Molecular Microbiology (1992) 6(2), 257-265
Purification and functional characterization of the KdgR protein, a major repressor of pectinolysis genes of Erwinia chrysanthemi W. Nasser,* S. Reverchon and J. Robert-Baudouy Laboratoire de Genetique Moiecuiaire des Microorganismes, Batiment 406, Institut Nationai des Sciences Apliquees, 69621 Viileurbanne Cedex, France. Summary The phytopathogenicity of the enterobacterium Erwinia chrysanthemi chiefly results from its capacity to degrade pectin, which is the major component of plant cell walls. This degradation requires the product of 12 genes which constitute independent transcriptional units. All these genes, including Irc/gT which encodes the 2-keto-3-deoxygluconate (KDG) transport system, are negatively regulated by the KdgR protein. The E. chrysanthemi lidgR gene was cloned into an expression vector and overexpressed in Escherichia coii. KdgR was then purified to homogeneity by two chromatographic steps as a dimer of approximately 62 kDa. Using gel retardation assays, we demonstrated that this purified repressor binds to the 25 bp oligonucleotide (AAAAAAGAAACATTGTTTCATTTGT) present in the iidgT regulatory region. Dimethyl sulphate interference experiments revealed that the repressor interacts with four guanine bases and 10 adenine bases in the two strands of this KdgR box. KDG, an actual inducer of pectinolysis, releases the repressor from the operator complexes, whereas galacturonate, which is the precursor of the actual inducer, does not. These results suggest the existence of a specific interaction between KDG and KdgR protein. This study opens discussion on the relative affinity of the KdgR protein for the different operators of pectinolysis genes which are interpreted in terms of differential regulation.
Introduction The pathogenicity of the 'soft-rotting' erwiniae is related to their capacity to secrete many enzymes such as pectinases, cellulases and proteases, which degrade the major Received 1 August, 1991; revised 1 October, 1991, *For correspondence, Tel, 72 43 80 88; Fax 72 43 85 11,
components of plant cell walls. Among these enzymes, pectate lyases (Pel) play a preponderant role since the purified proteins induce plant tissue rotting (Collmer and Kenn, 1986). Erwinia chrysanthemi strain 3937 synthesizes and secretes in the extracellular medium one pectin methylesterase (Pem) and five pectate lyases (Pel) which cleave pectin and generate unsaturated digalacturonates. These degradation products are transported into the bacterium, where they are catabolized (Fig. 1) (Condemine et al. 1986; Hugouvieux-Cotte-Pattat and Robert-Baudouy, 1987). The 12 structural genes (pem, pelA-E, ogl, kdul, kduD, kdgT, kdgK, kdgA) involved in the pectin degradation pathway (Fig. 1) have been cloned and characterized. These genes are organized in six clusters on the chromosome (Hugouvieux-Cotte-Pattat etai, 1989). Within each cluster, genes are not arranged in operons but constitute independent transcriptional units (Reverchon etai, 1986; Hugouvieux-Cotte-Pattat and Robert-Baudouy, 1989). Expression of all these genes is inducible in the presence of polygalacturonic acid (PGA) or galacturonate. Analysis of mutants in different steps of pectinolysis has demonstrated that the real intracellular inducers are 2-keto-3deoxygluconate (KDG), 2,5-diketo-3-deoxygluconate (DKII), and 5-keto-4-deoxyuronate (DKI) (Condemine et ai, 1986). Inducibility by these pectic derivatives is mainly mediated by the /cdgfl product, which negatively regulates all the genes involved in pectin degradation (Condemine and Robert-Baudouy, 1987; Reverchon etai, 1990). The E. chrysanthemi kdgR regulatory gene was cloned in £ coii and sequenced. The KdgR repressor shows homology with two other regulatory proteins: GylR, an activator protein of the glycerol operon in Streptomyces coeiicor; and IcIR, which corresponds to a repressor of the acetate operon in Saimoneiia typhimurium and in Escherichia coii (Reverchon ef ai., 1991). Recently, comparison of the regulatory regions of several genes controlled by the KdgR protein revealed the existence of a highly conserved 25 bp imperfect palindrome which was proposed as the KdgRbinding site (Reverchon ef ai., 1989; Condemine and Robert-Baudouy, 1991). Substitution of this 25 bp palindrome for the iac operator placed the transcription of the iacZ gene under the control of the KdgR. Therefore, this sequence is sufficient to function as an operator for the
258
VJ. Nasser, S. Reverchon and J. Robert-Baudouy plant pectin CH3 60
COOH
OH
CH3
CH3
CO
CO
OH
OH
Fig. 1. Degradative pathway of pectin and gaiacturonate in E. ciirysanttiemi. The different steps are cataiysed by the products of the genes specified near the con-esponding arrow: pem, gene encoding pectin-methyi-esterase; pei, pectate-lyase (actually five genes; pelA to pelFj; ogl, oligogalacturonate-lyase; kdui, 5-i
