Accepted Manuscript Protective effect of Satureja montana extract on cyclophosphamide-induced testicular injury in rats Azza M. Abd El Tawab, Nancy N. Shahin, Mona M. AbdelMohsen PII: DOI: Reference:

S0009-2797(14)00341-X http://dx.doi.org/10.1016/j.cbi.2014.11.001 CBI 7186

To appear in:

Chemico-Biological Interactions

Received Date: Revised Date: Accepted Date:

29 August 2014 23 October 2014 4 November 2014

Please cite this article as: A.M. Abd El Tawab, N.N. Shahin, M.M. AbdelMohsen, Protective effect of Satureja montana extract on cyclophosphamide-induced testicular injury in rats, Chemico-Biological Interactions (2014), doi: http://dx.doi.org/10.1016/j.cbi.2014.11.001

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

Manuscript (Un-highlighted Version)1 Protective effect of Satureja montana extract on cyclophosphamide-induced testicular injury in rats Azza M. Abd El Tawab a, Nancy N. Shahina, Mona M. AbdelMohsenb a

Biochemistry Department, Faculty of Pharmacy, Cairo University, Kasr El-Eini street, Cairo 11562, Egypt b

National Research Center, P.C. (12622), Dokki, Giza, Egypt

Abbreviations: ACP, acid phosphatase; ALP, alkaline phosphatase; 3β-HSD, 3βhydroxysteroid dehydrogenase; 17β-HSD, 17β-hydroxysteroid dehydrogenase; CP, cyclophosphamide; DAD, diode array detector; FasL, Fas ligand; Fe III-TPTZ, ferrictripyridyltriazine complex; FRAP, ferric reducing antioxidant power; FSH, follicle stimulating hormone; GC/MS, gas chromatography-mass spectrometry; γ-GT, gammaglutamyl transferase; G6PD, glucose-6-phosphate dehydrogenase; GPx, glutathione peroxidase; GR, glutathione reductase; GSH, reduced glutathione; GSSG, oxidized glutathione; H&E, hematoxylin and eosin; Hb, hemoglobin; iNOS, inducible nitric oxide synthase; LDH, lactate dehydrogenase; LH, luteinizing hormone; MDA, malondialdehyde; PI3K/Akt, phosphatidyl inositol-3-kinase/serine threonine kinase; PPAR-γ, peroxisome proliferator-activated receptor gamma; ROS, reactive oxygen species; RT-PCR, real time polymerase chain reaction; SDH, sorbitol dehydrogenase; TAC, total antioxidant capacity; TFC, total flavonoid content; TPC, total phenolic content 1

1

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

Abstract The present study investigated the protective effect of Satureja montana extract against cyclophosphamide-induced testicular injury in rats. Total phenolic and flavonoid contents of the extract were 1.03% and 0.34% w/w of dry herb expressed as chlorogenic acid and quercetin, respectively. HPLC analysis identified caffeic, syringic and rosmarinic acids as the chief phenolic acids, and rutin as the major flavonoid in the extract. Oral daily administration of Satureja montana extract (50 mg/Kg/day) for 7 days before and 7 days after an intraperitoneal injection of cyclophosphamide (200 mg/Kg) restored the reduced relative testicular weight, serum testosterone level and testicular alkaline phosphatase activity, raised the lowered testicular sorbitol dehydrogenase and acid phosphatase activities, and decreased the elevated testicular hemoglobin absorbance. It also attenuated lipid peroxidation, restored the lowered glutathione content, glucose-6-phosphate dehydrogenase, glutathione peroxidase and glutathione reductase activities, and improved total antioxidant capacity. Moreover, Satureja montana extract mitigated testicular DNA fragmentation, decreased the elevated Fas and Bax gene expression, up-regulated the decreased Bcl-2 and peroxisome proliferatoractivated receptor-gamma (PPAR-γ) gene expression and normalized Akt1 protein level. Histopathological investigation confirmed the protective effects of the extract. Conclusively, Satureja montana extract protects the rat testis against cyclophosphamide-induced damage via anti-oxidative and anti-apoptotic mechanisms that seem to be mediated, at least in part, by PPAR-γ and Akt1 up-regulation. Keywords: Satureja montana extract; Testis; Cyclophosphamide; Apoptosis; Peroxisome proliferator-activated receptor-gamma; Akt1

2

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

1. Introduction Satureja montana L., commonly known as winter savory or mountain savory, is a perennial shrub (20–30 cm high) with white flowers and small rough leaves belonging to the Lamiaceae family and is native to the Mediterranean region. Satureja montana is an aromatic culinary and medicinal plant [1]. Phytochemical investigations demonstrated the presence of many biologically active constituents in Satureja montana accounting for its medicinal values such as the monoterpenes carvacrol, p-cymene, γ-terpinene and thymol in the essential oil, rosmarinic acid, triterpenes, flavonoids and caffeic acid [2,3]. The whole plant, its essential oil and extracts are used in traditional medicine for their stomachic, digestive, carminative, expectorant, aphrodisiac, bactericidal and fungicidal activities [1]. In addition to being traditionally used as an aphrodisiac remedy, recently, Satureja montana could be considered as a natural remedy for the treatment of premature ejaculation. Furthermore, its reported ability to raise the serum level of testosterone confirms its positive influence on male sexual function [3]. However, to our knowledge, there are no reports regarding a potential protective effect of Satureja montana against testicular injury. Oxidative stress is a key factor in the etiology of male infertility, and peroxidative damage is currently regarded as the single most important cause of impaired testicular function in a wide range of testicular stresses. Increased testicular oxidative stress can cause changes in the dynamics of testicular microvascular blood flow and endocrine signaling leading to an increase in germ cell apoptosis and subsequent hypospermatogenesis [4]. Germ cell apoptosis is a significant process even in conventional spermatogenesis, but the process is up-regulated in testicular stress conditions [5]. There is a prominent role for the mitochondrial pathway in germ cell apoptosis, where associations between pro-apoptotic and anti-apoptotic members of the Bcl-2 family (e.g. Bax and Bcl-2, respectively) are altered, 3

allowing the release of cytochrome c and the eventual activation of a caspase cascade, which 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

ultimately results in DNA fragmentation [6]. The Fas system is also a key regulator of germ cell apoptosis in the testis. This is a pathway involving Fas ligand (FasL) and Fas, members of the TNF superfamily of ligands and receptors [7]. FasL is secreted by Sertoli cells, and its receptor, Fas, is on the germ cell membrane. Fas-FasL binding initiates the intracellular “death domain” pathway, which, like the mitochondrial pathway, eventually leads to DNA degradation via the caspase cascade [4]. Important regulatory pathways of testicular homeostasis also include the peroxisome proliferator-activated receptor-gamma (PPAR-γ) [8] and phosphatidyl inositol-3-kinase/serine threonine kinase (PI3K/Akt) [9] signaling systems. Cyclophosphamide (CP) is an alkylating agent that has been widely used in the acute treatment of various neoplastic diseases and in the chronic treatment of autoimmune disorders. The major limitation of CP chemotherapy is the injury of normal tissue, leading to multiple organ toxicity mainly in the testes, heart and urinary bladder [10]. The therapeutic and toxic effects of CP are mediated by its active metabolites phosphoramide mustard and acrolein [11]. Phosphoramide mustard acts by the formation of a positively charged reactive intermediate that irreversibly binds to DNA causing intra- and interstrand cross-linkages, leading to DNA strand breaks, the inability to synthesize DNA, and ultimately cell death, which is a major anticancer mechanism of CP. Acrolein, which inactivates the DNA repair protein O6-methylguanine-DNA methyltransferase, also partially contributes to the cellular toxicity of CP [11]. The cytotoxicity of CP to rapidly dividing cells makes the highly proliferative testes a target for the damaging effects of this drug. A number of reports described the adverse effects of CP on fertility in humans and animals. Male patients treated with CP develop oligospermia and azospermia [12]. In rodents, administration of CP leads to decreased testicular weight, transitory oligospermia, decreased DNA synthesis in spermatogonia and protein synthesis in 4

spermatids [13]. Cyclophosphamide-induced testicular toxicity is considered an important 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

model combining major oxidative and apoptotic alterations [14]. Therefore, this model was adopted in the present study as a representative of the deregulated redox homeostasis and germ cell survival/apoptosis occurring in a wide range of testicular stresses. There are several reports on the benefit of antioxidants in protecting male reproductive system from deleterious effects of reactive oxygen species (ROS) generated during CP exposure [10,15]. Among natural antioxidants, phenolic compounds, such as caffeic acid, rosmarinic acid and the monoterpenes abundant in Satureja montana, are well known for their protective potential against ROS overproduction though direct and indirect antioxidant mechanisms [16,17]. Therefore, the present study was designed to investigate, for the first time, the protective effect of Satureja montana extract against CP-induced testicular injury in rats, following the quantification of total phenolics, total flavonoids and individual phenolic compounds in the extract. This study is an attempt to introduce a relatively safe approach to alleviate the almost inevitable consequence of CP therapy.

