Eur J Nutr DOI 10.1007/s00394-014-0788-7

ORIGINAL CONTRIBUTION

Protective effect of thymoquinone against high-fructose diet-induced metabolic syndrome in rats Pankaj Prabhakar • K. H. Reeta • S. K. Maulik A. K. Dinda • Y. K. Gupta

•

Received: 6 May 2014 / Accepted: 14 October 2014 Ó Springer-Verlag Berlin Heidelberg 2014

Abstract Purpose Thymoquinone (TQ), a bioactive constituent of Nigella sativa (Linn.) seed, which is commonly used as a spice in Asian food, has been reported to possess a wide range of biological effects. The present study evaluated the effect of TQ on high-fructose diet (HFD)-induced metabolic syndrome (MetS) in male Wistar rats. Methods MetS was induced by 60 % HFD over 42 days. TQ (25, 50 and 100 mg/kg, p.o. once daily) was administered along with HFD for 42 days. Pioglitazone (10 mg/kg, p.o. once daily) was used as a standard drug. Plasma glucose, triglycerides, total cholesterol and HDL-cholesterol were estimated on days 0 and 42. Change in blood pressure, oral glucose tolerance and insulin resistance were measured. Hepatic thiobarbituric acid reactive substances (TBARS), reduced glutathione (GSH), superoxide dismutase (SOD) and catalase levels were estimated as measures of hepatic oxidative stress. Hepatic mRNA of PPAR-a and PPAR-c was also studied. Results TQ prevented the characteristic features of HFDinduced MetS, such as hyperglycaemia, hypertriglyceridemia, hypercholesterolaemia and elevated systolic blood pressure. TQ also prevented impaired glucose tolerance and insulin resistance. It also ameliorated HFD-induced increase in hepatic TBARS and depletion of SOD, catalase and GSH. TQ prevented reduction in hepatic mRNA of PPAR-a and PPAR-c in HFD rats, and the effects were comparable to those of pioglitazone. P. Prabhakar  K. H. Reeta (&)  S. K. Maulik  Y. K. Gupta Department of Pharmacology, All India Institute of Medical Sciences, New Delhi 110029, India e-mail: [email protected] A. K. Dinda Department of Pathology, All India Institute of Medical Sciences, New Delhi 110029, India

Conclusions This study demonstrates protective effect of TQ against HFD-induced MetS on rats which might have been mediated via PPAR mechanism. Keywords Thymoquinone  High-fructose diet  Metabolic syndrome  Insulin resistance  Oxidative stress  Peroxisome proliferator-activated receptors (PPARs)

Introduction Metabolic syndrome (MetS), characterized by hyperglycaemia, dyslipidemia, insulin resistance, obesity and hypertension, is a major public health problem and is becoming an epidemic that predisposes individuals to the development of type 2 diabetes and cardiovascular diseases [1]. It affects many organ systems, leading to high morbidity and mortality [2]. Its prevalence varies widely from 12 to 41 % in different parts of the world [3]. Increased consumption of fructose in diet has been identified as one of the leading causes of MetS in the USA [4]. Fructose is widely used as an industrial sweetener in fruit juices, jams, candies, high-fructose corn syrup and soft drinks throughout the world. A state of insulin resistance and hypertriglyceridemia in rats can develop following high-fructose diet (HFD) (50–60 %) and has been used widely as a suitable animal model of human MetS [5]. Scientific evidences indicate that peroxisome proliferator-activated receptors PPAR-a and PPAR-c, two members of the ligand-activated nuclear receptors superfamily, are involved in lipid and glucose metabolism. PPARs function as sensors for free fatty acid derivatives and regulate the important metabolic pathways involved in lipid and energy metabolism [6], thus making them effective targets for drug development in the treatment and prevention of the MetS.

123

Eur J Nutr

PPAR-c is associated with improved insulin sensitivity, whereas PPAR-a is associated with lipid and lipoprotein metabolisms. Moreover, dysregulation in expression of the PPARs leads to metabolic diseases such as type 2 diabetes and MetS [7]. Likewise, administration of fructose in rats has been reported to cause reduction in the expression of PPARa/c [8]. Activation of PPAR-c has been reported to improve insulin sensitivity and decrease blood pressure [9] while activation of PPAR-a caused decrease in triglycerides and increase in HDL-cholesterol [10]. Pioglitazone, a thiazolidinedione, is a strong dual PPAR-c/PPAR-a agonist and improves insulin resistance as well as lipid profile. It has been used for the treatment of type-2 diabetes mellitus and MetS [11]. Therefore, improvement of PPAR-a/c expressions may be a potential target in the treatment of MetS. Thymoquinone (TQ) is a principal active ingredient of the Nigella sativa [12]. N. sativa popularly known as black cumin (English), fennel flower (English), Kalonji (Hindi, Urdu), Mangrail (Hindi), Kalojira (Bengali), kalijeera (Assamese), etc. is used commonly as a spice in the food of many Asian countries [13]. It has been reported to exhibit various pharmacological activities, such as antioxidant [14], PPAR-c modulatory [15], antidiabetic [16], cardioprotective [17], anti-inflammatory and anti-cancer [18] effects. Therefore, the present study was designed to investigate the effect of TQ in HFD-induced MetS in rats.

Experimental design Rats were randomly assigned to seven experimental groups as follows (n = 6): 1. 2. 3. 4. 5. 6. 7.

Control: fed with standard rat chow diet. HFD: fed with HFD (60 %, w/w). Pio ? HFD: administered pioglitazone (10 mg/kg, orally, once daily) along with HFD. TQ25 ? HFD: administered TQ (25 mg/kg, orally, once daily) along with HFD. TQ50 ? HFD: administered TQ (50 mg/kg, orally, once daily) along with HFD. TQ100 ? HFD: administered TQ (100 mg/kg, orally, once daily) along with HFD. TQ per se: administered TQ (100 mg/kg, orally, once daily) along with standard rat chow diet.

