Clin Transl Oncol DOI 10.1007/s12094-013-1127-9
RESEARCH ARTICLE
Proteomic analysis of differentially expressed proteins in 5-fluorouracil-treated human breast cancer MCF-7 cells J. Cai • S. Chen • W. Zhang • Y. Wei J. Lu • J. Xing • Y. Dong
•
Received: 9 September 2013 / Accepted: 22 October 2013 Ó Federacio´n de Sociedades Espan˜olas de Oncologı´a (FESEO) 2013
Abstract Background 5-Fluorouracil (5-Fu) is a commonly used chemotherapeutic agent in clinical care of breast cancer patients. However, the mechanism of how the 5-Fu works is complex and still largely unknown. Objective The objective of this study was to understand the mechanism further and explore the new targets of 5-Fu. Methods The differentially expressed proteins induced by 5-Fu in human breast cancer MCF-7 cells were identified by proteomic analysis. Four differentially expressed proteins were validated using Western blot and quantitative real-time reverse-transcription polymerase chain reaction analysis for protein and mRNA levels. The effect of 5-Fu on MCF-7 cells was determined by cell viability assay, transmission electron microscopy and flow cytometry analysis. Results 5-Fu dose-dependently inhibited cell proliferation with the IC50 value of 98.2 lM. 5-Fu also induced obviously morphological change and apoptosis in MCF-7 cells. Twelve differentially expressed proteins involved in energy metabolism, cytoskeleton, cellular signal transduction and tumor invasion and metastasis were identified.
J. Cai and S. Chen contributed equally to this work. J. Cai S. Chen W. Zhang Y. Wei J. Lu Y. Dong (&) Department of Pharmacy, The First Affiliated Hospital of Medical College, Xi’an Jiaotong University, Xi’an 710061, China e-mail: [email protected] J. Xing (&) Department of Pharmacy, College of Medicine, Xi’an Jiaotong University, Xi’an 710061, China e-mail: [email protected]
Conclusion These results may provide a new insight into the molecular mechanism of 5-Fu in therapy of breast cancer. Keywords 5-Fluorouracil Breast cancer Apoptosis Proteomics Guanine nucleotide-binding protein subunit beta-2-like 1
Introduction 5-Fluorouracil (5-Fu), a kind of synthetic antimetabolic drug, has become one of the most widely used anticancer agents since it was first synthesized in 1957 [1]. In the present study, it has been found that 5-Fu can induce a variety of tumor cells apoptosis and have certain effects on various cancers including digestive tract tumor, chorionic epithelial cancer, gastric cancer, and colorectal cancer [2– 4]. The curative effect of 5-Fu for breast cancer is outstanding. It is commonly used in clinical breast cancer chemotherapy project, such as project CMF (cyclophosphamide/methotrexate/5-Fu), project CAF (cyclophosphamide/adriamycin/5-Fu) and project FEC (cyclophosphamide/epirubicin/5-Fu). The known mechanism of action of 5-Fu is as follows: 5-Fu is converted intracellularly to three major active metabolites: fluorodeoxyuridine monophosphate (FdUMP), fluorodeoxyuridine triphosphate (FdUTP) and fluorouridine triphosphate (FUTP). The active metabolites of 5-Fudisrupt RNA synthesis (FUTP), inhibit the action of thymidylate synthase (TS) which is a nucleotide synthetic enzyme (FdUMP), and it can be mismerged into DNA (FdUTP), leading to RNA damage and DNA damage [5]. However, the process of tumor development is complex. As a first-line anticancer drug, the effect of 5-Fu may be the result of multiple mechanisms. In
123
Clin Transl Oncol
this study, we compared the changes of MCF-7 human breast cancer cells cycle distribution, apoptosis and proteins expression induced by 5-Fu, expecting to deeply discuss the mechanism of 5-Fu and identify new targets of 5-Fu by proteomics.
were collected and pre-fixed with cold glutaraldehyde and then fixed with 1 % osmic acid solution for 2 h. Cells were washed with phosphate buffer solution (PBS), dehydrated in graded ethanol solution and embedded in spur resin for overnight, stained with 1 % uranyl acetate and washed with water. Samples were examined in transmission election microscope (Hitachi H-7650, Japan).
Materials and methods Annexin V-FITC/PI analysis Chemicals and reagents 5-Fluorouracil was purchased from Shanghai Xudong Haipu Pharmaceutical Co. (Shanghai, China). 3-(4,5Dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), propidium iodide (PI) and RNase were obtained from Sigma Co. (USA). All reagents used in two-dimensional electrophoresis (2-DE) experiment were purchased from Bio-Rad Laboratories (Hercules, USA).
Apoptosis assay was performed according to the manufacturer’s instructions (Annexin-V FLUOS staining kit, Invitrogen, USA). Briefly, MCF-7 cells treated with 98.2 lM 5-Fu for 12, 24 and 48 h, respectively. Then, cells were harvested and stained with Annexin V-FITC/PI and analyzed by flow cytometry (BD Bioscience, USA). Triplicate experiments were implemented for flow cytometric analysis. Cell cycle distribution analysis
Cell culture The human breast cancer cell line MCF-7 was obtained from Cell Bank of Shanghai, Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China), and cells were cultured in RPMI-1640 (Gibco, USA) with 10 % newborn bovine serum (PAA, USA), 100 U/mL of penicillin, and 100 mg/mL of streptomycin in a humidified atmosphere with 5 % CO2 at 37 °C. Cell viability assay Cells were seeded in 96-well microplate (Corning, USA) for 24 h and treated with various concentrations of 5-Fu for 48 h. Then 20 lL of MTT solution (5 mg/mL) was added to each well and incubated at 37 °C for 4 h. The purple crystals were dissolved in 150 lL of DMSO. Optical absorbance was determined at 490 nm with a microplate reader (BioTek, USA). Each treatment was performed in sextuplicate and each experiment was repeated three times. Cell survival ratio was calculated using Atreated/Acontrol 9 100 %, where Atreated and Acontrol were the absorbance of treated and control cells after 48 h incubation, respectively. Calculate the half-maximal inhibitory concentration (IC50) of 5-Fu in MCF-7 cells. The IC50 value was defined as the concentration that caused 50 % inhibition of cell proliferation.
The MCF-7 cells at a concentration of 5 9 105 cell/mL were seeded into six-well plate in 2 mL culture medium with a concentration of IC50 value of 5-Fu and were incubated at 37 °C in an atmosphere of 5 % CO2 for 12, 24 and 48 h. Cells without treatment were used as a control. After the incubation period, the cultured cells were harvested using trypsin and centrifuged. Then cells were fixed gently with 70 % of cold ethanol overnight at 4 °C. After suspension in PBS, cells were incubated with RNase at 37 °C for 15 min. Next, the cells were incubated with PI on ice for 15 min in the dark. The cell cycle distribution of each sample was then determined immediately using flow cytometry (BD Bioscience, USA). All experiments were performed in triplicate and yielded similar results. Sample preparation for 2-DE MCF-7 cells (1 9 106) were treated with 98.2 lM 5-Fu for 48 h and harvested by trypsinization. Cell pellets were lysed in lysis buffer containing 8 M urea, 2 M thiourea, 4 % CAHPS, 50 mM DTT, protease inhibitor cocktail and 0.2 % Bio-lyte at 4 °C for 30 min. The lysates were homogenized and centrifuged at 20,664g for 30 min and stored at -80 °C until use. The concentrations of protein samples were determined using Bradford assay. 2-DE and image analyses
Effect of 5-Fu on MCF-7 cells morphology The morphological change of MCF-7 cells induced by 5-Fu was observed by transmission electron microscopy. Cells were plated into six-well plates each at a density of 106 for 24 h. After treatment with 98.2 lM 5-Fu for 48 h, cells
123
For 2-DE analysis, nonlinear IPG strips (pH 3–10) 17 cm were rehydrated in swelling buffer containing 8 M urea, 2 M thiourea, 4 % CHAPS, 100 mM DTT, 0.2 % IPG buffer, 0.2 % Bio-lyte and 0.002 % bromophenol blue. The protein samples and lysis buffer were mixed, making the
Clin Transl Oncol
total sample volume to 350 lL. After rehydration for 16 h, IPG strips were focused successively for 1 h at 250 V, 1 h at 1,000 V, and 5 h at 10,000 V to give a total of 60,000 vh on an isoelectric focusing system (IEF). Following IEF, IPG strips were equilibrated for 15 min in equilibration buffer containing 2 % DTT, 6 M urea, 2 % SDS, 0.05 M Tris–HCl, pH 8.8, and 20 % glycerol and then equilibrated for another 15 min in the same equilibration buffer (containing 2.5 % iodoacetamide instead of DTT). The 2-DE separation was performed on 12 % gradient SDS-polyacrylamide gels. Following fixation of the gels in a solution of 10 % ethanol containing 7 % acetic acid, the gels were stained with colloidal Coomassie blue G-250 solution. The stained gels were scanned using UMax Powerlook 2110XL (Umax). Protein spot detection and 2-DE pattern matching were carried out using PDQuest 7.1 Software. Only those significantly (P \ 0.05) and consistently up- or downregulated spots ([1.5-fold) after treatment in three independent experiments were selected for further analysis. In-gel digestion Proteins spots were cut into gel particles and washed twice with sterile ultrapure water for 10 min each and 25 mM ammonium bicarbonate for 20 min. After centrifugation, samples were destained with equal volumes of 30 mM potassium ferricyanide and 100 mM sodium thiosulfate twice for 30 min each. The destained gel spots were equilibrated with 25 mM ammonium bicarbonate for 20 min and dried in a vacuum centrifuge to complete desiccation. The dried gel particles were rehydrated with 20 lg/mL trypsin in 40 mM ammonium bicarbonate (pH 8.0)/10 % acetonitrile and were incubated at 37 °C overnight. Trypsinated gel particles were collected in two extractions: the first was by agitation in 5 % trifluoroacetic acid at 40 °C for 1 h and the second was by agitation in 50 % acetonitrile containing 5 % trifluoroacetic acid at 37 °C for 1 h. The collected and combined peptide solutions were dried by vacuum centrifugation for about 24 h. Then the extracted peptide solutions were reconstituted with 5 lL of 50 % acetonitrile containing 0.1 % acetic acid for analysis.