Purification and functional characterization of the KdgR protein, a major repressor of pectinolysis genes of Erwinia chrysanthemi W. Nasser,* S. Reverchon and J. Robert-Baudouy Laboratoire de Genetique Moiecuiaire des Microorganismes, Batiment 406, Institut Nationai des Sciences Apliquees, 69621 Viileurbanne Cedex, France. Summary The phytopathogenicity of the enterobacterium Erwinia chrysanthemi chiefly results from its capacity to degrade pectin, which is the major component of plant cell walls. This degradation requires the product of 12 genes which constitute independent transcriptional units. All these genes, including Irc/gT which encodes the 2-keto-3-deoxygluconate (KDG) transport system, are negatively regulated by the KdgR protein. The E. chrysanthemi lidgR gene was cloned into an expression vector and overexpressed in Escherichia coii. KdgR was then purified to homogeneity by two chromatographic steps as a dimer of approximately 62 kDa. Using gel retardation assays, we demonstrated that this purified repressor binds to the 25 bp oligonucleotide (AAAAAAGAAACATTGTTTCATTTGT) present in the iidgT regulatory region. Dimethyl sulphate interference experiments revealed that the repressor interacts with four guanine bases and 10 adenine bases in the two strands of this KdgR box. KDG, an actual inducer of pectinolysis, releases the repressor from the operator complexes, whereas galacturonate, which is the precursor of the actual inducer, does not. These results suggest the existence of a specific interaction between KDG and KdgR protein. This study opens discussion on the relative affinity of the KdgR protein for the different operators of pectinolysis genes which are interpreted in terms of differential regulation.
Introduction The pathogenicity of the 'soft-rotting' erwiniae is related to their capacity to secrete many enzymes such as pectinases, cellulases and proteases, which degrade the major Received 1 August, 1991; revised 1 October, 1991, *For correspondence, Tel, 72 43 80 88; Fax 72 43 85 11,
components of plant cell walls. Among these enzymes, pectate lyases (Pel) play a preponderant role since the purified proteins induce plant tissue rotting (Collmer and Kenn, 1986). Erwinia chrysanthemi strain 3937 synthesizes and secretes in the extracellular medium one pectin methylesterase (Pem) and five pectate lyases (Pel) which cleave pectin and generate unsaturated digalacturonates. These degradation products are transported into the bacterium, where they are catabolized (Fig. 1) (Condemine et al. 1986; Hugouvieux-Cotte-Pattat and Robert-Baudouy, 1987). The 12 structural genes (pem, pelA-E, ogl, kdul, kduD, kdgT, kdgK, kdgA) involved in the pectin degradation pathway (Fig. 1) have been cloned and characterized. These genes are organized in six clusters on the chromosome (Hugouvieux-Cotte-Pattat etai, 1989). Within each cluster, genes are not arranged in operons but constitute independent transcriptional units (Reverchon etai, 1986; Hugouvieux-Cotte-Pattat and Robert-Baudouy, 1989). Expression of all these genes is inducible in the presence of polygalacturonic acid (PGA) or galacturonate. Analysis of mutants in different steps of pectinolysis has demonstrated that the real intracellular inducers are 2-keto-3deoxygluconate (KDG), 2,5-diketo-3-deoxygluconate (DKII), and 5-keto-4-deoxyuronate (DKI) (Condemine et ai, 1986). Inducibility by these pectic derivatives is mainly mediated by the /cdgfl product, which negatively regulates all the genes involved in pectin degradation (Condemine and Robert-Baudouy, 1987; Reverchon etai, 1990). The E. chrysanthemi kdgR regulatory gene was cloned in £ coii and sequenced. The KdgR repressor shows homology with two other regulatory proteins: GylR, an activator protein of the glycerol operon in Streptomyces coeiicor; and IcIR, which corresponds to a repressor of the acetate operon in Saimoneiia typhimurium and in Escherichia coii (Reverchon ef ai., 1991). Recently, comparison of the regulatory regions of several genes controlled by the KdgR protein revealed the existence of a highly conserved 25 bp imperfect palindrome which was proposed as the KdgRbinding site (Reverchon ef ai., 1989; Condemine and Robert-Baudouy, 1991). Substitution of this 25 bp palindrome for the iac operator placed the transcription of the iacZ gene under the control of the KdgR. Therefore, this sequence is sufficient to function as an operator for the
258
VJ. Nasser, S. Reverchon and J. Robert-Baudouy plant pectin CH3 60
COOH
OH
CH3
CH3
CO
CO
OH
OH
Fig. 1. Degradative pathway of pectin and gaiacturonate in E. ciirysanttiemi. The different steps are cataiysed by the products of the genes specified near the con-esponding arrow: pem, gene encoding pectin-methyi-esterase; pei, pectate-lyase (actually five genes; pelA to pelFj; ogl, oligogalacturonate-lyase; kdui, 5-i
