Fish & Shellfish Immunology 37 (2014) 96e107

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Proteomic identification, characterization and expression analysis of Ctenopharyngodon idella VDAC1 upregulated by grass carp reovirus infection Xiaobao Shen, Tu Wang, Dan Xu, Liqun Lu* Key Laboratory of Freshwater Fishery Germplasm Resources, Ministry of Agriculture of P. R. China, Shanghai Ocean University, Shanghai 201306, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 11 September 2013 Received in revised form 5 January 2014 Accepted 5 January 2014 Available online 14 January 2014

Voltage-dependent anion channels (VDACs) located in the mitochondrial outer membrane are mitochondrial porins that play central roles in regulating cell life and death. In this present report, the VDAC protein 1 from grass carp Ctenopharyngodon idella (designated as CiVDAC1) was found to be upregulated by grass carp reovirus (GCRV) infection through two-dimensional gel electrophoresis and protein analysis of infected C. idella kidney (CIK) cells. The full-length cDNA of CiVDAC1 was 995 bp with an open reading frame (ORF) of 852 bp that encodes a putative 283-amino acid protein. Phylogenic analysis revealed that the complete ORF of CiVDAC1 demonstrated high identity with well characterized mammalian homologs. The deduced CiVDAC1 protein contains an a-helix at the amino terminal, 19 membrane-spanning b-strands, and one eukaryotic mitochondrial porin signature motif. Tissue tropism analysis indicated that CiVDAC1 is abundant in muscle, heart, skin, swim bladder, trunk kidney and spleen. Transcriptional expression profiles indicated that the CiVDAC1 gene was upregulated upon viral challenge in a manner similar to the Mx2 gene, which is a marker gene used to indicate activation of innate antiviral immunity. Similar expression patterns of the CiVDAC1 gene were observed in CIK cells stimulated with poly (I:C), as well as grass carp kidney tissue challenged with GCRV in vivo. CiVDAC1 silencing in CIK cells had no impact on progeny virus production, but over-expression of CiVDAC1 in vivo showed strongly protect against challenge with live virus. To interpret the role of other VDAC proteins in viral pathogenesis, CiVDAC2 was characterized and showed to respond positively to GCRV challenge, which suggested that CiVDAC2 might functionally complement CiVDAC1 in C. idella. The present data did demonstrate that CiVDAC1 might be mediated grass carp antiviral immune response. Ó 2014 Elsevier Ltd. All rights reserved.

Keywords: Grass carp reovirus CiVDAC1 CiVDAC2 Mx2 Poly (I:C)

1. Introduction Grass carp Ctenopharyngodon idella is one of the most important freshwater aquaculture species, and it accounts for around 23% of annual fisheries production in China [1]. Grass carp hemorrhagic disease caused by grass carp reovirus (GCRV) is emerging as one of the most prominent problems in grass carp aquaculture. GCRV is a dsRNA virus with a double-layered protein capsid, while the GCRV genome consists of 11 dsRNA genomic fragments that encode 12 viral proteins [2]. GCRV has been assigned to the genus Aquareovirus of the family Reoviridae [3]. To date, there are no effective therapeutic drugs available to the farmers against GCRV and vaccine protection is regarded as the only promising strategy against

* Corresponding author. College of Fisheries and Life Science, Shanghai Ocean University, Shanghai 201306, China. E-mail address: [email protected] (L. Lu). 1050-4648/$ e see front matter Ó 2014 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2014.01.009

this disease. A commercial vaccine protecting against GCRV infection was recently developed in China; however, the appearance of more genetically-distant genotypes of GCRV has limited the commercialization of this single viral strain-based vaccine product [4]. To understand the pathogenesis of GCRV disease, it is crucial to characterize the interactions between host cells and the virus, but this knowledge has been reported only rarely and the pathogenesis of this disease is still not completely understood. The mitochondrial-related voltage-dependent anion-selective channel proteins (VDACs), which have molecular masses of about 30 kDa, are also known as mitochondrial porins, and these proteins are located in the mitochondrial outer membrane (MOM) [5,6]. In mammals, three clades of VDACs are present: VDAC1, VDAC2 and VDAC3 [7]. The three-dimensional structure of eukaryotic VDACs, which form pores in the MOM, are characterized by the presence of an N-terminus a-helical region located inside the pore and a 13-, 16- or 19-stranded b-barrel [8,9]. VDAC channels regulate the energy balance of mitochondria and the entire cell by forming a

X. Shen et al. / Fish & Shellfish Immunology 37 (2014) 96e107

common pathway for the exchange of metabolites between the mitochondrion and the cytosol [10e12]. Expression level studies of VDACs have shown that these proteins serve critical roles in cell life and death, and interaction of anti-apoptotic proteins with VDACs and regulation of cytochrome c release indicate that VDACs play roles in mitochondria-mediated apoptosis [13e15]. In olive flounder, Paralichthys olivaceus and Marsupenaeus japonicus, upregulation of VDACs in response to viral infection has been reported [16,17]; however, the regulation and functional relevance of VDACs in viral infection remain to be further characterized. Typical cytopathic effects have been associated with GCRV infection of C. idella kidney (CIK) cells, including apoptosis, extensive cell fusion and necrosis. Both host proteins and virus-encoding proteins contribute to cellular pathogenesis and efficient viral replication processes. As host protein, VDACs may be involved in a cell defense mechanism or induced by GCRV pathogenesis. In this present study, two-dimensional electrophoresis (2-DE) with immobilized pH gradients (IPG) [18] was employed to produce protein profiles for GCRV-infected CIK cells in an attempt to investigate the interactions between GCRV and host cells. Through analyzing the differentially-expressed proteins upon viral challenge, CiVDAC1 was identified to be significantly upregulated by virus infection. This present study aims to characterize the grass carp CiVDAC1 gene and determine its role after upregulation during viral replication.

