ANDROLOGY
ISSN: 2047-2919
ORIGINAL ARTICLE
Correspondence: Agnieszka Paradowska-Dogan, Department of Urology, Pediatric Urology and Andrology, Section Molecular Andrology, Schubertstr. 81, 35392 Giessen, Germany. E-mail: Agnieszka. [email protected]
Protamine mRNA ratio in stallion spermatozoa correlates with mare fecundity
Keywords: in situ hybridization, protamines, seasonal breeding, semen analysis, stallion’s spermatogenesis, subfertility
1
Received: 20-Jan-2014 Revised: 26-Feb-2014 Accepted: 27-Feb-2014
A. Paradowska-Dogan, 2A. Fernandez, 3M. Bergmann, 3K. Kretzer, C.Mallidis, 1M. Vieweg, 1P. Waliszewski, 2M. Zitzmann, 1W. Weidner, 1 K. Steger and 2S. Kliesch 2
1 Department of Urology, Pediatric Urology and Andrology, Justus Liebig University of Giessen, Giessen, 2Centre of Reproductive Medicine and Andrology, University Clinic Muenster, Muenster, and 3Institute for Veterinary Anatomy, Histology and Embryology, Justus Liebig University of Giessen, Giessen, Germany
doi: 10.1111/j.2047-2927.2014.00211.x
SUMMARY Highly compacted sperm DNA in protamine toroids and a minor fraction of nucleohistones are prerequisites for the efficient transmission of the paternal genome into the oocyte at fertilization. The objective of this study was to evaluate whether protamines might serve as a prognostic factor for stallion fertility. In situ hybridization detected specific expression of P1 mRNA in the cytoplasm of stage I to VII spermatids, whereas comparable immunohistochemical stainings showed that protein expression was delayed till elongating spermatids in differentiation stages III to VIII. No staining was detectable in cryptorchid testis because of the lack of spermatids in the seminiferous tubules. Using quantitative real-time polymerase chain reaction, we identified mRNA transcripts of P1 and 2 variants of protamine- 2 (P2, P3) in ejaculated spermatozoa from 45 thoroughbred stallions. According to the mare fertility descriptor (i.e. the ‘none-return-rate 28 percentage’ or NRR28%), stallions were divided into three groups (i.e. high, reduced and low fertility). The P2/P1 mRNA ratio was found to be significantly reduced in the group with lower fertility (p = 0.016) and was slightly correlated with sperm concentration (correlation coefficient r = 0.263). Furthermore, morphologically abnormal sperm count negatively correlated with P2/P1 mRNA ratio, indicating that spermatozoa carrying head defects display a diminished protamine ratio (r = 0.348). Conversely, the P2/P1 ratio was positively correlated with mare fertility or NRR28% (r = 0.274). Interestingly, P3/P1 mRNA ratio remained unaltered in the investigated groups indicating that this variant plays a minor role in equine sperm chromatin compaction. Aberrant protamine transcripts content in equine spermatozoa was not associated with DNA defragmentation rate as measured by flow cytometric acridine orange test. On the basis of these results, we suggest that, similar to human, equine protamine expression constitutes a checkpoint of spermatogenesis and as a corollary the level of protamine mRNA may reflect the quality of spermatogenesis and spermatozoa’s fertilizing capacity.
INTRODUCTION Protamines are the sperm nuclear proteins which replace DNA-binding histones during late spermatogenesis. In contrast to histones, protamines are arginine-rich and positively charged, giving them an extreme affinity to the negatively charged DNA backbone. As a consequence, sperm chromatin is delivered to the zygote in a highly compacted and transcriptionally inactive form. Protamine-dependent packaging of paternal DNA within the spermatozoa and its subsequent deprotamination in the zygote represents a common feature of all mammalian species. While protamine-1 (P1) is present in all species analysed thus far and has been revealed to have high amino acid homology between bull (Mazrimas et al., 1986), boar (Tobita et al., 1983), © 2014 American Society of Andrology and European Academy of Andrology
la€ıche et al., 1987) and mouse (Bellv e et al., 1988), stallion (Be man (Ammer et al., 1986), protamine-2 is absent or expressed in low levels in bull and boar (Coeling et al., 1972; Tobita et al., 1982). Interestingly, while the bull and boar possess genes for both forms, they specifically express P1 (Maier et al., 1990; Queralt et al., 1995), that said some evidence of protamine-2 mRNA has been reported in mature bull spermatozoa (Lalancette et al., 2008; Bissonnette et al., 2009; Ganguly et al., 2013). It is known that the protamine-1 to protamine-2 protein ratio varies between different mammalian species, but is constant within a specific species. Aberrant protamine ratios have been demonstrated to be related to male infertility (Corzett et al., 2002). These data are corroborated by functional studies in Andrology, 2014, 2, 521–530
521
A. Paradowska-Dogan et al.
knockout mice, where it has been demonstrated that deletion of only one protamine allele – mimicking an aberrant protamine ratio – is sufficient to cause male infertility (Cho et al., 2001). In man, where most of the fertility-related protamine studies have been performed, subfertility has been correlated with either an abnormal persistence of histones (Silvestroni et al., 1976; Blanchard et al., 1990; Hofmann & Hilscher, 1991; Foresta et al., 1992; Zhang et al., 2006) or an aberrant protamine ratio (Balhorn et al., 1988; Belokopytova et al., 1993; De Yebra et al., 1998; Carrell & Liu, 2001; Mengual et al., 2003; Steger et al., 2003, 2008; Nasr-Esfahani et al., 2004; Aoki et al., 2005, 2006; De Mateo et al., 2007; Hammoud et al., 2009; Depa-Martynow et al., 2012; Rogenhofer et al., 2013). As the protamine ratio has been suggested a potential clinical parameter for the assessment of sperm fertilizing capacity, we wondered whether this is also applicable to the stallion. While in human spermatozoa, the relative proportion of protamine-1 to protamine-2 protein is regulated at approximately a 1 : 1 ratio (Balhorn et al., 1988), in stallion, the two variants of protamine-2 (P2 and P3) which have been found, constitute approximately 15% of the entire protamine content (Corzett et al., 2002). Furthermore, owing to similarities in protein length and amino acid composition, it has been suggested that these variants may be transcribed by homologous genes (Pirhonen et al., 1989). Similar to man, stallion fertility is gauged based upon the number, motility and morphology of spermatozoa(Jasko et al., 1992; Colenbrander et al., 2003) with the limit of normality being one billion morphologically normal and progressively motile spermatozoa per ejaculate (Kenney et al., 1983). The role of sperm motility in stallion fertility, however, remains controversial with claims ranging from no correlation (Voss et al., 1981; Dowsett & Pattie, 1982) to high correlation (Samper et al., 1991; Jasko et al., 1992). What is indisputable is that despite a sufficient number of progressively motile and morphologically normal spermatozoa, a high percentage of stallions are unable to achieve acceptable pregnancy rates. Consequently, there is a need for a suitable biomarker that reflects the sperm fertilizing potential and correlates with mare fecundity. This study, therefore, aims at investigating the expression pattern of protamine mRNA and protein during normal equine spermatogenesis and identifying any possible aberrations in subfertile stallions. Furthermore, we sought to identify any possible correlations between protamine mRNA ratio and semen parameters, DNA defragmentation rate and mare fecundity.