5

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

2. Materials and methods 2.1.

Plant material Seeds of Satureja montana were obtained from the HEM ZADEN B.V - P.O. Box 4 -

1606 ZG Venhuizen - The Netherlands. Seeds were sown in the nursery under the natural conditions of the greenhouse of the National Research Center, Giza, Egypt, on November 25th, 2011.

On February 10th, 2012, uniform seedlings were transplanted into the

experimental farm of the Faculty of Pharmacy, Cairo University, Giza, Egypt, which represents clay-loamy soil. The fresh herb was collected at the end of July, 2012. The herb was air-dried in a room (under shade) for three weeks.

2.2. Preparation of plant extract A hydroalcoholic extract of Satureja montana was prepared by placing the dried aerial parts of the plant (250 g) in 80% ethanol (Sigma-Aldrich Chemicals Co., St. Louis, MO, USA) containing 1% hydrochloric acid (1Lx3 times) at room temperature with the aid of sonication. The combined alcoholic extracts were filtered and evaporated to dryness under vacuum at 45ºC. The crude alcoholic extract was subjected to quantitative estimation of the total phenolic and flavonoid contents as well as HPLC analysis.

2.2.1. Determination of total phenolic content (TPC) The Folin-Ciocalteu method was used to determine total phenolic content (TPC) [18]. The absorbance was measured at 725 nm, and chlorogenic acid (Sigma-Aldrich Chemicals Co., St. Louis, MO, USA) was used as a standard to produce the calibration curve. The results were expressed as chlorogenic acid equivalents mg/100 g of dry herb weight.

6

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

2.2.2. Determination of total flavonoid content (TFC) The total flavonoid content (TFC) was determined according to the colorimetric assay of Chang et al. [19] using a calibration curve with quercetin (Sigma-Aldrich Chemicals Co., St. Louis, MO, USA) as standard. Absorbance was measured at 510 nm. Results were expressed as quercetin equivalents mg/ 100 g of dry herb weight.

2.2.3. Quantification of phenolic compounds by HPLC analysis Phenolic acid and flavonoid standards were quantified by preparing in methanol solution (HPLC grade, Merck, Germany), and serial dilutions were carried out by doubledistilled water. Various standard concentrations were injected into HPLC system to establish standard calibration curves. Analyses were developed by HPLC system (Agilent Technologies,Waldbronn, Germany, modular model 1200 series instrument), equipped with Eclipse DB- C18 column (5 µm, 4.6 x 250 mm i.d.) according to Neo et al. [20]. A mobile phase was prepared consisting of acidified water and acetonitrile in the ratio of 90:10 (v/v), at a flow rate of 1 ml/min. Detection was done using a diode array detector (DAD) at 280 and 320 nm and the chromatographic data analyses were done using Chemstation soft-ware. Quantitation in each gram of sample was carried out using external standard method. The amount of each phenolic compound was expressed as micrograms per gram of dry plant weight (µg/g).

2.3. Animals Male Wistar albino rats weighing 170-200 g were used for the study. Rats were allowed free access to commercial pellet diet and water throughout the experimental period. All animal experiments were conducted in accordance with the approval of the Ethical Committee for Animal Experimentation at Faculty of Pharmacy, Cairo University and

7

conformed to the Guide for the Care and Use of Laboratory Animals published by the US 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

National Institutes of Health (NIH Publication No. 85-23, revised 1996).

2.4.

Experimental design After one week of acclimatization, rats were randomly divided into four groups.

Group I (n =18) served as the normal control. Group II rats (n = 17) were treated with Satureja montana extract daily for 14 consecutive days. The extract was suspended in 0.5% xanthan gum and was administered orally through an intragastric tube at a dose of 50 mg/Kg/day [3]. Group III rats (n = 20) were injected intraperitoneally with a single dose of CP (Endoxan®, Baxter Oncology GmbH, Frankfurt, Germany), 200 mg/Kg, dissolved in saline [10]. In Group IV (n = 20), rats were co-treated with CP (as in group III) and the extract (as in group II). The extract was administered daily for 7 days prior to CP administration and was continued daily for 7 more days after CP administration. Groups I and III received the vehicle of the extract orally for the same period of time (14 days).

2.5.

Tissue sampling At the end of the experimental period and 24 h after the last dose of the extract, body

weight was determined and rats were sacrificed by cervical decapitation after an overnight fast. Blood samples were collected and centrifuged to separate serum, which was kept at 30oC until testosterone, luteinizing hormone (LH) and follicle stimulating hormone (FSH) were assayed. Both testes were excised, dissected free of surrounding connective tissue, and rinsed in ice-cold saline. One whole testis was weighed and homogenized in ice-cold doubledistilled water to give a 10% homogenate. A suitable aliquot of homogenate was mixed with Tris-HCL buffer (0.01 mol/L, pH 7.4) and ultracentrifuged at 10,000 ×g at 4oC for 30 min

8

using Dupont Sorvall (Wilmington, DE) ultracentrifuge. The resulting supernatant was used 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

for the estimation of glucose-6-phosphate dehydrogenase (G6PD), glutathione peroxidase (GPx), glutathione reductase (GR), sorbitol dehydrogenase (SDH), lactate dehydrogenase (LDH), gamma-glutamyltransferase (γ-GT), acid phosphatase (ACP), alkaline phosphatase (ALP) activities as well as protein levels and the total antioxidant capacity (TAC). Glutathione (GSH) levels in testes were estimated in a second deproteinized aliquot of the homogenate. A third aliquot was mixed with 2.3% KCl, centrifuged at 600 ×g and the resulting supernatant was used for the determination of malondialdehyde (MDA) level, an end product of lipid peroxidation. To determine the extent of CP-induced testicular hemorrhage, a fourth aliquot of the homogenate was mixed with 10 ml of 5 mM Tris-HCL, pH 7, containing 1 mM MgCl 2 and 100 mM CaCl2. The homogenate was centrifuged at 600 ×g for 30 min. The obtained supernatant was used for the determination of hemoglobin (Hb) absorbance. Apoptosis was estimated by determination of PPAR-γ, Fas, Bax and Bcl-2 gene expression as well as Akt1 protein level, and by the detection of DNA fragmentation (DNA ladder formation). Hence, the other testis was weighed, cut into small pieces, subsequently frozen in liquid nitrogen and stored at -70°C for DNA and RNA analyses.

2.6. Biochemical investigations 2.6.1. Oxidative stress markers Glucose-6-phosphate dehydrogenase activity was determined by estimating the rate of reduction of NADP+ at 340 nm, utilizing glucose-6-phosphate as a substrate [21]. Glutathione peroxidase activity was assayed by monitoring the rate of GSH oxidation by hydrogen peroxide in presence of NADPH as a decrease in absorbance at 340 nm [22]. Glutathione

9

reductase that converts oxidized glutathione (GSSG) to the reduced form (GSH) was assayed 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

by measuring the decrease in absorbance at 340 nm due to the oxidation of NADPH [23]. The concentration of GSH was determined chemically using 5,5’-dithionitrobenzoic acid [24]. Malondialdehyde, the end product of lipid peroxidation, reacts with thiobarbituric acid to generate a colored product that can be measured colorimetrically [25]. The total antioxidant capacity of testicular tissue was measured by using the ferric reducing antioxidant power (FRAP) assay method [26]. It measures the ferric reducing ability of antioxidants in various samples. At low pH, the ferric-tripyridyltriazine complex (FeIIITPTZ) is reduced to the ferrous (Fe II) form by the antioxidant. This reaction produces an intense blue color with the absorption maximum at 593 nm. The intensity of the color is proportional to the antioxidant capacity of the sample.

2.6.2. Assay of serum testosterone, LH and FSH levels Levels of serum testosterone, LH and FSH were measured by using automated chemiluminescence immunoassay systems (ADVIA Centaur, Bayer Vital, Fernwald, Germany).

2.6.3. Testicular markers Sorbitol dehydrogenase activity was assayed based on interconversion of D-sorbitol and D-fructose [27]. Lactate dehydrogenase activity was measured by using a commercially available kit provided by Stanbio (San Antonio, TX, USA) based on the interconversion of pyruvate and lactate [28]. Gamma-glutamyltransferase activity was determined using a kit provided by Quimica Clinica Aplicada (Amposta, Tarragona, Spain) employing a kinetic method which measures the rate of liberation of 5-amino-2-nitrobenzoate from L-gammaglutamyl-3-carboxy-4-nitroanilide at 405 nm [29].

