PROTEIN
EXPRESSION
3, 295-300 (19%)
AND PURIFICATION
Purification of an Mole Alkaloid Biosynthetic Enzyme, Strictosidine Synthase, from a Recombinant Strain of Escherichia co/i Charles
A. Roessner,
Center for Biological
Received
February
NMR,
20,1992,
Rama
Devagupta,
Chemistry
and in revised
Department,
form
May
Mashooda Texas A&M
Strictosidine, the precursor of over 1200 plant indole alkaloids including the antitumor agents vinblastine and vincristine, is formed by the condensation of tryptamine with secologanin (Fig. 1). The reaction can occur chemically at low pH, leading to a mixture of strictosidine and its epimer, vincoside (1,2). Strictosidine synthase, the enzyme that mediates the reaction leading only to the 3c~(S) configuration of strictosidine (2), is normally isolated from the plants Catharanthus roseus (periwinkle) or Rauwolfia serpentina or from cell cultures of these plants (3,4). The gene for strictosidine synthase from R. serpentina has recently been reported to have been expressed in active form in Escherichia coli (5).
As an aid to our efforts to study the enzymatic mechanism of strictosidine synthase by NMR, which requires 20-40 mg of pure enzyme for each experiment, and to produce large quantities of strictosidine for use as substrate for the next enzyme in the pathway (strictosidine glucosidase), we have cloned and determined the nu-
1046.5928192
Copyright All rights
of Chemistry,
Quid-i-Azam
$5.00
0 1992 by Academic Press, Inc. of reproduction in any form reserved.
University,
Howard
University,
J. Williams,
College Station,
and A. Ian Scott
Texas 77843-3255
11,1992
The gene for the indole alkaloid biosynthetic enzyme, strictosidine synthase, of Catharanthus roaeus has been cloned into an inducible Escherichia coli expression vector using an expression cassette polymerase chain reaction technique. Induction of the gene resulted in overexpression of the enzyme which accumulated mainly as insoluble inclusion bodies. Denaturation and refolding of the insoluble protein resulted in the ability to purify up to 6 mg of active enzyme from a single liter of cell culture. The recombinant enzyme has good activ0 1992 Academic Press, Inc. ity (-30 nkatlmg).
’ Department Pakistan.
Hasan,l
Islamabad,
cleotide sequence of the homologous gene from C. roseu.s (6). This gene has been transformed into tobacco plants, where it has been shown to express active strictosidine synthase (7). In this paper we report the overexpression of active C. roseus strictosidine synthase in E. coli using an expression cassette polymerase chain reaction technique (8,9). Overexpression has led to the capability to purify the enzyme in quantities exceeding those previously possible. MATERIALS
AND
METHODS
Chemicals and reagents. [side chain-2-14C]Tryptamine bisuccinate (55.9 mCi/mM) was purchased from American Radiolabeled Chemicals, Inc. Secologanin was purchased from Aldrich and tryptamine hydrochloride was purchased from Sigma. TLC2 was performed with Analtech silica gel HLF plates. Other chemicals were of the highest purity obtainable from commercial sources. Bacterial strains and plasmids. E. coli strain XASO(F’lr&‘) (8) and plasmid pHNl+ (8,9) (containing the tat promoter and operator, a multiple cloning region, and the blu gene for P-lactamase) were generous gifts from Dr. Gregory Verdine (Harvard University). Molecular biology techniques. Molecular biology techniques were performed by standard procedures (10). The polymerase chain reaction was performed with a kit from Perkin-Elmer Cetus following the directions provided by the manufacturer. The reaction contained, in a final volume of 100 ~1, 10 ~1 of 10X reaction buffer, 200 PM of each dNTP, 40 pmol of each primer, 2.5 units of Taq polymerase, and 500 ng of DNA isolated
’ Abbreviations used: TLC, thin layer chromatography; protein liquid chromatography; SDS-PAGE, sodium polyacrylamide gel electrophoresis.
dodecyl
FPLC, fast sulfate-
295
296
ROESSNER
ET
AL.
12345 WHz k
CH,O#
&O Secologanin
Tryptamine
Strictosidine synthase
Sa-(S)-Strictosidine FIG. 1. strictosidine.
