. J Biol Chem 2002;277:44147e54. [15] Minami M, Shimizu K, Okamoto Y, Folco E, Ilasaca M-L, Feinberg MW, et al. Prostaglandin E receptor type 4-associated protein interacts directly with NFkB1 and attenuates macrophage activation. J Biol Chem 2008;283:9692e703. [16] Takayama K, Sukhova GK, Chin MT, Libby P. A novel prostaglandin E receptor 4eAssociated protein participates in antiinflammatory signaling. Circ Res 2006;98:499e504. [17] Xu XJ, Reichner JS, Mastrofrancesco B, Henry Jr WL, Albina JE. Prostaglandin E2 suppresses lipopolysaccharide-stimulated IFN-beta production. J Immunol (Baltim Md 1950) 2008;180:2125e31. [18] Caggiano AO, Kraig RP. Prostaglandin E2 and 4-Aminopyridine prevent the Lipopolysaccharide-Induced outwardly rectifying potassium current and interleukin-1b production in cultured rat microglia. J Neurochem 1998;70: 2357e68. minon C, Maclouf J, Levi G. Prostaglandin [19] Minghetti L, Nicolini A, Polazzi E, Cre E2 downregulates inducible nitric oxide synthase expression in microglia by increasing cAMP levels. Recent advances in prostaglandin, thromboxane, and leukotriene research. Springer; 1997. p. 181e4. [20] Zahner G, Schaper M, Panzer U, Kluger M, Stahl R, Thaiss F, et al. Prostaglandin EP2 and EP4 receptors modulate expression of the chemokine CCL2 (MCP-1) in response to LPS-induced renal glomerular inflammation. Biochem J 2009;422:563e70. [21] Shi J, Johansson J, Woodling NS, Wang Q, Montine TJ, Andreasson K. The prostaglandin E2 E-prostanoid 4 receptor exerts anti-inflammatory effects in ́ brain innate immunity. J Immunol 2010;184:7207e18. [22] Cipollone F, Fazia M, Iezzi A, Zucchelli M, Pini B, De Cesare D, et al. Suppression of the functionally coupled cyclooxygenase-2/prostaglandin E synthase as a basis of simvastatin-dependent plaque stabilization in humans. Circulation 2003;107:1479e85.

[23] Jones CB, Sane DC, Herrington DM. Matrix metalloproteinases A review of their structure and role in acute coronary syndrome. Cardiovasc Res 2003;59:812e23. [24] Chen B-C, Liao C-C, Hsu M-J, Liao Y-T, Lin C-C, Sheu J-R, et al. Peptidoglycaninduced IL-6 production in RAW 264.7 macrophages is mediated by cyclooxygenase-2, PGE2/PGE4 receptors, protein kinase A, IkB kinase, and NFkB. J Immunol 2006;177:681e93. [25] Dey I, Giembycz M, Chadee K. Prostaglandin E2 couples through EP4 prostanoid receptors to induce IL-8 production in human colonic epithelial cell lines. Br J Pharmacol 2009;156:475e85. [26] Bastien L, Sawyer N, Grygorczyk R, Metters KM, Adam M. Cloning, functional expression, and characterization of the human prostaglandin E2 receptor EP2 subtype. J Biol Chem 1994;269:11873e7. [27] Honda A, Sugimoto Y, Namba T, Watabe A, Irie A, Negishi M, et al. Cloning and expression of a cDNA for mouse prostaglandin E receptor EP2 subtype. J Biol Chem 1993;268:7759e62. [28] Kwok AHY, Wang Y, Wang CY, Leung FC. Molecular cloning and characterization of chicken prostaglandin E receptor subtypes 2 and 4 (EP 2 and EP 4). General Comp Endocrinol 2008;157:99e106. [29] Cha YI, Kim S-H, Sepich D, Buchanan FG, Solnica-Krezel L, DuBois RN. Cyclooxygenase-1-derived PGE2 promotes cell motility via the G-protein-coupled EP4 receptor during vertebrate gastrulation. Genes Dev 2006;20:77e86. [30] Leong JS, Jantzen SG, von Schalburg KR, Cooper GA, Messmer AM, Liao NY, et al. Salmo salar and Esox lucius full-length cDNA sequences reveal changes in evolutionary pressures on a post-tetraploidization genome. BMC Genomics 2010;11:279. [31] Bonasio R, Zhang G, Ye C, Mutti NS, Fang X, Qin N, et al. Genomic comparison of the ants Camponotus floridanus and Harpegnathos saltator. Science 2010;329:1068e71. [32] Qu F, Xiang Z, Yu Z. The first molluscan acute phase serum amyloid A (A-SAA) identified from oyster Crassostrea hongkongensis: molecular cloning and functional characterization. Fish Shellfish Immunol 2014;39:145e51. [33] Zhu B, Wu X. Characterization and function of CREB homologue from Crassostrea ariakensis stimulated by rickettsia-like organism. Dev Comp Immunol 2008;32:1572e81. [34] Hall BG. Building phylogenetic trees from molecular data with MEGA. Mol Biol Evol 2013;30:1229e35. [35] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2 DDCT method. Methods 2001;25:402e8. [36] Morga B, Arzul I, Faury N, Segarra A, Chollet B, Renault T. Molecular responses of Ostrea edulis haemocytes to an in vitro infection with Bonamia ostreae. Dev Comp Immunol 2011;35:323e33. [37] Roberts S, Goetz G, White S, Goetz F. Analysis of genes isolated from plated hemocytes of the Pacific oyster, Crassostreas gigas. Mar Biotechnol 2009;11: 24e44. [38] Liang Y, Zhou Y, Shen P. NF-kappaB and its regulation on the immune system. Cell Mol Immunol 2004;1:343e50. [39] Montagnani C, Kappler C, Reichhart J, Escoubas J. Cg-Rel, the first Rel/NF-kB homolog characterized in a mollusk, the Pacific oyster Crassostrea gigas. FEBS Lett 2004;561:75e82. [40] Zhou Z, Wang M, Zhao J, Wang L, Gao Y, Zhang H, et al. The increased transcriptional response and translocation of a Rel/NF-kB homologue in scallop Chlamys farreri during the immune stimulation. Fish Shellfish Immunol 2013;34:1209e15. [41] Banu SK, Lee J, Speights Jr V, Starzinski-Powitz A, Arosh JA. Selective inhibition of prostaglandin E2 receptors EP2 and EP4 induces apoptosis of human endometriotic cells through suppression of ERK1/2, AKT, NFkB, and b-catenin pathways and activation of intrinsic apoptotic mechanisms. Mol Endocrinol 2009;23:1291e305.