Protein Expression and Purification 105 (2015) 61–70

Contents lists available at ScienceDirect

Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep

Purification and immunodetection of the complete recombinant HER-2[neu] receptor produced in yeast Alexandre Chamas a, Martin Giersberg a, Katrin Friedrich b, Frank Sonntag c, Dietmar Kunze b, Steffen Uhlig d, Kirsten Simon e, Keith Baronian f, Gotthard Kunze a,⇑ a

Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), Corrensstr. 3, D-06466 Gatersleben, Germany Universitätsklinikum ‘‘Carl Gustav Carus’’ Dresden, Institut für Pathologie, Fetscherstr. 74, 01307 Dresden, Germany Fraunhofer Institut for Material and Beam Technology (IWS), Winterbergstr. 28, D-01277 Dresden, Germany d quo data GmbH, Kaitzer Str. 135, D-01187 Dresden, Germany e new diagnostics GmbH, Moosstr. 92c, D-85356 Freising, Germany f School of Biological Sciences, University of Canterbury, Private Bag 4800, Christchurch, New Zealand b c

a r t i c l e

i n f o

Article history: Received 5 June 2014 and in revised form 1 September 2014 Available online 17 October 2014 Keywords: Breast cancer HER-2[neu] A. adeninivorans Protein solubilization Surface Plasmon Resonance Immunoassay

a b s t r a c t For the first time, the full length recombinant HER-2[neu] receptor has been produced in a yeast (Arxula adeninivorans). It is one of the most studied membrane receptors in oncology and is involved in aggressive tumor formation. A yeast integration rDNA cassette containing the human gene coding for the HER-2[neu] protein was constructed and a screening procedure was performed to select the most productive transformant. Different detergents were tested for efficient solubilization of the membrane bound protein, with CHAPS giving the best results. To increase the yield of the recombinant protein from HER-2[neu] producing A. adeninivorans, optimal culture parameters were established for cultivation in bioreactor. The recombinant protein was subsequently assayed using ELISA and SPR immunoassays systems with antibodies raised against two different epitopes of the human receptor. In both cases, elution fractions containing the recombinant HER-2[neu] receptor successfully reacted with the immunoassays with limits of quantification below 100 ng ml1. These results demonstrate that the full length recombinant HER-2[neu] reported here has the potential to be a new standard for the detection of HER-2 type cancer. Ó 2014 Elsevier Inc. All rights reserved.

Introduction In the field of oncology much research has focused on the role played by epidermal growth factor receptors [1]. One member of this membrane receptor family, the tyrosine-protein kinase erbB2 also known as HER-2[neu] receptor, has been intensively investigated for its role in the progression of breast, colorectal and lung cancer [2–4]. It has been shown that overexpression of this receptor on the surface of breast cells is correlated with the development of a breast cancer known as HER2-positive carcinoma. [5]. In comparison to other types of breast carcinomas which do not show any overexpression of epidermal growth receptors, this type is characterized by high tumor aggressiveness and consequently, poor prognosis for the patient [4]. Although several commercially

⇑ Corresponding author at: Leibniz Institute of Plant Genetics and Crop Plant Research (IPK), Corrensstr. 3, D-06466 Gatersleben, Saxony-Anhalt, Germany. Tel.: +49 39482 5247; fax: +49 39482 5366. E-mail address: [email protected] (G. Kunze). http://dx.doi.org/10.1016/j.pep.2014.10.004 1046-5928/Ó 2014 Elsevier Inc. All rights reserved.

available drugs such as Trastuzumab (HerceptinÒ, Roche) and Lapatinib (TykerbÒ, Glaxo-Smith-Kline) have already greatly improved the treatment of patients affected by HER-2 type of breast carcinoma [6–8] and new therapies are showing promising results [9], a major challenge for oncologists remains the accurate determination of the HER2-positive status. Currently, only immunohistochemistry and Fluorescent In-Situ Hybridisation (FISH)1 are approved by the Food and Drug Administration (FDA) for the detection of HER-2[neu] protein accumulation or ERBB2 gene amplification [10]. Although these methods are easy to use, there are concerns regarding the production of qualitative information only and their low inter-laboratory reproducibility [11,12].

1 Abbreviations used: FISH, Fluorescent In-Situ Hybridisation; FDA, Food and Drug Administration; SPR, Surface Plasmon Resonance; PCR, Polymerase Chain Reaction; rDNA, ribosomal DNA; PBS, phosphate buffer saline; dcw, dry cell weight; LED, light emitting diode; cmc, critical micelle concentration; DEAE, diethylaminoethyl cellulose; IDA, iminodiacetic acid; NTA, nitrilotriacetic acid; TED, tris-carboxymethyl ethylene diamine.

62

A. Chamas et al. / Protein Expression and Purification 105 (2015) 61–70

Recently several immunoassays have been developed for HER2[neu] testing using piezoelectric microcantilevers [13], nanoelectrode ensembles [14] and Surface Plasmon Resonance (SPR) [15] but none of them is yet used for routine diagnosis. Although ELISA is used for HER-2[neu] quantification and commercial kits are available, their use is not approved for medical diagnosis because of a lack of consistency with FISH and immunohistochemistry results. The method is used to detect and quantify a truncated version of the HER-2[neu] receptor called HER-2[neu] ECD (Extra Cellular Domain). Although reports have shown that the quantification of this soluble version of the receptor in plasma and serum can be useful for diagnosis of the disease [16], and for monitoring treatment, low sensitivity remains a major problem for its use as a diagnostic standard [17]. A truncated version of the HER-2[neu] protein is commercially available (HER2, Active, SignalChem; active ErbB2 protein fragment, Abcam) but this protein lacks part of the receptor. It is smaller and differs in its spatial conformation from the human HER-2[neu] receptor although it is functional for the kinase assay. As the quantitative detection of protein is mainly based on epitope recognition by antibody, it is desirable that the structural integrity of the protein is preserved. A truncated version of the receptor will have different secondary and tertiary conformations and thus lack epitopes which could be used for immuno-detection. To establish a new assay for HER2-positive cancer determination, it is impossible to rely only on tissue-produced receptor because of the low quantity that the common methods can extract. This makes the production of a complete recombinant protein necessary which, until the present, was not possible because of its complexity. In the present study, the non-pathogenic yeast Arxula adeninivorans was used to produce a complete recombinant HER-2[neu] protein modified to carry a hexahistidine tag at the N-terminus. Yeast, a eukaryote, allows heterologous production of a human receptor in a functional state because its cellular structures and processes are similar to that of higher eukaryotes. Additionally the yeast is easy to cultivate and transform [18] and it is robust. A. adeninivorans has already been used to produce several types of recombinant enzymes [19–21] and other proteins [22]. The production of a membrane receptor, regardless of the heterologous system used, is often challenging and solubilization strategies have to be considered [23]. Consequently this study also tests a number of different detergents for solubilization. Further, the yield of such a protein is generally reported as relatively low (in the lg ml1 range) [23] and the purification procedures used often lead to loss of activity. In addition, the apparent size of this receptor protein (185 kDa [24]) increases the probability of protein degradation and loss of conformation during growth of the cells and during the solubilization and purification processes. Two different epitope recognition methods, ELISA and the Surface Plasmon Resonance (SPR), were used to test the integrity of the recombinant HER-2[neu] receptor. Both techniques use antibodies directed against different parts of the HER-2[neu] receptor and together can indicate that the conformation of the recombinant yeast-produced receptor is intact. The strategy used in these two detection methods involves an antibody recognizing an immobilized receptor (ELISA) and the receptor binding to a coated antibody (SPR).