The
condensation
of tryptamine
and
secologanin
to form
from bacteriophage X gtll bearing the strictosidine synthase gene (6). The reaction steps consisted of 2 min at 94”C, 2 min at 42”C, and 4 min at 72°C and were carried out for 30 cycles. Construction of a strictosidine synthase expression vector. A plasmid, pRD1, for the expression of strictosidine synthase was constructed using an expression cassette polymer chain reaction technique described by McFerrin et al. (8,9). In this technique, the per primers are designed to provide cloning sites and optimal translation signals for the expression of foreign proteins in E. coli. Thus, the sequence of the 5’ primer was GGTACCCGGGGATCCAGGAGGAATTTAAAATGTCACCAATTTTGAAAAAGATTTTTATTGAA and provided a
E B Pfac,
y
trictosidine
FIG. 2. Map of pRD1. Tut, tat promoter; RBS, ribosome binding site. The restriction sites shown were predicted from the DNA sequence and confirmed to be present by restriction analysis. Restriction enzymes: B, BarnHI; E, EcoRI; H, HindIII; N, NciI; S, SalI.
FIG. thase tures
3. SDS-PAGE analysis of a time course of strictosidine synproduction by XASO(pRD1). The cells were grown in 50-ml culto OD 550 = 0.5 and then induced by the addition of IPTG to 0.1 mM. Aliquots (200 ~1) of the culture were removed at various times after induction and the cells pelleted in a microfuge. The cell pellets were resuspended in 40 ~1 of SDS sample buffer, placed in a boiling water bath for 5 min, and loaded onto a 12% polyacrylamide gel. Lanes l-3,2,4, and 6 h after induction, respectively, lane 4, the same as lane 3 (6 h) except the culture was not induced, lane 5, molecular weight markers (bovine albumin, 66 kDa; ovalbumin, 45 kDa; glyceraldehyde-3-phosphate dehydrogenase, 36 kDa; carbonic anhydrase, 29 kDa; trypsinogen, 24 kDa; trypsin inhibitor, 20 kDa; and a-lactalbumin, 14 kDa).
5’BarnHI restriction site (GGATCC), a strong ribosome binding site (AGGAGG), an optimal translational spacer element (AATTTAAA), a translational initiation signal (ATG), and the codons for the first 10 amino acids of the mature strictosidine synthase. The sequence of the 3’ primer was CTGCAGGTCGACTTAATTAATGACTAGCTGAGAAACATAAGAATT and provided the codons for the last 10 amino acids of the enzyme, a translational stop signal (TAA), and a 3’ Sal1 (GTCGAC) restriction site. The per product was digested with BamHI and Sal1 and ligated into BamHIand SalI-digested pHNl+. The ligation mixture was transformed into XA90 and colonies containing the plasmid bearing the proper insert were tested for strictosidine synthase activity. Strictosidine synthase activity assay. We have observed that strictosidine, after chromatography on silica gel TLC plates, displays a bright yellow fluorescence when irradiated with ultraviolet light at 302 nm which is not displayed by tryptamine (faint green fluorescence) or secologanin (nonfluorescent). A similar fluorescence of other indole alkaloids has been reported (11). This observation was incorporated into a semiquantiative assay to detect strictosidine synthase activity in cells,
PURIFICATION
OF
RECOMBINANT
STRICTOSIDINE
SYNTHASE
297
FIG. 5.
SDS-PAGE analysis of the purification of insoluble strictosidine synthase. Lane 1, cell lysate (5 rg protein); lane 2, insoluble pellet; lane 3, washed pellet; lane 4, pellet solubilized in 8 M urea, dialyzed, and centrifuged (5 gg protein); lane 5, FPLC-purified enzyme (10 pg protein); lane 6, molecular weight markers (see legend to Fig. 2).
FIG. 4.
TLC analysis of the products of strictosidine synthase assays. Lane 1, tryptamine + secologanin + XASO(pRD1); lane 2, tryptamine + secologanin + XASO(pHNl+); lane 3, tryptamine + secologanin; lane 4, secologanin alone; lane 5, tryptamine alone. The cells from 50-ml overnight cultures were collected by centrifugation and resuspended in buffer. The reactions and TLC analysis were performed as described under Materials and Methods. The circles indicate fluorescence observed at 254 nm corresponding to tryptamine (top) and secologanin (bottom). The arrow indicates the R, of strictosidine.
