Research

Protein phosphatase 2A (PP2A) regulatory subunit B0c interacts with cytoplasmic ACONITASE 3 and modulates the abundance of AOX1A and AOX1D in Arabidopsis thaliana Grzegorz Konert1*, Andrea Trotta1*, Petri Kouvonen2, Moona Rahikainen1, Guido Durian1, Olga Blokhina3, Kurt Fagerstedt3, Dorota Muth2, Garry L. Corthals2 and Saijaliisa Kangasj€a rvi1 Department of Biochemistry, Molecular Plant Biology, University of Turku, FI-20014 Turku, Finland; 2Turku Centre for Biotechnology, University of Turku and  Abo Akademi University,

1

FI-20014 Turku, Finland; 3Department of Biosciences, University of Helsinki, FI-00014 Helsinki, Finland

Summary Author for correspondence: Saijaliisa Kangasj€ arvi Tel: +358 2 3338580 Email: [email protected] Received: 30 May 2014 Accepted: 11 September 2014

New Phytologist (2015) 205: 1250–1263 doi: 10.1111/nph.13097

Key words: alternative oxidase, multiple/ selected reaction monitoring (M/SRM), protein phosphatase 2A, proteomics, reactive oxygen species (ROS) signalling.

 Organellar reactive oxygen species (ROS) signalling is a key mechanism that promotes the

onset of defensive measures in stress-exposed plants. The underlying molecular mechanisms and feedback regulation loops, however, still remain poorly understood. Our previous work has shown that a specific regulatory B0 c subunit of protein phosphatase 2A (PP2A) is required to control organellar ROS signalling and associated metabolic adjustments in Arabidopsis thaliana. Here, we addressed the mechanisms through which PP2A-B0 c impacts on organellar metabolic crosstalk and ROS homeostasis in leaves.  Genetic, biochemical and pharmacological approaches, together with a combination of data-dependent acquisition (DDA) and selected reaction monitoring (SRM) MS techniques, were utilized to assess PP2A-B0 c-dependent adjustments in Arabidopsis thaliana.  We show that PP2A-B’c physically interacts with the cytoplasmic form of aconitase, a central metabolic enzyme functionally connected with mitochondrial respiration, oxidative stress responses and regulation of cell death in plants. Furthermore, PP2A-B’c impacts ROS homeostasis by controlling the abundance of specific alternative oxidase isoforms, AOX1A and AOX1D, in leaf mitochondria.  We conclude that PP2A-B’c-dependent regulatory actions modulate the functional status of metabolic enzymes that essentially contribute to intracellular ROS signalling and metabolic homeostasis in plants.

Introduction Plants have evolved versatile mechanisms that sense, signal and integrate information from external factors to optimize growth and acclimation under environmental fluctuations. In this regulation, reactive oxygen species (ROS) mediate important signalling functions, which are spatially and temporally controlled through versatile signalling networks (Baxter et al., 2014). On a molecular level, ROS signalling is intimately connected with metabolic cues, and involves concerted interactions between the extracellular space, organelles and the nucleus. Owing to the availability of sophisticated biochemical and genetic approaches, precise details concerning the molecular mechanisms and their interactions have started to emerge (Sierla et al., 2013; Baxter et al., 2014; Vaahtera et al., 2014). Light-dependent formation of ROS in chloroplasts, and indirectly in mitochondria and peroxisomes, provides plants with a key mechanism that promotes the onset of defensive measures on environmental challenges (Umbach et al., 2005; Elhafez et al., *These authors contributed equally to this work.

1250 New Phytologist (2015) 205: 1250–1263 www.newphytologist.com

2006; Zhang et al., 2009; Chaouch et al., 2010; Kangasj€arvi et al., 2012; Kim et al., 2012; Nomura et al., 2012; Hoffmann et al., 2013). The extent of stress responses may be delicately controlled through multilayered enzymatic systems, such as catalases (CATs), superoxide dismutases (SODs), ascorbate peroxidases (APXs) and alternative oxidases (AOXs), that maintain ROS balance and metabolic homeostasis in different cellular compartments (Mittler et al., 2004; Foyer & Noctor, 2009). AOXs of the mitochondrial inner membrane comprise a family of five members (AOX1A–AOX1D and AOX2) in Arabidopsis thaliana (L.) (hereafter Arabidopsis). AOX1A has been well characterized and is generally considered to be responsive to metabolic signals and oxidative stress (Vanlerberghe & McIntosh, 1997; Elhafez et al., 2006). In organellar crosstalk, AOX1A plays a central role in the scavenging of excess reducing equivalents, which may originate, for example, from photosynthetic electron transfer and enter mitochondria through metabolic exchange (Finnegan et al., 1997; Rhoads et al., 2006; Zhang et al., 2009). The other AOX isoforms, by contrast, have remained less well characterized and their importance in stress responses is not well understood. Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

New Phytologist Studies on mutant plants with decreased activities of antioxidative systems have revealed central aspects concerning the role, significance and mechanisms of intracellular ROS signalling (Mhamdi et al., 2010a; Maruta et al., 2012). Recently, by utilizing the cat2 mutant deficient in the main peroxisomal CATALASE 2, we demonstrated that a cytoplasmic regulatory B0 c subunit of trimeric protein phosphatase 2A (PP2A-B0 c) controls intracellular oxidative stress responses in Arabidopsis (Li et al., 2014). In double-mutant combination with cat2, pp2a-b0 c allowed salicylic acid (SA)-dependent pathogenesis responses and lesion formation to occur in short days, that is in conditions in which cat2 single mutants do not activate defence responses despite the prevalence of oxidative stress (Li et al., 2014). The pp2a-b0 c mutation also had a strong impact on metabolite profiles and, in particular, the responses of primary metabolism in the cat2 mutant background (Li et al., 2014). The metabolic adjustments were paralleled by proteomic alterations, demonstrating that PP2A-B0 c is required to control the abundance, complex formation and/or phosphorylation status of enzymatic machineries and redox signalling components (Trotta et al., 2011a,b; Li et al., 2014). These include, for example, the chloroplast copper/zinc SOD (CSD2) and aconitase, both of which have well-established roles in cellular metabolism and signalling (Moeder et al., 2007; Trotta et al., 2011a; Li et al., 2014). The Arabidopsis genome encodes three aconitase isoforms that are dually localized to mitochondria and cytoplasm. The mechanisms determining the dual localization of aconitase are not known, although inefficient import into mitochondria has been suggested (Carrari et al., 2003). Lowered aconitase activity has been connected with the upregulation of AOX activity and enhanced tolerance to methyl viologen, which induces oxidative stress by mediating electrons from chloroplastic and mitochondrial electron transfer chains to oxygen with a consequent formation of superoxide (O2) radicals and hydrogen peroxide (H2O2) (Moeder et al., 2007; Gupta et al., 2012). Indeed, mitochondrial respiration is a key source of ROS during plant stress responses. Here, we address the mechanisms underpinning the function of PP2A-B0 c in organellar crosstalk, with particular emphasis on metabolic pathways. First, we provide evidence that PP2A-B0 c physically interacts with ACONITASE 3 and modulates its phosphorylation level in the cytoplasm. Second, through a combination of biochemical and pharmacological approaches, and selected reaction monitoring (SRM) MS, we show that PP2A-B0 c impacts foliar H2O2 metabolism by controlling the abundance of AOX1A and AOX1D isoforms in leaf mitochondria. These findings position PP2A-B0 c in the signalling hub that controls versatile pathways in the maintenance of ROS homeostasis in plants.

Research 1251

b0 f1-1 and pp2a-b0 f1-2 (SALK_107944C and SALK_150586 for AT3 g21650, respectively) mutant lines were identified from the SALK collection by PCR analysis according to the institute’s protocols (Alonso et al., 2003; Rasool et al., 2014). A pp2a-b0 cf double mutant was obtained by crossing the mutant lines SALK_039172 and SALK_107944C (Rasool et al., 2014). Experiments were conducted with 4-wk-old plants. Yeast two-hybrid screening Yeast two-hybrid screening was conducted with HybridHunter (Invitrogen, http://www.invitrogen.com) using L40 yeast strain and LexA DNA binding domain (DBD) fusion of PP2A-B0 c in pHybLex as bait against a cDNA library enriched for stress-related factors, as described in Jaspers et al. (2009). 25 colony-forming units of tryptophan auxotrophic yeast were placed on –His selection supplemented with 10 mM 3-aminotriazole (3AT; Sigma-Aldrich, http://www.sigmaaldrich.com) to remove autoactivation. Colonies were picked after 4 d of growth at 28°C and tested for b-galactosidase activity according to the HybridHunter manual. Putative interaction partners in the pYESTrp2 library plasmid were identified by sequencing. Bimolecular fluorescence complementation (BiFC) analysis All constructs for BiFC analyses were introduced into pGPTVII backbone vectors and verified by sequencing (Walter et al., 2004; Waadt & Kudla, 2008). Complete protein coding regions were amplified by PCR and fused to the C-terminal fragment (SPYCE) or N-terminal fragment (SPYNE) of yellow fluorescent protein (YFP) using the following primers: PP2A-B0 c: 50 GCCTCGAGATGATCAAACAGATATTTG GGA 30 and 50 ATCCCGGGACTACCCGAAGTTTTACCGG 30 ; Aconitase: 50 GCCTCGAGATGTATTTAACCGCTTCAT CTT 30 and 50 ATCCCGGGTTGCTTGCTCAAGTTTCTGATA 30 ; AOX1A: 50 GCCTCGAGATGATGATAACTCGCGGTGG A 30 and 50 ATCCCGGGATGATACCCAATTGGAGCTGG 30 Agrobacterium tumefaciens strain GV3101/PMP90, carrying the fluorescent fusion constructs, was infiltrated into Nicotiana benthamiana leaves according to Waadt & Kudla (2008). YFP fluorescence was imaged with a confocal laser scanning microscope (Zeiss LSM510 META) with excitation at 514 nm and detection at 535–590 nm. Maximal projections of the sequential confocal images were created with Zeiss Zen 2012 software version 8.0.0.273 (http://www.zeiss.com).