Materials and methods Escherichia coli XL1-Blue (recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F0 proAB lacIqZDM15 Tn10 (Tetr)]), obtained from Stratagene (La Jolla, USA), served as the host strain for bacterial transformation and plasmid isolation. It was grown on LB medium supplemented with ampicillin (100 lg ml1, AppliChem GmbH,

Darmstadt, Germany) or kanamycin (50 lg ml1, Carl Roth GmbH, Karlsruhe, Germany) for selection. The tryptophan-auxotrophic mutant A. adeninivorans G1212 [aleu2 atrp1::ALEU2] [25] deposited in the strain collection of the Department of Biology of the University of Greifswald was used in this study. All strains were cultured at 30 °C, 180 rpm under either non-selective conditions in a complex medium (YEPD) or under selective conditions in yeast minimal medium supplemented with 20 g l1 glucose as carbon source and 43 mM NaNO3 as nitrogen source (YMM-glucose-NaNO3) [26,27]. Agar plates were prepared by the addition of 1.6% (w/v) agar to the liquid media. For this publication HER-2[neu] will refer to the recombinant protein and ERBB2 will refer to the gene coding for this protein. Transformation procedures, recovery of stable A. adeninivorans strains, and isolation of nucleic acids E. coli and A. adeninivorans cells were transformed according to Böer et al. [28]. Stabilization of the yeast transformants was performed by passaging on selective and non-selective media [29]. Isolation of plasmid DNA and DNA restrictions were carried out as described previously [30]. Construction of HER-2[neu] expression plasmids The ORF of the ERBB2 gene was provided by Life Technologies GmbH (Darmstadt, Germany) in an A. adeninivorans codon optimized form with a hexahistidine encoding sequence at the 50 end. For cloning, the 6H-ERBB2 ORF was amplified by Polymerase Chain Reaction (PCR) using the following primers (Metabion international AG, Martinsried, Germany): primer 1-50 -GAATTCA TGCACCATCATCACCACCACGAGCTGGCTGCTCTGTGCCGATGGGGAC T-30 (nucleotide positions 10–27 – hexahistidine encoding sequence; nucleotide positions 28–56 – ERBB2 ORF sequence position 4–32; EcoRI restriction site in bold type) and primer 2-50 GGATCCCTAGACAGGGACGT-30 (nucleotide positions 7–20, ERBB2 ORF sequence position 3765–3754, BamHI restriction site in bold type). The EcoRI-BamHI 6H-ERBB2 ORF fragment was inserted into the plasmid pBS-TEF1-PHO5-EBN (flanked by EcoRI-BamHI restriction sites) between the constitutive A. adeninivorans-derived TEF1 promoter and the Saccharomyces cerevisiae-derived PHO5 terminator [31]. Construction of plasmids with the 6H-ERBB2 expression module required the insertion of TEF1 promoter – 6H-ERBB2 ORF – PHO5 terminator flanked by SpeI-SacII restriction sites into the Xplor2.2 plasmid to generate Xplor2.2-TEF1-6H-ERBB2-PHO5. The 25S ribosomal DNA (rDNA) target sequences were interrupted by the selection marker module (ALEU2 promoter – ATRP1m gene – ATRP1 terminator) and Eco47III, SpeI, SacII, SalI, ApaI multicloning restriction sites for insertion [32]. These rDNA sequences allow yeast rDNA integration of the ERBB2 gene in the genome of A. adeninivorans as single or multi-copy. The ATRP1m gene is necessary for tryptophan synthesis and is lacking in the mutant G1212 strain. The plasmid Xplor2.2-TEF1-6H-ERBB2-PHO5, constructed in E. coli, was digested with AscI to remove E. coli sequences and the resulting linear cassette YRC102-6H-ERBB2 was then introduced into A. adeninivorans G1212. A control strain, YRC102, possessing the expression cassette without the ORF of the HER-2[neu] receptor was also constructed. Screening of 6H-ERBB2 expressing transformants After stabilization, transformants expressing 6H-HER-2 protein were cultivated for 48 h in 750 ll YMM-glucose-NaNO3 at 30 °C,

A. Chamas et al. / Protein Expression and Purification 105 (2015) 61–70

200 rpm. 400 ll culture was harvested (4600  g, 5 min), and the pellet was washed with phosphate buffer saline (PBS). Cells were disrupted in 20 mM sodium phosphate, pH 7.5 supplemented with 1% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS, Sigma–Aldrich, Saint Louis, USA) by zirconia/silica beads (0.5 mm diameter, Biospec Products, Inc, Bartlesville, USA) using a Mixer Mill MM400 (RETSCH, Germany) for 3 min, at a frequency of 30 s1 at 4 °C. After removal of cell debris (centrifugation at 6000g for 20 min), the lysate containing the HER-2[neu] receptor was kept on ice and the total protein content was measured using the Bio-Rad Protein Assay (Bio-Rad, München, Germany) with BSA (Sigma–Aldrich, Saint Louis, USA) as reference to establish a calibration curve. The lysate was then run on a SDS– PA gel for Coomassie staining and Western blot analysis. Batch fermentation A batch cultivation was conducted in a 1.5 l stirred-tank reactor (Univessel 1L, Sartorius Stedim Biotech GmbH, Goettingen, Germany) and the monitoring of cultivation parameters was performed using a BiostatÒ-Aplus Fermentor system (Sartorius Stedim Systems GmbH, Melsungen, Germany). The stirrer speed was adjusted to maintain 40% oxygen saturation in the culture medium (YMM-glucose-NaNO3) and the pH was maintained automatically at 6.0 by the addition of an HCl solution. A 60 ml preculture of A. adeninivorans G1212/YRC102-6H-ERBB2-10 was used as the inoculum giving a final volume of 660 ml. Dry cell weight (dcw), glucose concentration and total protein content determination, was from a 2 ml sample of culture taken at the beginning of the experiment and subsequently every 60 min between 6 and 22 h after. Samples were also taken 25 and 30 h after start of the experiment. For each sample, 1 ml was used for OD600nm measurement with a Nanodrop 2000c spectrophotometer (Thermo Scientific/Peqlab, Wilmimgton, USA) to calculate the dry cell weight (dcw). A calibration curve was constructed by diluting a culture sample of A. adeninivorans in different volumes of YMM-glucose-NaNO3. The culture was in the exponential phase to avoid the presence of a large number of dead cells. The OD600nm of these dilutions was first measured and then an identical volume of these dilutions was dried at 100 °C until no further change in mass was observed. Plotting the OD600nm as a function of the mass of the dilutions resulted a linear relationship yielding the equation: OD600nm = 0.6446xdcw + 0.0117. Thus by measuring the OD600nm, the dcw could be determined. The rest of the sample was centrifuged at 6000g for 20 min and the supernatant was used for determination of the glucose concentration using a D-glucose kit as per the user manual instructions (Boehringer/Biopharm AG, Darmstadt, Germany). The pellet was resuspended in extraction buffer and lysed. The lysate was analyzed using the Bio-Rad Protein Assay for quantification of the total protein and 5 lg of the protein solution was loaded onto a SDS–PA gel for Western blot analysis. SDS–PAGE and Western blotting For SDS–PAGE, all samples were treated with SDS loading buffer at 70 °C for 15 min. Then 25 ll of each sample were loaded on a 7% SDS–PA gel and electrophoresed in electrophoresis buffer at 60 V for the first 60 min and 100 V for the next 2 h. The gel was stained with Instantblue™ (Expedeon, Harston, UK) for 40 min followed by immersion in ddH2O for 60 min. Western blotting was performed by transferring the gel to a PVDF membrane (ImmobilonÒ-P Membrane; EMD Millipore Corporation, Billerica, USA), blocked with 1% non-fat dry milk (Roth, Karlsruhe, Germany) and incubating for 60 min with 1:4000 diluted polyclonal rabbit anti-human c-ErbB-2 oncoprotein (Dako