10

Activities of ACP and ALP were estimated by using the kits supplied by Quimica 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

Clinica Aplicada (Amposta, Tarragona, Spain) and Biolabo SA (Maizy, France). The assay depends on the hydrolysis of p-nitrophenyl-phosphate in acid and alkaline medium, respectively. The liberated p-nitrophenol is quantified spectrophotometrically at 420 nm [30,31]. Protein levels were determined using Folin-Ciocalteu reagent with bovine serum albumin as standard [32]. A 1 ml aliquot of the previously mentioned testicular supernatant in tissue sampling was diluted in 5 ml buffer. Then, the absorbance of Hb at 405 nm was determined [33].

2.6.4. Apoptotic markers and apoptosis-related parameters 2.6.4.1. Determination of PPAR-γ, Fas, Bax and Bcl-2 gene expression using quantitative real time PCR (RT–PCR) Total RNA was extracted from testicular tissue using the SV Total RNA extraction kit (Promega, Madison USA). Concentration of the extracted RNA was quantified by measuring the absorbance at 260 nm, and RNA integrity was verified on an agarose gel electrophoresis stained with ethidium bromide. The cDNA was synthesized using random primers (250 ng/μl), dNTP (10 mmol/l) and the SuperScript II Reverse Transcriptase Kit (Invitrogen). Real-time quantitative PCR was conducted using the 7500 Real Time PCR System and the Sybr Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) with 200 ng of each primer. Primer sequences are shown in Table 1.

PCR reactions consisting of 95°C for 10 min (1 cycle), 94°C for 15 s, and 60°C for 1 min (40 cycles) were performed on step one plus Real Time PCR system (Applied Biosystems). Data were analyzed and quantified using the v1·7 Sequence Detection Software from PE Biosystems (Foster City, CA, USA). Relative expression of the studied genes was

11

calculated using the comparative threshold cycle method. All values were normalized to the 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

β-actin gene [34].

2.6.4.2. Determination of Akt1 protein level Akt1 protein level was measured by an ELISA kit supplied by Ray Biotech. Inc. (Norcross, USA) according to manufacturer’s instructions. 2.6.4.3. Gel electrophoresis of DNA High-molecular-weight DNA was extracted from frozen tissue samples as described by

Yanamandra

and

Lee

[35].

The

concentration

of

DNA

was

measured

spectrophotometrically at 260 nm. Aliquots of DNA samples (20 μg/lane) were separated on a 2% agarose gel and stained with ethidium bromide. The DNA in the gel was visualized and photographed under UV light.

2.7.

Histopathological studies Immediately after sacrifice, sections of the testis were fixed in 10% formalin and were

embedded in paraffin wax. Sections were cut at 5-μm thickness, deparaffinized and stained with hematoxylin and eosin (H&E). The sections were then viewed through the light microscope for histopathological changes [36].

2.8.

Statistical analysis The values are expressed as mean ± standard error of the mean (SEM) for eight

animals. Differences between groups were assessed by one-way analysis of variance (ANOVA). Tukey-Kramer test was performed for inter-group comparisons. Statistical tests were performed using Graphpad Instat 2.04 statistical package. A p-value < 0.05 was considered significant. 12

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

3. Results 3.1.

TPC, TFC and HPLC analysis of Satureja montana extract (Table 2,

Figure 1) The results showed that the value of the TPC of Satureja montana was 1030 mg chlorogenic acid equivalents/100 g dry weight and the TFC measured was 340 mg quercetin equivalents/100 g dry weight. Seven phenolic acids were identified using HPLC, namely gallic acid, caffeic acid, syringic acid, vanillic acid, ferulic acid, rosmarinic acid and cinnamic acid. The amounts of individual phenolic acids were calculated as shown in Table 2 and Figure 1. Major acids found were caffeic, syringic and rosmarinic, and all the seven phenolic acids identified are known to be hydrophilic antioxidants. Three flavonoid compounds were identified using HPLC, namely rutin (major), luteolin and quercetin; their amounts were calculated as shown in Table 2 and Figure 1. Moreover, the volatile oil content of Satureja montana extract has been analyzed by gas chromatography-mass spectrometry (GC/MS) in a previous work [37] and the results revealed the presence of carvacrol as the major component (79.75%).

3.2.

Effect of Satureja montana extract, CP and Satureja montana extract

+ CP on body weight, testicular weight, and relative testicular weight (Table 3) Tables 3-7 show that daily administration of Satureja montana extract (group II) had no effect on all measured parameters as compared to the control group (group I). Table 3 shows that CP caused a significant reduction in body weight, testicular weight and relative testicular weight when compared with the control group. Concurrent treatment with Satureja montana extract (group IV) had no significant effect on body weight, whereas a significant

13

increase in testicular weight was observed as compared to the CP-administered group. In 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

addition, Satureja montana reverted the reduced relative testicular weight to almost normal when compared with the control group.

3.3.

Effect of Satureja montana extract, CP and Satureja montana extract

+ CP on oxidative stress markers of the testicular tissue (Table 4) Oxidative damage induced by CP in testicular tissue was manifested by a significant reduction in the activities of G6PD, GPx, GR and the levels of GSH and TAC. In addition, CP caused a significant increase in the levels of MDA and NO when compared with the control group. Co-treatment with Satureja montana effectively increased the activities of G6PD, GPx and GR as well as GSH level toward normalcy, whereas no significant change was detected in the level of NO as compared with the CP-treated group. Moreover, the Satureja montana + CP group showed a significantly lower MDA level and a significantly higher TAC when compared with the CP-treated group.

3.4.

Effect of Satureja montana extract, CP and Satureja montana extract + CP on the levels of serum testosterone, LH and FSH (Table 5) A significant decrease was shown in serum levels of testosterone, LH and FSH in the

CP-treated group. Co-administration of Satureja montana extract succeeded in normalizing the reduced serum testosterone level observed in the CP-treated group. However, it had no significant effect on serum LH and FSH levels.

14

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

3.5.

Effect of Satureja montana extract, CP and Satureja montana extract

+ CP on testicular marker enzymes and Hb absorbance (Table 6) Compared with the control group, testicular SDH, LDH, ACP and ALP activities showed significant decreases in the CP-treated group, whereas γ-GT activity as well as Hb absorbance were significantly increased. Satureja montana produced marked effects in the testes of CP-treated rats, as demonstrated by the restoration of the reduced ALP activity toward normalcy and a significant increase in the decreased activities of SDH and ACP. Moreover, a significant decrease was observed in the CP-elevated Hb absorbance. However, no significant change was detected in the activities of LDH and γ-GT as compared with the CP-treated group.

3.6.

Effect of Satureja montana extract, CP and Satureja montana extract

+ CP on PPAR-γ, Fas, Bax and Bcl-2 gene expression and Akt1 protein level (Table 7) Administration of CP caused significant increases in the mRNA gene expression levels of Fas and Bax along with significant decreases in Bcl-2 and PPAR-γ mRNA gene expression as well as Akt1 protein level in the testes when compared with the control group. Co-administration of Satureja montana resulted in marked anti-apoptotic effects as demonstrated by significant down-regulation of the elevated Fas and Bax gene expression and significant elevation of the reduced Bcl-2 and PPAR-γ gene expression as compared to the CP-treated group. In addition, it effectively normalized Akt1 protein level that was lowered by testicular damage in the CP group.

15

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

3.7.

DNA ladder formation (Figure 2) To assess the involvement of apoptosis in germ cell loss after CP administration,

DNA was extracted from rat testes and was analyzed for the appearance of the DNA ladder on agarose gel electrophoresis (Figure 2). Necrotic strand breaks/streaking DNA were observed as a result of testicular damage in the CP-administered group, but not in testes treated with the extract either alone or with CP.

3.8.

Histopathological findings (Figure 3) Histopathological

examination

supported

the

present

biochemical

findings.

Photomicrographs a and b in Figure 3 (H&E) show normal architecture of mature active seminiferous tubules with complete spermatogenic series (S). Photomicrographs c and d (Figure 3c and d) show no histopathological alteration in the testes of rats treated only with the extract. Photomicrographs e and f (Figure 3e and f) display the testes of rats in the CPadministered group showing atrophy, degeneration (ds), loss of spermatogenesis in most of the seminiferous tubules and homogenous eosinophilic material with edema replacing the interstitial Leydig cells. Testes from the extract + CP-co-treated group (Figure 3g and h) show nearly normal mature active seminiferous tubules with complete spermatogenic series.