cell lysates, and column fractions. Strictosidine synthase was assayed by observing the formation of strictosidine in incubations containing 150 pg of tryptamine, 300 pg of secologanin, and enzyme in a total volume of 150 ~1 of potassium phosphate buffer, pH 6.5. After incubation at 37°C for 1 h, the reaction mixtures were lyophilized and extracted with 50 ~1 methanol. The methanol extract was spotted on silica gel TLC plates which were developed in an acetone:methanol:diethylamine (7:2:1) solvent system. The plates were dried thoroughly and strictosidine formation was monitored by illumination of the dried plates at 302 nm on a uv transilluminator (Haake-Buchler UVT). The bright yellow fluorescent spot was observed only from incubations containing enzyme and had the same R, as authentic strictosidine. The fluorescent spot was purified by TLC and demonstrated to be strictosidine by mass spectrometry and ‘H NMR analysis of its tetraacetate-lactam derivative. A methanol extract of a preparative scale enzymatic reaction was also prepared and analyzed by HPLC and
NMR. The product with the same retention time and ‘H NMR spectrum as authentic strictosidine was isolated by HPLC. The vincoside epimer was not observed in the enzymatic reactions, whereas a product corresponding to vincoside was observed in samples that had been prepared by the chemical condensation of tryptamine and secologanin. These observations further confirm that the strictosidine seen in the fluorescence assay is the product of enzymatic coupling of tryptamine and secologanin.
FIG.
6. Autoradiogram of TLC-separated products of reactions containing “C-labeled tryptamine, secologanin, and varying amounts of purified enzyme. The reactions contained 0.5,1.0,2.0,4.0, or 8.0 pg of strictosidine synthase (lanes l-5, respectively) and were incubated for 10 min as described under Materials and Methods.
298
ROESSNER TABLE The
Stage
Purification
of purification
Volume
Cell lysate 8 M urea solution (after washes) Dialysate Note.
n.d.,
not
of Recombinant
(ml)
Strictosidine
Synthase
Concentration (w/ml)
ET
AL.
1 from
1.0 Liter Total
protein (ms)
of
E. coli Strain
XA90
Specific activity (nkat/mg)
Bearing
pRD1 Total
activity (nkat)
40
4.5
180
n.d.
n.d.
40 40
0.9 0.7
36 28
n.d. -30
n.d. -840
determined.
To determine specific activity, a series of dilutions of the enzyme was incubated for 10 min at 37°C with 1.25 mM secologanin, 0.25 InM tryptamine, and 0.2 PCi 14Clabeled tryptamine (0.025 mM) in 150 ~1 phosphate buffer. The samples were rapidly frozen in liquid nitrogen, lyophilized, and then chromatographed on TLC plates as described above. An autoradiogram of the TLC plate was then prepared to determine at what enzyme concentration 100% of the tryptamine had been converted to strictosidine. One nanokatal is the amount of enzyme required to synthesize 1 nmol of strictosidine in 1 s under the conditions described. Purification of strictosidine synthase. XASO(pRD1) cells were grown at 37°C in LB medium containing 50 pg/ml ampicillin to an OD,,, of 0.5 and then induced by the addition of IPTG to 0.1 mM. The cultures were grown for a further 2 h at 37°C and the cells collected by centrifugation. The ceil pellets were suspended in & vol of 0.1 M phosphate buffer, pH 8.0, containing 5.0 mM EDTA and 50 pg/ml lysozyme and incubated at room temperature for 30 min. The cells were then disrupted by sonication and the lysates centrifuged for 10 min at 10,000 rpm in a Sorvall SS-34 rotor. The pellet, containing most of the enzyme, was washed once with phosphate buffer and once with 0.1 M Tris-HCl buffer, pH 8.0, containing 3 M urea. The pellet was then suspended in 0.1 M Tris-HCl buffer, pH 8.0, containing 8 M urea and allowed to stand at room temperature for 15 h. The solution was centrifuged at 37,000 rpm in a Beckman Ti 45 rotor and dialyzed extensively against two changes of 100 vol each of 0.1 M Tris-HCl, pH 8.0. The dialysate was again centrifuged at 37,000 rpm in the Ti 45 rotor, the clear supernatant loaded onto a DEAE-Sephacel or a MonoQ lO/lO FPLC column equilibrated with 0.020 M phosphate buffer, pH 8.0, and the protein eluted with a O-O.5 M KC1 linear gradient. The active fractions were combined and concentrated by ultrafiltration with an Amicon concentrator fit with a PM10 membrane. Strictosidine synthase activity was also observed in the soluble fraction, but attempts to purify it proved tedious and resulted in poor yields. Other procedures. Protein concentrations were determined by the procedure of Bradford (12). SDS-