High-fructose diet and drugs (TQ in all the doses and pioglitazone) were administered for 42 days Rats were sacrificed at the end of study. A portion of liver (50 % of the largest hepatic lobe) was rapidly excised, dipped in liquid nitrogen and stored at -80 °C for biochemical estimations and real-time PCR study for the hepatic mRNA of PPAR-a and PPAR-c. The remaining 50 % of liver was kept in 10 % formalin for histopathological study.

Materials and methods The protocol was approved by the Institutional Animal Ethics Committee, All India Institute of Medical Sciences (AIIMS), New Delhi, India (532/IAEC/09). All experimental protocols were performed in compliance with the National Institute of Health (NIH) Guidelines for the Care and Use of the Laboratory Animals (NIH Publication no. 85723, revised 1996). Experimental animals Male Wistar rats (150–200 g, 10–12 weeks) were maintained under standard laboratory conditions (temperature: 25 ± 2 °C, relative humidity: 50 ± 15 % and natural dark/ light cycle). Food and water were provided ad libitum. Body weight was measured twice weekly with the help of an electronic balance (Oras Tech, India). A mean of three consecutive readings was taken. Drugs and chemicals TQ and all chemicals used for experiments were of analytical grade and were purchased from Sigma-Aldrich Co., USA.

123

Fasting plasma glucose, total cholesterol, triglycerides and HDL-cholesterol After overnight fast (12 ± 1 h), blood sample was collected and was centrifuged at 3,000 rpm for 10 min at 4 °C for the separation of plasma. The fasting plasma glucose, total cholesterol, triglycerides and HDL-C were estimated as per standard protocol given by the manufacturers of the kits (Vital Diagnostics Pvt. Ltd, India) using a semi-autoanalyser (Minitecno, India). Blood pressure The indirect tail cuff method was used for measurement of blood pressure (Biopac, UK) as described before [19]. Briefly, tail of rats were preheated in a chamber at 37 °C for 10 min and then placed in plastic restrainers. A cuff with a pneumatic pulse sensor was attached to the tail. Rats were allowed to habituate to this procedure for 7 days before actual experiments were performed. Mean of three consecutive readings was taken as the systolic and diastolic blood pressures of each rat.

Eur J Nutr

Oral glucose tolerance test After overnight fast (12 ± 1 h), each rat was fed glucose through a gastric gavage in a dose of 2 g/kg body weight. Blood was collected at 0, 30, 60 and 120 min for blood glucose estimation. The oral glucose tolerance test was evaluated by the total area under blood glucose curve using the trapezoidal method [20]. Insulin tolerance test Insulin tolerance test [21] was performed for evaluation of insulin sensitivity. Rats were administered regular insulin (Torrent Pharmaceuticals Ltd, India) (0.75 U/kg) subcutaneously. Blood samples were collected at 0, 30 and 60 min after insulin for glucose estimation. Oxidative stress parameters

double-distilled water were added. The mixture was vortexed, and the absorbance was read at 412 nm within 15 min. Superoxide dismutase Superoxide dismutase (SOD) was estimated as described by Kakkar et al. [24]. Briefly, liver tissue was homogenized with 10 times (w/v) 0.1 M sodium phosphate buffer (pH 7.4). The reagents sodium pyrophosphate buffer 1.2 ml (0.052 M, pH 8.3), 0.1 ml phenazine methosulphate (186 lM), 0.3 ml nitroblue tetrazolium (300 lM) and 0.2 ml NADH (780 lM) were added to 0.1 ml of processed sample. The mixture was incubated for 90 min at 30 °C. Then, 4 ml of n-butanol and 1 ml of acetic acid was added. After centrifugation at 4,000 rpm for 10 min, the organic layer was separated and absorbance was measured at 560 nm using spectrophotometer.

Liver tissue samples were thawed once and homogenized in 10 % w/v ice-cold 0.1 M phosphate buffer (pH 7.4). The homogenates were used for estimation of thiobarbituric acid reactive substances (TBARS) as a marker of lipid peroxidation and endogenous antioxidants such as reduced glutathione (GSH) level, superoxide dismutase (SOD) and catalase activities. Protein was estimated using Bradford’s reagent.

Catalase was estimated as described by Aebi et al. [25]. Briefly, liver tissue was homogenized with 10 times (w/v) 0.1 M sodium phosphate buffer (pH 7.4). Sample (0.05 ml) was added to 2 ml of 50 mM phosphate buffer, and at last 1 ml hydrogen peroxide (H2O2) was added. Extinction was read at 240 nm at intervals of 15 s for a total of 30 s.

Thiobarbituric acid reactive substances

Histopathological analysis

Thiobarbituric acid reactive substances (TBARS) were estimated as described by Ohkawa et al. [22]. Briefly, liver tissue was homogenized with 10 times (w/v) 0.1 M sodium phosphate buffer (7.4). The reagents, 1.5 ml acetic acid (20 %) pH-3.5, 1.5 ml thiobarbituric acid (0.8 %) and 0.2 ml sodium lauryl sulphate (8.1 %) were added to 0.1 ml of processed tissue sample. The mixture was heated at 95 °C for 60 min. The mixture was cooled, and 5 ml of n-butanol:pyridine (15:1) and 1 ml distilled water were added. After centrifugation at 5,000 rpm for 10 min at room temperature, the organic layer was separated and absorbance was measured at 532 nm using a spectrophotometer (Systronic 119, India).

Liver tissue samples were fixed in 10 % formalin and embedded in paraffin. 5-lm-thick paraffin sections were cut from the paraffin-embedded tissue blocks and stained with haematoxylin and eosin and picrosirius red. The paraffin sections were deparaffinized by immersing in xylene and rehydrated through a series of graded alcohols (100, 95 and 75 %), for 15 min each. The slides were stained with haematoxylin and eosin as well as picrosirius red and mounted with coverslip using distyrene plasticizer and xylene (DPX). The slides were examined under light microscope by a pathologist blinded to the study groups. Images were taken at magnification 9 20 [26].