16

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

4. Discussion To the best of our knowledge, the present study is the first to investigate the influence of Satureja montana extract on experimentally-induced testicular injury. The results revealed that Satureja montana extract restored the reduced serum testosterone level, the endogenous antioxidant enzyme activities as well as the non-enzymatic scavenger (GSH) in CP-treated rats. It also suppressed lipid peroxidation and significantly enhanced the lowered TAC and most of the decreased testicular marker enzyme activities. Moreover, CP-administered rats treated with Satureja montana extract exhibited mitigated DNA fragmentation in the testis associated with amelioration of the altered apoptotic markers. The current findings indicate that Satureja montana extract can significantly protect the rat testis from CP-induced damage. Its protective mechanisms might be linked with its anti-oxidative and anti-apoptotic properties and seem to be mediated, at least in part, by PPAR-γ and Akt1 up-regulation. In the present study, testicular weight, a valuable index of reproductive toxicity in male animals, showed a significant decrease in CP-treated rats that is consistent with previous work [13]. A reduction in the weight of the testis may be attributed to reduced availability of androgens and decreased sperm production [13], as is evident in the present study from observations of lowered serum testosterone level and disrupted spermatogenesis, respectively. In addition, reduction in body weight is indicative of drug toxicity and impaired general metabolic functions [13]. Co-administration of Satureja montana extract in CPtreated rats significantly increased testicular weight and restored the relative testicular weight compared to the CP group. This effect could be ascribed to the ability of the extract to restore serum testosterone level and to improve spermatogenesis as observed by histopathological examination.

17

In accordance with previous work [10], CP administration induced a state of oxidative 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

stress in the rat testis, demonstrated by enhanced lipid peroxidation and compromised antioxidant defense system revealed by decreased TAC and GSH levels with concomitant reduction in G6PD, GPx and GR activities. Oxidative stress is the result of an imbalance between ROS generation and the intracellular capacity for removing ROS, subsequently leading to excessive damage in the cell [16]. Increase in testicular ROS level was previously reported in CP-treated rats [15]. Spermatozoa are particularly susceptible to ROS-induced injury and peroxidative damage because of their high concentrations of polyunsaturated fatty acids and low antioxidant capacity [38]. Reduced glutathione plays an important role in scavenging ROS by the formation of oxidized glutathione (GSSG) and other disulfides. Increased oxidative stress enhances the formation and efflux of GSSG, and GR mediates the reduction of GSSG to GSH. This reduction reaction requires the reduced form of nicotinamide adenine dinucleotide phosphate, which is supplied by the enzyme G6PD in the pentose phosphate pathway. Glucose-6phosphate dehydrogenase activity was lowered in the CP group, which decreases the availability of NADPH. This, in turn, reduces GR activity, provokes increase in oxidative stress to tissues and may lead to cell death [39]. The activity of GPx, which is another constituent of GSH redox cycle, also showed a significant decrease after CP administration. All these events eventually lead to an imbalance in the GSSG/GSH redox couple. Glutathione peroxidase is the principal enzyme responsible for H2O2 elimination in the testis [40]. Therefore, the decrease in its activity might predispose testicular tissue and sperms to increase in H2O2-induced damage. Glucose-6-phosphate dehydrogenase is also a key enzyme of the testicular tissue that provides reducing equivalents for the hydroxylation of steroids. The decreased testicular TAC level may indicate deficiency of testicular ascorbic acid as ascorbic acid contributes a major part to TAC in the FRAP assay. The reduction of testicular 18

ascorbic acid content in CP-treated rats was previously reported [41]. Decreased GSH content 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

might also reflect a decreased concentration of ascorbic acid, which enters the cell mainly in the oxidized form where it is reduced by GSH. The normalization of testicular GSH content as well as G6PD, GPx and GR activities, in addition to the significant alleviation of lipid peroxidation and elevation in TAC level in extract-CP co-treated rats reveal the marked antioxidant potential of the extract. In vitro studies demonstrated that Satureja montana herb possesses high lipid peroxidation inhibitory activity [2], radical scavenging activity and total antioxidant capacity [16,17]. The antioxidant properties of the herb could be attributed mostly to its rutin [42], caffeic acid [2], syringic acid [43] and rosmarinic acid [16] contents. Most importantly, the antioxidant potential of rutin, the major flavonoid identified in our extract, was previously demonstrated in CP-induced testicular injury in rats [42]. The decline in serum testosterone level after CP treatment is consistent with previous reports [10,44]. Increased generation of free radicals is a possible mechanism involved in CPinduced Leydig cell degeneration, as revealed in our histopathological findings, resulting in marked reduction of serum testosterone. An increase in oxidative stress causes ROS-induced damage to macromolecules such as DNA, protein and key enzymes involved in testicular steroidogenesis and spermatogenesis [45]. Indeed, CP-induced lipid peroxidation and decrease in plasma testosterone level were reportedly associated with a significant decline in testicular activities of 3β-hydroxysteroid dehydrogenase (3β-HSD) and 17β-hydroxysteroid dehydrogenase (17β-HSD), the key enzymes responsible for the regulation of testosterone biosynthesis [44]. Therefore, the restoration of serum testosterone level observed upon coadministration of Satureja montana is most likely due to its antioxidant effect and the restoration of testicular GPx activity. Rutin, a major component in our extract, was previously shown to increase CP-lowered testicular activities of 3β-HSD and 17β-HSD in rats [42]. It is

19

worthy to note that Satureja montana extract was previously reported to increase serum 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

testosterone concentration in sexually potent male rats [3]. A possible explanation for the observed low serum levels of gonadotrophins is the activation of the stress signal pathway and the hypophyseal-adrenocortical axis under stress induced by administration of anticancer drugs. This leads to elevated secretion of corticosterone, which may suppress the sensitivity of gonadotrophic cells to gonadotrophinreleasing hormone [46]. Activities of the testicular marker enzymes SDH, LDH, γ-GT, ACP and ALP are considered functional indicators of spermatogenesis [10]. Sorbitol dehydrogenase is primarily associated with pachytene spermatocyte maturation of the germinal epithelium. Its activity correlates with the function of germ cells and decreases during the depletion of germ cells [47]. It is also responsible for providing energy to sperm cells by converting sorbitol to fructose. Decreased SDH activity after CP treatment in our study suggests an altered cellular physiology of the germinal elements in the seminiferous tubules. The decline in LDH activity represents a defect in spermatogenesis and testicular maturation [48]. It was reported that FSH stimulates pyruvate and lactate production in the rat Sertoli cells and this is a ratelimiting factor for germ cell activities [49]. Therefore, the lowered FSH level in the current study may account for the decline in LDH activity. Moreover, a unique testis and spermspecific LDH isoenzyme, LDH-X, was found to be located in the inner mitochondrial membrane of the spermatogenic cells of the mature and developing testis. This isoenzyme plays an important role in maintaining the redox balance during spermatozoal metabolism [50]. Cyclophosphamide was reported to induce lipid peroxidation in the mitochondria of rat testis [41], which may result in disintegration of the mitochondrial membrane ultrastructure. This, in turn, can affect the membrane-bound LDH activity. Gamma-glutamyltransferase is an index of Sertoli cell function, and its activity parallels Sertoli cell maturation and 20

replication [51]. The marked increase in γ-GT activity in CP-treated rats in our study 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

indicates impaired Sertoli cell function and spermatogenesis, manifested by the histologically observed atrophy, degeneration and impairment of spermatogenesis in most of the seminiferous tubules. A similar pattern of alterations in testicular SDH, LDH and γ-GT activities in CP-treated rats was reported by Selvakumar et al. [15]. The decreased activities of ACP and ALP in CP-administered animals were previously reported, and may reflect the release of these non-specific phosphatases from the lysosomes of the degenerating cells and rapid catabolism of the injured germ cells [42]. The partial restoration of SDH and ACP activities, and the normalization of ALP activity by Satureja montana co-administration reflect the significant protection of the testis and germ cells from CP-induced degeneration, as evidenced histologically by the improved spermatogenesis and alleviation of seminiferous tubule degeneration. This beneficial effect of Satureja montana on SDH, ACP and ALP activities in CP-treated rats could be mainly attributed to its rutin content. Rutin exerted similar effects in an earlier model of CP-induced testicular injury in rats [42]. Furthermore, activities of free lysosomal enzymes were shown to rise when testicular steroidogenesis was increased [52], which is manifested in Satureja montana co-treated rats by the restoration of serum testosterone level. As previously reported [10], CP increased testicular Hb absorbance, which is a characteristic of testicular edema, as revealed by the present histopathological findings, and hemorrhage. This may be due to the interaction of CP with sulfhydryl-containing proteins [15]. In addition, excessive generation of ROS could directly damage blood vessels. The decrease in Hb absorbance shown in the extract-CP co-treated group could thus be explained on the basis of the free radical scavenging activity of the extract. Peroxisome proliferator-activated receptor-gamma (PPAR-γ) is a ligand-activated transcription factor that belongs to the nuclear receptor family. It is expressed in both 21