97

(version 7.0; GE Healthcare). For evaluation of the differentially expressed protein spots, Student’s t-tests were applied and a significance threshold of 95% enforced. Differentially expressed protein spots were cut out and processed by in-gel digestion according to Rosenfeld et al. [23], followed by sequence analysis of the peptides by mass spectrometry (MS) performed as described previously [24]. Briefly, the differentially expressed protein spots were manually excised from the silver-stained gel, placed in centrifuge tubes, re-dissolved in 0.8 ml of matrix solution (a-cyano-4hydroxycinnamic acid in 0.1% trifluoroacetic Acid (TFA) and 50% acetonitrile), and then spotted onto the 4800 Plus MALDI-TOF/ TOFÔ Analyzer (Applied Bio-systems, USA). The Nd:YAG laser was operated at a wavelength of 355 nm with an acceleration voltage of 2 kV. All acquired sample spectra were processed using 4700 ExploreÔ software (Applied Bio-systems) operating with default settings. Parent mass peaks with a mass of 800e4000 Da and a minimum signal-to-noise ratio of 50 were picked out for tandem MS/MS analysis. MS data were analyzed using MASCOT software (Matrix Science, London, UK) and the NCBInr eukaryotic protein sequence database. The parameters were set as follows: trypsin digest with one missing cleavage; fixed modification of carbamidomethyl (C); oxidation of variable modification; peptide mass tolerance of 100 ppm; and fragment mass tolerance of 0.3 Da. Proteins with a minimum ion score of 35 (P < 0.05) were considered to be identified reliably. 2.3. Identification of the full-length CiVDAC1 cDNA

2. Materials and methods 2.1. Animals, cell lines and virus Pathogen-free grass carp (15e20 g) were obtained from the SHOU experimental fish breeding farm. GCRV-JX01 and CIK cells were used in this study for GCRV propagation [4]. CIK cells were grown in M199 medium supplemented with 10% inactivated fetal calf serum (Gibco BRL). CIK cells were incubated and infected at 28
C. The GCRV particles were purified from the supernatant of infected CIK cells by an ultracentrifugation method described previously [19]. Virus titration was performed by a standard 50% tissue culture infective dose (TCID50) assay [20]. 2.2. 2-DE, image analysis and diversity protein spot analysis CIK cells were infected with a multiplicity of infection (MOI) of 1. The cells were scraped from the wells and harvested by centrifugation at 1200  g for 10 min at 6, 12, and 24 h post infection (p.i.). The total cellular proteins were extracted from the purified infected cells as described previously [21]. The protein concentration was determined by the standard Bradford method. 2-DE was performed with 24-cm (linear, pH 3e10) IPG strips (Bio-Rad) according to Cao Haipeng et al. [22].The IPG strips were loaded with 250 ml of rehydration buffer (7 M urea, 2 M thiourea, 2% (w/v) CHAPS and 65 mM DTT) containing 80 mg of protein. Three technical replicates were performed for each group. Isoelectric focusing (IEF) was performed at 17
C with a voltage gradient of 500 V for 1 h, 1000 V for 1 h, 8000 V for 8 h, and then continued up to a total of 60 kVh. The focused strip was equilibrated for 15 min with equilibration solution (6 M urea, 0.375 M TriseHCl, 20% glycerol and 2% sodium dodecyl sulfate [SDS]) containing 2% DTT. Then, the strips were equilibrated for another 15 min with equilibration solution containing 2.5% (w/v) iodoacetamide. Equilibrated strips were sealed onto the top of 12.5% SDS-PAGE gels for electrophoresis. The gels were visualized with 0.1% Coomassie Brilliant Blue (CBB) R-250 stain and scanned using a Bio-Rad GS-710 scanner (Bio-Rad). The spots were analyzed with ImageMaster 2D platinum software

The MS/MS identified VDAC1 to be a conservative protein among various organisms. The partial gene sequence of VDAC from the Danio rerio (GenBank accession no. NM_001001404.1) expressed sequence tag (EST) database was used to design primers (F1 and R1) to amplify the internal region of the grass carp CiVDAC1 gene. The polymerase chain reaction (PCR) product was purified using the WizardÒ SV Gel and PCR Clean-Up System kits (Promega), cloned into the pGEM-T easy vector (Promega) and transformed into competent DH5a cells. Plasmids were isolated using the WizardÒ Plus Midipreps DNA Purification System kit (Promega) and sequenced on a 3730XL DNA sequencer (Applied Biosystems). To obtain the full-length cDNA sequence of CiVDAC1, rapid amplification of cDNA ends (RACE) was carried out using the SMARTerÔ RACE cDNA Amplification kit (Clontech). First cDNA synthesis and 50 RACE and 30 RACE were performed with total cellular RNA as the amplification template. 50 RACE and 30 RACE were performed using gene-specific primers and adapter primers. The CiVDAC1 coding sequence was confirmed by primers VDAC-ORF-F1 and VDAC-ORFR2. All amplification products were cloned and sequenced. The universal primer mix (UPM) contained a mixture of UPM and NUP. All primers are listed in Table 1. 2.4. Sequence analysis Sequence homology was analyzed using the BLAST program (http://www.ncbi.nlm.nih.gov/blast) and the Matrix Global Alignment Tool (MatGAT) (http://bitincka.com/ledion/matgat/). The protein domains were predicted by the Simple Modular Architecture Research Tool (SMART) (http://smart.embl-heidelbera.de/) [25] and Pfam database searches (http://pfam.sanger.ac.uk/search) [26]. Multiple sequence alignments were created using DNAman software (http://www.lynnon.com/) and the ClustalW Multiple Alignment program (http://www.wbi.ac.uk/clustalw/). Intra-domain features were predicted by scanning the sequence against the PROSITE database (http://us.expasy.org/tools/scanprosite). Secondary structure predictions of the CiVDACs were performed at the Psipred server (http://bioinf.cs.ucl.ac.uk/psipred/). A phylogenetic

98

X. Shen et al. / Fish & Shellfish Immunology 37 (2014) 96e107

Table 1 Primers used in the present study. CiVDAC1 F1 R1

CTCCTCCTTTTCTCCAAACACTG TCACCTTCTGGTAGATGGAGCCG

Cloning the partial sequence

CiVDAC2 F2 R2

GGGCAGCCTGGAAACCAAATAC CAGCAAGCCATCCCTCATAGCC

Cloning the partial sequence

VDAC1-5RACE1 VDAC1-5RACE2 VDAC1-3RACE2 VDAC1-3RACE2 VDAC2-5RACE1 VDAC2-5RACE2 VDAC2-3RACE2 VDAC2-3RACE2 VDAC1-ORF-F1 VDAC1-ORF-R VDAC2-ORF-F1 VDAC2-ORF-R2 CiVDAC1 VDAC1-F VDAC1-R CiVDAC2 VDAC2-F VDAC2-R 18S rRNA 18F99 18R100 EF1a EF125 ER126 Mx-2 Mx2-F Mx2-R Universal adaptor primer UPM

GTCATAGTCCACGTCACAGCCC AGGTTG GCTCTTGATCTTCCCGCTCTTCTT CCCA CCAGGGACATCTTCACCAAAGG ATACGG AGTTGACATTTGATTCCTCCTTTTCTCC TTCCTGTGTTTGGTGAGAAGGTTGTGTC TCTGTGCCCAGGGTGTTGTCAGTATTCC GTGGGCAGCCTGGAAACCAAATACAAGA CCAAACACAGGAAAAAAGAGTGGGAAAG CATCCTCTCCGCTGTGAGTCCTG CTCGGCTTCCTATGCCTCAAACT