63

Denmark A/S, Glostrup, Denmark) directed against the intracellular part of the HER-2[neu] receptor. Subsequently the gel was incubated with anti-rabbit IgG (Fc) AP conjugate (Promega, Madison, USA) at a dilution of 1:15,000 for 30 min. BCIP/NBT tablet (Roche Diagnostics GmbH, Mannheim, Germany) for chromogenic detection. The stained membrane was then scanned. Protein purification A batch cultivation was performed with the G1212/YRC102-6HERBB2 strain in a final volume of 660 ml YMM-glucose-NaNO3 followed by protein purification. The cultivation was performed at 30 °C under constant agitation. At 13 h, the culture reached a dcw of 18.6 g per liter of culture corresponding to an OD600nm of 12. This gave a total mass of cells of about 12.3 g. After that, the cells were pelleted, washed with PBS, resuspended in 40 ml extraction buffer (LEW buffer) supplemented with 1% CHAPS and lysed by mechanical disruption using zirconia/silica beads in a Mixer Mill MM400 for 3 min at a frequency of 30 s1. The lysate was then further placed in ice and agitated for 60 min to allow solubilization of the transmembrane HER-2[neu] protein. The receptor was purified on a ProtinoÒNi-TED packed column 1000 (Macherey-Nagel GmbH & Co. KG, Düren, Germany) under native conditions according to manufacturer’s recommendations. This column possesses 250 mg TED resin. Imidazole was not present in either the extraction or the wash buffer (LEW buffer) and all purification steps were performed at 4 °C. A total volume of 4 ml LEW buffer (2  2 ml) was used to remove the unbound protein. Elution was performed with the recommended volume (3  1.5 ml) of elution buffer containing 250 mM imidazole. The affinity-purified protein was gel filtered with a PD10 column to remove imidazole from the elution fraction and recovered in PBS. The purity was assessed by SDS–PAGE total protein staining and Western blot analysis. The protein concentration was determined with a Bio-Rad Protein Assay using BSA as the standard. Solubilization of membrane protein The solubilization test is based on the work of White et al. [23] with some modifications. In a 1 l shaking flask, a 60 ml culture of A. adeninivorans G1212/YRC102-6H-ERBB2-10 was grown in YMM culture medium for 48 h at 30 °C, 180 rpm agitation until the culture reached an OD600nm of approximately 1.5. Cells were then harvested by centrifugation (10 min at 8000g) and resuspended in 850 ll lysis buffer (50 mM Tris, 1 mM EDTA, 1 M NaCl, 1 mM PMSF, pH 7.5). The cells were then disrupted using zirconia/silica beads in a Mixer Mill MM400. Lysed samples were then centrifuged at 11,500g, 4 °C for 25 min and the supernatant was transferred to a new tube and protein concentration was assessed using the Bio-Rad Protein Assay to be 22 mg ml1. Nine solubilization solutions were prepared. The first, the control solution, consisted of solubilization buffer (20 mM HEPES (Roth, Karlsruhe, Germany), 500 mM NaCl (Roth, Karlsruhe, Germany), 10% glycerol (Roth, Karlsruhe, Germany), pH 7.5 with the remaining eight solutions supplemented with the following detergents (all concentrations are w/v): 1% n-octyl-b-D-glucoside (octylglucoside, Sigma–Aldrich, Saint Louis, USA), 1% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS, Sigma–Aldrich, Saint Louis, USA), 1% methyl-6-O-(N-heptylcarbamoyl)-a-D-glucopyranosid (Hecameg, Sigma–Aldrich, Saint Louis, USA), 1% N,N-dimethyldodecylamine N-oxide (LDAO, Sigma– Aldrich, Saint Louis, USA), 1% decyl-b-D-maltoside (decyl-maltoside, Fluka/Sigma–Aldrich, Buchs, Switzerland), octylphenoxypolyethoxyethanol (Nonidet P40, Roche Diagnostics GmbH, Mannheim, Germany) and 1% Triton X-100 (TX-100, Boehringer, Mannheim, Germany).