MATERIALS AND METHODS Animals The study was performed between March and September 2009 € t Warendorf, Gerat the Northrhine-Westfalian (NRW) Landgestu many, on 55 cross-bred stallions aged 3–18 years. Ejaculates were obtained in presence of a mare using a phantom (Klug, 1990). Testes samples were collected by routine castration from a total of 34 horses, ranging in age from 1 to 27 years. The castration was performed in the Clinic of Equine Surgery, Justus-Liebig University of Giessen. Specimen was fixed in Bouins solution, dehydrated and paraffin-embedded according to routine procedure. Sections (6 lm) were stained with haematoxilin and eosin 522
Andrology, 2014, 2, 521–530
ANDROLOGY and analysed. Stages of spermatogenesis were defined according to Johnson et al. (1990). Semen analysis Directly after ejaculation, semen analysis was performed at € fungsanstalt) of the the stallions0 s test institution (Hengstpru € t Warendorf, Germany. Sperm density was meaNRW Landgestu € b GmbH, Tiefensured by a photometer (SpermaCue, Minitu bach, Germany). Multiplication of sperm density with sperm volume resulted in total sperm count. Sperm motility was estimated using Nomarski technique (BX 60 by Olympus, Hamburg, € b GmbH, TieGermany) and an object table (HAT 400 by Minitu fenbach, Germany) heated to 38 °C. Based on three different fields of vision, spermatozoa were assessed as progressive motile, local motile or immotile using magnification 9200. For the analysis of sperm morphology, 10 lL ejaculate was streaked onto glass slides, air dried and stained according to the protocol of Papanicolaou. Subsequently, 2 9 200 sperm cells were assessed using magnification 9100 with sperm morphology being classified as normal (N), head defects (K), midpiece defects (M) and flagellum defects (S). Nicks between head and midpiece were classified as midpiece defects, nicks between midpiece and flagellum as flagellum defects. Separated sperm heads were classified as midpiece defects. Morphometric analyses were later performed on the same slides using the ISAS integrated semen analysis system version 1.0.19 (Proiser, Valencia, Spain) at the Centre of Reproductive Medicine and Andrology € nster. (CeRA), University Clinic Mu Sperm DNA integrity The flow cytometric version of the acridine orange test (FCAOT) was performed on thawed cryopreserved samples at the Centre of Reproductive Medicine and Andrology (CeRA), € nster as previously described (Evenson University Clinic Mu et al., 1999). Fluorescence data were acquired using a Cytomics FC 500 (Beckmann Coulter, Brea, CA, USA) from a total of 50 000 spermatozoa per sample and collected using the CXP Cytometry List Mode Data Acquisition & Analysis Software CXP Cytometer 2.2. Results were expressed as DNA fragmentation index (DFI) (FCS Express V 3.0 Research Edition). Protamine mRNA expression in testicular tissue In-situ hybridization was performed according to the protocol described by Steger et al. (1998) with several modifications. Based on sequence conservation of protamines in mammals, primers complementary to the human protamine-1 sequence were used to amplify the open reading frame of P1 from stallion testis complementary DNA (cDNA) (P1: forward primer: 50 -G CCAGGTACAGATGCTGTCGCAG-30 ; reverse: 50 - TTAGTGTCTA CATCTCGGTCTG-30 ; P2: forward primer: 50 - GTGAGGAGCCTG AGCGAACGC-30 ; reverse: 50 -TTAGTGCCTTCTGCATGTTCTCT TC-30 ). After 40 cycles of PCR, the resulting product was electrophoresed on a 1% agarose gel, eluted using the Taq PCR-Core Kit and cloned into the pGEM-T Vector, according to the manufacturer’s instructions (Promega, Heidelberg, Germany). After transformation of the E. coli XL1-Blue strain, mini preparations were performed (Qiagen, Hilden, Germany) and the plasmid clone DNA was sequenced at QIAGEN Genomic Services using SP6 and T7 primers. A DIG-labelled cRNA probe was produced using the previously described procedure (Steger et al., 1998; © 2014 American Society of Andrology and European Academy of Andrology
PROTAMINE EXPRESSION IN STALLION GERM CELLS
Hecht et al., 2009). Briefly, a 156 nt PCR product of stallion P1 was subcloned into pGEM-T (Promega), transformed into E. coli XL1-Blue strain (Stratagene, Heidelberg, Germany), cultured and then extracted by column purification (Qiagen). In vitro transcription of the DIG-labelled P1 was performed using the 109 RNA-DIG labelling mix (Roche, Mannheim, Germany) and RNA polymerases T3 and SP6. Vectors containing the protamine inserts were digested with NcoI and NotI (New England Biolabs, Frankfurt, Germany) for the production of sense and antisense cRNA respectively. Sections of testis from E. callabus were digested with proteinase K, post-fixed in 4% paraformaldehyde and incubated with the DIG-labelled sense or antisense cRNA probes (diluted 1 : 100 in hybridization buffer containing 50% deionized formamide, 10% dextran sulphate, 29 saline sodium citrate (SSC), 19 Denhardt’s solution, 10 mg/mL salmon sperm DNA and 10 mg/mL yeast tRNA). Hybridization was performed overnight at 37 °C in a humidified chamber containing 50% formamide in 29 SSC. Post-hybridization washes were performed, according to Lewis & Wells (1992). After blocking with 3% bovine serum albumin (BSA), sections were incubated with the anti-DIG Fab-antibody conjugated to alkaline phosphatase (Roche) overnight at 48 °C. Staining was visualized by developing sections with nitroblue-tetrazolium/5bromo-4-chloro-3-indolylphosphate in a humidified chamber protected from light. For each analysis, DIG-labelled cRNA sense probes were included as negative controls. Stage-specific analysis of equine spermatogenesis and protamine mRNA expression pattern was performed according to Johnson et al. (1990). Protamine protein expression in testicular tissue For immunohistochemistry, 6 lm sections were deparaffinized in xylene, hydrated through a graded series of ethanol, incubated in citrate buffer for 30 min at 98 °C then washed in 0.02 M PBS, pH 7.4. To make the antibody accessible to protamine antigens, the highly compacted chromatin was treated with the ‘decondensing’ mix established by Van der Heijden et al., 2006 (i.e. freshly prepared 25 mM dithiothreitol, 0.2% Triton X-100, 200 IU heparin/mL in PBS) for 10 min. Slides were then treated with 3% H2O2 in methanol for 30 min followed by washing in PBS containing 1.5% BSA for 20 min. Incubation followed with either monoclonal mouse anti-protamine-1 (Hub 1N; MAb-001) purchased from Briar Patch (Livermore, CA, USA) (dilution 1 : 1000 in DAKO Antibody Diluent) or anti-protamine2 (Hub 2B; MAb-002, Briar Patch, dilution 1 : 200 in DAKO Diluent). The slides were incubated overnight in a humidified chamber at 4 °C followed by application of DAKO EnVision System HRP (DAKO, Hamburg, Germany) for 30 min at room temperature. Finally, immunodetection was performed using the DAB reagent. Protamine ratio The ratio was determined at the Department of Urology, Paediatric Urology and Andrology, Justus Liebig University Giessen. Cryopreserved ejaculates were thawed and centrifuged for 10 min at 1000 g (4 °C). The supernatant was removed, pellet was washed with 1 mL PBS (pH 7.4) by centrifugation for 10 min at 1000 g (4 °C) and resuspended in 250 lL PBS. After mixing for 30 sec with UltraTurrax, 1 mL Trizol and 25 lL 0.1 M dithiothreithol (DTT) was added, the sample vortexed for 2 min © 2014 American Society of Andrology and European Academy of Andrology