Catalase

Real-time polymerase chain reaction (PCR) Reduced glutathione Reduced glutathione (GSH) was estimated by the method as described by Ellman et al. [23]. Briefly, liver tissue was homogenized with 10 times (w/v) 0.1 M sodium phosphate buffer (pH 7.4). This homogenate was centrifuged with 5 % trichloroacetic acid to extrude out proteins. To this homogenate, 2 ml phosphate buffer (pH 8.4), 0.5 ml 50 5 dithiobis (2-nitrobenzoic acid) (DTNB) and 0.4 ml of

The mRNA level of hepatic PPAR-a and PPAR-c was examined using real-time PCR detection system (CFX96, Bio-Rad, Richmond, CA, USA) as described earlier [27]. Briefly, total RNA from liver tissue was isolated using pureZol reagent (Bio-Rad, USA). Isolated RNA concentration was assessed in a UV spectrophotometer (Nanodrop Technologies ND-1000 V3.6.0, Wilmington, USA), and its integrity was determined on 1.4 % agarose gel

123

Eur J Nutr

electrophoresis. Subsequently, equal amount of RNA was taken for cDNA synthesis using RevertAid First Strand cDNA synthesis kit (Thermo Scientific, USA). The quality of the cDNA produced was confirmed by PCR amplification using b-actin primers as a housekeeping gene. The primers used for real-time PCR were designed from the individual mRNA transcripts using Primer 3 Input (version 0.4.0) and synthesized from Sigma-Aldrich, USA (Table 1). Real-time quantitative PCR was performed using SYBR Green PCR Master Mix (Bio-Rad, USA), and protocol was followed as prescribed by supplier (Bio-Rad, USA). The PCR cycling conditions were: 95 °C for 3 min (hold), followed by 40 cycles of 95 °C for 10 s (denaturation), 60 °C for 30 s (annealing) and 72 °C for 30 s (extension). We used b-actin as a housekeeping gene as a standard procedure reported earlier [28]. The expression of the housekeeping gene, b-actin, was used to normalize the expression of target genes. Threshold cycle (Ct) values were obtained, and comparative 2DDCt method has been used for relative quantification of gene where DDCt = is the cycle threshold normalized first with the endogenous control b-actin (Ct sample—Ct b-actin = DCt) and then with the control (DDCt Sample—DCt Control = DDCt). Statistical analysis Data were analysed using SPSS (version 16.0) statistical package. The results are expressed as mean ± standard error of mean. One-way analysis of variance (ANOVA) followed by Bonferroni multiple comparison test was done Table 1 Primers used for realtime PCR analysis

for test of significance. A value of P \ 0.05 was considered statistically significant.

Results Effect of TQ on fasting plasma glucose levels HFD caused significant increase in fasting plasma glucose levels as compared to control group at the end of 42 days. TQ (50 and 100 mg/kg) significantly prevented this increase in fasting plasma glucose caused by HFD at 42 days and was comparable to the effect of pioglitazone. TQ per se had no effect on fasting plasma glucose levels (Tables 2, 3). Effect of TQ on oral glucose tolerance test Area under curve (AUC) of HFD was significantly higher as compared to control group, which implies impaired oral glucose tolerance in HFD group at the end of 42 days. TQ (25, 50 and 100 mg/kg) produced significant improvement of the impaired oral glucose tolerance in a dose-dependent manner. The effects of TQ (50 and 100 mg/kg) was comparable to pioglitazone group. TQ per se did not cause significant change on glucose tolerance (Fig. 1a, b). Effect of TQ on insulin tolerance test In the insulin tolerance test, AUC was significantly higher in HFD group as compared to control group at the end of

Gene

Forward primer (FP)

Reverse primer (RP)

Annealing

PPAR-c

ATGTCTCACAATGCCATCAGGTT

AGTCATACAAATGCTTTGCCAGG

60

PPAR-a

TAATTTGCTGTGGAGATCGGC

TTGAAGGAGTTTTGGGAAGAGAA

60

b-Actin

TGAAGATCAAGATCATTGCTCCTC

TCATCGTACTCCTGCTTGCTGA

60

Table 2 Baseline (0 day) values: HFD—high-fructose diet, Pio—pioglitazone, TQ—thymoquinone Parameters

Control

HFD

Pio ? HFD

TQ25 ? HFD

TQ50 ? HFD

TQ100 ? HFD

TQ per se

Plasma glucose level (mmol/l)

5.56 ± 0.2

5.51 ± 0.1

5.71 ± 0.1

5.77 ± 0.3

5.59 ± 0.2

5.62 ± 0.3

5.38 ± 0.1

Plasma triglycerides level (mmol/l)

0.48 ± 0.04

0.46 ± 0.02

0.47 ± 0.02

0.46 ± 0.03

0.49 ± 0.03

0.45 ± 0.05

0.49 ± 0.01

Plasma cholesterol level (mmol/l)

1.13 ± 0.05

1.13 ± 0.05

1.10 ± 0.03

1.14 ± 0.1

1.10 ± 0.05

1.11 ± 0.05

1.14 ± 0.03

Plasma HDL-C level (mmol/l)

0.66 ± 0.03

0.65 ± 0.03

0.67 ± 0.02

0.68 ± 0.06

0.66 ± 0.03

0.66 ± 0.05

0.67 ± 0.02

Systolic blood pressure (mmHg)

110 ± 5

111 ± 4

115 ± 2

111 ± 3

112 ± 3

115 ± 4

113 ± 2

157.5 ± 12.7

164.17 ± 5.3

156.5 ± 2.5

162.7 ± 5.9

171.7 ± 10.7

155.2 ± 5.4

163.0 ± 3.7

Body weight (g)

Values are mean ± SEM (n = 6)