5’RACE

3’RACE

Sequence confirmation

GCCATTCCCCCAACATACGCT CCACAGATGCCCTCAGTTCCA AGGTCAGAGAATGGATTGG CGAGAGTGTTGTCAGTGT

qRT-PCR

CAGGAAACAACAGCACAC TAACCAACACCGACAAGG

qRT-PCR

ATTTCCGACACGGAGAGC CATGGGTTTAGCATACGCTC

qRT-PCR

CGCCAGTGTTGCCTTCGT CGCTCAATCTTCCATCCCTT

qRT-PCR

ACATTGACATCGCCACCACT TTCTGACCACCGTCTCCTCC

qRT-PCR

RACE

50 RACE CDS primer A ECiVDAC-F1

Long: CTAATACGACTCACTATAGGCAAGC AGTGGTATCAACGCAGAGT Short: CTAATACGACTCACTATAGGGC AAGCAGTGGTATCAACGCAGAGTACXX XXX AAGCAGTGGTATCAACGCAGAGTAC(T) 30V N (T)25 VN CCGCTCGAGATGGCTGCTCCTCCGACAT

ECiVDAC-R1

CGCGGATCCCGCCATGCCTCAAACTCCAG

NUP SMARTer II A Oligonucleotide 30 RACE CDS primer A

Construct plasmid

Note: R ¼ A/G; V ¼ A/G/C; N ¼ A/G/C/T; X ¼ undisclosed base in proprietary SMARTer oligo sequence.

tree was constructed based on the deduced amino acid sequences by the neighbor-joining algorithm embedded in the Mega 5.0 program (http://www.megasoftware.net/mega.html) [27]. Reliability of the tree was assessed by 1000 bootstrap repetitions. 2.5. Fish viral challenge and sample collection Expression profiles of the CiVDACs were assessed in different grass carp tissues. For viral challenge, 100 mL of GCRV-JX01 suspended in PBS (107 viral particles/ml) per g of body weight were injected intraperitoneally [28]. Control fish were injected with PBS only. For tissue distribution analyses, various tissues were collected from the fish prior to and 24 h p.i., including the intestine, muscle, eye, gill, liver, spleen, skin, head kidney, trunk kidney and heart. Tissue samples were homogenized in TRIZOL reagent (Invitrogen)

and total RNA was isolated according to the manufacturer’s instructions. Total RNA was incubated with RNase-free DNase I (Promega) to remove contaminating genomic DNA prior to reverse transcription (RT) into cDNA using random hexamer primers and MMLV Reverse Transcriptase (TaKaRa). These methods were carried out as previously reported [29]. 2.6. CIK cells, immune challenge and sample collection For virus infection studies, CIK cells were infected with GCRV at a MOI of 1. Controls were treated with PBS only. For determining time-dependent expression profiles, cells were collected at 0, 4, 8, 12, 24, 36 and 48 h p.i. Then, RNA was extracted and reverse transcribed as above. For synthetic dsRNA stimulation, poly (I:C) (SigmaeAldrich, St Louis, MO, USA) dissolved in PBS was heated to 55
C for 5 min and allowed to cool at room temperature. For naked poly (I:C) treatment, 1  106 cells were treated with 5 mg/ml (terminal concentration) poly (I:C), while controls were treated with PBS only. For kinetic studies, the cells were harvested at 0, 2, 8 and 24 h post stimulation and RNA was isolated and reverse transcribed as above [28]. 2.7. CiVDAC1 gene expression in different tissues Quantitative real-time RT-PCR (qRT-PCR) was performed to quantify CiVDAC1 gene expression in different tissues using the CFX96 Real-time PCR Detection System (Bio-Rad). 18S rRNA served as the internal reference gene. Each reaction mixture consisted of 1 mL DNA, 7 ml nuclease-free water, 10 ml of 2  SsoAdvancedÔ SYBR Green Supermix (Bio-Rad), and 1 mL of each gene-specific primer (10 mM). The PCR was performed at 95
C for 30 s, followed by 40 cycles of 95
C for 5 s and 54.9
C for 30 s, and then dissociation curve analysis (65e95
C: increment of 0.5
C for 5 s) to verify the amplification of a single product. After the PCR program was completed, the data was analyzed using the CFX Manager software 2.1 with subsequent analyses on SPSS software. The 2DDCT method was used to analyze the expression of the CiVDAC1 gene [30]. Expression data obtained from independent biological replicates were subjected to analysis Student’s t-test. Differences were considered to be significant at P < 0.05. 2.8. mRNA expression of CiVDAC1 in vitro post poly (I:C) stimulation or GCRV infection The mRNA expression of CiVDAC1 in vitro post poly (I:C) stimulation or GCRV infection was observed using qRT-PCR. EF1a was used as the internal reference gene and the forward and reverse primers for this gene were EF125 and EF126 (Table 1). Follow-up analyses were performed as above. 2.9. Knock-down of CiVDAC1 mRNA expression in CIK cells Short interfering (si)RNA sequences for CiVDAC1 were designed according to web-based criteria (http://rnaidesigner.invitrogen. com/rnaiexpress/design.do and http://www.dharmacon.com/ DesignCenter/DesignCenterPage.aspx). Three siRNA sequences were selected by homology analysis (Table 2). Approximately 24 h before transfection, CIK cells were seeded in a 24-cell plate at 4  105 cells per well in M199 supplemented with 10% PBS, and then incubated at 28
C. Once grown to about 80% confluence, CIK cells were washed with PBS and then culture supernatants were replaced with Opti-MEM (Invitrogen). A siRNA, each a doublestranded RNA 19-mer plus a TT overhang (Shanghai GenePharma), was transfected into CIK cells using Lipofectamine 2000

X. Shen et al. / Fish & Shellfish Immunology 37 (2014) 96e107 Table 2 Synthesized siRNA targeting CiVDAC1 and EGFP. Targets VDAC-siRNA1 VDAC-siRNA2 VDAC-siRNA3 GFP-siRNA

Sequences of siRNA (5’e3’) Sense strand Antisense strand Sense strand Antisense strand Sense strand Antisense strand Sense strand Antisense strand

GCCUGACAUUCACCGAGAATT UUCUCGGUGAAUGUCAGGCTT GCAACUUUGCUGUCGGAUATT UAUCCGACAGCAAAGUUGCTT GCUGACCCUUUCUGCUCUUTT AAGAGCAGAAAGGGUCAGCTT GGCUACGUCCAGGAGCGCACC UGCGCUCCUGGACGUAGCCUU