MALDI-TOF–MS analysis The mass spectra were obtained using MALDI-TOF/TOF Mass Spectrometer (Biosystems, USA). Protein identification was performed automatically by searching the EBI database using the MASCOT 2.2 search engine (Matrix Science, UK). Database search was performed using the following parameters: enzyme, trypsin, and allowance of one missed cleavage, carbamidomethylation was selected as a fixed modification and oxidation of methionine was allowed to be variable. The peptide and fragment mass tolerance were set at 100 ppm and 0.4 Da, respectively. Proteins with probability-based MOWSE scores (P \ 0.05) were considered credible. Western blot Western blot assay was performed according to the reference instruction [6]. MCF-7 cells were treated with 98.2 lM 5-Fu for 48 h, lysed in lysis buffer (Beyotime, China) on ice for 30 min. After centrifuging at 13,225g for 15 min, the supernatant was collected and protein concentration was determined by BCA reagent (Beyotime, China). The lysates were subjected to Western blotting by alpha-enolase, enoyl-CoA hydratase short chain 1, guanine nucleotide-binding protein subunit beta-2-like 1 (abcam, UK), protein disulfide isomerase 3 (GeneTax, USA) and b-actin (Beijing biosynthesis biotechnology, China) antibodies. b-Actin was used as an internal control. All Western blots were repeated at least three times for each experiment. Q-PCR analysis The MCF-7 cells were treated with 98.2 lM 5-Fu for 48 h and the total mRNA was extracted using RNAfast2000 kit (Fastagen, China) according to the manufacturer’s instruction. Q-PCR was performed using the PrimeScript RT Master Mix Perfect Real Time Kit (TaKaRa DRR036A) and SYBR Premix Ex Taq II (TaKaRa). The primers sequences and products are listed in Table 1. The experiments were run on the Thermal Cycler Dice Real
Table 1 List of primers used in Q-PCR Gene
Forward primer (50 ? 30 )
Reverse primer (50 ? 30 )
Product size (bp)
ECHS1
CGATGGAGATGGTCCTCAC
GCACACTGGATGGCTTCTTC
115
GNB2L1
GGGTCACTCCCACTTTGTTAGT
ACACTCAGCACATCCTTGGTAT
153
PDIA3
TCGTCCTTCACATCTCACTAACA
TCCTTGCCCTGTATCAAATCTT
159
ENO1
TCCCTTTGACCAGGATGACT
GACTTTGAGCAGGAGGCAGTT
151
b-Actin
TGACGTGGACATCCGCAAAG
CTGGAAGGTGGACAGCGAGG
205
123
Clin Transl Oncol
Time System (TaKaRa) with the following parameters: 1 cycle of predenaturation of 95 °C for 30 s, 40 cycles of 95 °C for 5 s, various annealing temperature for 30 s depending on the target gene (59 °C for ENO1 and GNB2L1, 57 °C for PDIA3, 60 °C for ECHS1, and 56 °C for b-actin), and a cooling program of 60 °C for 30 s. b-Actin was used as an internal control gene.
of the control, 5-Fu treatment for 12 h, 5-Fu treatment for 24 h and 5-Fu treatment for 48 h were 2.1 ± 0.6, 4.1 ± 0.3, 8.6 ± 0.4 and 49.9 ± 2.8 %, respectively. The cell apoptotic rate of the 5-Fu treatment for 24 and 48 h was markedly higher than the cell apoptotic rate of control group (P \ 0.01). 5-Fu induced apoptosis in MCF-7 cells in a time-dependent manner (P \ 0.01).
Statistical analysis
Cell cycle distribution analysis
Each experiment was repeated at least three times. Statistical analysis was carried out using the program SPSS 16.0 (Chicago, IL, USA). Statistical analyses were carried out using one-way ANOVA. Results were presented as mean ± SD. P \ 0.05 was considered statistically significant.
Based on the preliminary assays in which we determined the effects of 5-Fu on cell proliferation, 98.2 lM of 5-Fu was selected for further in vitro mechanistic studies. As we found a significant growth inhibitory effect of 5-Fu on MCF-7 cells, we determined the possible inhibitory effect of 5-Fu on cell cycle progression. As summarized in Fig. 2b and c, compared with MCF-7 cells, 5-Fu induced increasing number of cells in the G1-phase and a concomitant reduction in the S-phase and G2/M-phase in a time-dependent manner (P \ 0.05), this experiment indicated that 5-Fu induces G1-phase cell cycle arrest in MCF7 cells.
Results Cell viability assay To assess the effects of 5-Fu on MCF-7 cell proliferation, the cells were treated with 5-Fu at 0, 7.5, 15, 30, 60, 120, 240, 480, 960, and 1,920 lM concentrations for 48 h. Cell viability was measured using MTT assay (Fig. 1a). The data indicated that 5-Fu treatment for 48 h dose-dependently inhibited cell growth (P \ 0.01). The IC50 value of 5-Fu in MCF-7 cells was determined as 98.2 lM. Effect of 5-Fu on MCF-7 cells morphology As shown in Fig. 1b (a1 and a2), MCF-7 cells exhibited abundant irregular microvilli at the cell surface (arrow 1), and the nuclei and cytoplasm were normal and homogeneous. When treated with 5-Fu for 48 h, MCF-7 cells exhibited a significant change in morphology. As shown in Fig. 1b (b1 and b2), the microvilli at the cell surface disappeared with increasing vacuoles in the cytoplasm (arrow 2). The nucleus was abnormal and the fragmented chromatin arranged against the nuclear membrane (arrow 3). The typical characteristics of apoptosis including chromatin marginal (arrow 3), apoptotic body (arrow 4) and mitochondrial edema (arrow 5) emerged. In addition, expanded rough endoplasmic reticulum appeared (arrow 6) and the glycogen (arrow 7) in MCF-7 cells vanished after treatment with 5-Fu. Annexin V-FITC/PI analysis The apoptosis rate of MCF-7 cells induced by 5-Fu was quantified by flow cytometry after Annexin V-FITC/PI staining (Fig. 2a). Results showed that the apoptotic rates
123
Differential expression of proteins induced by 5-Fu In 2-DE-based proteomic analysis, three gels per sample were analyzed simultaneously. After automatic spot detection, background subtraction, and volume normalization, 50 protein spots were found to be differentially expressed between 5-Fu-treated group and control group, of which 26 spots were up-regulated and 24 spots downregulated. Twelve proteins were preliminarily identified by MALDI-TOF–MS (showed in Fig. 3a, b; Table 2). The up-regulated proteins are alpha-enolase (ENO1), nucleophosmin isoform 3, protein disulfide isomerase A3 (PDIA3) and one unknown protein, while down-regulated proteins are isoform 1 of triosephosphate isomerase (TPI1), fascin-1, guanine nucleotide-binding protein subunit beta-2-like 1 (GNB2L1), lasp-1, 78-kDa glucoseregulated protein (GRP78), enoy- CoA hydratases short chain 1 (ECHS1), keratin 8 (K8) and one unknown protein. Western blot To verify the identified proteins, we selected four differentially expressed proteins including PDIA3, GNB2L1, ECHS1, and ENO1 to be validated by Western blot (Fig. 4a). Consistent with the observations in 2-DE analysis, PDIA3 and ENO1 proteins were found significantly up-regulated (P \ 0.01), while ECHS1 and GNB2L1 were significantly down-regulated (P \ 0.01) in 5-Fu-treated cells compared with MCF-7 cells.