differentiating germ and Sertoli cells; where it is involved in regulating the pattern of 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

expression of key lipid metabolic genes in Sertoli cells [53]. Cyclophosphamide was shown to up-regulate the expression of tumor necrosis factor-alpha, interleukin-1beta and transforming growth factor-beta [54]. These cytokines are known to suppress PPAR-γ expression [55]. It was reported that PPAR-γ down-regulation leads to disturbance in spermatogenesis [56], as presently observed upon histological examination. Satureja montana extract previously showed dose-dependent PPAR-γ-activating properties in vitro [57]. This effect of the currently tested extract could be attributed to the reported PPAR-γactivating properties of rutin [58] and rosmarinic acid [57]. In addition to its positive impact on spermatogenesis, as observed histologically, activation of PPAR-γ was reported to alleviate testicular oxidative stress in rats [59]. Therefore, up-regulation of PPAR-γ signaling by Satureja montana may provide a protective mechanism against CP-induced testicular damage in rats. The cytotoxic effects of CP on the testis were further confirmed by the significantly elevated mRNA expression of the apoptosis receptor Fas. Expression of both Fas and FasL in rat/mouse testis was markedly elevated and associated with the induction of germ cell apoptosis after treatment with cytotoxic compounds [7], or after testosterone withdrawal [60]. The induction of Fas could be a cellular response to oxidative stress [5]. Therefore, the antioxidant effect of Satureja montana observed in the present study could possibly explain the suppression of testicular Fas expression in the drug-extract co-treated group. Another possible explanation for Fas down-regulation in co-treated rats could be the normalized serum testosterone level; testosterone may play a role in germ cell survival via its suppression of Fas [60]. The roles of the pro-apoptotic factor, Bax, and the anti-apoptotic factor, Bcl-2, in CPinduced apoptosis and cytotoxicity were previously demonstrated in a tumor cell line in 22

which expression of Bax enhanced caspase-9 activation and CP-induced cell death and 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

cytotoxicity whereas overexpression of Bcl-2 blocked these events [61]. Therefore, we can speculate that the observed up-regulation of Bax and down-regulation of Bcl-2 may mediate CP-induced apoptosis and cytotoxicity in the rat testis. Such alterations in testicular Bax and Bcl-2 expression levels were reported to be triggered by the enhanced generation of ROS [6]. Therefore, the up-regulation of Bcl-2 and the down-regulation of Bax observed in the extractdrug co-treated group could be ascribed to the marked antioxidant effect exerted by the extract. Moreover, PPAR-γ, which was up-regulated in the co-treated group, was reported to prevent apoptosis via Bcl-2 up-regulation in oxidative stress-mediated apoptosis [62]. The partial restoration of both Bax and Bcl-2 expression levels by Satureja montana extract coadministration in CP-treated rats could be attributed to the rutin and rosmarinic acid contents of the extract. Both compounds increased the Bcl-2/Bax ratio and thereby attenuated apoptotic cell death in myocardial [63] and neuronal [64] injury, respectively. Caffeic acid, the main phenolic acid identified in our extract, was also reported to up-regulate Bcl-2 gene expression in a pancreatic cell line [65]. The anti-apoptotic effect of syringic acid was recently demonstrated in a brain ischemia model in rats [66]. The serine/threonine kinase Akt1, also known as protein kinase B alpha, plays a role in the protection of germ cells and the suppression of germ cell apoptosis in several models of rodent testicular injury. It acts through enhancing spermatogenic stem cell survival and increasing stem cell self-renewal. Akt1 deficient testes suffer mitochondrial dysfunction and delayed Sertoli cell maturation resulting in the premature onset of germ cell apoptosis [9,67]. Given these facts, we can suggest that the presently observed decrease in testicular Akt1 level in CP-treated rats may mediate, at least in part, the significant injury and enhanced apoptosis seen in their testicular tissue. Cyclophosphamide-induced decrease in testicular Akt1 protein level could be attributed to H2O2-triggered ROS generation and Fas stimulation [68], which 23

result in Akt cleavage and inactivation. In view of that, mitigation of oxidative stress and 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

down-regulation of Fas, achieved upon Satureja montana extract administration to CP-treated rats, are likely mechanisms for the noted normalization of their testicular Akt1 level. Akt activation was shown to protect against CP-induced testicular damage and sperm DNA damage [14]. It is also important to note that the PI3K/Akt pathway is implicated in germ cell survival following testicular injury [9]. Thus, the marked protective effect of Satureja montana against CP testicular injury may be mediated, at least partly, by Akt activation, which could be attributed to its rutin and caffeic acid contents. Rutin reportedly increased Akt phosphorylation in H9c2 cells [63], whereas caffeic acid up-regulated Akt1 gene expression in a pancreatic cell line [65]. Cyclophosphamide-induced testicular DNA fragmentation was previously associated with peroxidative damage to the mitochondria and plasma membrane and was attributed to the excessive generation of ROS [38]. The observed up-regulation of Akt1 may be responsible for the amelioration of DNA fragmentation, since the activation of the Akt/glycogen synthase kinase-3β pathway is known to play a crucial role in DNA repair [69]. In conclusion, the present study highlights the role of Satureja montana extract in ameliorating the biochemical aberrations induced in the rat testes by CP administration. By the reversal of most testicular, oxidative and apoptotic markers toward normalcy, the protective role of Satureja montana in testicular toxicity is evident. The results presented in this study suggest that Satureja montana extract protects against CP-induced testicular damage via anti-oxidative and anti-apoptotic mechanisms that seem to be mediated, at least in part, by PPAR-γ and Akt1 up-regulation. A study of the effect of Satureja montana extract on the metabolism of CP may provide better understanding of the mechanisms contributing to its testicular protective effect against CP injury. This may be of great value in devising better strategies for using the extract in this context. 24

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

Conflict of Interest The authors declare that there are no conflicts of interest.

Acknowledgements The authors greatly appreciate the financial assistance provided by Faculty of Pharmacy, Cairo University, Egypt. The authors are greatly indebted to Dr. Hussein A. H. Said-Al Ahl, National Research Center, Giza, Egypt, for kindly providing the plant material. The authors also acknowledge Dr. Adel Bakeer, Faculty of Veterinary Medicine, Cairo University, Egypt, for performing the histopathological examinations in this study.

25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

References [1]

N. Bezić, M. Skoĉibušić, V. Dunkić, Phytochemical composition and antimicrobial activity of Satureja montana L. and Satureja cuneifolia Ten. essential oils, Acta Bot. Croat. 64 (2005) 313–322.

[2]

G.S. Ćetković, J.M. Ĉanadanović-Brunet, S.M. Djilas, V.T. Tumbas, S.L. Markov, D.D. Cvetković, Antioxidant Potential, Lipid Peroxidation Inhibition and Antimicrobial Activities of Satureja montana L. subsp. kitaibelii Extracts, Int. J. Mol. Sci. 8 (2007) 1013–1027.

[3]

M. Zavatti, P. Zanoli, A. Benelli, M. Rivasi, C. Baraldi, M. Baraldi, Experimental study on Satureja montana as a treatment for premature ejaculation., J. Ethnopharmacol. 133 (2011) 629–633.

[4]

T.T. Turner, J.J. Lysiak, Oxidative stress: a common factor in testicular dysfunction., J. Androl. 29 (2008) 488–498.

[5]

T.T. Turner, K.S. Tung, H. Tomomasa, L.W. Wilson, Acute testicular ischemia results in germ cell-specific apoptosis in the rat., Biol. Reprod. 57 (1997) 1267–1274.

[6]

D.R. Green, Apoptotic pathways: the roads to ruin., Cell. 94 (1998) 695–698.

[7]

J. Lee, J.H. Richburg, S.C. Younkin, K. Boekelheide, The Fas system is a key regulator of germ cell apoptosis in the testis., Endocrinology. 138 (1997) 2081–2088.

[8]

J.Y. Ryu, J. Whang, H. Park, J.Y. Im, J. Kim, M.Y. Ahn, et al., Di(2-ethylhexyl) phthalate induces apoptosis through peroxisome proliferators-activated receptorgamma and ERK 1/2 activation in testis of Sprague-Dawley rats., J. Toxicol. Environ. Health. A. 70 (2007) 1296–1303.