ANDROLOGY and centrifuged for 5 min at 13 000 g (4 °C). The supernatant was then transferred into a new tube, 300 lL chloroform added, vortexed and incubated for 10 min at room temperature. After a further centrifugation (20 min at 13 000 g, 4 °C), the upper phase was transferred into new tube, 10 lL glycogen (2 mg/mL), 0.1 Vol% NaAc (3 M) and 1 Vol% isopropanol (20 °C) added, vortexed and incubated at 20 °C overnight. The following day the sample was again centrifuged (20 min at 13 000 g, 4 °C), the supernatant discharged and the pellet dissolved in 10–15 lL DEPC water. Digestion of DNA was then performed using RQ1 RNase-free DNase, according to the protocol of the manufacturer (Promega). First strand cDNA synthesis was carried out using iScript cDNA Kit (BioRad, Munich, Germany) and real-time quantitative PCR (qPCR) subsequently performed using SYBR Green Supermix, according to the protocol of the manufacturer (BioRad, Munich, Germany). Primer sequences used were as follows: P1 (GenBank Acc. No. NC009156) forward: 50 GGAGACGAAGAT GTCGCAG; reverse: 50 ACCTCAGGACAGTGTAGCGG 30 (81 bp product). P2: forward: 50 ACCGCCGGGAGCTACTAC30 ; reverse: 50 -GCCGTCTACGGAGCCTGT-30 (73 bp product). P3: forward 50 TCCTCCATGAAGAAGCTGGT-30 ; reverse: 50 - CTCCTCTTCCTCT GCCTCCT-30 (93 bp product). GAPDH (GenBank Acc. No. AF157626) forward: 50 GACTCCACAACATATTCAGC 30 ; reverse: 50 GACTCCACAACATATTCAGC 30 (77 bp product). b-actin (GenBank Acc. No. AF035774) forward: 50 ATCTGGGTCATCTTCTCG 30 ; reverse: 50 CACCACACCTTCTACAAC 30 (107 bp product). 18S rRNA (GenBank Acc. No. AJ311673) forward: 50 GCTATC AATCTGTCAATCCTGTCC 30 ; reverse: 50 ATGCGGCGGCGTTA TTCC 30 (107 bp product). Cycling conditions were as follows: 95 °C for 3 min; 40 cycles 95 °C for 30 sec, 60 °C for 30 sec, 72 °C for 1 min; 72 °C for 3 min. qPCR products were separated by capillary electrophoresis (Sensi Script Bio-Rad, Experion Munich, Germany) and analysed on a virtual gel (Experion, Bio-Rad, Germany). For the analysis of sequence homology of horse with human protamines, qPCR products were cloned and sequenced using standard Sanger protocols (SRD Biosciences, Bad Homburg, Germany). Sequence alignment was carried out using ClustalW 2.0.12 software (http://www.clustal.org/clustal2). Relative expression levels were expressed by DCt values which represent a measure of the log-ratio of the transcript abundances in the samples. The log-ratio of P2 and P1 is given by DCt = CtP2 CtP1 as described by Steger et al., 2008. Mare fecundity To appraise the fertility of the stallions, data from the breeding € t were obtained to determine the registry of the NRW Landgestu most often used measure of breeding success, the ‘non-returnrate 28’ (NNR28) percentage. This is defined as the percentage of mares which did not return within a period of 28 days after artificial insemination (Van Buiten et al., 1999). Statistics Analysis of data was performed using either Microsoft Excel 2010, Statistica 8 (Statsoft, USA) or Sigma Plot 10 (Systat Software Inc., San Jose, CA, USA) according to the rules described elsewhere (Lewis, 1984). The null hypothesis was rejected at p < 0.05. The normality of data distribution was evaluated by both the Shapiro–Wilk W test and the Kolmogorov–Smirnov Andrology, 2014, 2, 521–530
523
ANDROLOGY
A. Paradowska-Dogan et al.
one-sample test. If the hypothesis of normal distribution was rejected then the non-parametric Mann–Whitney U-test was applied and Spearman correlation coefficients for non-parametric variables were calculated. We assumed that r < 0.2 denoted a meaningless correlation, whereas values greater that 0.2 constituted a correlation warranting further investigation.
RESULTS
Table 3 Sperm DNA integrity Group
n
Mean DFI
DNA integrity 1 – low fertility 2 – reduced fertility 3 – high fertility Total
14 27 14 55
206.88 201.79 198.41 202.23
% high DFI
38.56 39.88 43.87 40.56
4.51 5.28 5.17 5.06
3.94 3.87 3.02 3.64
Data are presented as mean with standard deviation SD.
Evaluation of stallion sperm fertility parameters Based on the NRR28% (Van Buiten et al., 1999), stallions could be placed into one of three groups: low fertility (NRR28% = 20– 50%; n = 14), reduced fertility (NRR28% = 51–75%; n = 27) and high fertility (NRR28% = 76–100%, n = 14). No difference was found in the ages of the stallions across the groups (average 8.05 4.8 years), however, there were slight differences in sperm concentration (Table 1). Unexpectedly the animals in the low fertility group had the highest concentration, those with reduced fertility the lowest whereas those with the highest NRR28% rating had sperm concentrations between the two other levels. Only the difference between concentrations between the low and reduced fertility groups reached statistical significance (p = 0.022). However, the average of total sperm count was equal in all groups within the statistical error. Hence, the volume of ejaculates compensated the differences in sperm concentration. Morphometric examination of stallion spermatozoa (Table 2) showed that width, area and perimeter were similar across groups but found variations in the length of spermatozoa with those from the animals with low fertility (5.75 0.24 lm) being statistically longer than both those with reduced (5.58 0.22 lm, p = 0.036) and high fertility (5.57 0.23 lm; p = 0.049). No significant difference (p = 0.071) was found in sperm length between latter two groups. No differences were found in sperm nDNA integrity regardless of fertility grouping as both the mean DFI and the percentage of spermatozoa with nDNA damage (i.e.% high DFI) were similar for all animals assessed (Table 3).