64

A. Chamas et al. / Protein Expression and Purification 105 (2015) 61–70

20 ll of lysate (440 lg of total protein) was added to 2 ml of the solubilization solution and gently agitated at 4 °C for 60 min. Subsequently, the samples were centrifuged in a Beckman TLA-100.3 rotor at 150,000g for 60 min. 500 ll of supernatant was kept on ice for further analysis and the remainder of the supernatant was carefully removed by aspiration. The pellet was subsequently resuspended in 100 ll PBS. All samples (supernatant and resuspended pellets) were then prepared for SDS–PAGE and the presence of the HER-2[neu] receptor was determined by Western blotting. HER-2[neu] quantification by ELISA assay For the ELISA test, 200 ll of recombinant HER-2[neu] purified protein was immobilized in triplicate on a Maxisorp Immunowell plate (NUNC™, Roskilde, Denmark) for 16 h at 4 °C. The coated wells were then washed three times with PBS-tween and blocked for 60 min at room temperature with PBS-tween containing 5 mg ml1 BSA (Sigma–Aldrich, Saint Louis, USA) and then washed a further three times with PBS-tween. The first antibody, a 1:1000 dilution of the polyclonal rabbit anti-human c-ErbB-2 oncoprotein (Dako Denmark A/S Glostrup, Denmark) in PBS-tween was added and incubated for 60 min at room temperature. After three more washes with PBS-tween, the second antibody, a 1:1000 dilution of an anti-rabbit IgG peroxidase (Sigma–Aldrich, Saint Louis, USA), was added and incubated for 60 min at room temperature. After six further washes with PBS-tween colorimetric detection was performed by adding 0.1 mg ml1 3,30 ,5,50 tetramethylbenzidine (TMB, Sigma–Aldrich, Saint Louis, USA) dissolved in 0.1 M sodium acetate, pH 6. After blocking the reaction with 1 M phosphoric acid (Roth, Karlsruhe, Germany), the absorbance at 450 nm was measured using a Sunrise reader (Tecan Trading AG, Zürich, Switzerland) and the results analyzed by SigmaPlot 11.0 (Systat Software Inc, San Jose, USA) for statistical analysis and graphics display. HER-2[neu] quantification by SPR An SPR platform developed by the Fraunhofer-Institut für Werkstoff- und Strahltechnik (IWS, Dresden, Germany) and commercialized by Capitalis Technology GmbH (Berlin, Germany) was employed. It uses a collimated light at a constant wavelength of 810 nm from a near-infrared light emitting diode (LED) to irradiate a sensor chip (Capitalis Technology GmbH, Berlin, Germany) consisting of a bare gold surface on a plastic support. The gold chip was cleaned with 10 drops of fuming sulfuric acid (Roth, Karlsruhe, Germany), then washed with ddH2O and finally neutralized by addition of ‘piranha solution’ (H2O: NH4OH: 30% H2O2/5:1:1 (v/ v)) in preparation for immobilisation. It was then separated into three immobilization surfaces using a hydrophobic barrier to provide a non-functionalised control surface for detection of non-specific binding and two free surfaces for the immobilization of a HER2/ErbB2 monoclonal antibody (Pierce Biotechnology, Rockford, USA). The antibody, raised against the intracellular part of the receptor, was immobilised at two different dilutions. This immobilization was performed for 60 min at 25 °C. Remaining bare gold on the chip surface was blocked by soaking in a 100 mM concentration of O-[2-(3-tritylthiopropionylamino)ethyl]polyethylene glycol (Sigma–Aldrich, Saint Louis, USA) diluted in PBS for 4 h at 25 °C. The functionalized chip was then mounted on a temperature-regulated flow cell and attached to the SPR device. It was equilibrated by the injection of 4 ml running buffer (PBS) at a flow rate of 2.5 ll s1, 25 °C. 100 ll of a sample was injected at a flow rate of 2 ll s1. The SPR results were analyzed by the SPR integrated software. This software allows direct-visualisation of angle shift in the

functionalized surfaces of the gold chip. SigmaPlot was used for statistical analysis and creating graphics. Results and discussion Screening and cultivation of the 6H-ERBB2 expressing transformants The use of Xplor2.2 expression vector allows targeted yeast rDNA integration of the both single and multicopy versions of the gene of interest into the yeast genome. As demonstrated by Boer et al. [28], this integration occurs generally as single copy and at a very high transformation rate. A physical map of the linearized vector used for yeast rDNA integration can be seen in Fig. 1. To test if the transformants, A. adeninivorans G1212/YRC102-6HERBB2, were producing the HER-2[neu] receptor, 32 colonies were selected and grown in the culture medium as described in Material and methods. Western blotting allows rapid visualisation of the production of protein and the detection of protein degradation. As seen in Fig. 2a almost all transformants exhibit a band at approximately 185 kDa, which is the predicted molecular mass of the complete HER-2[neu] receptor. In addition the Western blots showed some protein bands of a lower molecular mass which are probably due to degradation of the protein. In contrast, the control strain G1212/YRC102 does not show these bands. Fig. 2b shows the Coomassie staining of these transformants and serves as control procedure. Several transformants showed more intense bands in the Western blot, and one of them, G1212/YRC102-6H-ERBB2-10, was chosen for further experiments. Solubilization of the recombinant HER-2[neu] Because the HER-2[neu] receptor contains one transmembrane domain, the solubilization of this protein was examined in detail. It is known that the efficiency of a membrane-bound protein extraction is highly dependent on the particular detergent used and hence a broad range of commonly used detergents were screened Six of them are non-ionic and two are zwitterionic. Octyl-glucoside, Hecameg and decyl-maltoside share similar hydrophilic segments but have different chain lengths and hydrophobic regions. A second group comprising Nonidet P40, Triton X-100 and digitonin have completely different hydrophilic sections and a third group, CHAPS and LDAO, are zwitterionic detergents and were selected because they have been shown to be efficient for membrane protein solubilization [33]. To ensure the solubilization effectiveness, the detergents were always added at a concentration above the critical micelle concentration (cmc) and generally the ratio of lysate:detergent solution was approximately 1:15. Several detergents are known to impact, sometimes severely, on the ELISA immunoassay and all assessment of detergent solubilization was by Western blotting. Western blotting has the capacity to report the protein size and the presence of any degradation products, which appear as additional bands at lower molecular masses. Western blotting of the solubilized proteins (Fig. 3a) shows a very faint band at the expected molecular mass of the HER-2[neu] receptor (approximately 185 kDa) for the control lysate (i.e. without detergent) and for the two samples treated with the non-ionic detergents decyl-maltoside and octyl-glucoside which indicates that both of these detergents are not effective for solubilization of the protein. This conclusion is similar to the finding of White et al. [23] for octyl-glucoside where more than one hundred yeast species that produce membrane proteins were tested for membrane protein solubility in different detergents. Fig. 3a shows a faint band for treatment with Hecameg, Nonidet P40 and Digitonin indicating a partial solubilization of the membrane protein with these detergents. The most intensive bands were observed for

65

A. Chamas et al. / Protein Expression and Purification 105 (2015) 61–70

d25SrDNA-2

d25SrDNA-1

His-tag

YRC102-6H-ERBB2 ALEU2 pro.

TEF1 pro.

ATRP1m

PHO5 ter.

ERBB2

d25SrDNA-2

d25SrDNA-1

YRC102 ALEU2 pro.

TEF1 PHO5 pro. ter.

ATRP1m

Fig. 1. Physical map of the two YRCs used in this work. Cassettes contain the selection marker ATRP1m fused to the ALEU2 promoter, the expression module TEF1 promoter – ERBB2 gene –PHO5 terminator and the two 25S-rDNA sequences for integration in yeast genome. Position of the His-tag is also indicated for YRC102-6H-ERBB2.

(a)

kDa

C

1

2

3

4

5

6

7

8

9

10 11 12 13 14 15 16 HER-2[neu]

170 130 100 -

(b)

kDa

C

1

2

3

4

5

6

7

8

170 130 -

9

10 11 12 13 14 15 16 HER-2[neu]

100 70 55 40 Fig. 2. Screening for recombinant HER-2[neu] receptor in A. adeninivorans by Western-blotting (a) and Coomassie staining (b) (C) negative control A. adeninivorans G1212/ YRC102. All numbers above the lanes indicate a single transformant of A. adeninivorans G1212/YRC102-6H-ERBB2.