Clin Transl Oncol Fig. 1 Growth inhibition of MCF-7 cells induced by 5-Fu. a MCF-7 cells were treated with 5-Fu at indicated concentration for 48 h. Cell viability was measured using MTT assay. Data are represented as the mean ± SD from three repeated experiments *P \ 0.05, **P \ 0.01 by ANOVA, vs. untreated control cells. b Morphological change of MCF-7 cells following 5-Fu exposure. a1 and a2, MCF-7 cells; b1 and b2, MCF-7 cells treated with 5-Fu
Q-PCR analysis To further validate protein changes from proteomic profile with the occurrence of mRNA expression, Q-PCR were carried out for mRNAs of ECHS1, GNB2L1, PDIA3 and ENO1 detection. The mRNA expression of ECHS1 and GNB2L1 were down-regulated (P \ 0.01), while PDIA3 and ENO1 were up-regulated (P \ 0.01) in 5-Fu treatment cells compared with MCF-7 cells (Fig. 4b). The results
demonstrated that the changes for these genes in mRNA expression levels were consistent with its protein level by proteomics.
Discussion In this study, we validated the anti-proliferative properties of 5-Fu and further investigated the effect of 5-Fu
123
Clin Transl Oncol
Fig. 2 5-Fu induces MCF-7 cell apoptosis and G1-phase arrest. a Apoptosis analysis of MCF-7 cells treated with 98.2 lM 5-Fu for 12, 24 and 48 h, respectively. Cells were stained with Annexin V-FITC/PI and analyzed using flow cytometry (viable cells are in the lower left quadrant, early apoptotic cells are in the lower right quadrant, late apoptotic cells are in the upper right quadrant and
necrotic cells are in the upper left quadrant). b 5-Fu induced G1phase arrest. MCF-7 cells treated with 5-Fu for 12, 24 and 48 h, respectively. DNA content was determined by flow cytometry after ethanol fixation and PI staining of the cells. c Percentage of cell cycle phases. Values represent the mean ± SD of three independent experiments (*P \ 0.05, **P \ 0.01 by ANOVA, vs. MCF-7)
on the global protein expression in breast cancer MCF-7 cells using proteomic technique. Twelve differentially expressed proteins were successfully identified by MALDI-TOF–MS analysis with four up-regulated proteins and eight down-regulated proteins and two were unknown proteins. Moreover, differential expression of
four proteins was validated by Western blot and Q-PCR analysis for protein and mRNA expression levels, respectively. These proteins are involved in energy metabolism, cytoskeleton, signal transduction and tumor metastasis. Their roles in the anticancer activity of 5-Fu are discussed below.
123
Clin Transl Oncol
Fig. 3 The distribution of different proteins in samples of MCF-7 cells treated with or without 5-Fu for 48 h according to 2-DE protein maps. a Comparing the gels between MCF-7 cells and cells treated
with 5-Fu, the 12 differentially expressed protein spots were labeled with arrow for MS analysis. b Close-up view of the 12 differentially expressed proteins
Three proteins participated in energy metabolism were identified, including ENO1, TPI1 and ECHS1, and shown as spots 1, 2 and 12, respectively. ENO1 was a metalloenzyme that participates in the glycolytic pathway. It can suppress cancer cell growth by regulating MEK5-mediated signal pathway [7]. Besides, ENO1 could selectively inhibit the expression of Bcl-xL, releasing cytochrome C from the mitochondria and inducing tumor cell apoptosis
[8]. TPI1 as an important enzyme contacts with various metabolic pathways and was highly expressed in many tumor cells, participating in energy supplying of tumor cells, promoting tumor cells proliferation and differentiation [9, 10]. ECHS1 localizes to the mitochondrial matrix and functions in the second step of the mitochondrial fatty acid beta-oxidation pathway. The decreased expression of ECHS1 in mitochondria can reduce tumor cells
123
Clin Transl Oncol Table 2 Differentially expressed proteins identified by MALDI-TOF–MS Spot no.
Accession no.
Protein name
PI/Mr (kDa)
Peptide matched
Score
Sequence coverage (%)
Expression after treated with 5-Fu
1
IPI00465248
Alpha-enolase
7.01/47.48
16
277
39
Up
2
IPI00797270
Isoform 1 of triosephosphate isomerase
6.45/26.94
19
682
90
Down
3
IPI00658013
Nucleophosmin isoform 3
4.56/28.50
8
168
33
Up
4
IPI00163187
Fascin-1
6.84/55.12
13
361
34
Down
5
IPI00848226
Guanine nucleotide-binding protein subunit beta-2-like 1
7.6/35.51
11
413
33
Down
6
IPI00883946
Lasp-1
9.04/19.03
8
277
46
Down
7
IPI00025252
Protein disulfide isomerase A3
5.98/57.15
7
138
16
Up
8
IPI00003362
78 kDa glucose-regulated protein
5.07/72.40
20
979
36
Down
9
IPI00922693
Uncharacterized protein
5.23/38.90
7
90
28
Up
10
IPI00021439
Uncharacterized protein
5.29/42.05
14
738
47
Down
11
IPI01021414
Keratin 8
5.37/56.57
23
672
43
Down
12
IPI00024993
Enoyl-CoA hydratase, short chain, 1, mitochondrial
8.34/31.82
4
242
20
Down
Fig. 4 The result of 2-DE was validated by Western blot assay and Q-PCR analysis. a Protein levels of ECHS1, GNB2L1, PDIA3 and ENO1 were determined by Western blot analysis. Relative protein expression is shown as mean ± SD. b-Actin was loading control. b MCF-7 cells were treated with 5-Fu for 48 h and the mRNA expressions of proteins were detected by Q-PCR. All experiments were repeated in triplicate (*P \ 0.05, **P \ 0.01 by ANOVA, vs. MCF-7)
mitochondrial membrane potential, promoting cytochrome C release and inducing tumor cell apoptosis [11]. ECHS1 may be a key enzyme, which participates in mitochondriamediated apoptosis pathway. Therefore, up-regulation of ENO1, down-regulation of TPI1 and ECHS1 may activate cell apoptosis and block the energy source, and finally induce apoptosis in MCF-7 cells.