PAGE was performed by the procedure of Laemmli (13). Protein sequencing was performed with an Applied Biosystems 470A pulsed liquid protein sequencer. PCR primers were synthesized with an Applied Biosystems 391 PCR-MATE DNA synthesizer. FPLC was performed with a Waters 650 Advanced Protein Purification System using Pharmacia columns. RESULTS AND DISCUSSION Expression of strictosidine synthase in E. coli. Strictosidine synthase has been shown by ultrastructural immunolocalization to be associated with plant vacuoles (7). To effect transport across the endoplasmic reticulum and into the vacuole, it is normally synthesized with a signal peptide which is, presumably, removed by signal peptidase during transport. It is possible that the prokaryotic E. coli transport signal-processing system would not recognize a signal intended to direct the transport of an enzyme into a plant vacuole, and failure to remove the signal could result in decreased enzymic activity. With the expression cassette polymerase chain reaction technique, it is possible to construct expression vectors that will direct the expression of all or just portions of a protein (8). Therefore, we constructed our strictosidine synthase expression vector, pRD1 (Fig. 2), to contain E. coli transcriptional signals from plasmid pHNl+ and designed the expression cassette polymer chain reaction primers such that the protein expressed from the recombinant plasmid would contain a methionine residue immediately followed by the amino acids of the processed enzyme which were predicted from the DNA sequence (6). Determination of the nucleotide sequence of the strictosidine synthase gene in pRD1, isolated from cells from which the enzyme is purified as described below, revealed the expected sequence (6) with two variations: an A to T change at base 843 and a C to T change at base 977. These changes result in altering Ser to Arg and Ser to Phe, respectively. When induced with IPTG, E. coli strain XASO(pRD1) displayed a new protein band with an M, of about 34,000 on SDS-PAGE gels that was not seen in uninduced cells. A time course of the expression demonstrated that
PURIFICATION
OF
RECOMBINANT
collecting the cells 2 h after induction provided good expression of the new protein band (Fig. 3). After being grown in the presence of IPTG for 2 h, the whole cells displayed strictosidine synthase activity as was demonstrated by the appearance of strictosidine, as analyzed by TLC and NMR, in incubations containing the substrates and cells bearing pRD1 but not in incubations containing substrates and control cells bearing pHNl+ with no insert (Fig. 4). A cell-free extract prepared by sonication of the cells followed by centrifugation at 12,000g had an activity about four times higher than that of whole cells (not shown). This enzymatic activity was in the soluble fraction even though most of the protein associated with the induced band was found in the insoluble fraction (Fig. 5, lane 2), presumably in the form of inclusion bodies. However, only a very small portion of the protein was soluble as there was not enough to be seen by SDS-PAGE and attempts to purify it required up to eight different steps and resulted in less than 1 mg of 50% pure enzyme from 8 liters of cells. Solubilization, soluble protein
renaturation, and purification to form active strictosidine
of the insynthase.
Since most of the expressed enzyme was found to be in the insoluble fraction, in vitro denaturation and refolding of the inactive enzyme were performed to recover the enzyme in an active form. The insoluble pellets were washed with buffer and 3 M urea, solubilized in 8 M urea, and then dialyzed against 0.1 M Tris-HCI, pH 8.0 as described under Materials and Methods. The enzyme at this stage was >90% pure as judged by SDS-PAGE (Fig. 5, lane 4) and was active. When analyzed by the assay based on the conversion of 14C-labeled tryptamine to strictosidine described under Materials and Methods, the amount of labeled tryptamine consumed and of labeled strictosidine produced was proportional to the amount of enzyme added (Fig. 6), and the specific activity of the denatured and refolded enzyme was estimated to be about 30 nkat/mg (Fig. 6 and Table 1). This is a rough estimation of specific activity as it is determined under conditions of limiting substrate and by estimation of the relative intensity of