(Invitrogen) according to the manufacturer’s instructions. To investigate the inhibitory efficiencies of transcribed siRNAs on CiVDAC1, the relative expression levels of the CiVDAC1 gene were evaluated by qRT-PCR. At 48 h after transfection the cells were harvested, and after two screening tests the best performing siRNA was selected for subsequent studies. For the gene knock-down experiments, the processes were performed just as above. CIK cells were transfected with siRNA specific for the CiVDAC1 gene, while control cells were transfected with siRNA specific for the enhanced green fluorescent protein (EGFP) gene. At the earliest time point of maximal silencing (48 h post transfection), transfected cells were infected with GCRV at a MOI of 1. Viral replication was monitored at different time points by a TCID50 titration assay on the supernatant and a qRT-PCR assay on total cellular viral genomic RNA as reported previously [4]. 2.10. Cloning, expression pattern and response of CiVDAC2 to GCRV infection Based on C. idella EST data and sequences homologous to VDAC2 of D. rerio, specific primers (Table 1) were designed to obtain the 30 and 50 -ends of CiVDAC2 by RACE. The expression pattern, response to GCRV infection and poly (I:C) stimulation studies for CiVDAC2 were carried out exactly as described above for CiVDAC1. 2.11. Construction and preparation of recombinant plasmid The gene encoding ORF of CiVDAC1 was amplified and subsequently cloned into a eukaryotic expression vector pEGFP-N1 (Invitrogen), The pEGFP-CiVDAC1 was verified using XhoI and BamH I endonuclease analysis, and the recombinant plasmid was then transformed into Escherichia coli DH5a cells. The plasmid was prepared on a large scale; distilled and purified using kit

99

(PureYieldÔ Plasmid Midiprep System, Promega), with the quality and quantity of plasmid DNA determined using Nanodrop 2000 (Thermo). Prepared plasmid DNA was stored at 20
C until required. 2.12. Animals syringe procedures and challenge test Pathogen-free grass carp, approximately 15e20 g in body weight, were used as fish to evaluate the vaccine function of plasmid DNA. The fish were kept in a tank with a flow through, filtered and virus free water system at approximately 25e28
C with water quality monitored daily. Prior to vaccination, the fish were acclimatized for 2 weeks in the laboratory. A hundred fishes were randomly selected and anaesthetized using 0.02% tricaine methanesulfonate (MS-222). Five-micrograms of plasmid DNA (in 100 ml phosphate buffered saline, PBS, pH 7.4) was injected intramuscularly into each tester. As a negative control, 5 mg of the pEGFP-N1 vector (in 100 ml PBS, pH 7.4) was injected intramuscularly into each control fish. After vaccination, each group of 5 fish was kept in the same tanks under the identical experimental conditions. After 10 days vaccination, fish were put into tanks where fish had been infected with GCRV(107 viral particles/ml), and then detected the viral expression profiles of VP7 in site of injected plasmid DNA. These methods were carried out as previously reported [31,32]. 3. Results 3.1. 2-DE and MS identification of the CiVDAC1 protein To obtain a detailed comparison of differences in protein expression, proteins from GCRV-infected and control CIK cells were extracted for 2-DE analysis at 6, 12 and 24 h p.i. A pH non-gradient of 3e10 NL was found suitable for the separation of CIK cells proteins, as most of these proteins had isoelectric point (pI) values within the 3e10 range. In the 2-DE analysis, about 400e500 spots were visualized in each gel using the ImageMaster 2D software. A total of 23 protein spots from silver-stained gels with a fold-change of >3 were validated to be significantly differentially expressed in GCRV-infected cells, which included one downregulated protein and 22 upregulated protein spots. Of the upregulated proteins in infected CIK cells, protein spot 414 were upregulated at 12 h p.i. (Fig. 1). To identify the differentially expressed protein spots in GCRV-infected CIK cells, the spots were subjected to in-gel trypsin digestion and MALDI-TOF/TOF MS identification. The CiVDAC1 protein was found to be the protein spot that demonstrated greatest fold-change at 12 h p.i. (Table 3).

Fig. 1. CiVDAC1 protein expression profiles of GCRV-JX01-infected and mock-infected CIK cells as detected by 2-DE at 12 h p.i. Equal amounts (80 mg) of cell lysates were separated on 24-cm (pH 3e10) linear gradient IPG strips using 12.5% SDS-PAGE. A molecular weight marker was loaded on the right-hand side. (A) Uninfected cells; (B) Infected cells (12 h.p.i).

100

X. Shen et al. / Fish & Shellfish Immunology 37 (2014) 96e107

Table 3 List of the voltage-dependent amino channel protein spots in GCRV-infected CIK identified by MALDI-TOF/TOF. Spot no.a

Protein name

Gene name

Accession no.b

Theoretical Mr/Pic

Sequence coverage (%)d

Protein scoree

Best ion scoree

Peptides identifiedf

414

Voltage-dependent anion-selective channel protein 1

VDAC1

gij47777306

30,664/6.23

34

538

202

VNDNLETAVNLAW TAGNSNTR

a

Spot no. is the unique sample spot protein number that refers to the lables in Fig. 1. Accession no. is the MASCOT result of MALDI-TOF or MALDI-TOF/TOF searched from the NCBInr database. Theoretical Mr/pI is the predicted molecular weight and isoelectric point of the expressed differentially protein. d Coverage (%) is the number of amino acids spanned by the assigned peptides divided by the sequence length. e Protein score (based on combined MS and MS/MS spectra) and best ion score (based on MS/MS spectra) were from MALDI-TOF/TOF identification. The proteins that had a statistically significant protein score of great than 35 (P < 0.05) were considered successfully identified. f The peptides identified by MALDI-TOF/TOF with statistically significant ion score. b c

3.2. Characterization of CiVDAC1 cDNA The CiVDAC1 cDNA (GenBank accession no. KC684923.1) consisted of 995 nucleotides with an open reading frame (ORF) of 852 bp that encoded a peptide of 283 amino acids. In the deduced protein sequence, CiVDAC1 contained the characteristic VDAC domains of eukaryotic mitochondrial porins. The CiVDAC1 protein has a molecular weight of 30,539.03 Da and a pI of 6.351. BLASTP analysis showed that the gene was most similar to zebrafish VDAC1 (identity ¼ 95%). CiVDAC1 contains the eukaryotic mitochondrial

pattern [YH]-x(2)-D-[SPCAD]-x-[STA]-x(3)-[TAG]-[KR]-[LIVMF][DNSTA]-[DNS]-x(4)-[GSTAN]-[LIVMA]-x-[LIVMY] at positions 225e247 in the amino acid sequence of the C-terminus according to analysis using the PROSITE database. Additionally, The 2D structure of CiVDAC1 was established using the Psipred server (Fig. 2). Amino acid sequence comparison revealed conservation of VDAC sequences from mouse, human, silurana, zebrafish, puffer fish, fruit fly and grass carp (Fig. 3), and this predicted an a-helix at the amino terminus and a total of 19 membrane spanning bstrands.