123
Two proteins involved in cytoskeleton were identified, including fascin-1 and K8, shown as spots 4 and 11, respectively. Fascin-1 is an actin-bundling protein, absent in most normal epithelia but highly expressed in many human cancers [12]. Studies have shown that fascin-1 protein expression is correlated with poor prognosis [13]. K8 is widely expressed in a lot of cancers cells and tissues,
Clin Transl Oncol
which can inhibit PI3K/Akt/NF-jB signal pathway hyperactivation, decrease the expression of MMP2 and MMP9, and then inhibit apoptosis of tumor cells [14]. Therefore, down-regulation of fascin-1 and K8 expression may contribute to the apoptotic effect of 5-Fu. Three proteins associated with tumor metastasis were identified, including lasp-1, PDIA3 and GRP78 shown as spots 6, 7 and 8, respectively. Lasp-1 participates in cell interaction. Its overexpression will stimulate cancer cell growth and migration in vitro, and promote aggressive phenotypes of cancer cells in vivo by regulating the expression of various key molecules [15]. GRP78 localizes in the lumen of the endoplasmic reticulum and involves in the folding and assembly of proteins. A considerable amount of research has indicated that GRP78 was found to be up-regulated in about half of all cancers and promoted tumor metastasis [16]. PDIA3 also known as endoplasmic reticulum protein 57 (ERP57) could dictate indirectly the immunogenicity of tumor cell death by controlling the translocation of calreticulin. It also can regulate gene MSH6, TMEM126A and LRBA expression to interfere the DNA synthesis of tumor cells [17]. The decreased lasp-1 and GRP78 expression and elevated PDIA3 expression in 5-Fu-treated MCF-7 cells may cause apoptosis as observed in our assays. Two proteins involved in cellular signal transduction were identified, including NPM1 and GNB2L1 shown as spots 3 and 5. NPM1 is a common biomarker in acute myeloid leukemia and mainly locates in nucleolus, participating in the transportation between nuclear and cytoplasm by signal transduction [18]. The elevated NPM1 expression in response to 5-Fu treatment may relate to apoptosis during exchange between nuclear and cytoplasma and information transmission. GNB2L1 also named as RACK1, a 36-kDa homolog of the b-subunit of G proteins, was originally identified based on its ability to bind the activated form of protein kinase C and to facilitate its protein trafficking within cells [19]. GNB2L1 has been identified to interact with four signaling pathways, including PKC, PDE4D5 (a cyclic AMP-specific phosphordiesterase), tyrosine kinases/phosphatases, and signal transducers and activators of transcription 3 (STAT3), which are involved in cell growth, adhesion, movement, and migration [20]. It suggested that GNB2L1 might share function in carcinogenesis, as reported in multiple tumor types [21, 22]. Reports found that GNB2L1 was strongly related to commonly used biomarkers Ki67 [23]. It also found that GNB2L1 expression was also significantly associated with the pathological stage, tumor size and lymph node status of adenocarcinoma patients, but not with tumor differentiation, or patient age and gender. These results suggest that GNB2L1 may be a novel differential diagnostic marker for cancers [24]. In our study, the
decreased GNB2L1 expression in response to 5-Fu treatment may activate multiple signal pathways, thereby inducing apoptosis in MCF-7 cells. In conclusion, in the report we carried out the proteomic approach to identify proteins involved in the action mechanisms of 5-Fu in MCF-7 cells. Some of the 12 proteins participate in energy supply of tumor cells and some involve in cellular signal transduction promoting tumor invasion and metastasis. 5-Fu blocked up the energy source of MCF-7 cells and decreased the expression of carcinogenic proteins, which was different from the known mechanism of 5-Fu (DNA damage and RNA damage). Acknowledgments The work was supported by the National Natural Science Foundation of China (No. 30973578 and 30973673). Conflict of interest There is no any conflict of interest for all authors.
References 1. Heidelberger C, Chaudhuri NK, Danneberg P, Mooren D, Griesbach L, Duschinsky R, et al. Fluorinated pyrimidines, a new class of tumour-inhibitory compounds. Nature. 1957;179:663–6. 2. Chuang-Xin L, Wen-Yu W, Yao C, Xiao-Yan L, Yun Z. Quercetin enhances the effects of 5-fluorouracil-mediated growth inhibition and apoptosis of esophageal cancer cells by inhibiting NF-kappaB. Oncol Lett. 2012;4:775–8. 3. Gravalos C, Salut A, Garcia-Giron C, Garcia-Carbonero R, Leon AI, Sevilla I, et al. A randomized phase II study to compare oxaliplatin plus 5-fluorouracil and leucovorin (FOLFOX4) versus oxaliplatin plus raltitrexed (TOMOX) as first-line chemotherapy for advanced colorectal cancer. Clin Transl Oncol. 2012;14:606–12. 4. Garrido-Laguna I, Amador ML, Ruiz J, Cortes-Funes H. Acute ischaemic cerebrovascular attack secondary to infusional 5-fluoruracil and cisplatin in a patient with advanced gastric cancer. Clin Transl Oncol. 2009;11:183–5. 5. Parker WB, Cheng YC. Metabolism and mechanism of action of 5-fluorouracil. Pharmacol Ther. 1990;48:381–95. 6. Wang L, Zhang B, Xu X, Zhang S, Yan X, Kong F, et al. Clinical significance of FOXP3 expression in human gliomas. Clin Transl Oncol. 2013. doi:10.1007/ s12094-013-1037-x. 7. Ghosh AK, Steele R, Ray RB. c-Myc promoter-binding protein 1 (MBP-1) regulates prostate cancer cell growth by inhibiting MAPK pathway. J Biol Chem. 2005;280:14325–30. 8. Ghosh AK, Majumder M, Steele R, Liu TJ, Ray RB. MBP-1 mediated apoptosis involves cytochrome c release from mitochondria. Oncogene. 2002;21:2775–84. 9. Chen G, Gharib TG, Huang CC, Thomas DG, Shedden KA, Taylor JM, et al. Proteomic analysis of lung adenocarcinoma: identification of a highly expressed set of proteins in tumors. Clin Cancer Res. 2002;8:2298–305. 10. Roth U, Razawi H, Hommer J, Engelmann K, Schwientek T, Muller S, et al. Differential expression proteomics of human colorectal cancer based on a syngeneic cellular model for the progression of adenoma to carcinoma. Proteomics. 2010;10:194–202. 11. Liu X, Feng R, Du L. The role of enoyl-CoA hydratase short chain 1 and peroxiredoxin 3 in PP2-induced apoptosis in human breast cancer MCF-7 cells. FEBS Lett. 2010;584:3185–92. 12. Kulasingam V, Diamandis EP. Fascin-1 is a novel biomarker of aggressiveness in some carcinomas. BMC Med. 2013;11:53. 13. Tan VY, Lewis SJ, Adams JC, Martin RM. Association of fascin-1 with mortality, disease progression and metastasis in carcinomas: a systematic review and meta-analysis. BMC Med. 2013;11:52. 14. Busch T, Armacki M, Eiseler T, Joodi G, Temme C, Jansen J, et al. Keratin 8 phosphorylation regulates keratin reorganization and migration of epithelial tumor cells. J Cell Sci. 2012;125:2148–59. 15. Wang H, Li W, Jin X, Cui S, Zhao L. LIM and SH3 protein 1, a promoter of cell proliferation and migration, is a novel independent prognostic indicator in hepatocellular carcinoma. Eur J Cancer. 2013;49:974–83. 16. Martin S, Lamb HK, Brady C, Lefkove B, Bonner MY, Thompson P, et al. Inducing apoptosis of cancer cells using small-molecule plant compounds that bind to GRP78. Br J Cancer. 2013;109:433–43.
123
Clin Transl Oncol 17. Obeid M. ERP57 membrane translocation dictates the immunogenicity of tumor cell death by controlling the membrane translocation of calreticulin. J Immunol. 2008;181:2533–43. 18. Greiner J, Schneider V, Schmitt M, Gotz M, Dohner K, Wiesneth M, et al. Immune responses against the mutated region of cytoplasmatic NPM1 might contribute to the favorable clinical outcome of AML patients with NPM1 mutations (NPM1mut). Blood. 2013;122:1087–8. 19. Ruan Y, Sun L, Hao Y, Wang L, Xu J, Zhang W, et al. Ribosomal RACK1 promotes chemoresistance and growth in human hepatocellular carcinoma. J Clin Invest. 2012;122:2554–66. 20. Cao XX, Xu JD, Liu XL, Xu JW, Wang WJ, Li QQ, et al. RACK1: a superior independent predictor for poor clinical outcome in breast cancer. Int J Cancer. 2010;127:1172–9.
123
21. Berns H, Humar R, Hengerer B, Kiefer FN, Battegay EJ. RACK1 is up-regulated in angiogenesis and human carcinomas. Faseb J. 2000;14:2549–58. 22. Myklebust LM, Akslen LA, Varhaug JE, Lillehaug JR. Receptor for activated protein C kinase 1 (RACK1) is overexpressed in papillary thyroid carcinoma. Thyroid. 2011;21:1217–25. 23. Wang Z, Zhang B, Jiang L, Zeng X, Chen Y, Feng X, et al. RACK1, an excellent predictor for poor clinical outcome in oral squamous carcinoma, similar to Ki67. Eur J Cancer. 2009;45:490–6. 24. Nagashio R, Sato Y, Matsumoto T, Kageyama T, Satoh Y, Shinichiro R, et al. Expression of RACK1 is a novel biomarker in pulmonary adenocarcinomas. Lung Cancer. 2010;69:54–9.