123

212.8 ± 4.1

116 ± 2b*** 118 ± 3 *** *

Effect of TQ on lipid profile 183.66 ± 6.8 203.0 ± 13.7 181.2 ± 7.6

HFD-fed rats had a significantly higher level of plasma triglycerides, plasma total cholesterol and lower level of plasma HDL-cholesterol as compared to control group. TQ (25, 50 and 100 mg/kg) significantly prevented the increase in the plasma triglycerides, plasma total cholesterol (50 and 100 mg/kg) and decrease in plasma HDLcholesterol (50 and 100 mg/kg). Similar protection was seen in pioglitazone-treated rats, and the effects were comparable to those of control. TQ treatment per se did not cause any significant change in any lipid parameters during the study as compared to control (Tables 2, 3). Effect of TQ on blood pressure HFD caused a significant increase in systolic blood pressure at 42 days as compared to the control group. TQ, 50 and 100 mg/kg, administration significantly prevented the increase in the systolic blood pressure at 42 days as compared to the HFD-fed group. The effect of TQ (50 and 100 mg/kg) was comparable to the pioglitazone-administered group (Tables 2, 3). There was no significant difference in the diastolic blood pressure among the different groups. TQ per se did not cause any significant change in systolic as well as diastolic blood pressures. Effect of TQ on body weight No significant differences in the body weight were observed between the groups at any point of time (Tables 2, 3).

As compared to HFD

As compared to TQ25 ? HFD c

b

a

As compared to control

Effect of TQ on hepatic oxidative stress parameters Values are mean ± SEM (n = 6) * P \ 0.05; ** P \ 0.01; *** P \ 0.001

Body weight (g)

197.3 ± 6

193.3 ± 7.5

183.0 ± 3.2

127 ± 2 ** 138 ± 2 122 ± 3 ***

146 ± 5 *** 115 ± 4 Systolic blood pressure (mmHg)

0.70 ± 0.02b***

42 days, which implicates impaired insulin tolerance with HFD. TQ (25, 50 and 100 mg/kg) treatment caused significant decrease in impaired insulin tolerance in a dosedependent manner at the end of 42 days. The effects of TQ (50 and 100 mg/kg) were comparable to pioglitazone. TQ per se had no effect on insulin tolerance (Fig. 2a, b).

,c b

0.79 ± 0.08b***,c* 0.69 ± 0.04b*** 0.53 ± 0.05

b b

0.71 ± 0.03b*** 0.31 ± 0.04a*** 0.67 ± 0.03 Plasma HDL-C level (mmol/l)

a

1.30 ± 0.03b** 1.26 ± 0.1 ** 1.37 ± 0.08 * 1.55 ± 0.05 1.33 ± 0.04 **

1.91 ± 0.20 ** 1.29 ± 0.1 Plasma cholesterol level (mmol/l)

0.59 ± 0.01b***

b

0.60 ± 0.06 *** 0.64 ± 0.08 ** 0.72 ± 0.04 *

b b

0.57 ± 0.02 ***

1.20 ± 0.02 *** 0.6 ± 0.01 Plasma triglycerides level (mmol/l)

a

5.46 ± 0.1b***

b

6.48 ± 0.1b***,c**

b

6.72 ± 0.1b***,c* 7.62 ± 0.1

b b

6.15 ± 0.1b*** 8.32 ± 0.1a*** 5.30 ± 0.3 Plasma glucose level (mmol/l)

a

TQ per se TQ100 ? HFD TQ50 ? HFD TQ25 ? HFD Pio ? HFD HFD Control Parameters

Table 3 Effect of HFD on following parameters at the end of 42 days: HFD—high-fructose diet, Pio—pioglitazone, TQ—thymoquinone, HDL-C—high-density lipoprotein cholesterol

Eur J Nutr

HFD caused a significant increase in hepatic TBARS level and a significant decrease in hepatic GSH level, hepatic SOD as well as hepatic catalase activities. Administration of TQ, 50 and 100 mg/kg, significantly prevented the HFD-induced increase in TBARS levels (Table 4). TQ, only at 100 mg/kg, prevented the decrease in reduced GSH levels (Table 4). There was significant reversal of the decreased hepatic SOD activity by TQ, 50 and 100 mg/kg (Table 4). TQ, 50 and 100 mg/kg administration, significantly prevented the decrease in hepatic catalase activity as compared to the HFD group (Table 4). Protective effect of

123

Eur J Nutr

Fig. 1 Effect of TQ on oral glucose tolerance test in HFD-induced MetS. a Glucose levels were measured at 30, 60 and 120 min after oral glucose administration. b Area under curve of oral glucose

tolerance. Values are mean ± SEM (n = 6). **P \ 0.01; ***P \ 0.001; a—as compared to control, b—as compared to HFD, c—as compared to TQ25 ? HFD

Fig. 2 Effect of TQ on insulin sensitivity in HFD-induced MetS. a Glucose levels were measured at 30 and 60 min after insulin administration. b Area under curve of insulin sensitivity. Values are

mean ± SEM (n = 6). *P \ 0.05; ***P \ 0.001; a—as compared to control, b—as compared to HFD, c—as compared to TQ25 ? HFD

TQ, 100 mg/kg, was comparable with the pioglitazonetreated group. TQ per se did not cause significant change in any oxidative stress parameters.

control group. TQ administration prevented the reduction of mRNA of PPAR-a (Fig. 4a) and PPAR-c (Fig. 4b). TQ per se did not cause any significant change in the mRNA of PPAR-a and PPAR-c in normal rats. Pioglitazone also prevented the reduction of hepatic mRNA of PPAR-a/c and was comparable with TQ.