[9]

R. Rogers, G. Ouellet, C. Brown, B. Moyer, T. Rasoulpour, M. Hixon, Cross-talk between the Akt and NF-kappaB signaling pathways inhibits MEHP-induced germ cell apoptosis., Toxicol. Sci. 106 (2008) 497–508.

[10] T.M.K. Motawi, N.A.H. Sadik, A. Refaat, Cytoprotective effects of DL-alpha-lipoic acid or squalene on cyclophosphamide-induced oxidative injury: an experimental study on rat myocardium, testicles and urinary bladder., Food Chem. Toxicol. 48 (2010) 2326–2336. [11] S.M. Ludeman, The chemistry of the metabolites of cyclophosphamide., Curr. Pharm. Des. 5 (1999) 627–643. [12] A. Garolla, C. Pizzato, A. Ferlin, M.O. Carli, R. Selice, C. Foresta, Progress in the development of childhood cancer therapy., Reprod. Toxicol. 22 (2006) 126–132. [13] N. Elangovan, T.-J. Chiou, W.-F. Tzeng, S.-T. Chu, Cyclophosphamide treatment causes impairment of sperm and its fertilizing ability in mice., Toxicology. 222 (2006) 60–70. 26

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

[14] A. Carmely, D. Meirow, A. Peretz, M. Albeck, B. Bartoov, B. Sredni, Protective effect of the immunomodulator AS101 against cyclophosphamide-induced testicular damage in mice., Hum. Reprod. 24 (2009) 1322–1329. [15] E. Selvakumar, C. Prahalathan, P.T. Sudharsan, P. Varalakshmi, Protective effect of lipoic acid on cyclophosphamide-induced testicular toxicity., Clin. Chim. Acta. 367 (2006) 114–119. [16] S. Vladimir-Knežević, B. Blažeković, M. Kindl, J. Vladić, A.D. Lower-Nedza, A.H. Brantner, Acetylcholinesterase inhibitory, antioxidant and phytochemical properties of selected medicinal plants of the Lamiaceae family., Molecules. 19 (2014) 767–782. [17] D. Chrpov , L. Kou imsk , M.H. Gordon, V. He manov , I. Roubíĉkov , J. P nek, Antioxidant Activity of Selected Phenols and Herbs Used in Diets for Medical Conditions, Czech J. Food Sci. 28 (2010) 317–325. [18] V.L. Singleton, R. Orthofer, R.M. Lamuela-Raventós, Analysis of total phenols and other oxidation substrates and antioxidants by means of folin-ciocalteu reagent, Methods Enzymol. 299 (1999) 152–178. [19] C.C. Chang, M.H. Yang, H.M. Wen, J.C. Chern, Estimation of total flavonoid content in propolis by two complementary colorimetric methods, J. Food Drug Anal. 10 (2002) 178–182. [20] Y.-P. Neo, A. Ariffin, C.-P. Tan, Y.-A. Tan, Phenolic acid analysis and antioxidant activity assessment of oil palm (E. guineensis) fruit extracts, Food Chem. 122 (2010) 353–359. [21] A. Kornberg, B.L. Horecker, P.Z. Smyrniotis, [42] Glucose-6-phosphate dehydrogenase 6-phosphogluconic dehydrogenase, Methods Enzymol. 1 (1955) 323– 327. [22] D.E. Paglia, W.N. Valentine, Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase., J. Lab. Clin. Med. 70 (1967) 158–169. [23] W.K. Long, P.E. Carson, Increased erythrocyte glutathione reductase activity in diabetes mellitus, Biochem. Biophys. Res. Commun. 5 (1961) 394–399. [24] E. Beutler, O. Duron, B.M. Kelly, Improved method for the determination of blood glutathione., J. Lab. Clin. Med. 61 (1963) 882–888. [25] M. Uchiyama, M. Mihara, Determination of malonaldehyde precursor in tissues by thiobarbituric acid test, Anal. Biochem. 86 (1978) 271–278. [26] I.F. Benzie, J.J. Strain, The ferric reducing ability of plasma (FRAP) as a measure of “antioxidant power”: the FRAP assay., Anal. Biochem. 239 (1996) 70–76. [27] B. Chauncey, M. V Leite, L. Goldstein, Renal sorbitol accumulation and associated enzyme activities in diabetes., Enzyme. 39 (1988) 231–234. 27

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

[28] S.N. Buhl, K.Y. Jackson, Optimal conditions and comparison of lactate dehydrogenase catalysis of the lactate-to-pyruvate and pyruvate-to-lactate reactions in human serum at 25, 30, and 37 degrees C., Clin. Chem. 24 (1978) 828–831. [29] G. Szasz, A kinetic photometric method for serum gamma-glutamyl transpeptidase., Clin. Chem. 15 (1969) 124–136. [30] D.W. Moss, in: H.U. Bergmeyer (Ed.), Methods Enzym. Anal., 3rd ed., VerlagChemie, 1984: pp. 92–106. [31] P.R. Kind, E.J. King, Estimation of plasma phosphatase by determination of hydrolysed phenol with amino-antipyrine., J. Clin. Pathol. 7 (1954) 322–326. [32] O.H. Lowry, N.J. Rosebrough, A.L. Farr, R.J. Randall, Protein measurement with the Folin phenol reagent., J. Biol. Chem. 193 (1951) 265–275. [33] R.J. Niewenhuis, W.C. Prozialeck, Calmodulin inhibitors protect against cadmiuminduced testicular damage in mice., Biol. Reprod. 37 (1987) 127–133. [34] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method., Methods. 25 (2001) 402–408. [35] G. Yanamandra, M.L. Lee, Isolation and characterization of human DNA in agarose block., Gene Anal. Tech. 6 (1989) 71–74. [36] J.D. Bancroft, A. Stevens, D.R. Turner, Theory and Practice of Histological Techniques, Fourth, Churchill Livingstone, New York, 1996. [37] H.D. Hassanein, H.A.H. Said-Al Ahl, M.M. AbdelMohsen, Antioxidant polyphenolic constituents of Satureja montana L. growing in Egypt, Int. J. Pharm. Pharm. Sci. 6 (2014) 578–581. [38] P. Vernet, R.J. Aitken, J.R. Drevet, Antioxidant strategies in the epididymis., Mol. Cell. Endocrinol. 216 (2004) 31–39. [39] A.K. Prasad, N. Pant, S.C. Srivastava, R. Kumar, S.P. Srivastava, Effect of dermal application of hexachlorocyclohexane (HCH) on male reproductive system of rat., Hum. Exp. Toxicol. 14 (1995) 484–488. [40] V. Peltola, I. Huhtaniemi, M. Ahotupa, Antioxidant enzyme activity in the maturing rat testis., J. Androl. 13 (1992) 450–455. [41] E. Selvakumar, C. Prahalathan, Y. Mythili, P. Varalakshmi, Beneficial effects of DLalpha-lipoic acid on cyclophosphamide-induced oxidative stress in mitochondrial fractions of rat testis., Chem. Biol. Interact. 152 (2005) 59–66. [42] S.O. Abarikwu, C.A. Otuechere, M. Ekor, K. Monwuba, D. Osobu, Rutin Ameliorates Cyclophosphamide-induced Reproductive Toxicity in Male Rats., Toxicol. Int. 19 (2012) 207–214.