RESEARCH ARTICLE
Proteomic analysis of differentially expressed proteins in 5-fluorouracil-treated human breast cancer MCF-7 cells J. Cai • S. Chen • W. Zhang • Y. Wei J. Lu • J. Xing • Y. Dong
•
Received: 9 September 2013 / Accepted: 22 October 2013 Ó Federacio´n de Sociedades Espan˜olas de Oncologı´a (FESEO) 2013
Abstract Background 5-Fluorouracil (5-Fu) is a commonly used chemotherapeutic agent in clinical care of breast cancer patients. However, the mechanism of how the 5-Fu works is complex and still largely unknown. Objective The objective of this study was to understand the mechanism further and explore the new targets of 5-Fu. Methods The differentially expressed proteins induced by 5-Fu in human breast cancer MCF-7 cells were identified by proteomic analysis. Four differentially expressed proteins were validated using Western blot and quantitative real-time reverse-transcription polymerase chain reaction analysis for protein and mRNA levels. The effect of 5-Fu on MCF-7 cells was determined by cell viability assay, transmission electron microscopy and flow cytometry analysis. Results 5-Fu dose-dependently inhibited cell proliferation with the IC50 value of 98.2 lM. 5-Fu also induced obviously morphological change and apoptosis in MCF-7 cells. Twelve differentially expressed proteins involved in energy metabolism, cytoskeleton, cellular signal transduction and tumor invasion and metastasis were identified.
J. Cai and S. Chen contributed equally to this work. J. Cai S. Chen W. Zhang Y. Wei J. Lu Y. Dong (&) Department of Pharmacy, The First Affiliated Hospital of Medical College, Xi’an Jiaotong University, Xi’an 710061, China e-mail: [email protected] J. Xing (&) Department of Pharmacy, College of Medicine, Xi’an Jiaotong University, Xi’an 710061, China e-mail: [email protected]
Conclusion These results may provide a new insight into the molecular mechanism of 5-Fu in therapy of breast cancer. Keywords 5-Fluorouracil Breast cancer Apoptosis Proteomics Guanine nucleotide-binding protein subunit beta-2-like 1
Introduction 5-Fluorouracil (5-Fu), a kind of synthetic antimetabolic drug, has become one of the most widely used anticancer agents since it was first synthesized in 1957 [1]. In the present study, it has been found that 5-Fu can induce a variety of tumor cells apoptosis and have certain effects on various cancers including digestive tract tumor, chorionic epithelial cancer, gastric cancer, and colorectal cancer [2– 4]. The curative effect of 5-Fu for breast cancer is outstanding. It is commonly used in clinical breast cancer chemotherapy project, such as project CMF (cyclophosphamide/methotrexate/5-Fu), project CAF (cyclophosphamide/adriamycin/5-Fu) and project FEC (cyclophosphamide/epirubicin/5-Fu). The known mechanism of action of 5-Fu is as follows: 5-Fu is converted intracellularly to three major active metabolites: fluorodeoxyuridine monophosphate (FdUMP), fluorodeoxyuridine triphosphate (FdUTP) and fluorouridine triphosphate (FUTP). The active metabolites of 5-Fudisrupt RNA synthesis (FUTP), inhibit the action of thymidylate synthase (TS) which is a nucleotide synthetic enzyme (FdUMP), and it can be mismerged into DNA (FdUTP), leading to RNA damage and DNA damage [5]. However, the process of tumor development is complex. As a first-line anticancer drug, the effect of 5-Fu may be the result of multiple mechanisms. In
123
Clin Transl Oncol
this study, we compared the changes of MCF-7 human breast cancer cells cycle distribution, apoptosis and proteins expression induced by 5-Fu, expecting to deeply discuss the mechanism of 5-Fu and identify new targets of 5-Fu by proteomics.
were collected and pre-fixed with cold glutaraldehyde and then fixed with 1 % osmic acid solution for 2 h. Cells were washed with phosphate buffer solution (PBS), dehydrated in graded ethanol solution and embedded in spur resin for overnight, stained with 1 % uranyl acetate and washed with water. Samples were examined in transmission election microscope (Hitachi H-7650, Japan).
Materials and methods Annexin V-FITC/PI analysis Chemicals and reagents 5-Fluorouracil was purchased from Shanghai Xudong Haipu Pharmaceutical Co. (Shanghai, China). 3-(4,5Dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), propidium iodide (PI) and RNase were obtained from Sigma Co. (USA). All reagents used in two-dimensional electrophoresis (2-DE) experiment were purchased from Bio-Rad Laboratories (Hercules, USA).
Apoptosis assay was performed according to the manufacturer’s instructions (Annexin-V FLUOS staining kit, Invitrogen, USA). Briefly, MCF-7 cells treated with 98.2 lM 5-Fu for 12, 24 and 48 h, respectively. Then, cells were harvested and stained with Annexin V-FITC/PI and analyzed by flow cytometry (BD Bioscience, USA). Triplicate experiments were implemented for flow cytometric analysis. Cell cycle distribution analysis
Cell culture The human breast cancer cell line MCF-7 was obtained from Cell Bank of Shanghai, Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China), and cells were cultured in RPMI-1640 (Gibco, USA) with 10 % newborn bovine serum (PAA, USA), 100 U/mL of penicillin, and 100 mg/mL of streptomycin in a humidified atmosphere with 5 % CO2 at 37 °C. Cell viability assay Cells were seeded in 96-well microplate (Corning, USA) for 24 h and treated with various concentrations of 5-Fu for 48 h. Then 20 lL of MTT solution (5 mg/mL) was added to each well and incubated at 37 °C for 4 h. The purple crystals were dissolved in 150 lL of DMSO. Optical absorbance was determined at 490 nm with a microplate reader (BioTek, USA). Each treatment was performed in sextuplicate and each experiment was repeated three times. Cell survival ratio was calculated using Atreated/Acontrol 9 100 %, where Atreated and Acontrol were the absorbance of treated and control cells after 48 h incubation, respectively. Calculate the half-maximal inhibitory concentration (IC50) of 5-Fu in MCF-7 cells. The IC50 value was defined as the concentration that caused 50 % inhibition of cell proliferation.
The MCF-7 cells at a concentration of 5 9 105 cell/mL were seeded into six-well plate in 2 mL culture medium with a concentration of IC50 value of 5-Fu and were incubated at 37 °C in an atmosphere of 5 % CO2 for 12, 24 and 48 h. Cells without treatment were used as a control. After the incubation period, the cultured cells were harvested using trypsin and centrifuged. Then cells were fixed gently with 70 % of cold ethanol overnight at 4 °C. After suspension in PBS, cells were incubated with RNase at 37 °C for 15 min. Next, the cells were incubated with PI on ice for 15 min in the dark. The cell cycle distribution of each sample was then determined immediately using flow cytometry (BD Bioscience, USA). All experiments were performed in triplicate and yielded similar results. Sample preparation for 2-DE MCF-7 cells (1 9 106) were treated with 98.2 lM 5-Fu for 48 h and harvested by trypsinization. Cell pellets were lysed in lysis buffer containing 8 M urea, 2 M thiourea, 4 % CAHPS, 50 mM DTT, protease inhibitor cocktail and 0.2 % Bio-lyte at 4 °C for 30 min. The lysates were homogenized and centrifuged at 20,664g for 30 min and stored at -80 °C until use. The concentrations of protein samples were determined using Bradford assay. 2-DE and image analyses
Effect of 5-Fu on MCF-7 cells morphology The morphological change of MCF-7 cells induced by 5-Fu was observed by transmission electron microscopy. Cells were plated into six-well plates each at a density of 106 for 24 h. After treatment with 98.2 lM 5-Fu for 48 h, cells
123
For 2-DE analysis, nonlinear IPG strips (pH 3–10) 17 cm were rehydrated in swelling buffer containing 8 M urea, 2 M thiourea, 4 % CHAPS, 100 mM DTT, 0.2 % IPG buffer, 0.2 % Bio-lyte and 0.002 % bromophenol blue. The protein samples and lysis buffer were mixed, making the
Clin Transl Oncol
total sample volume to 350 lL. After rehydration for 16 h, IPG strips were focused successively for 1 h at 250 V, 1 h at 1,000 V, and 5 h at 10,000 V to give a total of 60,000 vh on an isoelectric focusing system (IEF). Following IEF, IPG strips were equilibrated for 15 min in equilibration buffer containing 2 % DTT, 6 M urea, 2 % SDS, 0.05 M Tris–HCl, pH 8.8, and 20 % glycerol and then equilibrated for another 15 min in the same equilibration buffer (containing 2.5 % iodoacetamide instead of DTT). The 2-DE separation was performed on 12 % gradient SDS-polyacrylamide gels. Following fixation of the gels in a solution of 10 % ethanol containing 7 % acetic acid, the gels were stained with colloidal Coomassie blue G-250 solution. The stained gels were scanned using UMax Powerlook 2110XL (Umax). Protein spot detection and 2-DE pattern matching were carried out using PDQuest 7.1 Software. Only those significantly (P \ 0.05) and consistently up- or downregulated spots ([1.5-fold) after treatment in three independent experiments were selected for further analysis. In-gel digestion Proteins spots were cut into gel particles and washed twice with sterile ultrapure water for 10 min each and 25 mM ammonium bicarbonate for 20 min. After centrifugation, samples were destained with equal volumes of 30 mM potassium ferricyanide and 100 mM sodium thiosulfate twice for 30 min each. The destained gel spots were equilibrated with 25 mM ammonium bicarbonate for 20 min and dried in a vacuum centrifuge to complete desiccation. The dried gel particles were rehydrated with 20 lg/mL trypsin in 40 mM ammonium bicarbonate (pH 8.0)/10 % acetonitrile and were incubated at 37 °C overnight. Trypsinated gel particles were collected in two extractions: the first was by agitation in 5 % trifluoroacetic acid at 40 °C for 1 h and the second was by agitation in 50 % acetonitrile containing 5 % trifluoroacetic acid at 37 °C for 1 h. The collected and combined peptide solutions were dried by vacuum centrifugation for about 24 h. Then the extracted peptide solutions were reconstituted with 5 lL of 50 % acetonitrile containing 0.1 % acetic acid for analysis.