Effect of TQ on histopathological studies HFD caused micro- and macrovesicular fatty changes of the hepatocytes (Fig. 3b). No infiltration of inflammatory cells, necrosis or fibrosis was observed in the HFD group. TQ (50 and 100 mg/kg) led to protection of micro- and macrovesicular fatty changes of hepatocytes caused by HFD (Fig. 3c). Pioglitazone also showed protection against fatty changes in the hepatocytes caused by HFD. TQ per se administration had no effect on hepatocytes. Effect of TQ on hepatic mRNA expression of PPAR-a and PPAR-c HFD caused significant decrease in mRNA of hepatic PPAR-a (4.3-fold) and PPAR-c (8.8-fold) as compared to

123

Discussion In the present study, HFD caused MetS in rats as manifested by insulin resistance, impaired glucose tolerance, increased plasma glucose level, elevated systolic blood pressure and deranged lipid profile, as reported earlier [29]. MetS in rats was associated with increased hepatic oxidative stress, indicated by the increased hepatic TBARS level and decreased endogenous antioxidant (reduced glutathione, SOD and catalase) levels. Additionally, micro- and macrovesicular fatty changes along with reductions in mRNA of PPAR-a/c in liver tissue were observed. TQ

2.07 ± 0.1b*** 1.44 ± 0.06 *** ***

108.8 ± 3.2b***

,c

1.27 ± 0.1 ** **

b

99.3 ± 5.3 **

33.1 ± 1.0b***

0.56 ± 0.1 1.21 ± 0.1 **

0.50 ± 0.07 ***

As compared to TQ50 ? HFD d

As compared to HFD

As compared to control

As compared to TQ25 ? HFD c

b

* P \ 0.05; ** P \ 0.01; *** P \ 0.001

2.01 ± 0.1 Hepatic catalase activity (U/mg protein)

a

109.9 ± 6.4 Hepatic SOD activity (U/mg protein)

Values are mean ± SEM (n = 6)

90.0 ± 8.0 * 70.0 ± 4.8

b b

109.9 ± 9.6 **

35.4 ± 1.0 Hepatic GSH level (mg/g wet tissue)

a

64.9 ± 2.0 ***

15.2 ± 1.6

18.3 ± 1.7

b b

31.3 ± 2.0b*** 14.1 ± 1.7a***

131.56 ± 8.6 63.57 ± 7.8 *** 144.6 ± 4.3 *** 57.08 ± 9.2 Hepatic TBARS level (nmol/g wet tissue)

a

105.21 ± 6.1 **

,c

b

27.3 ± 1.6b***,c**,d*

55.23 ± 8.5b*** 70.2 ± 6.2 *** *** *

TQ per se

,d ,c

TQ100 ? HFD

b b

TQ50 ? HFD TQ25 ? HFD

b

Pio ? HFD

a

HFD Control Parameters

Table 4 Effect of HFD on hepatic oxidative stress parameters: HFD—high-fructose diet, Pio—pioglitazone, TQ—thymoquinone, TBARS—thiobarbituric acid reactive substances, GSH— reduced glutathione, SOD—superoxide dismutase

Eur J Nutr

administration prevented these metabolic and microscopic changes caused by HFD. Consumption of high fructose disturbs normal hepatic carbohydrate metabolism leading to disturbance in glycolytic pathway, enhanced rate of de novo triglycerides synthesis [30] and decrease in expression of hepatic PPAR-a/c [8]. Activation of PPAR-a upregulates the expression of catabolic enzymes that are involved in b-oxidation of fatty acid, and also genes that play important role in the maintenance of the redox balance during the oxidative catabolism of fatty acids. PPARa also reduces the synthesis of triglycerides through activation of x-oxidation of fatty acids in liver [31]. Additionally, PPAR-c plays an important role in fat cell differentiation, lipid storage as well as in insulin sensitization. Moreover, agonists of PPAR-a are recommended for treatment of increased triglycerides and decreased HDL-cholesterol [32]. In our study, HFD-fed rats displayed reduced mRNA of PPAR-a and PPAR-c in liver. This corroborates with a previous finding [8], wherein fructose ingestion for 2 weeks induced hepatic lipogenesis and reduced PPAR-a mRNA expression as well as fatty acid oxidation. In the present study, TQ preserved the mRNA of PPAR-a and PPAR-c in hepatic tissues. This supports the finding of an earlier in silico study [33] showing an interaction of TQ with the ligand-binding pocket of PPAR-c, which is reported to be critical for its activity. Ours is the first study which shows that TQ reduces the mRNA of PPAR-a and PPAR-c pathways in vivo. TQ prevented the increase in triglycerides and total cholesterol as well as decrease in HDL-cholesterol caused by HFD consumption. Effect of TQ on serum lipids has been reported earlier in experimental conditions such as doxorubicin-induced hyperlipidemic nephropathy [34] and high-fat diet-induced atherosclerosis [35]. In the present study, pioglitazone (10 mg/kg) prevented the increase in triglycerides level and total cholesterol and decrease in HDL-cholesterol caused by HFD. Pioglitazone has been reported to be effective against increase in triglycerides in fructose-induced insulin resistance [36]. In our study, HFD also caused hyperglycaemia, impaired glucose tolerance and alteration in insulin sensitivity at the end of 42 days. TQ prevented the increase in fasting plasma glucose, impaired glucose tolerance and alteration in insulin sensitivity. Although anti-hyperglycaemic effect of TQ has been reported earlier in streptozotocin (STZ)–nicotinamide-induced diabetic rats [37], this study is the first of its kind showing anti-hyperglycaemic effect of TQ in a model which simulates human MetS. TQ per se did not cause any effect on plasma glucose level. The exact mechanisms of action of TQ against HFD-induced impaired glucose tolerance and insulin resistance are not known. A further molecular study is

123

Eur J Nutr Fig. 3 Haematoxylin and eosin-stained liver tissue: a control group with normal histopathology, b HFD group showing micro- and macrovesicular fatty change in hepatocytes (arrows) and c TQ group with normal histopathology

a

c

b

Fig. 4 a Effect of TQ on hepatic mRNA expression of PPAR-a expression in HFD-induced MetS. Values are mean ± SEM. ***P \ 0.001; a—as compared to control, b—as compared to