spots on an autoradiogram. Attempts to further purify the enzyme by anionexchange chromatography, which could remove improperly folded enzyme, on either a DEAE-Sephacel column or a MonoQ 10110 FPLC column resulted in no increase in the purity (Fig. 4, lane 5) or in the specific activity but resulted in substantial loss of enzyme due to precipitation of the enzyme at the top of the column. Therefore, our normal purification scheme, which we have performed one or two times a month over the past 6 months, does not include an anion-exchange chromatography step. The enzyme can be stored at -2O’C for up to 3 months with little loss of activity. The ready availability of the active recombinant enzyme is highly advantageous for the synthesis of strictosidine, which can be
STRICTOSIDINE
299
SYNTHASE
used as substrate for the next enzyme in the pathway and for NMR studies of enzyme-substrate intermediates. We now have the capability to purify more enzyme activity from a single liter of a 2-h-induced culture of bacterial cells (about 2.5 g of cells) as was previously reported to be possible (4) starting with 1 kg of C. roseus cells, which requires a complex growth medium and usually 2 weeks to grow. The purification procedure is also greatly simplified, requiring only washing, denaturation, and refolding of the insoluble enzyme. Characterization of purified strictosidine synthase. The sequence of the first 10 amino acids of the
purified enzyme was found to be Met-Ser-Pro-IleLeu-Lys-Lys-Ile-Phe-Ile, corresponding exactly to the sequence predicted from the nucleotide sequence. The lV, of the protein usually appeared to be about 34,000 (Fig. 2), slightly less than the 36,074-Da molecular weight predicted from the nucleotide sequence of the gene. A similar M, for the enzyme has also been reported in two previous reports on the expression of strictosidine synthase in heterologous systems (5,7) and may be an inherent property of the enzyme or due to proteolytic processing. In each of these works the enzyme was reported to retain activity, but in neither case was it purified or sequenced nor was a specific activity reported. The enzyme isolated from C. roseus is glycosylated, a process which E. coli is unable to perform, but it has been reported that chemical removal of the sugar moiety has no effect on the activity of the native enzyme (4). ACKNOWLEDGMENTS We thank Dr. Gregory Verdine (Harvard University) for XA90 and pHNl+, Dr. J. St&k& (Universitiit Miinchen) for a sample of purified strictosidine, the Advanced DNA Technologies Laboratory (Biology Department, Texas A&M University) for synthesizing oligonucleotides, the Biotechnology Support Laboratory (Entomology Department, Texas A&M University) for peptide sequencing, and NIH for financial support.
REFERENCES 1. Battersby, A. R., Burnett, A. R., and Parsons, P. G. (1969) Alkaloid biosynthesis. Part XV. Partial synthesis and isolation of vincoside and isovincoside: Biosynthesis of the three major classes of indole alkaloids from vincoside. J. Chem. Sot. C, 1193-1200. 2. Stock& J., and Zenk, M. H. (1977) Isovincoside (strictosidine), the key intermediate in the enzymatic formation of indole alkaloids. FEBS Lett. 79, 233-237. 3. Mizukami, Purification condensing S~ZLS cultured 4. Pfitzner, synthase
H., Nordlov, H., Lee, S. L., and Scott, A. I. (1979) and properties of strictosidine synthase (an enzyme tryptamine and secologanin) from Cantharanthus rocells. Biochemistry l&3760-3763.
U., and Zenk, M. H. (1989) Homogeneous isoenzymes from cell suspension cultures
strictosidine of Cuthar-
anthus roseus. Planta Med. 56, 525-530. 5. Kutchan,
T. M. (1989)
Expression
of enzymatically
active
cloned
300
ROESSNER strictosidine in Escherichia
synthase from the higher plant Rauuolfia coli. FEBS Lett. 257, 127-130.
6. McKnight, T. D., Roessner, C. A., Devagupta, Nessler, C. L. (1990) Nucleotide sequence the vacuolar protein strictosidine synthase roseus. Nucleic Acids Res. 18, 4939.
serpentina
R., Scott, A. I., and of a cDNA encoding from Catharanthus
7. McKnight, T. D., Bergey, D. R., Burnett, R. J., and Nessler, C. L. (1991) Expression of enzymatically active and correctly targeted strictosidine synthase in transgenic tobacco plants. Planta. 185, 148-152. 8. MacFerrin, K. D., Terranova, M. P., Schreiber, S. L., and Verdine, G. L. (1990) Overproduction and dissection of proteins by the expression-cassette polymerase chain reaction. Proc. Nutl. Acud. Sci. USA 87, 1937.