MALDI-TOF–MS analysis The mass spectra were obtained using MALDI-TOF/TOF Mass Spectrometer (Biosystems, USA). Protein identification was performed automatically by searching the EBI database using the MASCOT 2.2 search engine (Matrix Science, UK). Database search was performed using the following parameters: enzyme, trypsin, and allowance of one missed cleavage, carbamidomethylation was selected as a fixed modification and oxidation of methionine was allowed to be variable. The peptide and fragment mass tolerance were set at 100 ppm and 0.4 Da, respectively. Proteins with probability-based MOWSE scores (P \ 0.05) were considered credible. Western blot Western blot assay was performed according to the reference instruction [6]. MCF-7 cells were treated with 98.2 lM 5-Fu for 48 h, lysed in lysis buffer (Beyotime, China) on ice for 30 min. After centrifuging at 13,225g for 15 min, the supernatant was collected and protein concentration was determined by BCA reagent (Beyotime, China). The lysates were subjected to Western blotting by alpha-enolase, enoyl-CoA hydratase short chain 1, guanine nucleotide-binding protein subunit beta-2-like 1 (abcam, UK), protein disulfide isomerase 3 (GeneTax, USA) and b-actin (Beijing biosynthesis biotechnology, China) antibodies. b-Actin was used as an internal control. All Western blots were repeated at least three times for each experiment. Q-PCR analysis The MCF-7 cells were treated with 98.2 lM 5-Fu for 48 h and the total mRNA was extracted using RNAfast2000 kit (Fastagen, China) according to the manufacturer’s instruction. Q-PCR was performed using the PrimeScript RT Master Mix Perfect Real Time Kit (TaKaRa DRR036A) and SYBR Premix Ex Taq II (TaKaRa). The primers sequences and products are listed in Table 1. The experiments were run on the Thermal Cycler Dice Real
Table 1 List of primers used in Q-PCR Gene
Forward primer (50 ? 30 )
Reverse primer (50 ? 30 )
Product size (bp)
ECHS1
CGATGGAGATGGTCCTCAC
GCACACTGGATGGCTTCTTC
115
GNB2L1
GGGTCACTCCCACTTTGTTAGT
ACACTCAGCACATCCTTGGTAT
153
PDIA3
TCGTCCTTCACATCTCACTAACA
TCCTTGCCCTGTATCAAATCTT
159
ENO1
TCCCTTTGACCAGGATGACT
GACTTTGAGCAGGAGGCAGTT
151
b-Actin
TGACGTGGACATCCGCAAAG
CTGGAAGGTGGACAGCGAGG
205
123
Clin Transl Oncol
Time System (TaKaRa) with the following parameters: 1 cycle of predenaturation of 95 °C for 30 s, 40 cycles of 95 °C for 5 s, various annealing temperature for 30 s depending on the target gene (59 °C for ENO1 and GNB2L1, 57 °C for PDIA3, 60 °C for ECHS1, and 56 °C for b-actin), and a cooling program of 60 °C for 30 s. b-Actin was used as an internal control gene.
of the control, 5-Fu treatment for 12 h, 5-Fu treatment for 24 h and 5-Fu treatment for 48 h were 2.1 ± 0.6, 4.1 ± 0.3, 8.6 ± 0.4 and 49.9 ± 2.8 %, respectively. The cell apoptotic rate of the 5-Fu treatment for 24 and 48 h was markedly higher than the cell apoptotic rate of control group (P \ 0.01). 5-Fu induced apoptosis in MCF-7 cells in a time-dependent manner (P \ 0.01).
Statistical analysis
Cell cycle distribution analysis
Each experiment was repeated at least three times. Statistical analysis was carried out using the program SPSS 16.0 (Chicago, IL, USA). Statistical analyses were carried out using one-way ANOVA. Results were presented as mean ± SD. P \ 0.05 was considered statistically significant.
Based on the preliminary assays in which we determined the effects of 5-Fu on cell proliferation, 98.2 lM of 5-Fu was selected for further in vitro mechanistic studies. As we found a significant growth inhibitory effect of 5-Fu on MCF-7 cells, we determined the possible inhibitory effect of 5-Fu on cell cycle progression. As summarized in Fig. 2b and c, compared with MCF-7 cells, 5-Fu induced increasing number of cells in the G1-phase and a concomitant reduction in the S-phase and G2/M-phase in a time-dependent manner (P \ 0.05), this experiment indicated that 5-Fu induces G1-phase cell cycle arrest in MCF7 cells.
Results Cell viability assay To assess the effects of 5-Fu on MCF-7 cell proliferation, the cells were treated with 5-Fu at 0, 7.5, 15, 30, 60, 120, 240, 480, 960, and 1,920 lM concentrations for 48 h. Cell viability was measured using MTT assay (Fig. 1a). The data indicated that 5-Fu treatment for 48 h dose-dependently inhibited cell growth (P \ 0.01). The IC50 value of 5-Fu in MCF-7 cells was determined as 98.2 lM. Effect of 5-Fu on MCF-7 cells morphology As shown in Fig. 1b (a1 and a2), MCF-7 cells exhibited abundant irregular microvilli at the cell surface (arrow 1), and the nuclei and cytoplasm were normal and homogeneous. When treated with 5-Fu for 48 h, MCF-7 cells exhibited a significant change in morphology. As shown in Fig. 1b (b1 and b2), the microvilli at the cell surface disappeared with increasing vacuoles in the cytoplasm (arrow 2). The nucleus was abnormal and the fragmented chromatin arranged against the nuclear membrane (arrow 3). The typical characteristics of apoptosis including chromatin marginal (arrow 3), apoptotic body (arrow 4) and mitochondrial edema (arrow 5) emerged. In addition, expanded rough endoplasmic reticulum appeared (arrow 6) and the glycogen (arrow 7) in MCF-7 cells vanished after treatment with 5-Fu. Annexin V-FITC/PI analysis The apoptosis rate of MCF-7 cells induced by 5-Fu was quantified by flow cytometry after Annexin V-FITC/PI staining (Fig. 2a). Results showed that the apoptotic rates
123
Differential expression of proteins induced by 5-Fu In 2-DE-based proteomic analysis, three gels per sample were analyzed simultaneously. After automatic spot detection, background subtraction, and volume normalization, 50 protein spots were found to be differentially expressed between 5-Fu-treated group and control group, of which 26 spots were up-regulated and 24 spots downregulated. Twelve proteins were preliminarily identified by MALDI-TOF–MS (showed in Fig. 3a, b; Table 2). The up-regulated proteins are alpha-enolase (ENO1), nucleophosmin isoform 3, protein disulfide isomerase A3 (PDIA3) and one unknown protein, while down-regulated proteins are isoform 1 of triosephosphate isomerase (TPI1), fascin-1, guanine nucleotide-binding protein subunit beta-2-like 1 (GNB2L1), lasp-1, 78-kDa glucoseregulated protein (GRP78), enoy- CoA hydratases short chain 1 (ECHS1), keratin 8 (K8) and one unknown protein. Western blot To verify the identified proteins, we selected four differentially expressed proteins including PDIA3, GNB2L1, ECHS1, and ENO1 to be validated by Western blot (Fig. 4a). Consistent with the observations in 2-DE analysis, PDIA3 and ENO1 proteins were found significantly up-regulated (P \ 0.01), while ECHS1 and GNB2L1 were significantly down-regulated (P \ 0.01) in 5-Fu-treated cells compared with MCF-7 cells.