HFD. b Effect of TQ on hepatic mRNA expression of PPAR-c in HFD-induced MetS. Values are mean ± SEM. ***P \ 0.001; *P \ 0.05; a—as compared to control, b—as compared to HFD

required to find out the exact mechanisms of action of TQ against HFD-induced impaired glucose tolerance and insulin resistance. Clinically, MetS is characterized by hyperglycaemia, dyslipidemia, insulin resistance, obesity and hypertension [1]; however, there is wide variability in the criteria of MetS in rats. This variability has been attributed to the differences in the experimental protocols; differences in the diet composition form; fructose administration (diet or water); duration of dietary administration (days to months); use of different rodent models, etc. [38]. In our study, HFD did not cause a significant increase in body weight as has

been reported earlier [38, 39] and no significant change was observed in TQ-treated group. Oxidative stress is an important characteristic of dietinduced MetS in animals as well as humans [40, 41]. Moreover, there is some evidence albeit small that oxidative stress is a mechanism for the genesis of MetS [42]. It has been also reported that alteration of insulin sensitivity leads to a higher rate of glucose oxidation and increased production of OH free radical [43]. Thus, it is possible that TQ, by virtue of its reported antioxidant effect [44], might be playing an important protective role in MetS. There is evidence that oxidative stress is a sequel in MetS [45].

123

Eur J Nutr

Further, liver is the main organ responsible for fructose metabolism due to which hepatic oxidative stress has been incriminated in both genesis and sequel of Mets [46]. In our study, presence of increased oxidative stress manifested by increased hepatic TBARS and decrease in GSH, catalase as well as SOD levels in liver may be both a cause as well as effect of HFD-induced MetS. The observed preventive effect of TQ may be due its scavenger activities for superoxide, hydroxyl radical and singlet molecular oxygen [47]. Pioglitazone administration reduced the hepatic lipid peroxidation and prevented decrease in hepatic-reduced GSH, catalase and SOD levels in the present study. An earlier study has reported the preventive effect of pioglitazone against renal oxidative stress both by reducing freeradical production and by increasing nitric oxide production [48]. In our study, HFD caused an elevation in systolic blood pressure as also reported earlier [49]. Hypertension is a component of human MetS, the exact mechanism of which is not well established. Though further investigation into the details of mechanism of hypertension in MetS was not within the purview of our study objective, nevertheless, there are certain suggestions for fructose-induced hypertension based on previous studies such as increased sympathetic nervous system activity [50], increased level of circulating catecholamines [51], elevated renin-angiotensin system activity and angiotensin II levels [52], increased sodium reabsorption [53] and impaired endotheliumdependent relaxation [54]. These factors may have contributed to an increased vascular tone and endothelial dysfunction, which led to elevated systolic blood pressure. In our study, TQ prevented the increase in systolic blood pressures caused by HFD. It is possible that TQ may act by modulating any of these mechanisms. Anti-hypertensive effect of TQ has been reported earlier in nitric oxide deficient hypertensive rats [55]. The effective dose of TQ in our study was 50 mg/kg in rats, which comes to around 400 mg in a 60 kg adult human. Considering a yield of TQ from N. sativa seeds as 40 % [33], the amount of N. sativa required per day would be around 1,000 mg in humans. This concentration is within the range of normal human consumption in the Indian subcontinent. In conclusion, the present study demonstrates that HFD consumption caused MetS in rats, which was associated with hepatic oxidative stress, hepatic micro- and macrovesicular fatty changes, and decrease in mRNA of hepatic PPAR-a/c. TQ attenuated HFD-induced MetS, improved insulin sensitivity, preserved hepatic PPAR-a/c mRNA, reduced hepatic oxidative stress as well as micro- and macrovesicular fatty changes. This protective effect of TQ may be due to its antioxidant effect as well as PPAR agonistic effect. Further studies correlating transcription

and translation are warranted for better understanding of underlying molecular mechanisms for the beneficial effect of TQ in MetS. The results of this preliminary study provide evidence of health benefit of consumption of N. sativa, a commonly used spice in Asian food. Acknowledgments Authors gratefully acknowledge the Indian Council of Medical Research (ICMR), New Delhi, India, for financial support. Conflict of interest On behalf of all authors, the corresponding author states that there is no conflict of interest.

References 1. Tran LT, Yuen VG, McNeill JH (2009) The fructose-fed rat: a review on the mechanisms of fructose-induced insulin resistance and hypertension. Mol Cell Biochem 332(1–2):145–159 2. Aydin S, Aksoy A, Aydin S, Kalayci M, Yilmaz M, Kuloglu T, Citil C, Catak Z (2014) Today’s and yesterday’s of pathophysiology: biochemistry of metabolic syndrome and animal models. Nutrition 30(1):1–9 3. Shahbazian H, Latifi SM, Jalali MT, Shahbazian H, Amani R, Nikhoo A, Aleali AM (2013) Metabolic syndrome and its correlated factors in an urban population in South West of Iran. J Diabetes Metab Disord 12(1):11 4. Khitan Z, Kim DH (2013) Fructose: a key factor in the development of metabolic syndrome and hypertension. J Nutr Metab 2013:682673 5. Abdulla MH, Sattar MA, Johns EJ (2011) The relation between fructose-induced metabolic syndrome and altered renal haemodynamic and excretory function in the rat. Int J Nephrol 2011:934659 6. Fievet C, Fruchart JC, Staels B (2006) PPAR alpha and PPAR gamma dual agonists for the treatment of type 2 diabetes and the metabolic syndrome. Curr Opin Pharmacol 6(6):606–614 7. Wang YX (2010) PPARs: diverse regulators in energy metabolism and metabolic diseases. Cell Res 20(2):124–137 8. Nagai Y, Nishio Y, Nakamura T, Maegawa H, Kikkawa R, Kashiwagi A (2002) Amelioration of high fructose-induced metabolic derangements by activation of PPAR alpha. Am J Physiol Endocrinol Metab 282(5):E1180–E1190 9. Tenenbaum A, Fisman EZ, Motro M (2003) Metabolic syndrome and type 2 diabetes mellitus: focus on peroxisome proliferator activated receptors (PPAR). Cardiovasc Diabetol 2(1):4 10. Vosper H, Khoudoli GA, Graham TL, Palmer CNA (2002) Peroxisome proliferator–activated receptor agonists, hyperlipidemia, and atherosclerosis. Pharmacol Ther 95(1):47–62 11. Tjokroprawiro A (2006) New approach in the treatment of T2DM and metabolic syndrome (focus on a novel insulin sensitizer). Acta Med Indones 38(3):160–166 12. Chaieb K, Kouidhi B, Jrah H, Mahdouani K, Bakhrouf A (2011) Antibacterial activity of Thymoquinone, an active principle of Nigella sativa and its potency to prevent bacterial biofilm formation. BMC Complement Altern Med 11:29 13. Ibrahim RM, Hamdan NS, Mahmud R, Imam MU, Saini SM, Rashid SN, Abd Ghafar SA, Latiff LA, Ismail M (2014) A randomised controlled trial on hypolipidemic effects of Nigella sativa seeds powder in menopausal women. J Transl Med 12:82 14. Nagi MN, Alam K, Badary OA, al-Shabanah OA, al-Sawaf HA, al-Bekairi AM (1999) Thymoquinone protects against carbon tetrachloride hepatotoxicity in mice via an antioxidant mechanism. Biochem Mol Biol Int 47(1):153–159