ET
AL
9. Schreiber, S. L., and Verdine, G. L. (1991) Protein overproduction for organic chemists. Tetrahedron 47, 2543. 10. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) “Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 11. Renaudin, J-P. (1985) Extraction and fluorimetric detection after high-performance liquid chromatography of indole alkaloids from cultured cells of Cutharanthus roseus. Physiol. Veg. 23,381388. 12. Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254. 13. Laemmli, assembly
U. K. (1970) Cleavage of structural proteins during of the head of bacteriophage T4. Nature 277,680-685.
the
EXPRESSION
3, 295-300 (19%)
AND PURIFICATION
Purification of an Mole Alkaloid Biosynthetic Enzyme, Strictosidine Synthase, from a Recombinant Strain of Escherichia co/i Charles
A. Roessner,
Center for Biological
Received
February
NMR,
20,1992,
Rama
Devagupta,
Chemistry
and in revised
Department,
form
May
Mashooda Texas A&M
Strictosidine, the precursor of over 1200 plant indole alkaloids including the antitumor agents vinblastine and vincristine, is formed by the condensation of tryptamine with secologanin (Fig. 1). The reaction can occur chemically at low pH, leading to a mixture of strictosidine and its epimer, vincoside (1,2). Strictosidine synthase, the enzyme that mediates the reaction leading only to the 3c~(S) configuration of strictosidine (2), is normally isolated from the plants Catharanthus roseus (periwinkle) or Rauwolfia serpentina or from cell cultures of these plants (3,4). The gene for strictosidine synthase from R. serpentina has recently been reported to have been expressed in active form in Escherichia coli (5).
As an aid to our efforts to study the enzymatic mechanism of strictosidine synthase by NMR, which requires 20-40 mg of pure enzyme for each experiment, and to produce large quantities of strictosidine for use as substrate for the next enzyme in the pathway (strictosidine glucosidase), we have cloned and determined the nu-
1046.5928192
Copyright All rights
of Chemistry,
Quid-i-Azam
$5.00
0 1992 by Academic Press, Inc. of reproduction in any form reserved.
University,
Howard
University,
J. Williams,
College Station,
and A. Ian Scott
Texas 77843-3255
11,1992
The gene for the indole alkaloid biosynthetic enzyme, strictosidine synthase, of Catharanthus roaeus has been cloned into an inducible Escherichia coli expression vector using an expression cassette polymerase chain reaction technique. Induction of the gene resulted in overexpression of the enzyme which accumulated mainly as insoluble inclusion bodies. Denaturation and refolding of the insoluble protein resulted in the ability to purify up to 6 mg of active enzyme from a single liter of cell culture. The recombinant enzyme has good activ0 1992 Academic Press, Inc. ity (-30 nkatlmg).
’ Department Pakistan.
Hasan,l
Islamabad,
cleotide sequence of the homologous gene from C. roseu.s (6). This gene has been transformed into tobacco plants, where it has been shown to express active strictosidine synthase (7). In this paper we report the overexpression of active C. roseus strictosidine synthase in E. coli using an expression cassette polymerase chain reaction technique (8,9). Overexpression has led to the capability to purify the enzyme in quantities exceeding those previously possible. MATERIALS
AND
METHODS
Chemicals and reagents. [side chain-2-14C]Tryptamine bisuccinate (55.9 mCi/mM) was purchased from American Radiolabeled Chemicals, Inc. Secologanin was purchased from Aldrich and tryptamine hydrochloride was purchased from Sigma. TLC2 was performed with Analtech silica gel HLF plates. Other chemicals were of the highest purity obtainable from commercial sources. Bacterial strains and plasmids. E. coli strain XASO(F’lr&‘) (8) and plasmid pHNl+ (8,9) (containing the tat promoter and operator, a multiple cloning region, and the blu gene for P-lactamase) were generous gifts from Dr. Gregory Verdine (Harvard University). Molecular biology techniques. Molecular biology techniques were performed by standard procedures (10). The polymerase chain reaction was performed with a kit from Perkin-Elmer Cetus following the directions provided by the manufacturer. The reaction contained, in a final volume of 100 ~1, 10 ~1 of 10X reaction buffer, 200 PM of each dNTP, 40 pmol of each primer, 2.5 units of Taq polymerase, and 500 ng of DNA isolated
’ Abbreviations used: TLC, thin layer chromatography; protein liquid chromatography; SDS-PAGE, sodium polyacrylamide gel electrophoresis.
dodecyl
FPLC, fast sulfate-
295
296
ROESSNER
ET
AL.
12345 WHz k
CH,O#
&O Secologanin
Tryptamine
Strictosidine synthase
Sa-(S)-Strictosidine FIG. 1. strictosidine.