Fig. 2. Psipred secondary structure predictions for CiVDAC1 (http://bioinf.cs.ucl.ac.uk/psipred/) showing an a-helix at the amino terminus and 19 membrane spanning b-strands.

X. Shen et al. / Fish & Shellfish Immunology 37 (2014) 96e107

101

3.5. CiVDAC1 and MX2 mRNA expression profiles in vitro post poly (I:C) stimulation After naked poly (I:C) challenge, the expression levels of CiVDAC1 varied significantly and there was upregulation at 2 h (1.25fold, P > 0.05), followed by a gradual decrease in expression (Fig. 6A). Mx2 gene expression was monitored in response to poly (I:C) induction using the same RNA samples from the CIK cells (Fig. 6B). 3.6. CiVDAC1 and MX2 mRNA expression profiles in vitro post GCRV infection After GCRV infection, changes in CiVDAC1 mRNA expression patterns were detected. CiVDAC1 expression in CIK cells was significantly upregulated at 4 h (1.52-fold, P > 0.05), decreasing at 8 h (1.28-fold, P > 0.05), peaking at 12 h (2.4-fold, P < 0.01), before decreasing at 24 h (1.6-fold, P > 0.05), increasing rapidly at 36 h (2.1-fold, P < 0.05), and then decreasing at 48 h until the end of experiment (Fig. 6C). Mx2 gene expression was monitored in response to GCRV infection using the same RNA samples from the CIK cells (Fig. 6D). 3.7. Expression of CiVDAC1 and MX2 mRNA in heart and head kidney tissues post GCRV challenge

Fig. 3. Sequence comparison of proteins encoded by VDACs from human, mouse and silurana, zebrafish, puffer fish, fruit fly and grass carp. Sequences were aligned using the DNAman software. GenBank accession numbers are: human [NP_003365.1]; mouse [NP_035824.1]; silurana [NP_001016492.1], zebrafish [AAQ97862.1], puffer fish [CAG08797.1], fruit fly [AAC02635.1] and grass carp [KC684923.1].

3.3. Homology and phylogenetic tree analysis The molecular evolution of VDACs was studied by comparing sequences for similarities, and so all known or predicted VDAC protein sequences from vertebrates and invertebrates in the GenBank were analyzed with BLASTP to construct a phylogenetic tree (Fig. 4). All the sequences clustered into three groups: VDAC1, VDAC2 and VDAC3. CiVDAC1 fell into the VDAC1 group, and the results indicate that CiVDAC1 is an ortholog of corresponding mammalian VDAC genes. 3.4. Expression of CiVDAC1 in grass carp tissues qRT-PCR results showed similar expression patterns for CiVDAC1 in spleen, intestine, liver, muscle, trunk kidney, gill, head kidney, heart, swim bladder, brain, skin and blood tissues (Fig. 5). Expression of CiVDAC1 was greatest in muscle and heart tissues, while only low expression was detected in the gills.

To further investigate the effects of viral infection on CiVDAC1 gene expression in vivo, three grass carps from each experimental group were sacrificed for tissue collection. qRT-PCR assays were conducted to measure the levels of CiVDAC1 mRNA in heart and head kidney tissues at various time points post viral challenge. For kidney tissue, CiVDAC1 was significantly upregulated and reached greatest expression at 36 h (6.54-fold, P < 0.01), before decreasing rapidly (Fig. 7A). For heart tissue, CiVDAC1 expression was significantly upregulated at 8 h (5.68-fold, P > 0.05), showed peak expression at 36 h (14.1-fold, P < 0.01), before decreasing at 48 h (5.14-fold, P > 0.05), and finally showing further upregulation at 72 h (10.6-fold, P < 0.05) (Fig. 7B). Mx2 gene expression was monitored in response to GCRV infection using the same RNA samples in head kidney and heart tissue samples (Fig. 7C and D). 3.8. Knock-down of CiVDAC1 temporal expression in CIK cells after GCRV infection To test whether plasmid-transcribed siRNA could inhibit CiVDAC1 expression, the relative level of CiVDAC1 gene expression was evaluated at 48 h after transfection by qRT-PCR analysis, and siRNA3 was determined to be the best siRNA (Fig. 8). Cells transfected with siRNA3 or EGFP-siRNA were subsequently incubated with GCRV in the test. CiVDAC1 mRNA expression level was determined in the transfected-and-infected cells. At 0 h p.i., the mRNA expression level of CiVDAC1 in siRNA3 transfected cells was inhibited to 0.34 fold (P < 0.05) relative to that in EGFP-siRNA transfected cells, indicating that the siRNA worked well. In general, the mRNA expression of CiVDAC1 in siRNA3-transfected cells was significantly lower than EGFP-siRNA-transfected cells at each time point (Fig. 9A). After viral challenge, the supernatant of GCRV-infected cells was sampled for TCID50 assay at 0, 4, 8, 12, 24, 36 and 48 h p.i. Replication of GCRV in CIK cells with suppressed CiVDAC1 expression was revealed by the quantification of progeny virus in the supernatant and level of synthesis of VP7 protein mRNA inside the cells. Fig. 9B demonstrates that cells transfected with suppressed CiVDAC1 maintained similar levels of viral mRNA as control groups. CIK

102

X. Shen et al. / Fish & Shellfish Immunology 37 (2014) 96e107

Fig. 4. Neighbor-joining phylogenetic tree generated for VDAC amino acid sequences from vertebrates and invertebrates using the Mega 5.0 program and ClustalW. Robustness was ensured by 1000 bootstrap replications. The three VDAC groups (VDAC1, VDAC2 and VDAC3) are indicated.

cells with suppressed expression of the CiVDAC1 gene showed no reduction in progeny virus production.

(Fig. 11CeE). The high homology between CiVDAC1 and CiVDAC2 might suggest that they could functionally complement each other.