28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

[43] S. Kumar, P. Prahalathan, B. Raja, Syringic acid ameliorates (L)-NAME-induced hypertension by reducing oxidative stress., Naunyn. Schmiedebergs. Arch. Pharmacol. 385 (2012) 1175–1184. [44] D. Ghosh, U.B. Das, S. Ghosh, M. Mallick, J. Debnath, Testicular gametogenic and steroidogenic activities in cyclophosphamide treated rat: a correlative study with testicular oxidative stress., Drug Chem. Toxicol. 25 (2002) 281–292. [45] R. Sen Gupta, J. Kim, C. Gomes, S. Oh, J. Park, W.-B. Im, et al., Effect of ascorbic acid supplementation on testicular steroidogenesis and germ cell death in cadmiumtreated male rats., Mol. Cell. Endocrinol. 221 (2004) 57–66. [46] K. Jana, S. Jana, P.K. Samanta, Effects of chronic exposure to sodium arsenite on hypothalamo-pituitary-testicular activities in adult rats: possible an estrogenic mode of action., Reprod. Biol. Endocrinol. 4 (2006) 9. [47] N.C. Mills, A.R. Means, Sorbitol dehydrogenase of rat testis: changes of activity during development, after hypophysectomy and following gonadotrophic hormone administration., Endocrinology. 91 (1972) 147–156. [48] C. Latchoumycandane, P.P. Mathur, Effects of hyperthyroidism on the physiological status of pubertal rat testis, Biomed. Lett. 59 (1999) 33–41. [49] N.H. Jutte, R. Jansen, J.A. Grootegoed, F.F. Rommerts, H.J. van der Molen, FSH stimulation of the production of pyruvate and lactate by rat Sertoli cells may be involved in hormonal regulation of spermatogenesis., J. Reprod. Fertil. 68 (1983) 219– 226. [50] Y. Gu, D.R. Davis, Y.C. Lin, Developmental changes in lactate dehydrogenase-X activity in young jaundiced male rats., Arch. Androl. 22 (1989) 131–136. [51] R.J. Sherins, G.D. Hodgen, Testicular gamma glutamyl-transpeptidase: an index of Sertoli cell function in man., J. Reprod. Fertil. 48 (1976) 191–193. [52] P.P. Mathur, S. Chattopadhyay, Involvement of lysosomal enzymes in flutamideinduced stimulation of rat testis., Andrologia. 14 (1982) 171–176. [53] K. Thomas, D.-Y. Sung, X. Chen, W. Thompson, Y.E. Chen, J. McCarrey, et al., Developmental patterns of PPAR and RXR gene expression during spermatogenesis., Front. Biosci. (Elite Ed). 3 (2011) 1209–1220. [54] O.M. Abo-Salem, Uroprotective effect of pentoxifylline in cyclophosphamide-induced hemorrhagic cystitis in rats., J. Biochem. Mol. Toxicol. 27 (2013) 343–350. [55] J. Wei, S. Bhattacharyya, M. Jain, J. Varga, Regulation of Matrix Remodeling by Peroxisome Proliferator-Activated Receptor-γ: A Novel Link Between Metabolism and Fibrogenesis., Open Rheumatol. J. 6 (2012) 103–115. [56] P.B.T. Pichiah, A. Sankarganesh, S. Kalaiselvi, K. Indirani, S. Kamalakkannan, D. SankarGanesh, et al., Adriamycin induced spermatogenesis defect is due to the 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

reduction in epididymal adipose tissue mass: a possible hypothesis., Med. Hypotheses. 78 (2012) 218–220. [57] E. Schrader, S. Wein, K. Kristiansen, L.P. Christensen, G. Rimbach, S. Wolffram, Plant extracts of winter savory, purple coneflower, buckwheat and black elder activate PPAR-γ in COS-1 cells but do not lower blood glucose in Db/db mice in vivo., Plant Foods Hum. Nutr. 67 (2012) 377–383. [58] Y. Cai, C. Fan, J. Yan, N. Tian, X. Ma, Effects of rutin on the expression of PPARγ in skeletal muscles of db/db mice., Planta Med. 78 (2012) 861–865. [59] M. Inan, U. Basaran, D. Dokmeci, M. Kanter, O. Yalcin, N. Aydogdu, et al., Rosiglitazone, an agonist of peroxisome proliferator-activated receptor-gamma, prevents contralateral testicular ischaemia-reperfusion injury in prepubertal rats., Clin. Exp. Pharmacol. Physiol. 34 (2007) 457–461. [60] S. Nandi, P.P. Banerjee, B.R. Zirkin, Germ cell apoptosis in the testes of Sprague Dawley rats following testosterone withdrawal by ethane 1,2-dimethanesulfonate administration: relationship to Fas?, Biol. Reprod. 61 (1999) 70–75. [61] P.S. Schwartz, D.J. Waxman, Cyclophosphamide induces caspase 9-dependent apoptosis in 9L tumor cells., Mol. Pharmacol. 60 (2001) 1268–1279. [62] K. Fuenzalida, R. Quintanilla, P. Ramos, D. Piderit, R.A. Fuentealba, G. Martinez, et al., Peroxisome proliferator-activated receptor gamma up-regulates the Bcl-2 antiapoptotic protein in neurons and induces mitochondrial stabilization and protection against oxidative stress and apoptosis., J. Biol. Chem. 282 (2007) 37006–37015. [63] J.J. Jeong, Y.M. Ha, Y.C. Jin, E.J. Lee, J.S. Kim, H.J. Kim, et al., Rutin from Lonicera japonica inhibits myocardial ischemia/reperfusion-induced apoptosis in vivo and protects H9c2 cells against hydrogen peroxide-mediated injury via ERK1/2 and PI3K/Akt signals in vitro., Food Chem. Toxicol. 47 (2009) 1569–1576. [64] H.J. Lee, H.-S. Cho, E. Park, S. Kim, S.-Y. Lee, C.-S. Kim, et al., Rosmarinic acid protects human dopaminergic neuronal cells against hydrogen peroxide-induced apoptosis., Toxicology. 250 (2008) 109–115. [65] S. Bhattacharya, N. Oksbjerg, J.F. Young, P.B. Jeppesen, Caffeic acid, naringenin and quercetin enhance glucose-stimulated insulin secretion and glucose sensitivity in INS1E cells., Diabetes. Obes. Metab. (2013). [66] M. Güven, A.B. Aras, N. Topaloğlu, A. Özkan, H. Muratşen, Y. Kalkan, et al., The protective effect of syringic acid on ischemia injury in rat brain, Turkish J. Med. Sci., in press. [67] J. Santos-Ahmed, C. Brown, S.D. Smith, P. Weston, T. Rasoulpour, M.E. Gilbert, et al., Akt1 protects against germ cell apoptosis in the postnatal mouse testis following lactational exposure to 6-N-propylthiouracil., Reprod. Toxicol. 31 (2011) 17–25.

30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

[68] S. Rokudai, N. Fujita, Y. Hashimoto, T. Tsuruo, Cleavage and inactivation of antiapoptotic Akt/PKB by caspases during apoptosis., J. Cell. Physiol. 182 (2000) 290–296. [69] G.D. Kao, Z. Jiang, A.M. Fernandes, A.K. Gupta, A. Maity, Inhibition of phosphatidylinositol-3-OH kinase/Akt signaling impairs DNA repair in glioblastoma cells following ionizing radiation., J. Biol. Chem. 282 (2007) 21206–21212.

31

Figure Captions Figure 1. HPLC anaylsis of Satureja montana extract. 1-Gallic acid, 2-Caffeic acid, 3-Syringic acid, 4-Vanillic acid, 5-Ferulic acid, 6-Rutin, 7Rosmarinic acid, 8-Cinnamic acid.

Figure 2. Agarose gel electrophoresis of DNA isolated from testicular tissue. Lane M: DNA marker with 100 bp, Lane 1: Normal, Lane 2: Extract-treated group, Lane 3: Cyclophosphamide (CP)-administered group, Lane 4: Extract + CP-co-treated group.

Figure 3. Histopathology of testes in normal control rats, extract-treated rats, cyclophosphamide (CP)-treated rats and extract + CP-co-treated rats (H&E). Photomicrographs a (X16) and b (X40): Normal architecture of testes of normal control group. c (X16) and d (X40): No histopathological alteration in the testes of rats treated only with the extract. e (X16) and f (X40): Testes of CP-administered group showing atrophy, degeneration (ds), loss of spermatogenesis in most of the seminiferous tubules and homogenous eosinophilic material with edema replacing the interstitial Leydig cells. g (X16) and h (X40): Testes of the extract + CP-co-treated group showing nearly normal mature active seminiferous tubules with complete spermatogenic series (S).

Table 1. Primer sequences used for RT-PCR Gene PPAR-γ

Primer sequence Forward 5′ GCG GAG ATC TCC AGT GAT ATC 3′ Reverse 5′ TCA GCG ACT GGG ACT TTT CT 3′

GenBank accession number XM_006237009.1

Fas

Forward 5′ CGTGAAACCGACAACAACTG 3′ Reverse 5′ TTTTCGTTCACCAGGCTGAC 3′

NM_139194.2

Bax

Forward 5′ GTTGCCCTCTTCTACTTTG 3′ Reverse 5′ AGCCACCCTGGTCTTG 3′

NM_017059.1

Bcl-2

Forward 5′ CGGGAGAACAGGGTATGA 3′ Reverse 5′ CAGGCTGGAAGGAGAAGAT 3′

NM_016993.1

Forward 5′ AGGCCGGCTTCGCGGGCGAC 3′ Reverse 5′ CTCGGGAGCCACACGCAGCTC 3′

NM_001101.3

β-actin

Table 2. Amount of phenolic compounds in Satureja montana by HPLC analysis μg/g

Compound

Retention time

Area

Gallic acid

5.54

6349.95

154.41 ± 1.60

Caffeic acid

20.75

5984.24

415.92 ± 6.41

Syringic acid

22.22

5443.83

455.70 ± 6.76

Vanillic acid

24.05

6566.05

115.88 ± 1.06

Ferulic acid

31.64

4941.52

145.38 ± 1.44

Rutin

37.10

2521.78

1136.24 ± 27.00

Rosmarinic acid

39.60

3130.74

365.24 ± 4.55

Cinnamic acid

42.46

15436.70

5.16 ± 0.02

Luteolin

42.86

2621.29

72.12 ± 0.05

Quercetin

42.89

2310.24

240.11 ± 3.56

Values represent mean for three replicates ± standard deviation.