Materials and Methods Pharmacological approaches Plant material and growth conditions Arabidopsis thaliana ecotype Columbia wild-type and mutants were grown under 130 lmol photons m2 s1 at 22°C and 50% humidity in an 8-h light period. Homozygote pp2a-b0 c (SALK_039172 for AT4 g15415; Trotta et al., 2011a), pp2aÓ 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

Foliar H2O2 was detected using diaminobenzidine (DAB) (Sigma-Aldrich) as a substrate (Thordal-Christensen et al., 1997) with the modifications described by Kangasj€arvi et al. (2008). For the inhibition of mitochondrial electron transfer chain enzymes, 5 mM potassium cyanide (KCN) and 10 or 12 mM New Phytologist (2015) 205: 1250–1263 www.newphytologist.com

New Phytologist

1252 Research

salicylhydroxamic acid (SHAM), as indicated in the legends, were used in 0.1% DAB working solution. Plants were incubated on DAB solutions in the presence or absence of additional chemicals, and thereafter either kept in darkness or subjected to 3 h of treatment with 130 lmol photons m2 s1 for the induction of ROS production. The reactivity of DAB with H2O2 in the experimental conditions was confirmed by infiltrating excised rosettes for 5 min with the DAB solution in the presence and absence of SHAM and with and without 2 U ll1 CAT (Sigma), and by infiltrating leaf discs with 20 mM H2O2.

For the identification of aconitase and AOX isoforms, 100 lg of total soluble foliar extract and 60 lg of mitochondrial proteins from pp2a-b0 c were separated by 10% SDS-PAGE and partially transferred onto a poly(vinylidene difluoride) (PVDF) membrane using a transfer time of 15 min instead of the 1 h normally used for protein blotting with our instrumentation. Thereafter, the gel was stained with Coomassie and the PVDF membrane was probed with an anti-aconitase or anti-AOX antibody (Agrisera). The resulting X-ray films were overlapped with the membrane to pinpoint the localization of aconitase or AOX bands, and the marked membrane was overlapped with the Coomassie-stained gel.

Transcript analysis To assess the transcript levels of AOX1A and AOX1D in wild-type and pp2a-b0 c, RNA was isolated with an Agilent Plant RNA Isolation Mini Kit (no. 5185-5998; Agilent, Santa Clara, CA, USA) and thereafter DNase treated with an Ambion DNA-free Kit (no. AM1906) according to the manufacturer’s instructions for rigorous DNase treatment, as described in Rasool et al. (2014). cDNA was synthesized from 1 lg of RNA using the Invitrogen SuperScript III First-Strand Synthesis SuperMix for quantitative reverse transcription-polymerase chain reaction (qRT-PCR) (no. 11752050) and amplified using Thermo Fisher Scientific (Waltham, MA, USA) Phire Hot Start II DNA Polymerase (no. F-122S) with the primers FOR (50 -ATGGACTAGAGCTCCGACGA30 ) and REV (50 -AACGTCGAAGCGATTTGCAG-30 ) for AOX1A, FOR (50 -TTTACCGCACTCTTCGACCG-30 ) and REV (50 -CAAGTGCAAAAGCATCCCCC-30 ) for AOX1D, and FOR (50 -GTGAACGATTCCTGGACCTGCCTC-30 ) and REV (50 -GAGAGGTTACATGTTCACCACAAC-30 ) for ACTIN 2. DNA bands in 1% agarose gels were stained with NIPPON Genetics Midori Green Advanced DNA stain (no. MG 04; Dueren, Germany) detected with the PerkinElmer (Waltham, MA, USA) Geliance 1000 Imaging System. Band intensities were analysed with ImageJ (http://imagej.nih.gov/ij/) and signals from AOX1A and AOX1D were normalized to that of ACTIN 2. Isolation of mitochondria Isolation of Arabidopsis mitochondria was performed as described in Sweetlove et al. (2007) with the following modifications. Soil-grown, 4-wk-old plants were kept for 24 h in darkness and mitochondria were thereafter isolated on 60–35–20% Percoll–sucrose gradient. The mitochondrial band was observed on top of the 60% fraction. Sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and protein blotting SDS-PAGE and protein blotting were performed as described previously by Trotta et al. (2011a). For the immunodetection of AOX and aconitase with protein-specific antibodies (Agrisera, Va¨nna¨s, Sweden), mitochondrial preparations corresponding to 10 lg of protein were separated by SDS-PAGE on a 10% polyacrylamide gel in the presence or absence of 5 mM dithiothreitol (DTT). New Phytologist (2015) 205: 1250–1263 www.newphytologist.com

Mass spectrometry The bands from the SDS-PAGE gel corresponding to aconitase and AOXs were cut out and subjected to overnight in-gel trypsin digestion (Li et al., 2014). The eluted peptides were analysed in data-dependent acquisition (DDA) mode with Q-Exactive, an ESI-hybrid quadrupole-orbitrap mass spectrometer (Thermo Scientific, Thermo Fisher Scientific, Waltham, MA, USA), as described in Li et al. (2014). To increase the probability of identification of aconitase isoforms from the samples, an inclusion list was used in the DDA analysis containing in silico-digested peptides for all the isoforms. The Arabidopsis Information Resource (TAIR) annotations include ACONITASE 1 (ACO1, AT4G35830), ACONITASE 2 (ACO2, AT4G26970) and ACONITASE 3 (ACO3, AT2G05710) (www.arabidopsis.org). The inclusion list included the doubly and triply charged masses of all the tryptic peptides generated with a length between 8 and 25 amino acids without missed cleavages, with cysteine carboamidomethylation and serine/threonine phosphorylation as possible modifications. The DDA data were searched against the Arabidopsis database using Mascot with search parameters as detailed in Li et al. (2014). The DDA search results were transferred to Skyline software (MacLean et al., 2010) to generate SRM transitions to target AOX and aconitase peptides. The SRM measurements were performed on a TSQ Vantage QQQ mass spectrometer (Thermo Scientific). Both MS systems, Q-Exactive and TSQ Vantage, were equipped with a nanoelectrospray ion source. In addition, the chromatographic separation of the peptides was carried out using a similar nanoLC system connected to both mass spectrometers (Easy-nLC, Thermo Scientific). For the SRM measurements, the mass spectrometer was operated in the positive ion mode with a capillary temperature of 270°C, spray voltage of + 1600 V and collision gas pressure of 1.2 mTorr. Measurements in unscheduled mode were performed with a cycle time of 2.5 s and a dwell time of c. 25 ms. A detailed description of the scheduled SRM analysis of ACONITASE 3 is given in Supporting Information Methods S1. SRM data analysis The peptide library was generated by importing the database search results from the DDA runs to Skyline (MacLean et al., 2010). The SRM peak groups were manually selected in Skyline Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

New Phytologist using the dotp values and the retention time information from both the DDA and SRM runs. For ACONITASE 2 and ACONITASE 3, the unique peptides (i.e. proteotypic peptides; Kuster et al., 2005) were selected according to Taylor et al. (2014). To enable correction of the retention times between the runs, a set of synthetic peptides (Biognosys) was spiked into the sample as described in Escher et al. (2012). Using in-gel-digested peptides from SDS-PAGE significantly lowered the complexity of the injected samples, when compared, for example, with whole-cell lysates commonly used in studies on SRM (Picotti et al., 2009). We exploited the low sample complexity for sensitive detection and relative quantification of aconitase phosphopeptides by SRM. The two most intense transitions for three selected proteotypic peptides (Ludwig et al., 2012) were selected for relative quantification. Peak areas for phosphorylated and non-phosphorylated forms of a proteotypic ACONITASE 3 peptide were determined within the same injection, and the relative abundance of the phosphopeptide was calculated as phosphopeptide/(phosphopeptide + non-phosphorylated peptide). Finally, values from four injections, representing four biological replicates, were averaged to assess the relative abundance of the phosphopeptide in each Arabidopsis genotype of interest.