3.9. Cloning, expression pattern, and response of CiVDAC2 to GCRV infection

3.10. Cellular localization analysis of pEGFP-CiVDAC1

The cDNA sequence of CiVDAC2 (KC684924.1) was 1819 bp, which included an ORF of 852 bp encoding a 283-amino acid protein. Additionally, amino acid sequence comparison revealed 77.03% identity between CiVDAC1 and CiVDAC2 proteins, with both containing a 4-element eukaryotic porin signature motif, a GLK motif and a VKAKV-like sequence (Fig. 10). qRT-PCR demonstrated that CiVDAC2 was as widely distributed in grass carp tissues as CiVDAC1 (Fig. 11A), and it responded to poly (I:C) stimulation (Fig. 11B) in CIK cells as well as to GCRV infection. Also CiVDAC2 was induced in head kidney and heart tissues upon GCRV challenge

To investigate whether the over-expression of CiVDAC1, cellular localization was performed in transiently transfected CIK cells. CiVDAC1 was predominantly distributed in cytoplasm (Fig. 12). 3.11. GCRV titers changes after injected pEGFP-CiVDAC1 To further understand the functional role of CiVDA1, the overexpression of CiVDA1 was performed by constructing the DNA plasmid. After 10 days vaccination, the GCRV-infected muscle tissue was sampled at 8, 12, 24, 48 h p.i. Fig. 13 demonstrates that the

Fig. 5. Tissue-specific expression of CiVDAC1. qRT-PCR was employed to examine the expression of CiVDAC1 mRNA in different tissues. The relative expression levels of CiVDAC1 were normalized to 18S rRNA expression levels, and calculated against the CiVDAC1 level in the spleen by 2DDCT method. CiVDAC1 mRNA was expressed in all the tissues examined, and was especially high in the muscle and heart tissues but low in the gill tissues.

X. Shen et al. / Fish & Shellfish Immunology 37 (2014) 96e107

103

Fig. 6. (A) Expression of CiVDAC1 mRNA in CIK cells after stimulation with poly (I:C). CiVDAC1 transcript expression was detected at 0, 2, 8 and 24 h post stimulation, and EF1a served as the reference gene. (B) Expression of CiVDAC1 mRNA relative to EF1a as determined by qRT-PCR in CIK cells infected with GCRV. CiVDAC1 expression was examined at 0, 4, 8, 12, 24, 36 and 48 h post infection. (C) and (D) Mx2 gene expression was monitored in CIK cells in response to GCRV infection and poly (I:C) induction using the same RNA samples. Date are presented as the mean  SE, *P < 0.05, ** P < 0.01.

muscle tissue with over-expression of CiVDAC1 could strongly protect against challenge with live virus. 4. Discussion In this present report, CiVDAC1 was identified as one of the major upregulated host proteins upon GCRV challenge. First, we sequenced the cDNA of CiVDAC1, studied its differential expression, and investigated its response to GCRV and poly (I:C) challenges in vitro. To further characterize the role of CiVDAC1 in the interaction between GCRV and CIK cells, CiVDAC1 expression was silenced using RNAi technology, but this had no impact on viral replication and viral protein synthesis, and these mechanism underlying this

phenomenon remains unknown. But the over-expression of CiVDAC1 in fish was performed, the results showed increase their resistance to GCRV through unknown mechanisms. To interpret the role of other VDAC proteins in viral pathogenesis, the CiVDAC2 gene was cloned and characterized, and its expression was found to change in response to GCRV challenge in a similar way to CiVDAC1. Thus, the CiVDAC1 protein was determined to be a virus-induced factor in grass carp cells. In embryonic cells of the olive flounder P. olivaceus, the expression of PoVDAC was induced after infection by the Scophthalmus maximus rhabdovirus (SMRV), and its upregulation appeared to be related to the virus-induced apoptotic process [16]. VDAC of the shrimp M. japonicus (MjVDAC) localized in the

Fig. 7. (A) Temporal expression of CiVDAC1 mRNA relative to 18S rRNA as determined by qRT-PCR in kidney and heart tissues at different points after GCRV infection. (B) Mx2 gene expression was monitored in response to GCRV infection using the same RNA samples from kidney and heart tissues. Date are presented as the mean  SE, *P < 0.05, ** P < 0.01.

104

X. Shen et al. / Fish & Shellfish Immunology 37 (2014) 96e107

Fig. 8. Reduction in expression of CiVDAC1 mRNA by three different siRNAs as determined by qRT-PCR. siRNA3 was determined to be the most effective siRNA.

mitochondria and its expression was upregulated upon infection by white spot syndrome virus (WSSV) [18]. The HBV-x protein has been shown to co-localize with VDAC in the mitochondria, and the interaction of HBV-x-VDAC is thought to induce cell death by causing loss of mitochondrial membrane permeabilization [30]. The present findings on the function of the CiVDAC1 protein are consistent with these previous reports. Taken together, VDAC proteins seem to be involved in viral pathogenesis of aquatic

Fig. 9. (A) mRNA expression of CiVDAC1 post GCRV infection in CIK cells transfected with GFP-siRNA and siRNA3. The cells transfected with EGFP-siRNA was the control. EF1a was used as the internal reference gene. Date are presented as the mean  SE, *P < 0.05 **P < 0.01. (B) qRT-PCR analysis of viral RNA copy number from 105 cells. (C) Time-course TCID50 analysis of viral load in the supernatants of cells transfected with GFP-siRNA and siRNA3 post GCRV infection.

organisms. As is well known, the mitochondrion plays a crucial role in the regulation of apoptosis, and VDACs are a gatekeeper in mitochondrion-mediated apoptosis [14]. The expression level of VDAC controls the transport of ATP, ADP and other metabolites between the cytosol and mitochondrion [33], while low expression of VDAC should lead to disrupted energy production [34]. VDAC also serves as a target of pro- and anti-apoptotic proteins [35], and they are regarded as prime targets for therapeutic agents designed to modulate apoptosis [36]. It is well established that GCRV infection results in apoptosis of host cells [37]; thus, CiVDACs might contribute to facilitate viral transmission by inducing apoptosis of infected CIK cells. During developmental processes and environmental stress responses, compositional changes of VDACs and their oligomeric states have been reported and there are also changes in VDACassociated factors. However, the physiological significance of VDACs and the mechanism of their regulation are not fully understood. Downregulation of VDAC1 expression would result in decreased energy production, which would affect cell vitality. Overexpression of VDACs can induce apoptosis in some cells [16,38e 41]. However, it is closure of VDACs, not VDACs opening, that leads to permeabilization of the MOM and apoptosis [14]. In many cases, VDAC-associated proteins and non-protein modulators, such as Bcl-2 family proteins, HKs, and Ca2þ, have been characterized to be involved in the modulation of VDAC channels resulting in apoptosis [42]. Since both viral and host factors might contribute to virus-induced apoptosis, the association between VDAC1 and apoptosis was not addressed specifically in this present report. The present data indicated that upregulation of CiVDAC1 was a cellular response to viral infection. Keeping in mind that VDACs play crucial roles in the regulation of metabolic and energetic functions of mitochondria, the above conclusion does not exclude the possible function of upregulated VDAC1 in maintaining cellular redox homeostasis upon viral challenge besides its potential antiviral immune response by inducing apoptosis. The results of overexpression CiVDAV1 in vivo suggested that CiVDAC1 might be mediated fish antiviral immune response through induction of apoptosis. Increased cell vitality might explain the positive effect of upregulated VDAC on viral infection. The VDAC family proteins include three isoforms, VDAC1, VDAC2 and VDAC3, which are all located in the MOM. VDAC1 is labeled as the archetypal VDAC, as it is highly conserved in all eukaryotes in terms of single-channel conductance, selectivity and voltage