Expression pattern of protamine-1 mRNA in stallion’s germ cells (in situ hybridization) mRNA expression of P1 was detectable in the cytoplasm of developing spermatids, appearing first during stage I of the spermatogenic cycle and being maintained during the different maturation events (Sa-Sd2) of spermatogenesis stages I-VII (Fig. 1). No staining of elongating spermatids still embedded in the seminiferous tubule or elongated spermatids released into the lumen (stage VIII) was observed. Expression of protamine-1 during equine spermatogenesis (IHC) Immunohistochemical localization showed P1 protein to be present in the nuclei of elongating spermatids and spermatozoa from stage III to VIII (Fig. 2). Beginning in spermatids of stages III and IV, P1 protein expression extended beyond the nucleus in stages V and VII where it was also found in the cytoplasm of elongating spermatids. During sperm release (stage VIII), P1 was found to be expressed in elongated spermatids and residual bodies, although the intensity of staining was diminished comparably to the earlier forms of these cells. This finding was probably as a result of high chromatin condensation and thus reduced access of the antibodies to the antigen. As P1 is highly specific for elongating spermatids and spermatozoa, it was not surprising that no immunohistochemical signal was detectable in testicular tissue missing these cell types. Specifically, in testicular samples from a horse with cryptorchidism, no staining was found because of the absence
Table 1 Ejaculate parameters Group
n
Volume (mL)
Stallion ejaculate parameters 1 – low fertility 2 – reduced fertility 3 – high fertility Total
14 27 14 55
33.92 44.33 46.57 42.25
Total sperm count (107)
Concentration (106/mL)
24.28 24.58 22.43 24.06
336.14 263.33 272.07 284.09
123.20a 88.58 64.54 96.90
11.72 11.18 10.30 11.09
4464 5122 6344 5233
Progressive motility (%)
33.11 59.64 26.73 60.29
7.31 12.98 4.715 12.50
Morphological defects (%)
33.11 28.03 26.73 28.97
7.341 5.023 4.715 6.039
Data are presented as mean with standard deviation. a1 vs. 2; p = 0.022.
Table 2 Morphometric analysis Group
n
Length (lm)
Sperm morphometry 1 – low fertility 2 – reduced fertility 3 – high fertility Total
14 27 14 55
5.75 5.58 5.57 5.62
0.24a 0.22 0.23b 0.24
Width (lm)
2.96 2.91 3.00 2.94
1.08 1.31c 1.30 1.28
Area (lm²)
14.03 13.35 13.70 13.61
0.7d 1.0 0.91 0.94
Perimeter (lm)
18.09 17.84 17.73 17.87
0.76 0.77 0.67 0.74
1 vs. 2; p = 0.036. b1 vs. 3; p = 0.049. c2 vs. 3; p = 0.034. d1 vs. 2; p = 0.029.
a
524
Andrology, 2014, 2, 521–530
© 2014 American Society of Andrology and European Academy of Andrology
ANDROLOGY
PROTAMINE EXPRESSION IN STALLION GERM CELLS
Figure 1 In situ hybridization indicating protamine-1 mRNA expression in horse testicular sections. P1 mRNA presence was found to be unique to spermatids specifically in their cytoplasm in stages I to VI. No staining of elongating spermatids in stage VII or elongated spermatids released into the lumen (stage VII) was observed. Scheme demonstrates stages of E. callabus spermatogenesis according to Johnson et al. (1990). A-spermatogonia type A; B-spermatogonia type B; pL-preleptotene spermatocytes; L-leptotene spermatocytes; P-pachytene spermatocytes; Z-zygotene spermatocytes; SII-spermatocytes II; Sa- round spermatids; Sb1-Sd2-spermatids in different maturation stages. Slides conterstained with haematoxilin. Primary magnification 940.
II
VII
VIII
I
VI
Rb Sd2 Sb1
Sb2
Sc
Sc Sd1
Sd1
Sd2 Sa
P
P
P
SII
Sa
Sa P
P
L
L
Z
Z
A
A
A
A
A
I
II
III
IV
V
Sa
A
P
P B
A
VI
pL A
B
VIII
VII
Figure 2 Immunochistochemical localization of protamine-1 protein showing stage-specific expression during equine germ cell differentiation. Expression of protamine-1 was detected in the nucleus of elongating spermatids in stages III-VIII and in residual bodies (Rb) present in stage VII. No expression was detected in spermatids in stage I and II. A-spermatogonia type A; B-spermatogonia type B; pL-preleptotene spermatocytes; L-leptotene spermatocytes; Ppachytene spermatocytes; Z-zygotene spermatocytes; SII-spermatocytes II; Sa- round spermatids; Sb1-Sd2-spermatids in different maturation stages. Slides conterstained with haematoxilin. Primary magnification 940.
III
I
VI
IV
VIII Rb Sd2
Sb1
Sb2
Sc
Sc Sd1
Sd1
Sd2 Sa
P
P
P
SII
Sa
L
L
Z
Z
A
A
A
A
I
II
III
IV
V
© 2014 American Society of Andrology and European Academy of Andrology
Sa
P
P
A
of spermatids in the seminiferous epithelium (Fig. S1). As no specific antibody for P2 is available the expression of this protein could not be assessed (Fig. S1).
Sa
A
P B
VI
A
pL B
VII
P
A
VIII
The time shift (i.e. 2 spermatogenic stages) between mRNA and protein expression was further corroborated by dual in situ hybridization and IHC data. P1 mRNA and protein were found to Andrology, 2014, 2, 521–530
525
ANDROLOGY
A. Paradowska-Dogan et al.
co-localize in spermatids from stages III to VI. Although P1 protein was detected in elongating spermatids and spermatozoa of stage VII and VIII, mRNA was not detected. The protamine-1/protamine-2 mRNA ratio from horse spermatozoa correlates with fertility parameters Using specific primer pairs aligned to horse genomic sequence (Fig. 3) qPCR produced amplification products for P1 and two variants of P2 (P2 and P3) in samples from both testicular tissue and ejaculated spermatozoa. Both controls: negative for protamines (i.e. prostate tissue) and positive for intact mRNA (i.e. b-actin) produced the expected results. The relative expression (Fig. 4) of P1 ranged from 10.1 to 8.6, P2 from 2 to 5.6 and P3 from 7.8 to 4.6. In contrast to the expression levels of the two P2 variants which were similar across the groups, the P1 expression of the low and high fertility animals were found to be statistically different (p = 0.019). As would be expected, this pattern was inversely reflected in the corresponding P2/P1 ratios. Namely, stallions with low fertility had the lowest P2/P1 ratio (1.5 4.5), those with reduced fertility had an increased level (3.7 4), whereas the high fertility group had a ratio (5.5 3.8) which was significantly higher (p = 0.016) than the low fertility animals. Further analysis showed that the P2/P1 ratio was significantly, positively correlated with fertility rate (i.e. NRR28% – r = 0.274; p < 0.05; Fig. 5C), sperm concentration (r = 0.263; p < 0.05; Fig. 5A) and significantly negatively correlated with the percentage of morphologically aberrant spermatozoa (r = 0.348; p < 0.05; Fig. 5B). The percentage of spermatozoa with abnormal morphology was also found to be positively correlated with P1 expression (r = 0.314; p < 0.05).
Figure 4 Protamine mRNA ratios in ejaculates of stallions divided into three groups according to NRR28%. (A) P2/P1 mRNA ratio calculated as log-ratio of P2 and P1 (DCt = CtP2 CtP1). Asterisk indicates statistically significant difference between stallions with high and low fertility (p = 0.019, nonparametric Mann–Whitney U-test) (B) P3 (P2-variant)/P1 mRNA ratio calculated as log-ratio of P3 and P1 (DCt = CtP3 CtP1) (C) P1 relative mRNA expression in stallion spermatozoa (high vs. low fertility p = 0.05; non-parametric Mann–Whitney U-test).