Research 1253

KCN. Excised rosettes were floated on a DAB solution in the presence or absence of 5 mM KCN for 16 h in darkness, and thereafter illuminated with 130 lmol photons m2 s1 for 3 h. KCN treatment reduced H2O2 production in all the lines explored, demonstrating that the mitochondrial electron transfer chain made a significant contribution to ROS production in these experimental conditions (Fig. S1). Next, we compared the impact of SHAM, an inhibitor of AOX activity, on H2O2 levels in wild-type, pp2a-b0 c, pp2a-b0 f and pp2a-b0 cf leaves. To this end, excised rosettes were floated on a DAB solution in the presence or absence of 10 mM SHAM for 16 h in darkness, and thereafter either kept in darkness or illuminated with 130 lmol photons m2 s1 for 3 h. Subsequent examination of DAB staining revealed that treatment with SHAM slightly increased the staining of H2O2 in dark-treated pp2a-b0 c mutant leaves (Fig. 1). A visually more prominent increase in DAB staining was observed in light-exposed pp2a-b0 c (a)

(b)

Results Inhibition of AOX promotes localized formation of H2O2 in mature pp2a-b0 c leaves Previous studies indicated that PP2A-B0 c controls intracellular oxidative stress signalling in Arabidopsis, but provided no evidence for the involvement of the main antioxidant pools ascorbate or glutathione (Trotta et al., 2011a; Li et al., 2014). Nontargeted metabolite profiling instead indicated increased levels of amino acids and tricarboxylic acid (TCA) cycle intermediates in cat2 pp2a-b0 c double-mutant leaves (Li et al., 2014). This raised the question of whether PP2A-B0 c modulates cellular ROS homeostasis through adjustments in the composition of the mitochondrial electron transfer chain. To address this question, we first took a pharmacological approach to evaluate the possible impact of mitochondrial electron transfer pathways on H2O2 homeostasis in wild-type, pp2ab0 c, pp2a-b0 f and pp2a-b0 cf double-mutant leaves. The pp2a-b0 c mutant displays a conditional phenotype with premature yellowing and constitutive ROS production in distinct peripheral areas of mature leaves when grown under moderate light intensity and low humidity (Trotta et al., 2011a; Li et al., 2014; Fig. S1). The pp2a-b0 f mutant, lacking the PP2A-B0 f regulatory subunit, which among PP2A subunits shows the highest similarity to PP2A-B0 c (86% amino acid sequence identity; Rasool et al., 2014), showed no apparent stress symptoms and was included for comparison. A pp2a-b0 cf double mutant, in turn, did not undergo premature yellowing, but exhibited reduced growth indicative of moderate physiological stress (Fig. S1). First, we assessed the overall involvement of the mitochondrial electron transfer chain in H2O2 production by blocking the respiratory cytochrome pathway with a low concentration of Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

(c)

Fig. 1 Impact of ALTERNATIVE OXIDASE (AOX) inhibitor on reactive oxygen species (ROS) staining in Arabidopsis thaliana wild-type and pp2a-b0 c mutant. (a) Diaminobenzidine (DAB) staining of hydrogen peroxide (H2O2) in wild-type and pp2a-b0 c. Excised rosettes were floated on a DAB solution in the presence and absence of 12 mM salicylhydroxamic acid (SHAM) for 16 h, and thereafter either kept in darkness or illuminated with 130 lmol photons m2 s1 for 3 h. Bars, 1 cm. (b) Catalase controls showing the reactivity of DAB towards H2O2. Excised pp2a-b0 c rosettes were infiltrated for 5 min with DAB solution in the presence or absence of 12 mM SHAM and with and without 2 U ll1 catalase. After infiltration, the rosettes were illuminated for 3 h with the chemicals as indicated in the figure. Bars, 1 cm. (c) Representative leaf discs showing DAB staining after infiltration with water (H2O) or 20 mM H2O2. Bars, 5 mm. New Phytologist (2015) 205: 1250–1263 www.newphytologist.com

New Phytologist

1254 Research

single-mutant and pp2a-b0 cf double-mutant leaves (Figs 1, S1). An increase in DAB staining was also observed in light-exposed pp2a-b0 c when the SHAM-containing DAB solution was rapidly infiltrated into excised rosettes before the 3-h illumination, whereas co-infiltration of CAT into the leaves substantially reduced DAB staining (Fig. 1). These technical controls indicate that DAB primarily reacted with H2O2 in the experimental system (Fig. 1). In the pp2a-b0 f single mutant, the pattern of H2O2 staining did not differ from that of the wild-type or from the control samples incubated on DAB in the absence of additional chemicals (Fig. S1). The inhibition of cytochrome c oxidase (COX; complex IV) by KCN can result in the over-reduction of the ubiquinone pool, which may increase the probability of ROS formation at complexes I, II and III (Blokhina & Fagerstedt, 2010). However, under these circumstances, the reduced ubiquinone pool may become quenched through the AOX pathway. Therefore, to gain further support for the possible involvement of AOX in the mitigation of ROS production in pp2a-b0 c, we tested whether the decrease in ROS staining observed in KCN-treated plants could be reverted with combined effects of KCN and SHAM. Indeed, when both of the terminal oxidases (COX and AOX) were blocked, staining of H2O2 in pp2a-b0 c and pp2a-b0 cf was observed (Fig. S1). Taken together, these observations suggested that mature pp2a-b’c leaves may partially evade the accumulation of H2O2 via AOX activity. PP2A-B0 c interacts with the cytoplasmic form of ACONITASE 3 but not with AOX in planta To gain insights into the mechanisms underlying PP2A-B0 cdependent metabolic adjustments, full-length PP2A-B0 c was used as a bait in yeast two-hybrid screening against a cDNA library enriched for stress-related components (Jaspers et al., 2009). This led to the identification of ACONITASE 3 (AT2G05710) and AOX1A (AT3G22370) as candidate interactors for PP2A-B0 c (Table 1). The PP2A-B0 c protein is extremely low in abundance in Arabidopsis leaves (Trotta et al., 2011a), which hampered further analysis of protein interactions by pull-down assays. Therefore, we utilized BiFC, which deploys the heterologous expression of the proteins of interest and allows the visualization of interactions that are highly transient in nature. YFP fluorescence indication of protein interaction was consistently detected

in the epidermal cells of N. benthamiana leaves heterologously expressing the fusion proteins for PP2A-B0 c and ACONITASE 3 (Fig. 2). The observed pattern of interaction between PP2A-B0 c and ACONITASE 3 was well in line with the cytoplasmic localization of both enzymes (Carrari et al., 2003; Trotta et al., 2011a). Moreover, ACONITASE 3 is a phosphoprotein with at least two phosphopeptides with several potentially phosphorylated residues indicated by data deposited in the Arabidopsis Protein Phosphorylation Site Database (PhosPhAt; Durek et al., 2010). Protein import into mitochondria could also involve a transient regulatory phosphorylation of the precursor protein (Gerbeth et al., 2013). However, no in planta interaction between the phosphatase subunit PP2A-B0 c and AOX1A could be observed by BiFC (Fig. 2), regardless of reciprocal stereoisomeric constructions of YFP (data not shown). pp2a-b0 c mutants display increased levels of AOX1A and AOX1D in leaf mitochondria Next, we explored whether PP2A-B0 c affects the abundance of aconitase and/or AOX in leaf mitochondria. Immunoblot analysis of isolated mitochondria with anti-AOX antibody revealed increased abundance of AOX1A in pp2a-b0 c when compared with wild-type and pp2a-b0 f mutant (Fig. 3a). Notably, the AOX-specific antibody also detected a distinct 29-kDa protein in pp2a-b0 c (Fig. 3a). When separated by SDS-PAGE in the absence of the thiol-reducing agent DTT, both AOX1A and the 29-kDa protein gave rise to dimers and monomers (Fig. 3a), indicating that both proteins represent AOX isoforms, which are known to form dimers through a disulfide bridge (Umbach & Siedow, 1993). Re-probing the same membranes with an anti-aconitase antibody revealed no genotype-dependent adjustments in the abundance of aconitase in the isolated mitochondria (Fig. 3a). Further protein blot analysis detected the 29-kDa AOX also in the pp2a-b0 cf double mutant, albeit at a lower level than in pp2ab0 c (Fig. 3b). By contrast, no consistent changes were found in the level of cytochrome oxidase II (COXII) between the pp2a mutant lines (Fig. 3b).

Table 1 Candidate Arabidopsis thaliana PP2A-B0 c-interacting proteins related to mitochondrial function as identified by yeast two-hybrid screening AGI

Annotation

Phosphopeptides1

AT2G05710

ACONITASE 3

89

TFSSMASEHPFK100 LSVFDAAMRYKSSGED TIILAGAEYGSGSSR877

847

AT3G22370

AOX1A

1

–

Phosphopeptide according to the Arabidopsis Protein Phosphorylation Site Database (PhosPhAt).