(a) kDa

1

2

3

4

5

6

7

8

9 HER-2[neu]

170 130 100 -

(b) kDa

170 -

1

2

3

4

5

6

7

8

9

HER-2[neu]

Fig. 3. Effect of different detergents on protein solubilization. Western blotting of supernatant (a) and resuspended pellets (b) from A. adeninivorans G1212/YRC1026H-ERBB2-10 in the following solutions: (1) solution without detergent, (2) solution with octyl-glucoside, (3) solution with CHAPS, (4) solution with Nonidet P40, (5) solution with Hecameg, (6) solution with decyl-maltoside, (7) solution with LDAO, (8) solution with Triton X-100, (9) solution with digitonin.

the non-ionic detergent Triton X-100 and for the two zwitterionic detergents LDAO and CHAPS. It is probable that the band occurring at 100 kDa in all lanes may be due to degradation of the receptor. This may mean that low intensity of this band in the LDAO treatment is a sign of a protective effect of this detergent. However the visible distortion of the 185 kDa band will be problematic for future Western blot analysis. The opposite hypothesis could be inferred from observation of the results of the Triton X-100 treatment due to the appearance of an intense 100 kDa band. CHAPS shows a strong and clear band corresponding to the HER-2[neu] receptor and less degradation than Triton X-100 which seems to be a good compromise. These findings are supported by Western blotting of resuspended pellets (Fig. 3b) where a very faint band for the treatment with LDAO is present, meaning that a large amount of the receptor is in the solubilized fraction and not in membrane fraction. This contrasts with the large band observed for the control. Although the result is quite clear for LDAO, the poor quality of the Western blotting due to the nature of the sample make further interpretation relative to band intensity impossible. Proteins from resuspended pellets generally migrate with difficulty during electrophoresis and Western blotting often shows smearing bands. However these results indicate that LDAO and CHAPS, especially the latter, achieve the best solubilization of the full-length recombinant HER-2[neu] produced in yeast. CHAPS was thus used for the rest of the experimentation.

66

A. Chamas et al. / Protein Expression and Purification 105 (2015) 61–70

Production of recombinant HER2 [neu] To increase the yield of protein production and to have better control over the cultivation parameters, the organism was cultivated in batch mode in a bioreactor. Culture pH was maintained at 6.0 with HCl solution. To avoid a limiting effect of oxygen for the yeast growth, the influent air and the stirrer speed were automatically controlled to maintain a concentration of dissolved oxygen in the medium of 40% of saturation. Because the high density of yeast at the end of the exponential growth phase required more oxygen than was available from the atmosphere, pure compressed oxygen was used during the final hours of the experiment. To monitor the cultivation phases and determine the optimal period for HER-2[neu] production, samples were taken at regular intervals and the glucose content of the medium and the dcw of yeast were measured. Results of these measurements can be seen on Fig. 4a. After a lag phase of approximately 8 h characterized by low glucose consumption and a limited increase in culture dcw (1), the cells then enter typical exponential growth (2). After about 22 h almost all glucose was consumed and the culture dcw then decreased slowly corresponding to the stationary phase and the beginning of the death phase (3). A specific growth rate of

Fig. 4. Determination of A. adeninivorans G1212/YRC102-6H-ERBB2-10 cultivation parameters. (a) Evolution of dry weight/volume culture (black dots) and glucose concentration of the medium (white dots) during A. adeninivorans G1212/YRC1026H-ERBB2-10 growth. Dashed vertical lines show separation between lag phase (1), exponential phase (2) and stationary/death phase (3). (b) Logarithmic value of the culture dcw as a function of time during the exponential growth phase. The fitted curve was obtained by linear regression using SigmaPlot (parameters on the diagram).

0.0558 ± 0.0013 h1 was calculated by plotting the logarithm of the culture dcw during the exponential growth phase, (Fig. 4b). Protein production (Fig. 5a) started at around 6 h and then decreased after 25 h of cultivation, which correlates with the dcw measurement. It is important to determine the time at which the production of HER-2[neu] receptor starts. For this, a similar quantity of total proteins sampled over time was loaded on a SDS PA gel and the resulting membrane was stained for Western blotting as given in the Material and methods. As seen in Fig. 5b, receptor production was only detected after 12 h cultivation although the production other proteins had started to significantly increase after 6 h. One explanation could be that A. adeninivorans G1212/YRC102-6H-ERBB2 will, in the early stages of growth, focus on the production of proteins necessary to survive and divide and the production of the recombinant protein, which is not necessary for the cell, will start later. Another explanation is that even if the recombinant protein is produced, it will be degraded to make amino acids available for essential processes. After 16 h cultivation, several bands of low molecular mass appear, indicating either degradation products of the receptor or the production of a truncated version of the protein. 13 h was thus selected as the standard cultivation time because the band corresponding to HER-2[neu] receptor is at its high intensity and there are no visible low molecular mass products. Purification of the HER-2[neu] receptor was performed using three different strategies. Anion exchange chromatography was performed using diethylaminoethyl cellulose (DEAE) as a weak anion exchanger using a NaCl gradient concentration for elution but the method resulted in total degradation of the protein in all elution fractions (data not shown) probably reflecting the sensitivity of the recombinant HER-2[neu] receptor to high salt concentrations. CHT™ Ceramic Hydroxyapatite was also used for purification but without success even though including CHAPS in the protein lysate is known to be compatible with this technology. Sufficient separation effect of the protein was not observed and the method led solely to a dilution of the target protein (data not shown). Affinity purification using His-tag polypeptide provided the only efficient method. During this work, three different resin chemistries (iminodiacetic acid (IDA), nitrilotriacetic acid (NTA) and tris-carboxymethyl ethylene diamine (TED)) were trialled with TED was showing the best compromise between high intensity of the band corresponding to the HER-2[neu] receptor in the elution fraction and the presence of other stained bands in Coomassie staining (data not shown). Additionally, the use of cobalt ions as chelating agents (TALON purification) did not improve the purification efficiency. Fig. 6 shows a SDS–PA gel of the elution fractions after total protein staining (a) and Western-blotting (b). A unique band corresponding to the HER-2[neu] receptor with relatively high intensity in the Western-blot indicates purification without significant degradation. The total protein staining shows also a band at 180 kDa together with other faint bands. The fact that the band corresponding to the HER-2[neu] receptor is present and represents 15% of the total proteins indicates that the purification was successful. The final yield of purified recombinant HER-2[neu] protein per culture, calculated from the intensity of the bands, was determined to be 36 lg per liter of culture. As seen for a large number of membrane proteins produced by yeast expression systems, the low expression level of the receptor did not result in a high yield of recombinant protein in the elution fraction but this quantity was sufficient for the following experiments. Immunodetection of HER2 [neu] using ELISA assay As previously stated, ELISA was the method preferred to establish detection of the total recombinant receptor. The robustness, ease of use and specificity of the method ensure accurate and rapid