(A)
(B)
(C)
DISCUSSION Based upon standard semen parameters and mare pregnancy rates, stallion fertility can be classified into one of three categories: fertile (80–90% pregnancy rates), subfertile (
ISSN: 2047-2919
ORIGINAL ARTICLE
Correspondence: Agnieszka Paradowska-Dogan, Department of Urology, Pediatric Urology and Andrology, Section Molecular Andrology, Schubertstr. 81, 35392 Giessen, Germany. E-mail: Agnieszka. [email protected]
Protamine mRNA ratio in stallion spermatozoa correlates with mare fecundity
Keywords: in situ hybridization, protamines, seasonal breeding, semen analysis, stallion’s spermatogenesis, subfertility
1
Received: 20-Jan-2014 Revised: 26-Feb-2014 Accepted: 27-Feb-2014
A. Paradowska-Dogan, 2A. Fernandez, 3M. Bergmann, 3K. Kretzer, C.Mallidis, 1M. Vieweg, 1P. Waliszewski, 2M. Zitzmann, 1W. Weidner, 1 K. Steger and 2S. Kliesch 2
1 Department of Urology, Pediatric Urology and Andrology, Justus Liebig University of Giessen, Giessen, 2Centre of Reproductive Medicine and Andrology, University Clinic Muenster, Muenster, and 3Institute for Veterinary Anatomy, Histology and Embryology, Justus Liebig University of Giessen, Giessen, Germany
doi: 10.1111/j.2047-2927.2014.00211.x
SUMMARY Highly compacted sperm DNA in protamine toroids and a minor fraction of nucleohistones are prerequisites for the efficient transmission of the paternal genome into the oocyte at fertilization. The objective of this study was to evaluate whether protamines might serve as a prognostic factor for stallion fertility. In situ hybridization detected specific expression of P1 mRNA in the cytoplasm of stage I to VII spermatids, whereas comparable immunohistochemical stainings showed that protein expression was delayed till elongating spermatids in differentiation stages III to VIII. No staining was detectable in cryptorchid testis because of the lack of spermatids in the seminiferous tubules. Using quantitative real-time polymerase chain reaction, we identified mRNA transcripts of P1 and 2 variants of protamine- 2 (P2, P3) in ejaculated spermatozoa from 45 thoroughbred stallions. According to the mare fertility descriptor (i.e. the ‘none-return-rate 28 percentage’ or NRR28%), stallions were divided into three groups (i.e. high, reduced and low fertility). The P2/P1 mRNA ratio was found to be significantly reduced in the group with lower fertility (p = 0.016) and was slightly correlated with sperm concentration (correlation coefficient r = 0.263). Furthermore, morphologically abnormal sperm count negatively correlated with P2/P1 mRNA ratio, indicating that spermatozoa carrying head defects display a diminished protamine ratio (r = 0.348). Conversely, the P2/P1 ratio was positively correlated with mare fertility or NRR28% (r = 0.274). Interestingly, P3/P1 mRNA ratio remained unaltered in the investigated groups indicating that this variant plays a minor role in equine sperm chromatin compaction. Aberrant protamine transcripts content in equine spermatozoa was not associated with DNA defragmentation rate as measured by flow cytometric acridine orange test. On the basis of these results, we suggest that, similar to human, equine protamine expression constitutes a checkpoint of spermatogenesis and as a corollary the level of protamine mRNA may reflect the quality of spermatogenesis and spermatozoa’s fertilizing capacity.
INTRODUCTION Protamines are the sperm nuclear proteins which replace DNA-binding histones during late spermatogenesis. In contrast to histones, protamines are arginine-rich and positively charged, giving them an extreme affinity to the negatively charged DNA backbone. As a consequence, sperm chromatin is delivered to the zygote in a highly compacted and transcriptionally inactive form. Protamine-dependent packaging of paternal DNA within the spermatozoa and its subsequent deprotamination in the zygote represents a common feature of all mammalian species. While protamine-1 (P1) is present in all species analysed thus far and has been revealed to have high amino acid homology between bull (Mazrimas et al., 1986), boar (Tobita et al., 1983), © 2014 American Society of Andrology and European Academy of Andrology
la€ıche et al., 1987) and mouse (Bellv e et al., 1988), stallion (Be man (Ammer et al., 1986), protamine-2 is absent or expressed in low levels in bull and boar (Coeling et al., 1972; Tobita et al., 1982). Interestingly, while the bull and boar possess genes for both forms, they specifically express P1 (Maier et al., 1990; Queralt et al., 1995), that said some evidence of protamine-2 mRNA has been reported in mature bull spermatozoa (Lalancette et al., 2008; Bissonnette et al., 2009; Ganguly et al., 2013). It is known that the protamine-1 to protamine-2 protein ratio varies between different mammalian species, but is constant within a specific species. Aberrant protamine ratios have been demonstrated to be related to male infertility (Corzett et al., 2002). These data are corroborated by functional studies in Andrology, 2014, 2, 521–530
521
A. Paradowska-Dogan et al.
knockout mice, where it has been demonstrated that deletion of only one protamine allele – mimicking an aberrant protamine ratio – is sufficient to cause male infertility (Cho et al., 2001). In man, where most of the fertility-related protamine studies have been performed, subfertility has been correlated with either an abnormal persistence of histones (Silvestroni et al., 1976; Blanchard et al., 1990; Hofmann & Hilscher, 1991; Foresta et al., 1992; Zhang et al., 2006) or an aberrant protamine ratio (Balhorn et al., 1988; Belokopytova et al., 1993; De Yebra et al., 1998; Carrell & Liu, 2001; Mengual et al., 2003; Steger et al., 2003, 2008; Nasr-Esfahani et al., 2004; Aoki et al., 2005, 2006; De Mateo et al., 2007; Hammoud et al., 2009; Depa-Martynow et al., 2012; Rogenhofer et al., 2013). As the protamine ratio has been suggested a potential clinical parameter for the assessment of sperm fertilizing capacity, we wondered whether this is also applicable to the stallion. While in human spermatozoa, the relative proportion of protamine-1 to protamine-2 protein is regulated at approximately a 1 : 1 ratio (Balhorn et al., 1988), in stallion, the two variants of protamine-2 (P2 and P3) which have been found, constitute approximately 15% of the entire protamine content (Corzett et al., 2002). Furthermore, owing to similarities in protein length and amino acid composition, it has been suggested that these variants may be transcribed by homologous genes (Pirhonen et al., 1989). Similar to man, stallion fertility is gauged based upon the number, motility and morphology of spermatozoa(Jasko et al., 1992; Colenbrander et al., 2003) with the limit of normality being one billion morphologically normal and progressively motile spermatozoa per ejaculate (Kenney et al., 1983). The role of sperm motility in stallion fertility, however, remains controversial with claims ranging from no correlation (Voss et al., 1981; Dowsett & Pattie, 1982) to high correlation (Samper et al., 1991; Jasko et al., 1992). What is indisputable is that despite a sufficient number of progressively motile and morphologically normal spermatozoa, a high percentage of stallions are unable to achieve acceptable pregnancy rates. Consequently, there is a need for a suitable biomarker that reflects the sperm fertilizing potential and correlates with mare fecundity. This study, therefore, aims at investigating the expression pattern of protamine mRNA and protein during normal equine spermatogenesis and identifying any possible aberrations in subfertile stallions. Furthermore, we sought to identify any possible correlations between protamine mRNA ratio and semen parameters, DNA defragmentation rate and mare fecundity.