New Phytologist (2015) 205: 1250–1263 www.newphytologist.com

Fig. 2 Bimolecular fluorescence complementation (BiFC) analysis of protein interactions in Nicotiana benthamiana transiently expressing the fusion protein pairs YN:ACONITASE 3 (ACO3)/YC:PP2A-B0 c (ACO3) and YN:PP2A-B0 c/YC:ALTERNATIVE OXIDASE 1A (AOX1A). Bars, 100 lm. Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

New Phytologist

Research 1255 (a)

(c)

(b)

(d)

Fig. 3 Increased abundance of ALTERNATIVE OXIDASES AOX1A and AOX1D in mitochondrial preparations of pp2a-b0 c and pp2a-b0 cf. (a) Representative images depicting immunoblot analysis of AOX dimers and monomers. Mitochondria corresponding to 10 lg of protein were separated by 10% sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in the presence (left panel) or absence (right panel) of 5 mM dithiothreitol (DTT). The lower panels depict the same membranes after re-probing with anti-aconitase antibody. (b) Representative images depicting immunoblot analysis of AOX abundance in pp2a mutants. Mitochondria corresponding to 10 lg of protein were separated by 10% SDS-PAGE in the presence of 5 mM DTT. Immunoblot analysis of cytochrome oxidase II (COXII) is shown for comparison. (c) Representative MS/MS spectra of unique peptides identified from AOX1A (upper panel) and AOX1D (lower panel). The peptide sequence is presented with all possible y- and b-ions. The detected ions are marked into the spectra. (d) Reverse transcription-polymerase chain reaction (RT-PCR) analysis of AOX1A and AOX1D mRNA in wild-type (light grey bars) and pp2a-b0 c (dark grey bars) plants. Band intensity values of the AOX1A and AOX1D amplicons of each sample were normalized to Actin 2 intensity values. The results are means  SE, n = 3–4 independent biological replicates. Student’s t-test did not indicate statistical differences falling below P < 0.05 between wild-type and pp2a-b0 c.

To identify the 29-kDa AOX isoform, we first located the corresponding band on a Coomassie-stained SDS-PAGE gel. This was achieved by separating pp2a-b0 c mitochondrial proteins on a 10% polyacrylamide gel, followed by subsequent partial transfer of the proteins onto a PVDF membrane. The gel was then stained with Coomassie and the PVDF membrane was probed with the anti-AOX antibody. By overlapping the images of the resulting X-ray film, the membrane and the Coomassie-stained gel, it became possible to precisely pinpoint the location of AOX isoforms on the gel. Next, we coupled data-dependent nanoLC/ESI-MS/MS and nanoLC/ESI-SRM to unequivocally identify the corresponding AOX isoforms in a stochastic data-dependent (MS/MS) and targeted (SRM) manner. For both MS methods, the matching bands were cut out from the gel and subjected to in-gel trypsin Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

digestion. The peptides were retrieved from the gel pieces, after which they were subsequently separated on an LC column and infused directly into the mass spectrometer (Fig. 3c). In the three biological replicates analysed, we were able to identify AOX1A from the upper band with proteotypic peptides, whereas the lower band contained proteotypic peptides for AOX1D (Figs 3c, S2; Table 2). No unique peptides for AOX1B, AOX1C or AOX2 isoforms were detected in either of the analysed AOX bands (Table 2). After blasting the peptide sequences against the Arabidopsis and Human protein databases to confirm their uniqueness, the information from the identified peptides was used to generate peptide assays for subsequent SRM analysis (Table 2). After converting the DDA data to SRM transitions, we targeted selected peptides unique to AOX1A (GIASYWGVEPNK and LPADATLR) or New Phytologist (2015) 205: 1250–1263 www.newphytologist.com

New Phytologist

1256 Research Table 2 Peptides identified by MS (nanoLC/ESI-MS/MS) AOX isoform

Sequence coverage (%)

Peptide identified

Peptide score

Expectation value

Unique1

AOX1A

28.5

AOX1D

6.6

LPADATLR2 GIASYWGVEPNK3 HHVPTTFLDR DVNHFASDIHYQGR IAYWTVK ADITIDLK DVVMVVR FEQSGGWIK EAPAPIGYH ALLEEAENER4 IPVQLFFQR2 VISTYWGIPPTK3

45 66 37 41 42 41 24 54 44 50 47 41

3.0E-004 4.6E-006 3.1E-003 1.8E-003 8.0E-004 7.6E-004 4.5E-002 6.6E-005 1.1E-003 1.6E-004 1.0E-004 9.4E-004

Yes Yes Yes Yes No No No No No No Yes Yes

All peptides identified for Arabidopsis thaliana AOX1A were found in the upper AOX band, whereas the peptides from AOX1D were found uniquely in the lower band, as presented in Fig. 2(b). 1 Peptides with sequence uniquely belonging to AOX1A or AOX1D. 2 Peptides presented in Fig. 3(c). 3 Peptides presented in Fig. 4. 4 Peptide presented in Fig. 5(a).

AOX1D (VISTYWGIPPTK and IPVQLFFQR), as well as peptides originally identified from AOX1A, but based on the amino acid sequence alignment found to be common for both isoforms (Table 2, Figs 4, S2). The SRM verification was performed with a triple-stage quadrupole mass spectrometer (TSQ Vantage, Thermo Scientific). These two instruments (Q-Exactive for DDA and TSQ Vantage for SRM) produce similar fragmentation spectra, which allow reliable SRM transition generation from the initial MS/MS spectra (de Graaf et al., 2011). In addition, both instrument setups were equipped with similar LC systems for similar peptide retention times. The dotp value is a measure that indicates the identity between the MS/MS spectral library peak intensities and transition peak areas. A linear scatter blot generated using the retention time information from both of the experiments, together with the high dotp value calculated by Skyline software, verified the correct peak group selection (Fig. 5; MacLean et al., 2010). As shown in Fig. 4, the peptides discriminating between the two isoforms were specifically found only in the corresponding AOX1A or AOX1D bands, which were detected by immunoblotting in Fig. 3(b). In addition to the unique target peptides assigned by the DDA experiments for the upper AOX1A and lower AOX1D bands (Table 2, Fig. 4), the targeted SRM analysis detected a common peptide (ALLEEAENER) that was originally identified solely from AOX1A (Table 2, Fig. 5a). This peptide was missed by the DDA experiment from the lower AOX1D band (Table 2), presumably because of the lower abundance of AOX1D. These findings reflect the extremely high sensitivity of SRM and its power in discrimination between protein isoforms (Taylor et al., 2014). To test whether the increased levels of AOX1A and/or AOX1D result from transcriptional induction of gene expression, we analysed the transcript levels of AOX1A and AOX1D in wildtype and pp2a-b0 c mutant leaves. As shown in Fig. 3(d), neither AOX1A nor AOX1D transcript levels showed any significant differences between wild-type and pp2a-b0 y. New Phytologist (2015) 205: 1250–1263 www.newphytologist.com

PP2A-B0 c is required to control the level of ACONITASE 3 phosphorylation in the cytoplasm Finally, we applied the combination of partial blotting and MS identification to obtain samples of low complexity for the detection of aconitase phosphopeptides in the total soluble extracts isolated from wild-type and pp2a-b0 c mutant leaves. To increase the chances for the identification of potential serine and threonine phosphorylation sites in the three aconitase isoforms, a list of masses for all 8–25-amino-acid peptides, and their respective phosphorylated forms, was included in the DDA analysis. In soluble leaf extracts, the anti-aconitase antibody recognized several bands, but MS identification revealed the presence of aconitase only in the 100-kDa band, whereas the lower molecular weight bands were devoid of aconitase (Fig. 6a). Proteotypic peptides were identified for aconitase 1 and ACONITASE 3, whereas all peptides identified for aconitase 2 were common with the other isoforms. The full list of peptides identified by DDA analysis is presented in Table S1. The DDA analysis detected a unique peptide of ACONITASE 3, 89TFSSMASEHPFK100, in both phosphorylated and non-phosphorylated forms in samples that originated from soluble leaf extracts of wild-type and pp2a-b0 c, and the peptide was also indicated in the PhosPhAt database (Table 1, Figs 6, S3). This prompted us to further assess the phosphorylation of aconitase isoforms in the 100-kDa band (Fig. 6) by the sensitive SRM methodology. The identified phosphopeptide, together with the aconitase phosphopeptides indicated in PhosPhAt, and three selected unique peptides for each aconitase isoform, were used to generate a library for SRM analysis. As our DDA analysis failed to detect unique peptides for aconitase 2 in leaf soluble extracts (Table S2), proteotypic peptides indicated by Taylor et al. (2014) were used in SRM. The full list of peptides used is indicated in Table S2. The values of the two most intense transitions for the phosphorylated and non-phosphorylated forms of Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

New Phytologist

Research 1257

Fig. 4 Identification of Arabidopsis thaliana ALTERNATIVE OXIDASE 1D (AOX1D) by selected reaction monitoring (SRM). Four isoform-specific peptides were detected from the samples labelled ‘upper band’ and ‘lower band’, referring to the bands detected in immunoblot analysis as presented in Fig. 3. The peptides GIASYWGVEPNK for AOXIA and VISTYWGIPPTK for AOX1D occupy the same position in the AOX protein sequence (see Supporting Information Fig. S2). Peptides LPADATLR for AOX1A and IPVQLFFQR for AOX1D also distinguish between these two different AOX isoforms, but are localized to different parts of the sequence. The peptide sequences are presented with all possible y- and b-ions. The co-eluting ion signals corresponding to the y- or b-ions are indicated by coloured lines above the peptide sequence.