X. Shen et al. / Fish & Shellfish Immunology 37 (2014) 96e107

105

Fig. 10. (A) Alignment of deduced amino acid sequences of CiVDAC1 and CiVDAC2. (B) Domain structures of CiVDAC1 and CiVDAC2 predicted the presence of a 4-element eukaryotic porin signature motif (at amino acid residue positions 5e20, 68e83, 147e158 and 247e264), and this motif has been shaded. The vertical line indicates a GLK motif (at amino acid positions 84e96) and a VKAKV-like sequence (at amino acid positions 233e237).

dependence. Examination of mouse isoforms showed that all channels formed with VDAC1 and VDAC2 proteins have similar properties, while VDAC3 shows far less channel formation and exhibits a broader range of properties [8,43]. Knock-out of just one of the three VDAC isoforms in mice causes serious effects, but no single isoform is required for cell viability. For example, knock-out of VDAC3 in mice results in male sterility due to non-motile sperm

while the knock-out of either VDAC1 or VDAC2 yields mice with a 30% reduction in respiratory capacity [44,45]. In this present study, we checked VDAC2 expression as well as its response to viral challenge. Induced expression patterns were observed for both CiVDAC1 and CiVDAC2, which was consistent with findings for mouse VDACs. The existence of VDAC isoforms also explained the vitality of CIK cells with suppressed expression of CiVDAC1 by RNAi.

Fig. 11. (A) Tissue distribution of CiVDAC2 mRNA. (B) mRNA expression of CiVDAC2 post poly (I:C) stimulation in CIK cells. (C) mRNA expression of CiVDAC2 post GCRV infection. (D) and (E) Temporal expression of CiVDAC1 mRNA in kidney and heart tissues at different points after GCRV infection. The relative expression of the transcript from qRT-PCR was calculated based on the standard curve and normalized to the EF1a mRNA level. Date are presented as the mean  SE, *P < 0.05 **P < 0.01.

106

X. Shen et al. / Fish & Shellfish Immunology 37 (2014) 96e107

Fig. 12. In vitro gene expression of pEGFP-CiVDAC1 in CIK cell line by immuno fluorescence detection; The merge column also includes DAPI staining and shows the cytoplasm localization of CiVDAC1 in the CIK cells.

Fig. 13. Over-expression of CiVDAC1 protects fish from GCRV infection. Quantification of virus yields. EF1a was used as an internal control gene. The viral expression profiles of VP7 expression levels were examined at 8, 12 h, 24 and 48 h post-challenge in the muscles infected with pEGFP-CiVDAC1 and pEGFP-N1 post GCRV infection. Date are presented as the mean  SE, *P < 0.05 **P < 0.01.

In conclusion, as a central player in both signal transduction and regulation, VDAC1 was found to be significantly upregulated at both transcriptional and translational levels in response to GCRV infection. Suppression of CiVDAC1 expression by RNAi had no impact on replication of GCRV in CIK cells, but over-expression of CiVDAC1 in fish showed strongly protect against challenge with live virus. An isoform of CiVDAC1, CiVDAC2, demonstrated a similar pattern of expression changes as observed for CiVDAC1. CiVDAC2 may be an important supplement of CiVDAC1 in functions. Further, we showed that VDAC expression responded positively to poly (I:C) stimulation. Taken together, CiVDAC1 is suggested to be an inductive factor in response to GCRV challenge, and has no detectable effect on GCRV replication in infected CIK cells, but over-expression of CiVDAC1 protects fish from GCRV infection in fish. Since VDAC is a key player in mitochondria-mediated apoptosis, the next logical step should focus on the relations between VDAC and apoptosis induced by GCRV. Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (No. 31072244) and the Earmarked Fund for China Agriculture Research System (No. CARS-46-12). The authors thank the support from Shanghai Universities First-class Disciplines Project of Fisheries. References [1] Qiu T, Lu R, Zhang J, Zhu Z. Complete nucleotide sequence of the S10 genome segment of grass carp reovirus (GCRV). Dis Aquat Org 2001;44:69e74. [2] Zhang C, Wang Q, Shi C, Zeng W, Liu Y, Wu S. Molecular analysis of grass carp reovirus HZ08 genome segments 1-3 and 5-6. Virus Genes 2010;2010(41): 102e4.