MATERIALS AND METHODS Animals The study was performed between March and September 2009 € t Warendorf, Gerat the Northrhine-Westfalian (NRW) Landgestu many, on 55 cross-bred stallions aged 3–18 years. Ejaculates were obtained in presence of a mare using a phantom (Klug, 1990). Testes samples were collected by routine castration from a total of 34 horses, ranging in age from 1 to 27 years. The castration was performed in the Clinic of Equine Surgery, Justus-Liebig University of Giessen. Specimen was fixed in Bouins solution, dehydrated and paraffin-embedded according to routine procedure. Sections (6 lm) were stained with haematoxilin and eosin 522
Andrology, 2014, 2, 521–530
ANDROLOGY and analysed. Stages of spermatogenesis were defined according to Johnson et al. (1990). Semen analysis Directly after ejaculation, semen analysis was performed at € fungsanstalt) of the the stallions0 s test institution (Hengstpru € t Warendorf, Germany. Sperm density was meaNRW Landgestu € b GmbH, Tiefensured by a photometer (SpermaCue, Minitu bach, Germany). Multiplication of sperm density with sperm volume resulted in total sperm count. Sperm motility was estimated using Nomarski technique (BX 60 by Olympus, Hamburg, € b GmbH, TieGermany) and an object table (HAT 400 by Minitu fenbach, Germany) heated to 38 °C. Based on three different fields of vision, spermatozoa were assessed as progressive motile, local motile or immotile using magnification 9200. For the analysis of sperm morphology, 10 lL ejaculate was streaked onto glass slides, air dried and stained according to the protocol of Papanicolaou. Subsequently, 2 9 200 sperm cells were assessed using magnification 9100 with sperm morphology being classified as normal (N), head defects (K), midpiece defects (M) and flagellum defects (S). Nicks between head and midpiece were classified as midpiece defects, nicks between midpiece and flagellum as flagellum defects. Separated sperm heads were classified as midpiece defects. Morphometric analyses were later performed on the same slides using the ISAS integrated semen analysis system version 1.0.19 (Proiser, Valencia, Spain) at the Centre of Reproductive Medicine and Andrology € nster. (CeRA), University Clinic Mu Sperm DNA integrity The flow cytometric version of the acridine orange test (FCAOT) was performed on thawed cryopreserved samples at the Centre of Reproductive Medicine and Andrology (CeRA), € nster as previously described (Evenson University Clinic Mu et al., 1999). Fluorescence data were acquired using a Cytomics FC 500 (Beckmann Coulter, Brea, CA, USA) from a total of 50 000 spermatozoa per sample and collected using the CXP Cytometry List Mode Data Acquisition & Analysis Software CXP Cytometer 2.2. Results were expressed as DNA fragmentation index (DFI) (FCS Express V 3.0 Research Edition). Protamine mRNA expression in testicular tissue In-situ hybridization was performed according to the protocol described by Steger et al. (1998) with several modifications. Based on sequence conservation of protamines in mammals, primers complementary to the human protamine-1 sequence were used to amplify the open reading frame of P1 from stallion testis complementary DNA (cDNA) (P1: forward primer: 50 -G CCAGGTACAGATGCTGTCGCAG-30 ; reverse: 50 - TTAGTGTCTA CATCTCGGTCTG-30 ; P2: forward primer: 50 - GTGAGGAGCCTG AGCGAACGC-30 ; reverse: 50 -TTAGTGCCTTCTGCATGTTCTCT TC-30 ). After 40 cycles of PCR, the resulting product was electrophoresed on a 1% agarose gel, eluted using the Taq PCR-Core Kit and cloned into the pGEM-T Vector, according to the manufacturer’s instructions (Promega, Heidelberg, Germany). After transformation of the E. coli XL1-Blue strain, mini preparations were performed (Qiagen, Hilden, Germany) and the plasmid clone DNA was sequenced at QIAGEN Genomic Services using SP6 and T7 primers. A DIG-labelled cRNA probe was produced using the previously described procedure (Steger et al., 1998; © 2014 American Society of Andrology and European Academy of Andrology
PROTAMINE EXPRESSION IN STALLION GERM CELLS
Hecht et al., 2009). Briefly, a 156 nt PCR product of stallion P1 was subcloned into pGEM-T (Promega), transformed into E. coli XL1-Blue strain (Stratagene, Heidelberg, Germany), cultured and then extracted by column purification (Qiagen). In vitro transcription of the DIG-labelled P1 was performed using the 109 RNA-DIG labelling mix (Roche, Mannheim, Germany) and RNA polymerases T3 and SP6. Vectors containing the protamine inserts were digested with NcoI and NotI (New England Biolabs, Frankfurt, Germany) for the production of sense and antisense cRNA respectively. Sections of testis from E. callabus were digested with proteinase K, post-fixed in 4% paraformaldehyde and incubated with the DIG-labelled sense or antisense cRNA probes (diluted 1 : 100 in hybridization buffer containing 50% deionized formamide, 10% dextran sulphate, 29 saline sodium citrate (SSC), 19 Denhardt’s solution, 10 mg/mL salmon sperm DNA and 10 mg/mL yeast tRNA). Hybridization was performed overnight at 37 °C in a humidified chamber containing 50% formamide in 29 SSC. Post-hybridization washes were performed, according to Lewis & Wells (1992). After blocking with 3% bovine serum albumin (BSA), sections were incubated with the anti-DIG Fab-antibody conjugated to alkaline phosphatase (Roche) overnight at 48 °C. Staining was visualized by developing sections with nitroblue-tetrazolium/5bromo-4-chloro-3-indolylphosphate in a humidified chamber protected from light. For each analysis, DIG-labelled cRNA sense probes were included as negative controls. Stage-specific analysis of equine spermatogenesis and protamine mRNA expression pattern was performed according to Johnson et al. (1990). Protamine protein expression in testicular tissue For immunohistochemistry, 6 lm sections were deparaffinized in xylene, hydrated through a graded series of ethanol, incubated in citrate buffer for 30 min at 98 °C then washed in 0.02 M PBS, pH 7.4. To make the antibody accessible to protamine antigens, the highly compacted chromatin was treated with the ‘decondensing’ mix established by Van der Heijden et al., 2006 (i.e. freshly prepared 25 mM dithiothreitol, 0.2% Triton X-100, 200 IU heparin/mL in PBS) for 10 min. Slides were then treated with 3% H2O2 in methanol for 30 min followed by washing in PBS containing 1.5% BSA for 20 min. Incubation followed with either monoclonal mouse anti-protamine-1 (Hub 1N; MAb-001) purchased from Briar Patch (Livermore, CA, USA) (dilution 1 : 1000 in DAKO Antibody Diluent) or anti-protamine2 (Hub 2B; MAb-002, Briar Patch, dilution 1 : 200 in DAKO Diluent). The slides were incubated overnight in a humidified chamber at 4 °C followed by application of DAKO EnVision System HRP (DAKO, Hamburg, Germany) for 30 min at room temperature. Finally, immunodetection was performed using the DAB reagent. Protamine ratio The ratio was determined at the Department of Urology, Paediatric Urology and Andrology, Justus Liebig University Giessen. Cryopreserved ejaculates were thawed and centrifuged for 10 min at 1000 g (4 °C). The supernatant was removed, pellet was washed with 1 mL PBS (pH 7.4) by centrifugation for 10 min at 1000 g (4 °C) and resuspended in 250 lL PBS. After mixing for 30 sec with UltraTurrax, 1 mL Trizol and 25 lL 0.1 M dithiothreithol (DTT) was added, the sample vortexed for 2 min © 2014 American Society of Andrology and European Academy of Andrology