A. Chamas et al. / Protein Expression and Purification 105 (2015) 61–70

67

Fig. 5. Determination of optimal cultivation time for HER-2[neu] production. (a) Evolution of dcw (black dots) and total protein content (white dots) as a function of cultivation time for A. adeninivorans G1212/YRC102-6H-ERBB2-10. (b) Western blotting of the bioreactor samples for HER-2[neu] receptor detection. Numbers above the wells indicate cultivation time in hours.

kDa

1

2

3

4

1

2

3

4

HER-2[neu]

170 130 100 -

a

b

Fig. 6. Polyhistine affinity purification of HER-2[neu] receptor. Total protein staining (a) and Western blot analysis (b) of A. adeninivorans G1212/YRC102 raw extract (1), G1212/YRC102 elution fraction (2), G1212/YRC102-6H-ERBB2-10 raw extract (3) and G1212/YRC102-6H-ERBB2-10 elution fraction (4). For raw extract fractions, 15 lg proteins were loaded on the gel and for elution fraction, 1.6 lg proteins were loaded on the gel.

determination of proteins, even at low levels. Although ELISA is known to tolerate complex environments such as serum, milk and plasma, one of the major issues of this test is the purity of the sample. Cross-reactivity, poor antibody specificity and antigen masking of the analyte protein can lead to high noise levels or lack of binding requiring optimization of the ELISA assay by using different primary and secondary antibodies at different dilutions, by screening blocking solutions at different concentrations and by screening different coating buffers (data not shown). To perform the test, different protein concentrations of purified recombinant HER-2 [neu] receptor were immobilized in a 96 well plate and then incubated with an antibody directed against the intracytoplasmic part of this membrane protein. Antibody concentrations and incubation times were optimized (data not shown) to give the highest signal possible. To be certain that the signal obtained corresponded to the recombinant HER-2[neu] receptor, a control of an elution fraction from the control strain, A.

Fig. 7. HER-2[neu] detection with ELISA. Absorbance at 450 nm as a function of elution fraction protein concentration. Black dots represents elution fraction of A. adeninivorans G1212/YRC102-6H-ERBB2-10 and white dots represent elution fraction of G1212/YRC102. All experiments were performed in triplicate and error bars represent the standard deviation. The fitted curve was obtained by nonlinear regression in SigmaPlot (parameters on the diagram).

adeninivorans G1212/YRC102, was performed. CHAPS was removed after the purification procedure because it caused a dramatic decrease of the absorbance signal in the ELISA test (data not shown). The control elution fraction shows a constant signal of less than 0.06 units and an increase in protein concentration had no effect on the resulting signal (Fig. 7). On the other hand, an increasing absorbance signal was seen when the concentration of coated HER-2[neu] protein was increased to at least twice that of the control fraction. This indicates that the antibody can specifically bind to the immobilised receptor and can then be recognized by the sec-

68

A. Chamas et al. / Protein Expression and Purification 105 (2015) 61–70

ond antibody. Saturation of the signal for the receptor occurs above 10 lg ml1 corresponding to a maximal absorbance signal of around 0.13 units. These relatively low intensities were due to the high dilution of antibodies used but were however highly reproducible. Lower dilutions led to higher signals but also higher background signal. These results demonstrate that this ELISA test can specifically detect the recombinant total HER-2[neu] receptor. The comparison between our assay and other ELISA tests available is difficult because other studies using ELISA kits are mainly detecting the soluble, short version of the HER-2[neu] receptor. For example two of those ELISA tests have limits of quantification of 0.84 ng ml1 [35] and 0.123 ng ml1 [13]. There are commercially available kits for the detection of the complete HER-2[neu] receptor but the values presented to date are only from the manufacturers and have not been published in peer reviewed articles. For example, the PathScanÒ Total HER2/ErbB2 Sandwich ELISA Kit from Cell Signaling TechnologyÒ does not give any value related to the limit of quantification but presents a curve showing a relationship between absorbance and protein concentration in a range from approximately 10–400 lg ml1. Another ELISA kit for total HER-2[neu] detection, the Her2 (Total) Human ELISA kit from Life TechnologiesÒ, gives a sensitivity of 0.2 ng ml1 but this parameter was calculated by adding two standard deviations to the mean O.D. of the zero. In our study, consistent with the accepted standards [36], we calculated the limit of quantification to be the mean value plus 10 times the standard deviation of the blank. Then, we obtained a limit of quantification of 7.8 ng ml1. Currently all the commercially available assays use the Sandwich approach, which is known to give lower limits of quantification than the direct coating approach that was used in this work. Thus, although our system is sufficient to demonstrate detection of the recombinant protein by ELISA, switching to the Sandwich method could significantly lower the limit of quantification. Detection with Surface Plasmon Resonance The SPR platform chosen for this study has been used to detect DNA-DNA interactions for the detection plant pathogens [34] and this process was adapted to produce a protocol for antibody-antigen binding experiments. Several buffer systems, temperatures and pH’s were trialled to establish the optimal conditions (see Material and methods). To ensure the specificity of the HER2[neu] receptor-antibody interaction, each chip was divided into three parts to give three immobilization surfaces. This configuration allowed the SPR device to monitor a change in the plasmon surface resonance angle on 117 positions, meaning that at least 30 positions could be analyzed for each part of the chip, ensuring enough replicates for statistical analyses. In all experiments, two parts of the chip were functionalized with two different dilutions of the HER2/ErbB2 monoclonal antibody (ErbB2mono-ab) and the central part of the chip was used as a control surface (Fig. 8b). This surface underwent the same preparation and blocking as described in the Material and methods but was not functionalized with antibody. In a first experiment an elution fraction of A. adeninivorans G1212/YRC102-6H-ERBB2-10 was allowed to flow over the chip and the evolution of the Surface Plasmon Resonance angle over time for one position in each of the three surfaces of chip was recorded (Fig. 8a). The y-axis (SPR signal) is in arbitrary units termed pixels. No change in SPR signal was detected for the control surface, indicating a very low level of non-specific binding of other proteins which are in the elution fraction applied to the blocked non-functionalized gold surface. On the other hand, a clear rise of the SPR signal can be seen in the positions where the antibody was immobilized. Additionally, a higher concentration of this antibody gives a higher final signal, indicating that more protein was bound to this surface.

Fig. 8. Evolution of the SPR signal for differently coated surfaces. (a) SPR signal of A. adeninivorans G1212/YRC102-6H-ERBB2-10 as function of experiment time. The different curves correspond to the different treatments on the three parts on the chip (b). Arrows on the sensogram mark the injection of the sample and the final injection of running buffer.