[3] Francki RIB, Fauquet CM, Knudson DL, Brown F. Classification and nomenclature of viruses: fifth report of the international committee on taxonomy of viruses. New York: Springer-Verlag; 1991. [4] Wang T, Li J, Lv L. Quantitative in vivo and in vitro characterization of coinfection by two genetically distant grass carp reoviruses. J Gen Virol 2013;94:1301e9. [5] Shoshan-Barmatz V, Gincel D. The voltage-dependent anion channel: characterization, modulation, and role in mitochondrial function in cell life and death. Cell Biochem Biophys 2003;39:279e92. [6] Lemasters JJ, Holmuhamedov E. Voltage-dependent anion channel (VDAC) as mitochondrial governator-thinking outside the box. Biochim Biophys Acta 2006;1762:181e90. [7] Young MJ, Bay DC, Hausner G, Court DA. The evolutionary history of mitochondrial porins. BMC Evol Biol 2007;7:31. [8] Colombini M. VDAC: the channel at the interface between mitochondria and the cytosol. Mol Cell Biochem 2004;256/257:107e15. [9] Casadio R, Jacoboni I, Messina A, Pinto VD. A 3D model of the voltagedependent anion channel (VDAC). FEBS Lett 2002;520:1e7. [10] Bathori G, Sahin-Toth M, Fonyo A, Ligeti E. Transport properties and inhibitor sensitivity of isolated and reconstituted porin differ from those of intact mitochondria. Biochim Biophys Acta 1993;1145:168e76. [11] Lee AC, Xu X, Colombini M. The role of pyridine dinucleotides in regulating the permeability of the mitochondrial outer membranes. J Biol Chem 1996;271: 26724e31. [12] Rostovtseva TK, Komarov A, Bezukov SM, Colombini M. Dynamics of nucleotides in VDAC channels: structure-specific noise generation. Biophys J 2002;82:193e205. [13] Shoshan-Barmatza Varda, De Pinto Vito, Zweckstetter Markus, Raviv Ziv, Keinan Nurit, Arbel Nir. VDAC, a multi-functional mitochondrial protein regulating cell life and death. Mol Aspects Med 2010;31:227e85. [14] Rostovtseva TK, Tan W, Colombini M. On the role of VDAC in apoptosis: fact and fiction. J Bioenerg Biomembr 2005;37:129e42. [15] Cheng EH, Sheiko TV, Fisher JK, Craigen WJ, Korsmeyer SJ. VDAC2 inhibits BAK activation and mitochondrial apoptosis. Science 2003;301:513e7. [16] Lü AJ, Dong CW, Du CS, Zhang QY. Characterization and expression analysis of Paralichthys olivaceus voltage-dependent anion channel (VDAC) gene in response to virus infection. Fish Shellfish Immunol 2007;23:601e13. [17] Wang KC, Kondo H, Hirono I, Aoki T. The Marsupenaeus japonicus voltagedependent anion channel (MjVDAC) protein is involved in white spot syndrome virus (WSSV) pathogenesis. Fish Shellfish Immunol 2010;29:94e103. [18] Corbett JM, Dunn MJ, Posch A, Gorg A. Electrophoresis 1994;15:1205e11. [19] Fang Q, Seng EK, Ding QQ, Zhang LL. Characterization of infectious particles of grass carp reovirus by treatment with proteases. Arch Virol 2008;153: 675e82. [20] He YX, Yang Q, Xu HX, Wu H, Wu FY, Lu LQ. Prokaryotic expression and purification of grass carp reovirus capsid protein VP7 and its vaccine potential. Afr J Microbiol Res 2011;5:1643e8. [21] Cheng S, Zhang M, Li WT, Wang Y, Liu YY, He QG. Proteomic analysis of porcine alveolar macrophages infected with porcine circovirus type 2. Proteomics 2012;75:3258e69. [22] Cao HP, Zheng WD, He S, Wang H, Wang T, Lu LQ. Identification of upregulated proteins potentially involved in the antagonism mechanism of Bacillus amyloliquefaciens G1. Antonie Van Leeuwenhoek 2013;103:1395e404. [23] Rosenfeld J, Capdevielle J, Guillemot JC, Ferrara P. In-gel digestion of proteins for internal sequence analysis after one-or two-dimensional gel electrophoresis. Anal Biochem 1992;203:173e9. [24] Zheng X, Hong L, Shi L, Guo J, Sun Z, Zhou J. Proteomics analysis of host cells infected with infectious bursal disease virus. Mol Cell Proteomics 2008;7: 612e25. [25] Hulo N, Bairoch A, Bulliard V, Cerutti L, Cuche BA, de Castro E, et al. The 20 years of PROSITE. Nucleic Acids Res 2008;36:245. [26] Finn RD, Tate J, Mistry J, Coggill PC, Sammut SJ, Hotz HR, et al. The Pfam protein families database. Nucleic Acids Res 2008;36:D281e8. [27] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24:1596e7.

X. Shen et al. / Fish & Shellfish Immunology 37 (2014) 96e107 [28] Huang T, Su J, Heng J, Dong J, Zhang R, Zhu H. Identification and expression profiling analysis of grass carp Ctenopharyngodon idella LGP2 cDNA. Fish Shellfish Immunol 2010;29:349e55. [29] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(Delta Delta C(T)) method. Methods 2001;25:402e8. [30] Shirakata Y, Koike K. Hepatitis B virus X protein induces cell death by causing loss of mitochondrial membrane potential. J Biol Chem 2003;278:22071e8. [31] Zheng FR, Sun XQ, Liu HZ, Zhang JX. Study on the distribution and expression of a DNA vaccine against lymphocystis disease virus in Japanese flounder (Paralichthys olivaceus). Aquaculture 2006;261:1128e34. [32] Heppell J, Lorenzen N, Armstrong NK, Wu T, Lorenzen E, Jensen E, et al. Development of DNA vaccines for fish: vector design, intramuscular injection and antigen expression using viral haemorrhagic septicaemia virus genes as model. Fish Shellfish Immunol 1998;8:271e86. [33] Rostovtseva TK, Bezrukov SM. VDAC regulation: role of cytosolic proteins and mitochondrial lipids. J Bioenerg Biomembr 2008;40:163e70. [34] Abu-Hamad S, Sivan S, Shoshan-Barmatz V. The expression level of the voltage-dependent anion channel controls life and death of the cell. Proc Natl Acad Sci U S A 2006;103:5787e92. [35] Shoshan-Barmatz V, Keinan N, Zaid H. Uncovering the role of VDAC in the regulation of cell life and death. J Bioenerg Biomembr 2008;40:183e91. [36] Shoshan-Barmatz V, Mizrachi D. VDAC1: from structure to cancer therapy. Front Oncol 2012;2:164. [37] LI Q, Huang FT, Wang M, Wang WM, Liu XQ. Preliminary study on GCRVinduced apoptosis in FHM cells. J Hydroecol 2012;33:114e8.

107

[38] Abu-Hamad S, Zaid H, Israelson A, Nahon E, Shoshan-Barmatz V. Hexokinase-I protection against apoptotic cell death is mediated via interaction with the voltage-dependent anion channel-1: mapping the site of binding. J Biol Chem 2008;283:13482e90. [39] Ghosh T, Pandey N, Maitra A, Brahmachari SK, Pillai B. Role for voltage dependent anion channel VDAC1 in polyglutamine-mediated neuronal cell death. PLoS One 2007;2:1170. [40] Godbole A, Varghese J, Sarin A, Mathew MK. VDAC is a conserved element of death pathways in plant and animal systems. Biochim Biophys Acta 2003;1642:87e96. [41] Zaid H, Abu-Hamad S, Israelson A, Nathan I, Shoshan Barmatz V. The voltage dependent anion channel-1 modulates apoptotic cell death. Cell Death Differ 2005;12:751e60. [42] Tsujimoto Y, Shimizu S. The voltage-dependent anion channel: an essential player in apoptosis. Biochimie 2002;84:187e93. [43] Shoshan-Barmatz V, DePinto V, Zweckstetter M, Raviv Z, Keinan N, Arbel N. VDAC, a multi-functional mitochondrial protein regulating cell life and death. Mol Aspects Med 2010;31:227e85. [44] Wu S, Sampson MJ, Decker WK, Craigen WJ. Each mammalian mitochondrial outer membrane porin protein is dispensable: effects on cellular respiration. Biochim Biophys Acta 1999;1452:68e78. [45] Sampson MJ, Decker WK, Beaudet AL, Ruitenbeek W, Armstrong D, Hicks MJ, et al. Immotile sperm and infertility in mice lacking mitochondrial voltagedependent anion channel type 3. J Biol Chem 2001;276:39206e12.