ANDROLOGY and centrifuged for 5 min at 13 000 g (4 °C). The supernatant was then transferred into a new tube, 300 lL chloroform added, vortexed and incubated for 10 min at room temperature. After a further centrifugation (20 min at 13 000 g, 4 °C), the upper phase was transferred into new tube, 10 lL glycogen (2 mg/mL), 0.1 Vol% NaAc (3 M) and 1 Vol% isopropanol (20 °C) added, vortexed and incubated at 20 °C overnight. The following day the sample was again centrifuged (20 min at 13 000 g, 4 °C), the supernatant discharged and the pellet dissolved in 10–15 lL DEPC water. Digestion of DNA was then performed using RQ1 RNase-free DNase, according to the protocol of the manufacturer (Promega). First strand cDNA synthesis was carried out using iScript cDNA Kit (BioRad, Munich, Germany) and real-time quantitative PCR (qPCR) subsequently performed using SYBR Green Supermix, according to the protocol of the manufacturer (BioRad, Munich, Germany). Primer sequences used were as follows: P1 (GenBank Acc. No. NC009156) forward: 50 GGAGACGAAGAT GTCGCAG; reverse: 50 ACCTCAGGACAGTGTAGCGG 30 (81 bp product). P2: forward: 50 ACCGCCGGGAGCTACTAC30 ; reverse: 50 -GCCGTCTACGGAGCCTGT-30 (73 bp product). P3: forward 50 TCCTCCATGAAGAAGCTGGT-30 ; reverse: 50 - CTCCTCTTCCTCT GCCTCCT-30 (93 bp product). GAPDH (GenBank Acc. No. AF157626) forward: 50 GACTCCACAACATATTCAGC 30 ; reverse: 50 GACTCCACAACATATTCAGC 30 (77 bp product). b-actin (GenBank Acc. No. AF035774) forward: 50 ATCTGGGTCATCTTCTCG 30 ; reverse: 50 CACCACACCTTCTACAAC 30 (107 bp product). 18S rRNA (GenBank Acc. No. AJ311673) forward: 50 GCTATC AATCTGTCAATCCTGTCC 30 ; reverse: 50 ATGCGGCGGCGTTA TTCC 30 (107 bp product). Cycling conditions were as follows: 95 °C for 3 min; 40 cycles 95 °C for 30 sec, 60 °C for 30 sec, 72 °C for 1 min; 72 °C for 3 min. qPCR products were separated by capillary electrophoresis (Sensi Script Bio-Rad, Experion Munich, Germany) and analysed on a virtual gel (Experion, Bio-Rad, Germany). For the analysis of sequence homology of horse with human protamines, qPCR products were cloned and sequenced using standard Sanger protocols (SRD Biosciences, Bad Homburg, Germany). Sequence alignment was carried out using ClustalW 2.0.12 software (http://www.clustal.org/clustal2). Relative expression levels were expressed by DCt values which represent a measure of the log-ratio of the transcript abundances in the samples. The log-ratio of P2 and P1 is given by DCt = CtP2 CtP1 as described by Steger et al., 2008. Mare fecundity To appraise the fertility of the stallions, data from the breeding € t were obtained to determine the registry of the NRW Landgestu most often used measure of breeding success, the ‘non-returnrate 28’ (NNR28) percentage. This is defined as the percentage of mares which did not return within a period of 28 days after artificial insemination (Van Buiten et al., 1999). Statistics Analysis of data was performed using either Microsoft Excel 2010, Statistica 8 (Statsoft, USA) or Sigma Plot 10 (Systat Software Inc., San Jose, CA, USA) according to the rules described elsewhere (Lewis, 1984). The null hypothesis was rejected at p < 0.05. The normality of data distribution was evaluated by both the Shapiro–Wilk W test and the Kolmogorov–Smirnov Andrology, 2014, 2, 521–530
523
ANDROLOGY
A. Paradowska-Dogan et al.
one-sample test. If the hypothesis of normal distribution was rejected then the non-parametric Mann–Whitney U-test was applied and Spearman correlation coefficients for non-parametric variables were calculated. We assumed that r < 0.2 denoted a meaningless correlation, whereas values greater that 0.2 constituted a correlation warranting further investigation.
RESULTS
Table 3 Sperm DNA integrity Group
n
Mean DFI
DNA integrity 1 – low fertility 2 – reduced fertility 3 – high fertility Total
14 27 14 55
206.88 201.79 198.41 202.23
% high DFI
38.56 39.88 43.87 40.56
4.51 5.28 5.17 5.06
3.94 3.87 3.02 3.64
Data are presented as mean with standard deviation SD.
Evaluation of stallion sperm fertility parameters Based on the NRR28% (Van Buiten et al., 1999), stallions could be placed into one of three groups: low fertility (NRR28% = 20– 50%; n = 14), reduced fertility (NRR28% = 51–75%; n = 27) and high fertility (NRR28% = 76–100%, n = 14). No difference was found in the ages of the stallions across the groups (average 8.05 4.8 years), however, there were slight differences in sperm concentration (Table 1). Unexpectedly the animals in the low fertility group had the highest concentration, those with reduced fertility the lowest whereas those with the highest NRR28% rating had sperm concentrations between the two other levels. Only the difference between concentrations between the low and reduced fertility groups reached statistical significance (p = 0.022). However, the average of total sperm count was equal in all groups within the statistical error. Hence, the volume of ejaculates compensated the differences in sperm concentration. Morphometric examination of stallion spermatozoa (Table 2) showed that width, area and perimeter were similar across groups but found variations in the length of spermatozoa with those from the animals with low fertility (5.75 0.24 lm) being statistically longer than both those with reduced (5.58 0.22 lm, p = 0.036) and high fertility (5.57 0.23 lm; p = 0.049). No significant difference (p = 0.071) was found in sperm length between latter two groups. No differences were found in sperm nDNA integrity regardless of fertility grouping as both the mean DFI and the percentage of spermatozoa with nDNA damage (i.e.% high DFI) were similar for all animals assessed (Table 3).