89

TFSSMASEHPFK100 were used to calculate the relative abundance of phosphorylated ACONITASE 3 in wild-type and pp2a-b0 c (Fig. 7). Using in-gel-digested samples from SDS gels significantly reduced the amount of co-eluting peptides in SRM. Moreover, as the signals for the phosphorylated and non-phosphorylated peptides were measured and calculated from the same sample and from the same injection, the relative abundance of the phosphopeptide within individual samples could be calculated and thereafter averaged among biological replicates (Fig. 7). Using this approach, we repeatedly found a

Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

higher proportion of the phosphopeptide in pp2a-b0 c relative to the wild-type, and this tendency did not correlate with the intensity of ACONITASE 3 peak areas as detected using three different proteotypic peptides (Fig. S4). In soluble extracts isolated from pp2a-b0 c leaves, c. 6% of the unique ACONITASE 3 peptide was in its phosphorylated form, whereas, in the wild-type plants, the relative proportion of the phosphopeptide was c. 3%. Although all aconitase isoforms were detected by SRM (Fig. S4), no additional aconitase phosphopeptides were observed in any of the samples analysed. New Phytologist (2015) 205: 1250–1263 www.newphytologist.com

1258 Research

New Phytologist et al., 2014). Here, by utilizing biochemical and pharmacological approaches, and a combination of DDA MS and SRM, we demonstrate that PP2A-B0 c negatively regulates the abundance of AOX1A and AOX1D complexes in leaf mitochondria (Figs 3, 4). In addition, PP2A-B0 c modulates the level of ACONITASE 3 phosphorylation in the cytoplasm (Fig. 7). Thus, PP2A-dependent regulatory actions, involving direct physical interactions with metabolic enzymes, such as ACONITASE 3 (Figs 2, 7), may have far-reaching effects on the outcomes of ROS-mediated acclimation processes in plants. PP2A-B0 c interacts with cytosolic ACONITASE 3 – a key component in basic metabolism and signalling

Fig. 5 Selected reaction monitoring (SRM) analysis of a peptide common to Arabidopsis thaliana AOX1A and AOX1D. A common peptide for both isoforms, ALLEEAENER, was originally detected only from the ‘upper band’ (AOX1A isoform) using data-dependent analysis (DDA). However, using SRM, the peptide was detected from both samples. The lower intensity of the peptide in a ‘lower band’ possibly contributed to the DDA results (no detection of the peptide). The zoom-in depicts the abundance of the common peptide in the ‘lower band’ representing the less abundant AOX1D. The difference in intensities is also illustrated in the column chart, which sums the intensities of all the transitions from the given peak group. The observed retention times from the DDA runs were plotted together with the retention times observed in SRM runs. The linear correlation further confirms the correct peak group selection. The peptide sequence is presented with all possible y- and b-ions. The co-eluting ion signals corresponding to the y- or b-ions are indicated by coloured lines next to the peptide sequence.

Discussion Plants are highly responsive to external cues and deploy controlled production of ROS as a molecular mechanism to elicit physiological reprogramming under environmental stress conditions. Although the importance of ROS in cellular signalling has become well established, the signalling interactions and feedback regulation loops involved are still not fully understood. We have identified a specific regulatory B0 c subunit of PP2A as a central component that regulates organellar ROS signalling and associated metabolic alterations in Arabidopsis (Trotta et al., 2011a; Li New Phytologist (2015) 205: 1250–1263 www.newphytologist.com

The formation of ROS through light-dependent organellar pathways is intrinsically connected with the regulatory networks that determine the nature of defensive measures in green tissues (Rhoads et al., 2006; Giraud et al., 2008; Chaouch et al., 2010; Gleason et al., 2011; Hoffmann et al., 2013; Karpi nski et al., 2013; Perez-Perez et al., 2013). The cytoplasmic PP2A-B0 c phosphatase subunit directs the function of PP2A in such a way that unnecessary SA-dependent pathogenesis responses triggered by photorespiratory ROS signals from peroxisomes become suppressed (Trotta et al., 2011a; Li et al., 2014). PP2A phosphatases are trimeric enzymes and their target phosphoproteins are essentially determined by the highly variable regulatory B subunits, which, in Arabidopsis, are encoded by 17 distinct genes. Our recent metabolomic and phosphoproteomic studies have demonstrated PP2A-B0 c-dependent modulations in metabolic activities and redox signalling components, such as the SOD CSD2, the monodehydroascorbate reductase MDAR2 and glutathione S-transferase GSTF2 with well-known roles in plant resistance to stress (Trotta et al., 2011a; Li et al., 2014). Here, we show that PP2AB0 c physically interacts with ACONITASE 3 and is required to control its phosphorylation level in the cytoplasm (Figs 2, 7). ACONITASE 3 activity is functionally tightly connected with both primary carbon metabolism and the regulation of cellular redox balance (Moeder et al., 2007). By providing the substrate for isocitrate dehydrogenase, which catalyses the oxidative decarboxylation of isocitrate to a-ketoglutarate, CO2 and NADH, aconitase may contribute to the availability of reducing equivalents under stress conditions. This view is supported by a recent analysis of Arabidopsis mutants deficient in the cytoplasmic isoform of isocitrate dehydrogenase (cICDH) (Mhamdi et al., 2010b). Although icdh mutants showed no growth penalty in optimal conditions, cICDH was required to prevent oxidation of the glutathione pool and over-amplification of defence responses on pathogen infection (Mhamdi et al., 2010b). Studies have also connected cytoplasmic aconitase activity with the antioxidant network and cell death regulation in plants (Moeder et al., 2007). Paradoxically, however, Arabidopsis and N. benthamiana plants with reduced aconitase levels displayed increased resistance against methyl viologen-induced oxidative stress (Moeder et al., 2007). Moreover, aconitase was shown to play an important role in activating the cell death response at early stages of infection with avirulent bacteria. At later stages, Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

New Phytologist

Research 1259 (a)

(b)

Fig. 6 Identification of Arabidopsis thaliana aconitase isoforms and ACONITASE 3 phosphopeptide. (a) Localization of the aconitase band in sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) after partial blotting and Coomassie staining of the poly(vinylidene difluoride) (PVDF) membrane and the gel. The arrow indicates the band containing aconitase. (b) Representative MS/MS spectra of 89TFSSMASEHPFK100 (upper panel) and 89 TFSSMASEHPFK100 phosphorylated on serine 91 (lower panel). The peptide sequence is presented with all possible y- and b-ions. The detected ions are marked into the spectra.

however, aconitase was required to contain the spread of cell death lesions outside of infected areas (Moeder et al., 2007). The molecular function and the switch behind this regulation remain unknown. Mechanistically, it could involve redox-dependent post-translational modifications and consequent changes in the functional status of cytoplasmic aconitase. Under oxidative stress conditions, oxidation-induced release of iron ion from the labile FeS cluster of aconitase may inhibit its enzymatic activity, and the accumulation of free iron may also promote an abrupt ROS burst through the formation of hydroxyl radicals in the Fenton reaction (Navarre et al., 2000). In mammalian cells, the enzymatic aconitase activity and the stability of the iron cluster are regulated through a range of posttranslational modifications, including phosphorylation, nitrosylation and oxidation of surface-exposed residues (Lushchak et al., 2014). These regulatory actions are significant, as oxidation of the iron cluster turns the mammalian cytosolic aconitase into an iron regulatory protein (IRP1), which recognizes iron-responsive elements of mRNAs, affects their translation and hence mediates a vital function in free iron regulation. Associated with this, biochemical characterization provided evidence that phosphorylation of IRP1 at Ser138 destabilizes the iron cluster by enhancing 4Fe–3Fe cycling (Deck et al., 2009). In plants, cytosolic aconitase does not act as an IRP and its significance in iron homeostasis is not well understood (Dupuy et al., 2006; Arnaud et al., 2007; Moeder et al., 2007). Our study (Fig. 7) and large-scale phosphoproteomic studies by other laboratories (Sugiyama et al., 2008; Reiland et al., 2009) have detected phosphorylation at Ser91 in Arabidopsis ACONITASE 3, but its physiological impact remains obscure. A plausible scenario would be that PP2A-B0 c-dependent dephosphorylation of ACONITASE 3 hinders the progression of oxidative stress through structural Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

rearrangements that increase the stability of the FeS cluster in cytosolic aconitase 3. PP2A-B0 c-mediated dephosphorylation of ACONITASE 3 could also contribute to the maintenance of primary metabolism under oxidative stress conditions. This view is supported by the recent report by Li et al. (2014), who observed a reduced level of the aconitase substrate citric acid in non-symptomatic green pp2a-b0 c leaves. However, promotion of intracellular oxidative stress conditions by introduction of the cat2 mutation into the pp2a-b0 c background resulted in an increased level of citrate and mobilization of amino acids in cat2 pp2a-b0 c, possibly to fuel the activation of SA defence responses (Li et al., 2014). Such metabolic adjustments may increase the need for the quenching of excess reducing equivalents through the mitochondrial electron transfer chain, which is well in line with the observed increase in the abundance of AOX1A and AOX1D in pp2a-b0 c leaves (Figs 3, 4; Vanlerberghe & McIntosh, 1996). One of the key unresolved questions is to what extent the level of ACONITASE 3 phosphorylation is modulated under oxidative stress. In this respect, it is worth noting that the 6% of phosphorylated ACONITASE 3 observed for pp2a-b0 c single-mutant leaves compared with the 3% of phosphorylation in the wild-type reflects the situation in whole 4-wk-old Arabidopsis rosettes (Fig. 7). The promoter of PP2A-B0 c, however, is active in patches that closely resemble the areas that yellow in an age-dependent manner in mature pp2a-b0 c leaves (Trotta et al., 2011a). More detailed proteomic comparison of yellowing and green leaf areas of pp2a-b0 c can therefore be expected to provide further insights into the physiological role of ACONITASE 3 phosphorylation under oxidative stress conditions. Moreover, the identification of the protein kinase responsible for ACONITASE 3 phosphorylation, combined with the characterization of transgenic lines expressing ACONITASE 3 New Phytologist (2015) 205: 1250–1263 www.newphytologist.com