Clin Transl Oncol Fig. 1 Growth inhibition of MCF-7 cells induced by 5-Fu. a MCF-7 cells were treated with 5-Fu at indicated concentration for 48 h. Cell viability was measured using MTT assay. Data are represented as the mean ± SD from three repeated experiments *P \ 0.05, **P \ 0.01 by ANOVA, vs. untreated control cells. b Morphological change of MCF-7 cells following 5-Fu exposure. a1 and a2, MCF-7 cells; b1 and b2, MCF-7 cells treated with 5-Fu
Q-PCR analysis To further validate protein changes from proteomic profile with the occurrence of mRNA expression, Q-PCR were carried out for mRNAs of ECHS1, GNB2L1, PDIA3 and ENO1 detection. The mRNA expression of ECHS1 and GNB2L1 were down-regulated (P \ 0.01), while PDIA3 and ENO1 were up-regulated (P \ 0.01) in 5-Fu treatment cells compared with MCF-7 cells (Fig. 4b). The results
demonstrated that the changes for these genes in mRNA expression levels were consistent with its protein level by proteomics.
Discussion In this study, we validated the anti-proliferative properties of 5-Fu and further investigated the effect of 5-Fu
123
Clin Transl Oncol
Fig. 2 5-Fu induces MCF-7 cell apoptosis and G1-phase arrest. a Apoptosis analysis of MCF-7 cells treated with 98.2 lM 5-Fu for 12, 24 and 48 h, respectively. Cells were stained with Annexin V-FITC/PI and analyzed using flow cytometry (viable cells are in the lower left quadrant, early apoptotic cells are in the lower right quadrant, late apoptotic cells are in the upper right quadrant and
necrotic cells are in the upper left quadrant). b 5-Fu induced G1phase arrest. MCF-7 cells treated with 5-Fu for 12, 24 and 48 h, respectively. DNA content was determined by flow cytometry after ethanol fixation and PI staining of the cells. c Percentage of cell cycle phases. Values represent the mean ± SD of three independent experiments (*P \ 0.05, **P \ 0.01 by ANOVA, vs. MCF-7)
on the global protein expression in breast cancer MCF-7 cells using proteomic technique. Twelve differentially expressed proteins were successfully identified by MALDI-TOF–MS analysis with four up-regulated proteins and eight down-regulated proteins and two were unknown proteins. Moreover, differential expression of
four proteins was validated by Western blot and Q-PCR analysis for protein and mRNA expression levels, respectively. These proteins are involved in energy metabolism, cytoskeleton, signal transduction and tumor metastasis. Their roles in the anticancer activity of 5-Fu are discussed below.
123
Clin Transl Oncol
Fig. 3 The distribution of different proteins in samples of MCF-7 cells treated with or without 5-Fu for 48 h according to 2-DE protein maps. a Comparing the gels between MCF-7 cells and cells treated
with 5-Fu, the 12 differentially expressed protein spots were labeled with arrow for MS analysis. b Close-up view of the 12 differentially expressed proteins
Three proteins participated in energy metabolism were identified, including ENO1, TPI1 and ECHS1, and shown as spots 1, 2 and 12, respectively. ENO1 was a metalloenzyme that participates in the glycolytic pathway. It can suppress cancer cell growth by regulating MEK5-mediated signal pathway [7]. Besides, ENO1 could selectively inhibit the expression of Bcl-xL, releasing cytochrome C from the mitochondria and inducing tumor cell apoptosis
[8]. TPI1 as an important enzyme contacts with various metabolic pathways and was highly expressed in many tumor cells, participating in energy supplying of tumor cells, promoting tumor cells proliferation and differentiation [9, 10]. ECHS1 localizes to the mitochondrial matrix and functions in the second step of the mitochondrial fatty acid beta-oxidation pathway. The decreased expression of ECHS1 in mitochondria can reduce tumor cells
123
Clin Transl Oncol Table 2 Differentially expressed proteins identified by MALDI-TOF–MS Spot no.
Accession no.
Protein name
PI/Mr (kDa)
Peptide matched
Score
Sequence coverage (%)
Expression after treated with 5-Fu
1
IPI00465248
Alpha-enolase
7.01/47.48
16
277
39
Up
2
IPI00797270
Isoform 1 of triosephosphate isomerase
6.45/26.94
19
682
90
Down
3
IPI00658013
Nucleophosmin isoform 3
4.56/28.50
8
168
33
Up
4
IPI00163187
Fascin-1
6.84/55.12
13
361
34
Down
5
IPI00848226
Guanine nucleotide-binding protein subunit beta-2-like 1
7.6/35.51
11
413
33
Down
6
IPI00883946
Lasp-1
9.04/19.03
8
277
46
Down
7
IPI00025252
Protein disulfide isomerase A3
5.98/57.15
7
138
16
Up
8
IPI00003362
78 kDa glucose-regulated protein
5.07/72.40
20
979
36
Down
9
IPI00922693
Uncharacterized protein
5.23/38.90
7
90
28
Up
10
IPI00021439
Uncharacterized protein
5.29/42.05
14
738
47
Down
11
IPI01021414
Keratin 8
5.37/56.57
23
672
43
Down
12
IPI00024993
Enoyl-CoA hydratase, short chain, 1, mitochondrial
8.34/31.82
4
242
20
Down
Fig. 4 The result of 2-DE was validated by Western blot assay and Q-PCR analysis. a Protein levels of ECHS1, GNB2L1, PDIA3 and ENO1 were determined by Western blot analysis. Relative protein expression is shown as mean ± SD. b-Actin was loading control. b MCF-7 cells were treated with 5-Fu for 48 h and the mRNA expressions of proteins were detected by Q-PCR. All experiments were repeated in triplicate (*P \ 0.05, **P \ 0.01 by ANOVA, vs. MCF-7)
mitochondrial membrane potential, promoting cytochrome C release and inducing tumor cell apoptosis [11]. ECHS1 may be a key enzyme, which participates in mitochondriamediated apoptosis pathway. Therefore, up-regulation of ENO1, down-regulation of TPI1 and ECHS1 may activate cell apoptosis and block the energy source, and finally induce apoptosis in MCF-7 cells.