To test the selectivity of the immunoassay and to see if the signal is dependent on the HER-2[neu] concentration, a second experiment was performed in which different elution fraction concentrations including eluate from A. adeninivorans G1212/ YRC102 as a negative control were tested. The results of this experiment can be seen in Fig. 9 and are presented as a difference between SPR signal after the final injection of running buffer and the SPR signal before the injection of the receptor. In an effort to simplify the results, the signals presented here are those corresponding only to the control surface and to the functionalized surface with a 1:10 dilution of ErbB2mono-ab. For both elution fractions (A. adeninivorans G1212/YRC102 and G1212/YRC1026H-ERBB2-10), the protocol and handling was the same and a new chip was used for each concentration. To remove chip-to-chip variation, the control surface signal is also given for each concentration of the elution fraction. No significant increase in the SPR signal can be detected when A. adeninivorans G1212/YRC102 elution fraction is the analyte (Fig. 9a). Only at 50 lg ml1 does the signal of the functionalized surface show a higher value than the control surface but the difference is very small and does not exceed 1 pixel. However, at 5 lg ml1, the binding of A. adeninivorans G1212/YRC102-6H-ERBB2-10 elution fraction to the immobilized surface is significantly higher than the control surface signal (Fig. 9b). The negative values that can be seen are caused by a chip-dependent loss of blocking during the sample injection, leading to a smaller SPR signal at the end of the experiment because the analyte could not attach to the surface. To remove all chip-dependent effects, the SPR signals for different concentrations without the signals of the control surface were calculated to give ‘corrected SPR signals’ (Fig. 9c). They show a clear relationship between the SPR signal and the protein concentration only in the case of the A. adeninivorans G1212/YRC102-6H-ERBB2-10. This is confirmed by the linear shape of the fitted curve, but a higher concentration of elution fraction would be needed to completely describe the nature of this relationship. However these results confirm that the HER-2[neu] receptor can be specifically detected in the elution

A. Chamas et al. / Protein Expression and Purification 105 (2015) 61–70

69

Fig. 9. HER-2[neu] detection with SPR. SPR signal of antibody coated and control surface for 6 different elution fraction concentrations of A. adeninivorans G1212/YRC102 (a) and G1212/YRC102-6H-ERBB2-10 (b). (c) Describes the corrected SPR signal for A. adeninivorans G1212/YRC102 (white dots) and G1212/YRC102-6H-ERBB2-10 (black dots). For each concentration, 10 measurements were performed and the errors bars represent the standard deviation. The fitted curve was obtained by linear regression in SigmaPlot (parameters on the diagram).

fraction of G1212/YRC102-6H-ERBB2-10. Although the SPR limit of quantification of 76 ng ml1 is significantly higher than the ELISA values obtained, a reduction of LoQ could be achieved using a secondary probe. Because the concentration of HER-2[neu] receptor on the surface of breast cell in normal state and in cancer state is also not precisely known, the clinical relevance of these limits of quantification is currently not known. Trialling these immunosensors with proteins extracted from breast tissue will be the next phase of our research and will give more information on the detection range required for reliable diagnosis.

Conclusions To our knowledge, this work is the first to report the production of the complete recombinant HER-2[neu] receptor. HER-2[neu] is important in human metabolism and is a potential target for several cancer drugs. Its production was successfully detected by two independent quantitative techniques (ELISA and SPR) which make possible the use of recombinant total HER-2[neu] receptor as a standard for the determination of naturally occurring HER2[neu] in human tissue and for the discovery of effective receptor inhibitors. Further work to assess the stability of the recombinant protein and improve both the purification of the protein and the detection method is in progress. It is also planned to test the activity of the tyrosine kinase, which is part of the full-length receptor to determine whether or not the yeast recombinant system is able to produce a fully functional HER-2 receptor.

Acknowledgments The authors want to thank Ruth Franz for high quality practical work, Anja Schröter for the support in SPR experiments and Felix Bischoff for the advice on bioreactor cultivation. The research work was supported by grant from the BMWi (Project number KF2715702MD0).

References [1] F.F. Barros, D.G. Powe, I.O. Ellis, A.R. Green, Understanding the HER family in breast cancer: interaction with ligands, dimerization and treatments, Histopathology 56 (2010) 560–572. [2] D.J. Slamon, G.M. Clark, S.G. Wong, W.J. Levin, A. Ullrich, W.L. McGuire, Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene, Science 235 (1987) 177–182. [3] R.M. Hudziak, J. Schlessinger, A. Ullrich, Increased expression of the putative growth factor receptor p185HER2 causes transformation and tumorigenesis of NIH 3T3 cells, PNAS 84 (1987) 7159–7163. [4] D. Yu, M.C. Hung, Overexpression of ErbB2 in cancer and ErbB2-targeting strategies, Oncogene 19 (2000) 6115–6121. [5] E.A. Rakha, J.S. Reis-Filho, F. Baehner, D.J. Dabbs, T. Decker, V. Eusebi, S.B. Fox, S. Ichihara, J. Jacquemier, S.R. Lakhani, J. Palacios, A.L. Richardson, S.J. Schnitt, F.C. Schmitt, P.H. Tan, G.M. Tse, S. Badve, I.O. Ellis, Breast cancer prognostic classification in the molecular era: the role of histological grade, Breast Cancer Res. 12 (2010) 207. [6] M.A. Molina, J. Codony-Servat, J. Albanell, F. Rojo, J. Arribas, J. Baselga, Trastuzumab (herceptin), a humanized anti-Her2 receptor monoclonal antibody, inhibits basal and activated Her2 ectodomain cleavage in breast cancer cells, Cancer Res. 61 (2001) 4744–4749. [7] A. Thomson, Lapatinib: the evidence for its therapeutic value in metastatic breast cancer, Core Evid. 1 (2005) 77–87.