1260 Research (a)

(b)

Fig. 7 Quantification of relative 89TFSSMASEHPFK100 phosphorylation of Arabidopsis thaliana ACONITASE 3 by scheduled selected reaction monitoring (SRM). (a) Representative SRM chromatograms relative to phosphorylated (left panel) and non-phosphorylated (right panel) forms of 89TFSSMASEHPFK100. The upper panel indicates the transitions used. (b) Percentage of phosphorylated 89TFSSMASEHPFK100 peptide in wild-type and pp2a-b0 c. The relative abundance of the phosphopeptide was quantified as (phosphorylated/(phosphorylated + nonphosphorylated)) peptide. The results are  SD of four biological replicates; asterisk, t-test, P < 0.05. The peptide sequences are presented with all possible y- and b-ions. The co-eluting ion signals corresponding to the y- or b-ions are indicated by coloured lines below the peptide sequence.

with a mutated phosphorylation site, will aid in the understanding of this post-translational modification. Although the underlying molecular mechanisms are not yet fully understood, it is evident that the functional hierarchy among cytoplasmic metabolic enzymes and NADPH generating systems, and their regulation by reversible phosphorylation, provides plants with a mechanism to specifically determine the metabolic state, cellular redox status as well as the nature of defensive reactions under stress conditions (Mhamdi et al., 2010b; Dal Santo et al., 2012). New Phytologist (2015) 205: 1250–1263 www.newphytologist.com

New Phytologist PP2A-B0 c is required to control the abundance of AOX1A and AOX1D isoforms in leaf mitochondria Alterations in primary metabolism are readily reflected in the functional status of AOX in leaf mitochondria (Gupta et al., 2012). To ensure the delicate regulation of the alternative electron transfer pathway, AOX is regulated at multiple levels, including transcriptional induction by citrate and ROS, allosteric activation by pyruvate and reduction of the regulatory disulfide bridge by thioredoxin (Vanlerberghe & McIntosh, 1997; Mackenzie & McIntosh, 1999; Rhoads & Vanlerberghe, 2004; Rhoads et al., 2006). Our findings suggest that PP2A-B0 c-dependent alterations in organellar signalling are associated with increased abundance of AOX1A and AOX1D in leaf mitochondria (Figs 3, 4). Despite the apparent prevalence of SA signalling responses in pp2a-b0 c (Trotta et al., 2011a; Li et al., 2014), we found no evidence for the differential regulation of AOX1A or AOX1D transcript abundance in pp2a-b0 c relative to the wild-type (Fig. 3). AOX gene expression has become a model for studies on mitochondrial retrograde signalling, and a number of reports on various plant species have suggested that the individual AOX genes are specifically responsive to different stress conditions (Rhoads & Vanlerberghe, 2004; Rhoads et al., 2006; Rasmussen et al., 2009). In Arabidopsis, the predominantly expressed and most responsive isoform is AOX1A, which displays several-fold induction in response to a number of experimental stress conditions (Clifton et al., 2005; Elhafez et al., 2006; Rasmussen et al., 2009). Recent studies have started to uncover the molecular components underlying the regulation of AOX gene expression in plants. These include the transcription factor ABSCISIC ACID INSENSITIVE 4 (ABI4) with well-established roles in organelle retrograde signalling and plant resistance to biotic and abiotic stress (Koussevitzky et al., 2007; Giraud et al., 2008). Another nuclear-localized component, the cyclin-dependent kinase E1 (CDKE1), has been assigned a function as a cellular switch that determines the growth and elicitation of stress reactions in plants (Ng et al., 2013). The strict transcriptional regulation of AOX1A under different biotic and abiotic stress conditions presumably reflects its role in the amelioration of hazardous metabolic fluctuations (Rasmussen et al., 2009). Although AOX1A seems to play a broad role in modulating cellular ROS, redox and/or metabolic homeostasis, the functional significance of AOX1D has remained poorly understood (Strodtk€otter et al., 2009). Visualization of gene expression profiles by the Genevestigator tool (https://www.genevestigator.com) suggests that AOX1A and AOX1D share partially overlapping responses to environmental perturbations, but that AOX1D is typically induced to a lesser extent. In addition, the spatiotemporal patterns of AOX1A and AOX1D gene expression seem to differ, AOX1D being highly expressed in senescing leaves. Therefore, AOX1A and AOX1D do not seem to be functionally fully redundant. This conclusion is also supported by the observation that increased abundance of AOX1D mRNA in aox1a leaves did not protect the mutant from antimycin A-induced oxidative damage (Strodtk€otter et al., 2009). Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

New Phytologist Our findings suggest that PP2A-B0 c-dependent modulation of AOX1A and AOX1D abundance occurs at a post-transcriptional level (Fig. 3). For AOX1A, adjustments at the protein level have also been well documented, whereas, to the best of our knowledge, modulations in the abundance of AOX1D have not been reported previously. Immunoblot analysis with AOX antibodies has, however, detected a faint immunoresponse at c. 29 kDa, which corresponds to the size of AOX1D (Ng et al., 2013). Recently, Taylor et al. (2014) highlighted the experimental problems caused by cross-reactivity of polyclonal antibodies towards protein isoforms, and developed a Web-based tool for the selection of candidate SRM transitions that can be utilized for highly specific targeted analysis. We report a method whereby a combination of immunoblotting, DDA and subsequent targeted analysis by SRM enables the accurate discrimination between specific protein isoforms (Figs 4, 5). Through this methodological approach, we found that the levels of AOX1A and AOX1D, and consequently the foliar levels of ROS, are negatively regulated by PP2A-B0 c (Figs 1, 3). These findings suggest that both AOX1A and AOX1D are involved in the regulation and fine-tuning of ROS signalling and metabolic pathways in foliar tissues. The respiratory protein complexes of the mitochondrial electron transfer chain form a key contributor to localized ROS accumulation during plant stress responses (Gleason et al., 2011). By transferring electrons from ubiquinone to molecular oxygen, AOXs provide an alternative sink for excess reductants, and may thereby reduce the formation of ROS, not only in mitochondria, but also through metabolic shuttles in chloroplasts and peroxisomes of stress-exposed plants (Hanning & Heldt, 1993; Igamberdiev & Gardestr€om, 2003; Scheibe et al., 2005; Foyer & Noctor, 2009; Van Aken et al., 2009). In addition, AOX activity may allow more rapid function of the citric acid cycle, and has also been proposed to counteract deleterious metabolic fluctuations on environmental challenges (Rasmussen et al., 2009). AOX therefore essentially contributes to processes that occur outside of mitochondria. Indeed, as demonstrated by Giraud et al. (2008), AOX1A is required for full tolerance against the combined effects of light stress and drought. Regulation of AOX1A and AOX1D levels through pathways governed by PP2A-B0 c may therefore represent a key point in the maintenance of metabolic homeostasis, defence responses and light acclimation in plants.

Acknowledgements This work was supported by Academy of Finland projects 263772, 218157, 259888, 130595 and 271832, Finnish Graduate Program in Plant Biology and University of Turku Graduate School to G.K., A.T., G.D., M.R. and S.K. K.F. and O.B. were supported by the Academy of Finland project 123826. We thank Pekka Haapaniemi and Arttu Heinonen from the Turku Proteomics Facility for excellent assistance and the support from the Biocentre Finland Proteomics and Metabolomics infrastructure to conduct this work. The Salk Institute Genomic Analysis Laboratory is acknowledged for providing the sequence-indexed Arabidopsis T-DNA insertion mutants. Confocal imaging was Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

Research 1261

performed at the Cell Imaging Core, Turku Centre for Biotechnology, University of Turku and  Abo Akademi University.

References Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R et al. 2003. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657. Arnaud N, Ravet K, Borlotti A, Touraine B, Boucherez J, Fizames C, Briat JF, Cellier F, Gaymard F. 2007. The iron-responsive element (IRE)/ iron-regulatory protein 1 (IRP1)-cytosolic aconitase iron-regulatory switch does not operate in plants. Biochemical Journal 405: 523–531. Baxter A, Mittler R, Suzuki N. 2014. ROS as key players in plant stress signalling. Journal of Experimental Botany 65: 1229–1240. Blokhina O, Fagerstedt KV. 2010. Reactive oxygen species and nitric oxide in plant mitochondria: origin and redundant regulatory systems. Physiologia Plantarum 138: 447–462. Carrari F, Nunes-Nesi A, Gibon Y, Lytovchenko A, Loureiro EM, Fernie AR. 2003. Reduced expression of aconitase results in an enhanced rate of photosynthesis and marked shifts in carbon partitioning in illuminated leaves of wild species tomato. Plant Physiology 133: 1322–1335. Chaouch S, Queval G, Vanderauwera S, Mhamdi A, Vandorpe M, Langlois-Meurinne M, Van Breusegem F, Saindrenan P, Noctor G. 2010. Peroxisomal hydrogen peroxide is coupled to biotic defense responses by ISOCHORISMATE SYNTHASE1 in a daylength-related manner. Plant Physiology 153: 1692–1705. Clifton R, Lister R, Parker KL, Sappl PG, Elhafez D, Millar AH, Day DA, Whelan J. 2005. Stress-induced co-expression of alternative respiratory chain components in Arabidopsis thaliana. Plant Molecular Biology 58: 193–212. Dal Santo S, Stampfl H, Krasensky J, Kempa S, Gibon Y, Petutschnig E, Rozhon W, Heuck A, Clausen T, Jonak C. 2012. Stress-induced GSK3 regulates the redox stress response by phosphorylating glucose-6-phosphate dehydrogenase in Arabidopsis. Plant Cell 8: 3380–3392. Deck KM, Vasanthakumar A, Anderson SA, Goforth JB, Kennedy MC, Antholine WE, Eisenstein RS. 2009. Evidence that phosphorylation of iron regulatory protein 1 at Serine 138 destabilizes the [4Fe–4S] cluster in cytosolic aconitase by enhancing 4Fe–3Fe cycling. Journal of Biological Chemistry 284: 12701–12709. Dupuy J, Volbeda A, Carpentier P, Darnault C, Moulis JM, Fontecilla-Camp JC. 2006. Crystal structure of human iron regulatory protein 1 as cytosolic aconitase. Structure 14: 129–139. Durek P, Schmidt R, Heazlewood JL, Jones A, Maclean D, Nagel A, Kersten B, Schulze WX. 2010. PhosPhAt: the Arabidopsis thaliana phosphorylation site database. An update. Nucleic Acids Research 38: D828–D834. Elhafez D, Murcha MW, Clifton R, Soole KL, Day DA, Whelan J. 2006. Characterization of mitochondrial alternative NAD(P)H dehydrogenases in Arabidopsis: intraorganelle location and expression. Plant and Cell Physiology 47: 43–54. Escher C, Reiter L, MacLean B, Ossola R, Herzog F, Chilton J, MacCoss MJ, Rinner O. 2012. Using iRT, a normalized retention time for more targeted measurement of peptides. Proteomics 12: 1111–1121. Finnegan PM, Whelan J, Millar AH, Zhang Q, Smith MK, Wiskich JT, Day DA. 1997. Differential expression of the multigene family encoding the soybean mitochondrial alternative oxidase. Plant Physiology 114: 455–466. Foyer CH, Noctor G. 2009. Redox regulation in photosynthetic organisms: signaling, acclimation, and practical implications. Antioxidants and Redox Signaling 11: 861–905. Gerbeth C, Mikropoulou D, Meisinger C. 2013. From inventory to functional mechanisms: regulation of the mitochondrial protein import machinery by phosphorylation. FEBS Journal 280: 4933–4942. Giraud E, Ho LH, Clifton R, Carroll A, Estavillo G, Tan YF, Howell KA, Ivanova A, Pogson BJ, Millar AH et al. 2008. The absence of ALTERNATIVE OXIDASE1a in Arabidopsis results in acute sensitivity to combined light and drought stress. Plant Physiology 147: 595–610. Gleason C, Huang S, Thatcher LF, Foley RC, Anderson CR, Carroll AJ, Millar AH, Singh KB. 2011. Mitochondrial complex II has a key role in New Phytologist (2015) 205: 1250–1263 www.newphytologist.com

1262 Research mitochondrial-derived reactive oxygen species influence on plant stress gene regulation and defense. Proceedings of the National Academy of Sciences, USA 108: 10768–10773. de Graaf EL, Altelaar AF, van Breukelen B, Mohammed S, Heck AJ. 2011. Improving SRM assay development: a global comparison between triple quadrupole, ion trap, and higher energy CID peptide fragmentation spectra. Journal of Proteome Research 10: 4334–4341. Gupta KJ, Shah JK, Brotman Y, Jahnke K, Willmitzer L, Kaiser WM, Bauwe H, Igamberdiev AU. 2012. Inhibition of aconitase by nitric oxide leads to induction of the alternative oxidase and to a shift of metabolism towards biosynthesis of amino acids. Journal of Experimental Botany 63: 1773–1784. Hanning I, Heldt HW. 1993. On the function of mitochondrial metabolism during photosynthesis in spinach (Spinacia oleracea L.) leaves (partitioning between respiration and export of redox equivalents and precursors for nitrate assimilation products). Plant Physiology 103: 1147–1154. Hoffmann C, Plocharski B, Haferkamp I, Leroch M, Ewald R, Bauwe H, Riemer J, Herrmann JM, Neuhaus HE. 2013. From endoplasmic reticulum to mitochondria: absence of the Arabidopsis ATP antiporter endoplasmic reticulum adenylate transporter1 perturbs photorespiration. Plant Cell 25: 2647–2660. Igamberdiev AU, Gardestr€ om P. 2003. Regulation of NAD- and NADP-dependent isocitrate dehydrogenases by reduction levels of pyridine nucleotides in mitochondria and cytosol of pea leaves. Biochimica et Biophysica Acta 1606: 117–125. Jaspers P, Blomster T, Brosche M, Saloj€arvi J, Ahlfors R, Vainonen JP, Reddy RA, Immink R, Angenent G, Turck F et al. 2009. Unequally redundant RCD1 and SRO1 mediate stress and developmental responses and interact with transcription factors. Plant Journal 60: 268–279. Kangasj€a rvi S, Lepist€o A, H€a nnik€a inen K, Piippo M, Luomala EM, Aro EM, Rintam€aki E. 2008. Diverse roles for chloroplast stromal and thylakoid-bound ascorbate peroxidases in plant stress responses. Biochemical Journal 412: 275– 285. Kangasj€a rvi S, Neukermans J, Li S, Aro EM, Noctor G. 2012. Photosynthesis, photorespiration, and light signalling in defence responses. Journal of Experimental Botany 63: 1619–1636. Karpi nski S, Szechy nska-Hebda M, Wituszy nska W, Burdiak P. 2013. Light acclimation, retrograde signalling, cell death and immune defences in plants. Plant, Cell & Environment 36: 736–744. Kim C, Meskauskiene R, Zhang S, Lee KP, Lakshmanan Ashok M, Blajecka K, Herrfurth C, Feussner I, Apel K. 2012. Chloroplasts of Arabidopsis are the source and a primary target of a plant-specific programmed cell death signaling pathway. Plant Cell 24: 3026–3039. Koussevitzky S, Nott A, Mockler TC, Hong F, Sachetto-Martins G, Surpin M, Lim J, Mittler R, Chory J. 2007. Signals from chloroplasts converge to regulate nuclear gene expression. Science 316: 715–719. Kuster B, Schirle M, Mallick P, Aebersold R. 2005. Scoring proteomes with proteotypic peptide probes. Nature Reviews Molecular Cell Biology 6: 577–583. Li S, Mhamdi A, Trotta A, Kangasj€a rvi S, Noctor G. 2014. The regulatory subunit B0 c of protein phosphatase 2A acts downstream of oxidative stress in the control of salicylic acid responses by peroxisomal H2O2. New Phytologist 202: 145–160. Ludwig C, Claassen M, Schmidt A, Aebersold R. 2012. Estimation of absolute protein quantities of unlabeled samples by selected reaction monitoring mass spectrometry. Molecular & Cellular Proteomics 11: M111.013987: 1–16. Lushchak OV, Piroddi M, Galli F, Lushchak VI. 2014. Aconitase post-translational modification as a key in linkage between Krebs cycle, iron homeostasis, redox signaling, and metabolism of reactive oxygen species. Redox Reports 19: 8–15. Mackenzie S, McIntosh L. 1999. Higher plant mitochondria. Plant Cell 11: 571– 586. MacLean B, Tomazela DM, Shulman N, Chambers M, Finney GL, Frewen B, Kern R, Tabb DL, Liebler DC, MacCoss MJ. 2010. Skyline: an open source document editor for creating and analyzing targeted proteomics experiments. Bioinformatics 26: 966–968. Maruta T, Noshi M, Tanouchi A, Tamoi M, Yabuta Y, Yoshimura K, Ishikawa T, Shigeoka S. 2012. H2O2-triggered retrograde signaling from chloroplasts to New Phytologist (2015) 205: 1250–1263 www.newphytologist.com