Table 3. Effect of Satureja montana extract, cyclophosphamide (CP) and Satureja montana extract + CP on body weight, testicular weight, and relative testicular weight Group I (Control)

Group II (Extract)

Group III (CP)

Group IV (Extract + CP)

Initial body weight (g)

198.60 ± 3.04

199.40 ± 2.13

197.30 ± 3.09

195.93 ± 2.54

Final body weight (g)

231.40 ± 3.630

232.23 ± 4.649

173.80 ± 2.557a*b*

182.78 ± 2.634a*b*

Testicular weight (g)

2.513 ± 0.087

2.314 ± 0.144

1.028 ± 0.088a*b*

1.637 ± 0.153a*b#c#

Relative testicular weight (g%)

1.084 ± 0.021

1.007 ± 0.081

0.588 ± 0.043a*b*

0.899 ± 0.087c#

Body/Testis weight

Values represent mean ± SEM for eight rats. a, b and c represent significant differences from groups I, II and III, respectively. * and # represent statistical significance at p < 0.001 and p < 0.01, respectively.

Table 4. Effect of Satureja montana extract, cyclophosphamide (CP) and Satureja montana extract + CP on testicular glucose-6-phosphate dehydrogenase (G6PD), glutathione peroxidase (GPx), glutathione reductase (GR) activities, glutathione (GSH), malondialdehyde (MDA) and total antioxidant capacity (TAC) levels

Oxidative stress markers

Group I (Control)

Group II (Extract)

Group III (CP)

Group IV (Extract + CP)

G6PD (mU/mg protein)

5.97 ± 0.23

5.89 ± 0.31

2.35 ± 0.17a*b*

5.21 ± 0.25c*

GPx (U/mg protein)

36.47 ± 1.28

37.54 ± 1.20

25.75 ± 1.35a*b*

32.78 ± 2.57c†

GR (U/mg protein)

13.78 ± 1.19

14.29 ± 1.01

7.54 ± 0.27a*b*

11.35 ± 0.23c†

GSH (mg/g tissue)

2.46 ± 0.08

2.53 ± 0.10

1.77 ± 0.09a*b*

2.57 ± 0.12c*

MDA (nmol/g tissue)

219.34 ± 8.53

215.55 ± 7.56

307.14 ± 8.78a*b*

255.33 ± 7.96a†b#c*

TAC (μmol/mg protein)

450.6 ± 13.74

461.23 ± 12.95

234.7 ± 15.30a*b*

378.14 ± 21.30a†b#c*

Values represent mean ± SEM for eight rats. a, b and c represent significant differences from groups I, II and III, respectively. *, # and † represent statistical significance at p < 0.001, p < 0.01 and p < 0.05, respectively.

Table 5. Effect of Satureja montana extract, cyclophosphamide (CP) and Satureja montana extract + CP on serum testosterone, luteinizing hormone (LH) and follicle stimulating hormone (FSH) levels Hormones

Group I (Control)

Group II (Extract)

Group III (CP)

Group IV (Extract + CP)

Testosterone (ng/ml)

5.112 ± 0.361

5.162 ± 0.496

0.780 ± 0.057a*b*

3.882 ± 0.331c*

LH (mU/ml)

0.535 ± 0.049

0.555 ± 0.039

0.200 ± 0.011a*b*

0.210 ± 0.020a*b*

FSH (mU/ml)

0.236 ± 0.019

0.235 ± 0.021

0.079 ± 0.004a*b*

0.082 ± 0.005a*b*

Values represent mean ± SEM for eight rats. a, b and c represent significant differences from groups I, II and III, respectively. * represents statistical significance at p < 0.001.

Table 6. Effect of Satureja montana extract, cyclophosphamide (CP) and Satureja montana extract + CP on testicular sorbitol dehydrogenase (SDH), lactate dehydrogenase (LDH), gamma-glutamyltransferase (γ-GT), acid phosphatase (ACP) and alkaline phosphatase (ALP) activities and hemoglobin (Hb) absorbance

Testicular markers

Group I (Control)

Group II (Extract)

Group III (CP)

Group IV (Extract + CP)

SDH (mU/mg protein)

4.82 ± 0.34

4.96 ± 0.40

1.95 ± 0.18a*b*

3.21 ± 0.28a#b#c†

LDH (mU/mg protein)

3.61 ± 0.27

3.41 ± 0.25

0.91 ± 0.07a*b*

1.02 ± 0.08a*b*

γ-GT (U/mg protein)

20.42 ± 1.94

19.78 ± 1.72

45.62 ± 3.43a*b*

44.31 ± 3.67a*b*

ACP (U/mg protein)

160.54 ± 8.6

158.39 ± 7.8

75.35 ± 3.5a*b*

100.35 ± 3.6a*b*c†

ALP (U/mg protein)

158.21 ± 4.13

160.81 ± 11.42

95.07 ± 6.46a*b*

138.07 ±9.54c#

Hb absorbance

0.093 ± 0.005

0.098 ± 0.006

0.246 ± 0.005a*b*

0.152 ± 0.004a*b*c*

Values represent mean ± SEM for eight rats. a, b and c represent significant differences from groups I, II and III, respectively. *, # and † represent statistical significance at p < 0.001, p < 0.01 and p < 0.05, respectively.

Table 7. Effect of Satureja montana extract, cyclophosphamide (CP) and Satureja montana extract + CP on testicular peroxisome proliferator-activated receptor-gamma (PPAR-γ), Fas, Bax and Bcl-2 gene expression (relative to β-actin) and Akt1 protein level Group I (Control)

Group II (Extract)

Group III (CP)

Group IV (Extract + CP)

PPAR-γ / β-actin

1.775 ± 0.115

1.615 ± 0.132

0.372 ± 0.052a*b*

0.91 ± 0.060a*b*c#

Fas / β-actin

10.783 ± 0.721

10.365 ± 0.814 52.467 ± 5.069a*b*

25.333 ± 2.340a#b#c*

Bax / β-actin

0.145 ± 0.014

0.163 ± 0.015

1.362 ± 0.119a*b*

0.411 ± 0.043a†b†c*

Bcl-2 / β-actin

5.783 ± 0.463

5.648 ± 0.565

0.935 ± 0.073a*b*

3.893 ± 0.358a†b†c*

Akt1 (pg/ml)

23.95 ± 1.875

27.233 ± 1.514 13.667 ± 1.285a*b*

Apoptosis-related parameters

21.75 ± 1.439c#

Values represent mean ± SEM for eight rats. a, b and c represent significant differences from groups I, II and III, respectively. *, # and † represent statistical significance at p < 0.001, p < 0.01 and p < 0.05, respectively.

Figure 1.

M Figure 2.

1

2

3

4

Figure 3.

Figure 3.

Manuscript Title Page 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65



Title Protective effect of Satureja montana extract on cyclophosphamide-induced testicular injury in rats

• Author names and affiliations Azza M. Abd El Tawab a, Nancy N. Shahina, Mona M. AbdelMohsenb a

Biochemistry Department, Faculty of Pharmacy, Cairo University, Kasr El-Eini Street, Cairo 11562, Egypt b

National Research Center, P.C. (12622), Dokki, Giza, Egypt

Azza Mohamed Abd El Tawab Lecturer of Biochemistry Nancy Nabil Shahin Lecturer of Biochemistry Mona Mohamed AbdelMohsen Researcher of Phytochemistry

• Corresponding author Nancy Nabil Shahin e-mail address: [email protected] Postal address: Biochemistry Department, Faculty of Pharmacy, Cairo University, Kasr El-Eini Street, Cairo, Egypt Telephone number: +201228778550

+(202)22758059

Fax number: +(202)26190375, please call before sending the fax to turn the fax on

Highlights  This is the first demonstration of testicular protective effect of Satureja montana.  Satureja montana ameliorates cyclophosphamide-induced testicular injury in rats.  Satureja montana exerts its protection via antioxidant & anti-apoptotic mechanisms.  Satureja montana restores cyclophosphamide-lowered serum testosterone level.  Satureja montana upregulates cyclophosphamide-lowered testicular PPAR-γ & Akt1.