Expression pattern of protamine-1 mRNA in stallion’s germ cells (in situ hybridization) mRNA expression of P1 was detectable in the cytoplasm of developing spermatids, appearing first during stage I of the spermatogenic cycle and being maintained during the different maturation events (Sa-Sd2) of spermatogenesis stages I-VII (Fig. 1). No staining of elongating spermatids still embedded in the seminiferous tubule or elongated spermatids released into the lumen (stage VIII) was observed. Expression of protamine-1 during equine spermatogenesis (IHC) Immunohistochemical localization showed P1 protein to be present in the nuclei of elongating spermatids and spermatozoa from stage III to VIII (Fig. 2). Beginning in spermatids of stages III and IV, P1 protein expression extended beyond the nucleus in stages V and VII where it was also found in the cytoplasm of elongating spermatids. During sperm release (stage VIII), P1 was found to be expressed in elongated spermatids and residual bodies, although the intensity of staining was diminished comparably to the earlier forms of these cells. This finding was probably as a result of high chromatin condensation and thus reduced access of the antibodies to the antigen. As P1 is highly specific for elongating spermatids and spermatozoa, it was not surprising that no immunohistochemical signal was detectable in testicular tissue missing these cell types. Specifically, in testicular samples from a horse with cryptorchidism, no staining was found because of the absence
Table 1 Ejaculate parameters Group
n
Volume (mL)
Stallion ejaculate parameters 1 – low fertility 2 – reduced fertility 3 – high fertility Total
14 27 14 55
33.92 44.33 46.57 42.25
Total sperm count (107)
Concentration (106/mL)
24.28 24.58 22.43 24.06
336.14 263.33 272.07 284.09
123.20a 88.58 64.54 96.90
11.72 11.18 10.30 11.09
4464 5122 6344 5233
Progressive motility (%)
33.11 59.64 26.73 60.29
7.31 12.98 4.715 12.50
Morphological defects (%)
33.11 28.03 26.73 28.97
7.341 5.023 4.715 6.039
Data are presented as mean with standard deviation. a1 vs. 2; p = 0.022.
Table 2 Morphometric analysis Group
n
Length (lm)
Sperm morphometry 1 – low fertility 2 – reduced fertility 3 – high fertility Total
14 27 14 55
5.75 5.58 5.57 5.62
0.24a 0.22 0.23b 0.24
Width (lm)
2.96 2.91 3.00 2.94
1.08 1.31c 1.30 1.28
Area (lm²)
14.03 13.35 13.70 13.61
0.7d 1.0 0.91 0.94
Perimeter (lm)
18.09 17.84 17.73 17.87
0.76 0.77 0.67 0.74
1 vs. 2; p = 0.036. b1 vs. 3; p = 0.049. c2 vs. 3; p = 0.034. d1 vs. 2; p = 0.029.
a
524
Andrology, 2014, 2, 521–530
© 2014 American Society of Andrology and European Academy of Andrology
ANDROLOGY
PROTAMINE EXPRESSION IN STALLION GERM CELLS
Figure 1 In situ hybridization indicating protamine-1 mRNA expression in horse testicular sections. P1 mRNA presence was found to be unique to spermatids specifically in their cytoplasm in stages I to VI. No staining of elongating spermatids in stage VII or elongated spermatids released into the lumen (stage VII) was observed. Scheme demonstrates stages of E. callabus spermatogenesis according to Johnson et al. (1990). A-spermatogonia type A; B-spermatogonia type B; pL-preleptotene spermatocytes; L-leptotene spermatocytes; P-pachytene spermatocytes; Z-zygotene spermatocytes; SII-spermatocytes II; Sa- round spermatids; Sb1-Sd2-spermatids in different maturation stages. Slides conterstained with haematoxilin. Primary magnification 940.
II
VII
VIII
I
VI
Rb Sd2 Sb1
Sb2
Sc
Sc Sd1
Sd1
Sd2 Sa
P
P
P
SII
Sa
Sa P
P
L
L
Z
Z
A
A
A
A
A
I
II
III
IV
V
Sa
A
P
P B
A
VI
pL A
B
VIII
VII
Figure 2 Immunochistochemical localization of protamine-1 protein showing stage-specific expression during equine germ cell differentiation. Expression of protamine-1 was detected in the nucleus of elongating spermatids in stages III-VIII and in residual bodies (Rb) present in stage VII. No expression was detected in spermatids in stage I and II. A-spermatogonia type A; B-spermatogonia type B; pL-preleptotene spermatocytes; L-leptotene spermatocytes; Ppachytene spermatocytes; Z-zygotene spermatocytes; SII-spermatocytes II; Sa- round spermatids; Sb1-Sd2-spermatids in different maturation stages. Slides conterstained with haematoxilin. Primary magnification 940.
III
I
VI
IV
VIII Rb Sd2
Sb1
Sb2
Sc
Sc Sd1
Sd1
Sd2 Sa
P
P
P
SII
Sa
L
L
Z
Z
A
A
A
A
I
II
III
IV
V
© 2014 American Society of Andrology and European Academy of Andrology
Sa
P
P
A
of spermatids in the seminiferous epithelium (Fig. S1). As no specific antibody for P2 is available the expression of this protein could not be assessed (Fig. S1).
Sa
A
P B
VI
A
pL B
VII
P
A
VIII
The time shift (i.e. 2 spermatogenic stages) between mRNA and protein expression was further corroborated by dual in situ hybridization and IHC data. P1 mRNA and protein were found to Andrology, 2014, 2, 521–530
525
ANDROLOGY
A. Paradowska-Dogan et al.
co-localize in spermatids from stages III to VI. Although P1 protein was detected in elongating spermatids and spermatozoa of stage VII and VIII, mRNA was not detected. The protamine-1/protamine-2 mRNA ratio from horse spermatozoa correlates with fertility parameters Using specific primer pairs aligned to horse genomic sequence (Fig. 3) qPCR produced amplification products for P1 and two variants of P2 (P2 and P3) in samples from both testicular tissue and ejaculated spermatozoa. Both controls: negative for protamines (i.e. prostate tissue) and positive for intact mRNA (i.e. b-actin) produced the expected results. The relative expression (Fig. 4) of P1 ranged from 10.1 to 8.6, P2 from 2 to 5.6 and P3 from 7.8 to 4.6. In contrast to the expression levels of the two P2 variants which were similar across the groups, the P1 expression of the low and high fertility animals were found to be statistically different (p = 0.019). As would be expected, this pattern was inversely reflected in the corresponding P2/P1 ratios. Namely, stallions with low fertility had the lowest P2/P1 ratio (1.5 4.5), those with reduced fertility had an increased level (3.7 4), whereas the high fertility group had a ratio (5.5 3.8) which was significantly higher (p = 0.016) than the low fertility animals. Further analysis showed that the P2/P1 ratio was significantly, positively correlated with fertility rate (i.e. NRR28% – r = 0.274; p < 0.05; Fig. 5C), sperm concentration (r = 0.263; p < 0.05; Fig. 5A) and significantly negatively correlated with the percentage of morphologically aberrant spermatozoa (r = 0.348; p < 0.05; Fig. 5B). The percentage of spermatozoa with abnormal morphology was also found to be positively correlated with P1 expression (r = 0.314; p < 0.05).
Figure 4 Protamine mRNA ratios in ejaculates of stallions divided into three groups according to NRR28%. (A) P2/P1 mRNA ratio calculated as log-ratio of P2 and P1 (DCt = CtP2 CtP1). Asterisk indicates statistically significant difference between stallions with high and low fertility (p = 0.019, nonparametric Mann–Whitney U-test) (B) P3 (P2-variant)/P1 mRNA ratio calculated as log-ratio of P3 and P1 (DCt = CtP3 CtP1) (C) P1 relative mRNA expression in stallion spermatozoa (high vs. low fertility p = 0.05; non-parametric Mann–Whitney U-test).
(A)
(B)
(C)
DISCUSSION Based upon standard semen parameters and mare pregnancy rates, stallion fertility can be classified into one of three categories: fertile (80–90% pregnancy rates), subfertile (