New Phytologist nucleus plays specific role in response to stress. Journal of Biological Chemistry 287: 11717–11729. Mhamdi A, Mauve C, Gouia H, Saindrenan P, Hodges M, Noctor G. 2010b. Cytosolic NADP-dependent isocitrate dehydrogenase contributes to redox homeostasis and the regulation of pathogen responses in Arabidopsis leaves. Plant, Cell & Environment 33: 1112–1123. Mhamdi A, Queval G, Chaouch S, Vanderauwera S, Van Breusegem F, Noctor G. 2010a. Catalase function in plants: a focus on Arabidopsis mutants as stress-mimic models. Journal of Experimental Botany 61: 4197–4220. Mittler R, Vanderauwera S, Gollery M, Van Breusegem F. 2004. The reactive oxygen gene network in plants. Trends in Plant Science 9: 490–498. Moeder W, Del Pozo O, Navarre DA, Martin GB, Klessig DF. 2007. Aconitase plays a role in regulating resistance to oxidative stress and cell death in Arabidopsis and Nicotiana benthamiana. Plant Molecular Biology 63: 273–287. Navarre DA, Wendehenne D, Durner J, Noad R, Klessig DF. 2000. Nitric oxide modulates the activity of tobacco aconitase. Plant Physiology 122: 573–582. Ng S, Giraud E, Duncan O, Law SR, Wang Y, Xu L, Narsai R, Carrie C, Walker H, Day DA et al. 2013. Cyclin-dependent kinase E1 (CDKE1) provides a cellular switch in plants between growth and stress responses. Journal of Biological Chemistry 288: 3449–3459. Nomura H, Komori T, Uemura S, Kanda Y, Shimotani K, Nakai K, Furuichi T, Takebayashi K, Sugimoto T, Sano S et al. 2012. Chloroplast-mediated activation of plant immune signalling in Arabidopsis. Nature Communications 3: 926. Perez-Perez JM, Esteve-Bruna D, Gonza lez-Bayon R, Kangasj€a rvi S, Caldana C, Hannah MA, Willmitzer L, Ponce MR, Micol JL. 2013. Functional redundancy and divergence within the Arabidopsis RETICULATA-RELATED gene family. Plant Physiology 162: 589–603. Picotti P, Bodenmiller B, Mueller LN, Domon B, Aebersold R. 2009. Full dynamic range proteome analysis of S. cerevisiae by targeted proteomics. Cell 138: 795–806. Rasmussen AG, Fernie AR, van Dongen JT. 2009. Alternative oxidase: a defence against metabolic fluctuations? Physiologia Plantarum 137: 371–382. Rasool B, Karpinska B, Konert G, Durian G, Denessiouk K, Kangasj€a rvi S, Foyer CH. 2014. Effects of light and the regulatory Beta subunit composition of protein phosphatase 2A on the susceptibility of Arabidopsis thaliana to aphid (Myzus persicae) infestation. Frontiers in Plant Science 5: 405. Reiland S, Messerli G, Baerenfaller K, Gerrits B, Endler A, Grossmann J, Gruissem W, Baginsky S. 2009. Large-scale Arabidopsis phosphoproteome profiling reveals novel chloroplast kinase substrates and phosphorylation networks. Plant Physiology 150: 889–903. Rhoads DM, Umbach AL, Subbaiah CC, Siedow JN. 2006. Mitochondrial reactive oxygen species. Contribution to oxidative stress and interorganellar signaling. Plant Physiology 141: 357–366. Rhoads DM, Vanlerberghe GC. 2004. Mitochondria–nucleus interactions: evidence for mitochondrial retrograde communication in plant cells. In: Day DA, Millar AH, Whelan J, eds. Advances in photosynthesis and respiration, Vol 17. Dordrecht, the Netherlands: Kluwer Academic Publishers, 83–106. Scheibe R, Backhausen JE, Emmerlich V, Holtgrefe S. 2005. Strategies to maintain redox homeostasis during photosynthesis under changing conditions. Journal of Experimental Botany 56: 1481–1489. Sierla M, Rahikainen M, Saloj€arvi J, Kangasj€arvi J, Kangasj€a rvi S. 2013. Apoplastic and chloroplastic redox signaling networks in plant stress responses. Antioxidants and Redox Signaling 18: 2220–2239. Strodtk€otter I, Padmasree K, Dinakar C, Speth B, Niazi PS, Wojtera J, Voss I, Do PT, Nunes-Nesi A, Fernie AR et al. 2009. Induction of the AOX1D isoform of alternative oxidase in A. thaliana T-DNA insertion lines lacking isoform AOX1A is insufficient to optimize photosynthesis when treated with antimycin A. Molecular Plant 2: 284–297. Sugiyama N, Nakagami H, Mochida K, Daudi A, Tomita M, Shirasu K, Ishihama Y. 2008. Large-scale phosphorylation mapping reveals the extent of tyrosine phosphorylation in Arabidopsis. Molecular Systems Biology 4: 193. Sweetlove LJ, Taylor NL, Leaver CJ. 2007. Isolation of intact, functional mitochondria from the model plant Arabidopsis thaliana. Methods in Molecular Biology 372: 125–136. Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

New Phytologist Taylor NL, Fenske R, Castleden I, Tomaz T, Nelson CJ, Millar AH. 2014. Selected reaction monitoring to determine protein abundance in Arabidopsis using the Arabidopsis proteotypic predictor. Plant Physiology 164: 525–536. Thordal-Christensen H, Zhang Z, Wei Y, Collinge DB. 1997. Subcellular localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive response during the barley–powdery mildew interaction. Plant Journal 11: 1187–1194. Trotta A, Konert G, Rahikainen M, Aro EM, Kangasj€a rvi S. 2011b. Knock-down of protein phosphatase 2A subunit B0 c promotes phosphorylation of CALRETICULIN 1 in Arabidopsis thaliana. Plant Signaling and Behaviour 6: 1665–1668. Trotta A, Wrzaczek M, Scharte J, Tikkanen M, Konert G, Rahikainen M, Holmstr€om M, Hiltunen HM, Rips S, Sipari N et al. 2011a. Regulatory subunit B0 c of protein phosphatase 2A prevents unnecessary defense reactions under low light in Arabidopsis. Plant Physiology 156: 1464–1480. Umbach AL, Fiorani F, Siedow JN. 2005. Characterization of transformed Arabidopsis with altered alternative oxidase levels and analysis of effects on reactive oxygen species in tissue. Plant Physiology 139: 1806–1820. Umbach AL, Siedow JN. 1993. Covalent and noncovalent dimers of the cyanide-resistant alternative oxidase protein in higher plant mitochondria and their relationship to enzyme activity. Plant Physiology 103: 845–854. Vaahtera L, Brosche M, Wrzaczek M, Kangasj€a rvi J. 2014. Specificity in ROS signaling and transcript signatures. Antioxidants and Redox Signaling 21: 1422– 1441. Van Aken O, Zhang B, Carrie C, Uggalla V, Paynter E, Giraud E, Whelan J. 2009. Defining the mitochondrial stress response in Arabidopsis thaliana. Molecular Plant 2: 1310–1324. Vanlerberghe GC, McIntosh L. 1997. ALTERNATIVE OXIDASE: from gene to function. Annual Review of Plant Physiology and Plant Molecular Biology 48: 703–734. Vanlerberghe GC, McIntosh I. 1996. Signals regulating the expression of the nuclear gene encoding alternative oxidase of plant mitochondria. Plant Physiology 111: 589–595. Waadt R, Kudla J. 2008. In planta visualization of protein interactions using bimolecular fluorescence complementation (BiFC). Cold Spring Harbor Protocols 2008: t4995. Walter M, Chaban C, Sch€ utze K, Batistic O, Weckermann K, N€a ke C, Blazevic D, Grefen C, Schumacher K, Oecking C et al. 2004. Visualization of protein interactions in living plant cells using bimolecular fluorescence complementation. Plant Journal 40: 428–438. Zhang L, Li Y, Xing D, Gao C. 2009. Characterization of mitochondrial dynamics and subcellular localization of ROS reveal that HsfA2 alleviates

Research 1263 oxidative damage caused by heat stress in Arabidopsis. Journal of Experimental Botany 60: 2073–2091.

Supporting Information Additional supporting information may be found in the online version of this article. Fig. S1 Impact of mitochondrial electron transfer chain on reactive oxygen species (ROS) staining in Arabidopsis thaliana wildtype and pp2a mutants. Fig. S2 Amino acid sequence alignment between Arabidopsis thaliana ALTERNATIVE OXIDASE 1A and 1D. Fig. S3 Amino acid sequence alignment between Arabidopsis thaliana aconitase isoforms 1, 2 and 3. Fig. S4 Selected reaction monitoring (SRM) detection of aconitase isoforms. Table S1 List of peptides identified with Q-Exactive for the three Arabidopsis thaliana aconitase isoforms Table S2 List of peptides and relative transitions used in selected reaction monitoring (SRM) to detect Arabidopsis thaliana aconitase isoforms Methods S1 Selected reaction monitoring (SRM) method optimization for analysis of proteotypic peptide 89TFSSMASEHPFK100 of Arabidopsis thaliana ACONITASE 3. Please note: Wiley Blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office.

New Phytologist is an electronic (online-only) journal owned by the New Phytologist Trust, a not-for-profit organization dedicated to the promotion of plant science, facilitating projects from symposia to free access for our Tansley reviews. Regular papers, Letters, Research reviews, Rapid reports and both Modelling/Theory and Methods papers are encouraged. We are committed to rapid processing, from online submission through to publication ‘as ready’ via Early View – our average time to decision is