70

A. Chamas et al. / Protein Expression and Purification 105 (2015) 61–70

[8] A. Badache, A. Goncalves, The ErbB2 signaling network as a target for breast cancer therapy, J. Mammary Gland Biol. Neoplasia 11 (2006) 13–25. [9] R.Y. Tsang, R.S. Finn, Beyond trastuzumab: novel therapeutic strategies in HER2-positive metastatic breast cancer, Br. J. Cancer 106 (2012) 6–13. [10] A.C. Wolff, M.E. Hammond, D.G. Hicks, M. Dowsett, L.M. McShane, K.H. Allison, D.C. Allred, J.M. Bartlett, M. Bilous, P. Fitzgibbons, W. Hanna, R.B. Jenkins, P.B. Mangu, S. Paik, E.A. Perez, M.F. Press, P.A. Spears, G.H. Vance, G. Viale, D.F. Hayes, Recommendations for human epidermal growth factor receptor 2 testing in breast cancer: American Society of Clinical Oncology/College of American Pathologists Clinical Practice Guideline Update, J. Clin. Oncol. 31 (2013) 3997–4013. [11] P.C. Roche, V.J. Suman, R.B. Jenkins, N.E. Davidson, S. Martino, P.A. Kaufman, F.K. Addo, B. Murphy, J.N. Ingle, E.A. Perez, Concordance between local and central laboratory HER2 testing in the breast intergroup trial N9831, J. Natl Cancer Inst. 94 (2002) 855–857. [12] H. Choritz, G. Busche, H. Kreipe, H.E.R.M. Study Group, Quality assessment of HER2 testing by monitoring of positivity rates, Virchows Arch. 459 (2011) 283–289. [13] L. Loo, J.A. Capobianco, W. Wu, X. Gao, W.Y. Shih, W.H. Shih, K. Pourrezaei, M.K. Robinson, G.P. Adams, Highly sensitive detection of HER2 extracellular domain in the serum of breast cancer patients by piezoelectric microcantilevers, Anal. Chem. 83 (2011) 3392–3397. [14] S.P. Mucelli, M. Zamuner, M. Tormen, G. Stanta, P. Ugo, Nanoelectrode ensembles as recognition platform for electrochemical immunosensors, Biosens. Bioelectron. 23 (2008) 1900–1903. [15] V.S. Martin, B.A. Sullivan, K. Walker, H. Hawk, B.P. Sullivan, L.J. Noe, Surface plasmon resonance investigations of human epidermal growth factor receptor 2, Appl. Spectrosc. 60 (2006) 994–1003. [16] F.J. Esteva, C.D. Cheli, H. Fritsche, M. Fornier, D. Slamon, R.P. Thiel, D. Luftner, F. Ghani, Clinical utility of serum HER2/neu in monitoring and prediction of progression-free survival in metastatic breast cancer patients treated with trastuzumab-based therapies, Breast Cancer Res. 7 (2005) R436–R443. [17] S.Y. Kong, B.H. Nam, K.S. Lee, Y. Kwon, E.S. Lee, M.W. Seong, H. Lee do, J. Ro, Predicting tissue HER2 status using serum HER2 levels in patients with metastatic breast cancer, Clin. Chem. 52 (2006) 1510–1515. [18] M.A. O’Malley, T. Lazarova, Z.T. Britton, A.S. Robinson, High-level expression in Saccharomyces cerevisiae enables isolation and spectroscopic characterization of functional human adenosine A2a receptor, J. Struct. Biol. 159 (2007) 166– 178. [19] D.A. Jankowska, K. Faulwasser, A. Trautwein-Schult, A. Cordes, P. Hoferichter, C. Klein, R. Bode, K. Baronian, G. Kunze, Arxula adeninivorans recombinant adenine deaminase and its application in the production of food with low purine content, J. Appl. Microbiol. 115 (2013) 1134–1146. [20] D.A. Jankowska, A. Trautwein-Schult, A. Cordes, P. Hoferichter, C. Klein, R. Bode, K. Baronian, G. Kunze, Arxula adeninivorans xanthine oxidoreductase and its application in the production of food with low purine content, J. Appl. Microbiol. 115 (2013) 796–807. [21] A. Trautwein-Schult, D. Jankowska, A. Cordes, P. Hoferichter, C. Klein, A. Matros, H.P. Mock, K. Baronian, R. Bode, G. Kunze, Arxula adeninivorans recombinant urate oxidase and its application in the production of food with low uric acid content, J. Mol. Microbiol. Biotechnol. 23 (2013) 418–430.

[22] E. Boer, G. Steinborn, A. Matros, H.P. Mock, G. Gellissen, G. Kunze, Production of interleukin-6 in Arxula adeninivorans, Hansenula polymorpha and Saccharomyces cerevisiae by applying the wide-range yeast vector (CoMed) system to simultaneous comparative assessment, FEMS Yeast Res. 7 (2007) 1181–1187. [23] M.A. White, K.M. Clark, E.J. Grayhack, M.E. Dumont, Characteristics affecting expression and solubilization of yeast membrane proteins, J. Mol. Biol. 365 (2007) 621–636. [24] T. Akiyama, C. Sudo, H. Ogawara, K. Toyoshima, T. Yamamoto, The product of the human c-erbB-2 gene: a 185-kilodalton glycoprotein with tyrosine kinase activity, Science 232 (1986) 1644–1646. [25] G. Steinborn, G. Gellissen, G. Kunze, A novel vector element providing multicopy vector integration in Arxula adeninivorans, FEMS Yeast Res. 7 (2007) 1197–1205. [26] A. Tanaka, N. Ohishi, S. Fukui, Formation of vitamins and their functions in hydrocarbon fermentation. IV. Production of vitamin B6 by Candida albicans in a hydrocarbon medium, J. Ferment. Technol. (1967) 617–623. [27] M. Rose, F. Winston, P. Heiter, Methods in yeast genetics: a laboratory manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1990. [28] E. Boer, M. Piontek, G. Kunze, Xplor 2 – an optimized transformation/ expression system for recombinant protein production in the yeast Arxula adeninivorans, Appl. Microbiol. Biotechnol. 84 (2009) 583–594. [29] J. Klabunde, G. Kunze, G. Gellissen, C.P. Hollenberg, Integration of heterologous genes in several yeast species using vectors containing a Hansenula polymorpha-derived rDNA-targeting element, FEMS Yeast Res. 4 (2003) 185– 193. [30] T. Wartmann, E. Boer, A.H. Pico, H. Sieber, O. Bartelsen, G. Gellissen, G. Kunze, High-level production and secretion of recombinant proteins by the dimorphic yeast Arxula adeninivorans, FEMS Yeast Res. 2 (2002) 363–369. [31] E. Boer, R. Bode, H.P. Mock, M. Piontek, G. Kunze, Atan1p-an extracellular tannase from the dimorphic yeast Arxula adeninivorans: molecular cloning of the ATAN1 gene and characterization of the recombinant enzyme, Yeast 26 (2009) 323–337. [32] M. Alvaro-Benito, M. Fernandez-Lobato, K. Baronian, G. Kunze, Assessment of Schwanniomyces occidentalis as a host for protein production using the widerange Xplor2 expression platform, Appl. Microbiol. Biotechnol. 97 (2013) 4443–4456. [33] R. Navarrete, R. Serrano, Solubilization of yeast plasma membranes and mitochondria by different types of non-denaturing detergents, Biochim. Biophys. Acta 728 (1983) 403–408. [34] K. Florschutz, A. Schroter, S. Schmieder, W. Chen, P. Schweizer, F. Sonntag, N. Danz, K. Baronian, G. Kunze, ‘Phytochip’: on-chip detection of phytopathogenic RNA viruses by a new surface plasmon resonance platform, J. Virol. Methods 189 (2013) 80–86. [35] A.S. Gauchez, N. Ravanel, D. Villemain, F.X. Brand, D. Pasquier, R. Payan, M. Mousseau, Evaluation of a manual ELISA kit for determination of HER2/neu in serum of breast cancer patients, Anticancer Res. 28 (2008) 3067–3073. [36] L.A. Currie, Nomenclature in evaluation of analytical methods including detection and quantification capabilities (Iupac Recommendations 1995), Pure Appl. Chem. 67 (1995) 1699–1723.