123
Two proteins involved in cytoskeleton were identified, including fascin-1 and K8, shown as spots 4 and 11, respectively. Fascin-1 is an actin-bundling protein, absent in most normal epithelia but highly expressed in many human cancers [12]. Studies have shown that fascin-1 protein expression is correlated with poor prognosis [13]. K8 is widely expressed in a lot of cancers cells and tissues,
Clin Transl Oncol
which can inhibit PI3K/Akt/NF-jB signal pathway hyperactivation, decrease the expression of MMP2 and MMP9, and then inhibit apoptosis of tumor cells [14]. Therefore, down-regulation of fascin-1 and K8 expression may contribute to the apoptotic effect of 5-Fu. Three proteins associated with tumor metastasis were identified, including lasp-1, PDIA3 and GRP78 shown as spots 6, 7 and 8, respectively. Lasp-1 participates in cell interaction. Its overexpression will stimulate cancer cell growth and migration in vitro, and promote aggressive phenotypes of cancer cells in vivo by regulating the expression of various key molecules [15]. GRP78 localizes in the lumen of the endoplasmic reticulum and involves in the folding and assembly of proteins. A considerable amount of research has indicated that GRP78 was found to be up-regulated in about half of all cancers and promoted tumor metastasis [16]. PDIA3 also known as endoplasmic reticulum protein 57 (ERP57) could dictate indirectly the immunogenicity of tumor cell death by controlling the translocation of calreticulin. It also can regulate gene MSH6, TMEM126A and LRBA expression to interfere the DNA synthesis of tumor cells [17]. The decreased lasp-1 and GRP78 expression and elevated PDIA3 expression in 5-Fu-treated MCF-7 cells may cause apoptosis as observed in our assays. Two proteins involved in cellular signal transduction were identified, including NPM1 and GNB2L1 shown as spots 3 and 5. NPM1 is a common biomarker in acute myeloid leukemia and mainly locates in nucleolus, participating in the transportation between nuclear and cytoplasm by signal transduction [18]. The elevated NPM1 expression in response to 5-Fu treatment may relate to apoptosis during exchange between nuclear and cytoplasma and information transmission. GNB2L1 also named as RACK1, a 36-kDa homolog of the b-subunit of G proteins, was originally identified based on its ability to bind the activated form of protein kinase C and to facilitate its protein trafficking within cells [19]. GNB2L1 has been identified to interact with four signaling pathways, including PKC, PDE4D5 (a cyclic AMP-specific phosphordiesterase), tyrosine kinases/phosphatases, and signal transducers and activators of transcription 3 (STAT3), which are involved in cell growth, adhesion, movement, and migration [20]. It suggested that GNB2L1 might share function in carcinogenesis, as reported in multiple tumor types [21, 22]. Reports found that GNB2L1 was strongly related to commonly used biomarkers Ki67 [23]. It also found that GNB2L1 expression was also significantly associated with the pathological stage, tumor size and lymph node status of adenocarcinoma patients, but not with tumor differentiation, or patient age and gender. These results suggest that GNB2L1 may be a novel differential diagnostic marker for cancers [24]. In our study, the
decreased GNB2L1 expression in response to 5-Fu treatment may activate multiple signal pathways, thereby inducing apoptosis in MCF-7 cells. In conclusion, in the report we carried out the proteomic approach to identify proteins involved in the action mechanisms of 5-Fu in MCF-7 cells. Some of the 12 proteins participate in energy supply of tumor cells and some involve in cellular signal transduction promoting tumor invasion and metastasis. 5-Fu blocked up the energy source of MCF-7 cells and decreased the expression of carcinogenic proteins, which was different from the known mechanism of 5-Fu (DNA damage and RNA damage). Acknowledgments The work was supported by the National Natural Science Foundation of China (No. 30973578 and 30973673). Conflict of interest There is no any conflict of interest for all authors.
References 1. Heidelberger C, Chaudhuri NK, Danneberg P, Mooren D, Griesbach L, Duschinsky R, et al. Fluorinated pyrimidines, a new class of tumour-inhibitory compounds. Nature. 1957;179:663–6. 2. Chuang-Xin L, Wen-Yu W, Yao C, Xiao-Yan L, Yun Z. Quercetin enhances the effects of 5-fluorouracil-mediated growth inhibition and apoptosis of esophageal cancer cells by inhibiting NF-kappaB. Oncol Lett. 2012;4:775–8. 3. Gravalos C, Salut A, Garcia-Giron C, Garcia-Carbonero R, Leon AI, Sevilla I, et al. A randomized phase II study to compare oxaliplatin plus 5-fluorouracil and leucovorin (FOLFOX4) versus oxaliplatin plus raltitrexed (TOMOX) as first-line chemotherapy for advanced colorectal cancer. Clin Transl Oncol. 2012;14:606–12. 4. Garrido-Laguna I, Amador ML, Ruiz J, Cortes-Funes H. Acute ischaemic cerebrovascular attack secondary to infusional 5-fluoruracil and cisplatin in a patient with advanced gastric cancer. Clin Transl Oncol. 2009;11:183–5. 5. Parker WB, Cheng YC. Metabolism and mechanism of action of 5-fluorouracil. Pharmacol Ther. 1990;48:381–95. 6. Wang L, Zhang B, Xu X, Zhang S, Yan X, Kong F, et al. Clinical significance of FOXP3 expression in human gliomas. Clin Transl Oncol. 2013. doi:10.1007/ s12094-013-1037-x. 7. Ghosh AK, Steele R, Ray RB. c-Myc promoter-binding protein 1 (MBP-1) regulates prostate cancer cell growth by inhibiting MAPK pathway. J Biol Chem. 2005;280:14325–30. 8. Ghosh AK, Majumder M, Steele R, Liu TJ, Ray RB. MBP-1 mediated apoptosis involves cytochrome c release from mitochondria. Oncogene. 2002;21:2775–84. 9. Chen G, Gharib TG, Huang CC, Thomas DG, Shedden KA, Taylor JM, et al. Proteomic analysis of lung adenocarcinoma: identification of a highly expressed set of proteins in tumors. Clin Cancer Res. 2002;8:2298–305. 10. Roth U, Razawi H, Hommer J, Engelmann K, Schwientek T, Muller S, et al. Differential expression proteomics of human colorectal cancer based on a syngeneic cellular model for the progression of adenoma to carcinoma. Proteomics. 2010;10:194–202. 11. Liu X, Feng R, Du L. The role of enoyl-CoA hydratase short chain 1 and peroxiredoxin 3 in PP2-induced apoptosis in human breast cancer MCF-7 cells. FEBS Lett. 2010;584:3185–92. 12. Kulasingam V, Diamandis EP. Fascin-1 is a novel biomarker of aggressiveness in some carcinomas. BMC Med. 2013;11:53. 13. Tan VY, Lewis SJ, Adams JC, Martin RM. Association of fascin-1 with mortality, disease progression and metastasis in carcinomas: a systematic review and meta-analysis. BMC Med. 2013;11:52. 14. Busch T, Armacki M, Eiseler T, Joodi G, Temme C, Jansen J, et al. Keratin 8 phosphorylation regulates keratin reorganization and migration of epithelial tumor cells. J Cell Sci. 2012;125:2148–59. 15. Wang H, Li W, Jin X, Cui S, Zhao L. LIM and SH3 protein 1, a promoter of cell proliferation and migration, is a novel independent prognostic indicator in hepatocellular carcinoma. Eur J Cancer. 2013;49:974–83. 16. Martin S, Lamb HK, Brady C, Lefkove B, Bonner MY, Thompson P, et al. Inducing apoptosis of cancer cells using small-molecule plant compounds that bind to GRP78. Br J Cancer. 2013;109:433–43.
123
Clin Transl Oncol 17. Obeid M. ERP57 membrane translocation dictates the immunogenicity of tumor cell death by controlling the membrane translocation of calreticulin. J Immunol. 2008;181:2533–43. 18. Greiner J, Schneider V, Schmitt M, Gotz M, Dohner K, Wiesneth M, et al. Immune responses against the mutated region of cytoplasmatic NPM1 might contribute to the favorable clinical outcome of AML patients with NPM1 mutations (NPM1mut). Blood. 2013;122:1087–8. 19. Ruan Y, Sun L, Hao Y, Wang L, Xu J, Zhang W, et al. Ribosomal RACK1 promotes chemoresistance and growth in human hepatocellular carcinoma. J Clin Invest. 2012;122:2554–66. 20. Cao XX, Xu JD, Liu XL, Xu JW, Wang WJ, Li QQ, et al. RACK1: a superior independent predictor for poor clinical outcome in breast cancer. Int J Cancer. 2010;127:1172–9.
123
21. Berns H, Humar R, Hengerer B, Kiefer FN, Battegay EJ. RACK1 is up-regulated in angiogenesis and human carcinomas. Faseb J. 2000;14:2549–58. 22. Myklebust LM, Akslen LA, Varhaug JE, Lillehaug JR. Receptor for activated protein C kinase 1 (RACK1) is overexpressed in papillary thyroid carcinoma. Thyroid. 2011;21:1217–25. 23. Wang Z, Zhang B, Jiang L, Zeng X, Chen Y, Feng X, et al. RACK1, an excellent predictor for poor clinical outcome in oral squamous carcinoma, similar to Ki67. Eur J Cancer. 2009;45:490–6. 24. Nagashio R, Sato Y, Matsumoto T, Kageyama T, Satoh Y, Shinichiro R, et al. Expression of RACK1 is a novel biomarker in pulmonary adenocarcinomas. Lung Cancer. 2010;69:54–9.