123

Eur J Nutr 15. Woo CC, Loo SY, Gee V, Yap CW, Sethi G, Kumar AP, Tan KH (2011) Anticancer activity of thymoquinone in breast cancer cells: possible involvement of PPAR-c pathway. Biochem Pharmacol 82(5):464–475 16. Fararh KM, Shimizu Y, Shiina T, Nikami H, Ghanem MM, Takewaki T (2005) Thymoquinone reduces hepatic glucose production in diabetic hamsters. Res Vet Sci 79(3):219–223 17. Randhawa MA, Alghamdi MS, Maulik SK (2013) The effect of thymoquinone, an active component of Nigella sativa, on isoproterenol induced myocardial injury. Pak J Pharm Sci 26(6):1215–1219 18. Woo CC, Kumar AP, Sethi G, Tan KH (2012) Thymoquinone: potential cure for inflammatory disorders and cancer. Biochem Pharmacol 83(4):443–451 19. Kim HY, Okubo T, Juneja LR, Yokozawa T (2010) The protective role of amla (Emblica officinalis Gaertn.) against fructoseinduced metabolic syndrome in a rat model. Br J Nutr 103(4):502–512 20. Collino M, Aragno M, Castiglia S, Miglio G, Tomasinelli C, Boccuzzi G, Thiemermann C, Fantozzi R (2010) Pioglitazone improves lipid and insulin levels in overweight rats on a high cholesterol and fructose diet by decreasing hepatic inflammation. Br J Pharmacol 160(8):1892–1902 21. Lehnen AM, Leguisamo NM, Pinto GH, Markoski MM, De Angelis K, Machado UF, Schaan B (2010) The beneficial effects of exercise in rodents are preserved after detraining: a phenomenon unrelated to GLUT4 expression. Cardiovasc Diabetol 9:67 22. Ohkawa H, Ohishi N, Yagi K (1979) Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem 95(2):351–358 23. Ellman GL (1959) Tissue sulfhydryl groups. Arch Biochem Biophys 82(1):70–77 24. Kakkar P, Das B, Viswanathan PN (1984) A modified spectrophotometric assay of superoxide dismutase. Indian J Biochem Biophys 21(2):130–132 25. Aebi H (1974) Catalase. In: Bergmeyer HU (ed) Methods of Enzymatic Analysis. Chemic Academic Press Inc., Verlag, pp 673–685 26. Maulik SK, Prabhakar P, Dinda AK, Seth S (2012) Genistein prevents isoproterenol-induced cardiac hypertrophy in rats. Can J Physiol Pharmacol 90(8):1117–1125 27. Moran-Salvador E, Lopez-Parra M, Garcia-Alonso V, Titos E, Martı´nez-Clemente M, Gonzalez-Periz A, Lopez-Vicario C, Barak Y, Arroyo V, Claria J (2011) Role for PPARc in obesityinduced hepatic steatosis as determined by hepatocyte-and macrophage-specific conditional knockouts. FASEB J 25(8): 2538–2550 28. Gao H, Guan T, Li C, Zuo G, Yamahara J, Wang J, Li Y (2012) Treatment with ginger ameliorates fructose-induced Fatty liver and hypertriglyceridemia in rats: modulation of the hepatic carbohydrate response element-binding protein-mediated pathway. Evid Based Complement Altern Med 2012:570948 29. Ibrahim MA, Amin EF, Ibrahim SA, Abdelzaher WY, Abdelrahman AM (2014) Montelukast and irbesartan ameliorate metabolic and hepatic disorders in fructose-induced metabolic syndrome in rats. Eur J Pharmacol 724:204–210 30. Panchal SK, Poudyal H, Brown L (2012) Quercetin ameliorates cardiovascular, hepatic, and metabolic changes in diet-induced metabolic syndrome in rats. J Nutr 142(6):1026–1032 31. Monsalve FA, Pyarasani RD, Delgado-Lopez F, Moore-Carrasco R (2013) Peroxisome proliferator-activated receptor targets for the treatment of metabolic diseases. Mediat Inflamm 2013:549627 32. Huang J, Jia Y, Fu T, Viswakarma N, Bai L, Rao MS, Zhu Y, Borensztajn J, Reddy JK (2012) Sustained activation of PPARa

123

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

by endogenous ligands increases hepatic fatty acid oxidation and prevents obesity in ob/ob mice. FASEB J 26(2):628–638 Ahmad A, Husain A, Mujeeb M, Khan SA, Najmi AK, Siddique NA, Damanhouri ZA, Anwar F, Kishore K (2013) A review on therapeutic potential of Nigella sativa: a miracle herb. Asian Pac J Trop Biomed 3(5):337–352 Badary OA, Abdel-Naim AB, Abdel-Wahab MH, Hamada FM (2000) The influence of thymoquinone on doxorubicin-induced hyperlipidemic nephropathy in rats. Toxicology 143(3):219–226 Ragheb A, Elbarbry F, Prasad K, Mohamed A, Ahmed MS, Shoker A (2008) Attenuation of the development of hypercholesterolemic atherosclerosis by thymoquinone. Int J Angiol 17(4):186–192 Suzuki M, Nomura C, Odaka H, Ikeda H (1997) Effect of an insulin sensitizer, pioglitazone, on hypertension in fructosedrinking rats. Jpn J Pharmacol 74(4):297–302 Pari L, Sankaranarayanan C (2009) Beneficial effects of thymoquinone on hepatic key enzymes in streptozotocin-nicotinamide induced diabetic rats. Life Sci 85(23–26):830–834 de Castro UG, dos Santos RA, Silva ME, de Lima WG, Campagnole-Santos MJ, Alzamora AC (2013) Age-dependent effect of high-fructose and high-fat diets on lipid metabolism and lipid accumulation in liver and kidney of rats. Lipids Health Dis 12:136 de Moura RF, Ribeiro C, de Oliveira JA, Stevanato E, de Mello MA (2009) Metabolic syndrome signs in Wistar rats submitted to different high-fructose ingestion protocols. Br J Nutr 101(8):1178–1184 Pakdeechote P, Bunbupha S, Kukongviriyapan U, Prachaney P, Khrisanapant W, Kukongviriyapan V (2014) Asiatic acid alleviates hemodynamic and metabolic alterations via restoring eNOS/ iNOS expression, oxidative stress, and inflammation in dietinduced metabolic syndrome rats. Nutrients 6(1):355–370 Hokayem M, Blond E, Vidal H, Lambert K, Meugnier E, FeilletCoudray C, Coudray C, Pesenti S, Luyton C, Lambert-Porcheron S, Sauvinet V, Fedou C, Brun JF, Rieusset J, Bisbal C, Sultan A, Mercier J, Goudable J, Dupuy AM, Cristol JP, Laville M, Avignon A (2013) Grape polyphenols prevent fructose-induced oxidative stress and insulin resistance in first-degree relatives of type 2 diabetic patients. Diabetes Care 36(6):1454–1461 Yubero-Serrano EM, Delgado-Lista J, Pen˜a-Orihuela P, PerezMartinez P, Fuentes F, Marin C, Tunez I, Tinahones FJ, PerezJimenez F, Roche HM, Lopez-Miranda J (2013) Oxidative stress is associated with the number of components of metabolic syndrome: LIPGENE study. Exp Mol Med 45:e28 Vincent HK, Taylor AG (2006) Biomarkers and potential mechanisms of obesity-induced oxidant stress in humans. Int J Obes 30(3):400–418 Al Wafai RJ (2013) Nigella sativa and thymoquinone suppress cyclooxygenase-2 and oxidative stress in pancreatic tissue of streptozotocin-induced diabetic rats. Pancreas 42(5):841–849 Kim JH, Baik HW, Yoon YS, Joung HJ, Park JS, Park SJ, Jang EJ, Park SW, Kim SJ, Kim MJ, Jeon DO, Cho HJ, Lee SJ, Im SG, Jang SK (2014) Measurement of antioxidant capacity using the biological antioxidant potential test and its role as a predictive marker of metabolic syndrome. Korean J Intern Med 29(1):31–39 Giris¸ M, Dogru-Abbasoglu S, Kumral A, Olgac¸ V, Koc¸ak-Toker N, Uysal M (2014) Effect of carnosine alone or combined with atocopherol on hepatic steatosis and oxidative stress in fructoseinduced insulin-resistant rats. J Physiol Biochem 70(2):385–395 Badary OA, Taha RA, Gamal el-Din AM, Abdel-Wahab MH (2003) Thymoquinone is a potent superoxide anion scavenger. Drug Chem Toxicol 26(2):87–98 Gumieniczek A (2005) Modification of oxidative stress by pioglitazone in the heart of alloxan-induced diabetic rabbits. J Biomed Sci 12(3):531–537

Eur J Nutr 49. Mostarda C, Moraes-Silva IC, Salemi VM, Machi JF, Rodrigues B, De Angelis K, Vde Farah M, Irigoyen MC (2012) Exercise training prevents diastolic dysfunction induced by metabolic syndrome in rats. Clinics 67(7):815–820 50. Penicaud L, Berthault MF, Morin J, Dubar M, Ktorza A, Ferre P (1998) Rilmenidine normalizes fructose-induced insulin resistance and hypertension in rats. J Hypertens Suppl 16(3):S45–S49 51. Tran LT, MacLeod KM, McNeill JH (2009) Chronic etanercept treatment prevents the development of hypertension in fructosefed rats. Mol Cell Biochem 330:219–228 52. Kobayashi R, Nagano M, Nakamura F, Higaki J, Fujioka Y, Ikegami H, Mikami H, Kawaguchi N, Onishi S, Ogihara T (1993)

Role of angiotensin II in high fructose-induced left ventricular hypertrophy in rats. Hypertension 21:1051–1055 53. DeFronzo RA (1981) The effect of insulin on renal sodium metabolism.A review with clinical implications. Diabetologia 21(3):165–171 54. Katakam PV, Ujhelyi MR, Hoenig ME, Miller AW (1998) Endothelial dysfunction precedes hypertension in diet-induced insulin resistance. Am J Physiol 275(3):R788–R792 55. Khattab MM, Nagi MN (2007) Thymoquinone supplementation attenuates hypertension and renal damage in nitric oxide deficient hypertensive rats. Phytother Res 21(5):410–414

123