The
condensation
of tryptamine
and
secologanin
to form
from bacteriophage X gtll bearing the strictosidine synthase gene (6). The reaction steps consisted of 2 min at 94”C, 2 min at 42”C, and 4 min at 72°C and were carried out for 30 cycles. Construction of a strictosidine synthase expression vector. A plasmid, pRD1, for the expression of strictosidine synthase was constructed using an expression cassette polymer chain reaction technique described by McFerrin et al. (8,9). In this technique, the per primers are designed to provide cloning sites and optimal translation signals for the expression of foreign proteins in E. coli. Thus, the sequence of the 5’ primer was GGTACCCGGGGATCCAGGAGGAATTTAAAATGTCACCAATTTTGAAAAAGATTTTTATTGAA and provided a
E B Pfac,
y
trictosidine
FIG. 2. Map of pRD1. Tut, tat promoter; RBS, ribosome binding site. The restriction sites shown were predicted from the DNA sequence and confirmed to be present by restriction analysis. Restriction enzymes: B, BarnHI; E, EcoRI; H, HindIII; N, NciI; S, SalI.
FIG. thase tures
3. SDS-PAGE analysis of a time course of strictosidine synproduction by XASO(pRD1). The cells were grown in 50-ml culto OD 550 = 0.5 and then induced by the addition of IPTG to 0.1 mM. Aliquots (200 ~1) of the culture were removed at various times after induction and the cells pelleted in a microfuge. The cell pellets were resuspended in 40 ~1 of SDS sample buffer, placed in a boiling water bath for 5 min, and loaded onto a 12% polyacrylamide gel. Lanes l-3,2,4, and 6 h after induction, respectively, lane 4, the same as lane 3 (6 h) except the culture was not induced, lane 5, molecular weight markers (bovine albumin, 66 kDa; ovalbumin, 45 kDa; glyceraldehyde-3-phosphate dehydrogenase, 36 kDa; carbonic anhydrase, 29 kDa; trypsinogen, 24 kDa; trypsin inhibitor, 20 kDa; and a-lactalbumin, 14 kDa).
5’BarnHI restriction site (GGATCC), a strong ribosome binding site (AGGAGG), an optimal translational spacer element (AATTTAAA), a translational initiation signal (ATG), and the codons for the first 10 amino acids of the mature strictosidine synthase. The sequence of the 3’ primer was CTGCAGGTCGACTTAATTAATGACTAGCTGAGAAACATAAGAATT and provided the codons for the last 10 amino acids of the enzyme, a translational stop signal (TAA), and a 3’ Sal1 (GTCGAC) restriction site. The per product was digested with BamHI and Sal1 and ligated into BamHIand SalI-digested pHNl+. The ligation mixture was transformed into XA90 and colonies containing the plasmid bearing the proper insert were tested for strictosidine synthase activity. Strictosidine synthase activity assay. We have observed that strictosidine, after chromatography on silica gel TLC plates, displays a bright yellow fluorescence when irradiated with ultraviolet light at 302 nm which is not displayed by tryptamine (faint green fluorescence) or secologanin (nonfluorescent). A similar fluorescence of other indole alkaloids has been reported (11). This observation was incorporated into a semiquantiative assay to detect strictosidine synthase activity in cells,
PURIFICATION
OF
RECOMBINANT
STRICTOSIDINE
SYNTHASE
297
FIG. 5.
SDS-PAGE analysis of the purification of insoluble strictosidine synthase. Lane 1, cell lysate (5 rg protein); lane 2, insoluble pellet; lane 3, washed pellet; lane 4, pellet solubilized in 8 M urea, dialyzed, and centrifuged (5 gg protein); lane 5, FPLC-purified enzyme (10 pg protein); lane 6, molecular weight markers (see legend to Fig. 2).
FIG. 4.
TLC analysis of the products of strictosidine synthase assays. Lane 1, tryptamine + secologanin + XASO(pRD1); lane 2, tryptamine + secologanin + XASO(pHNl+); lane 3, tryptamine + secologanin; lane 4, secologanin alone; lane 5, tryptamine alone. The cells from 50-ml overnight cultures were collected by centrifugation and resuspended in buffer. The reactions and TLC analysis were performed as described under Materials and Methods. The circles indicate fluorescence observed at 254 nm corresponding to tryptamine (top) and secologanin (bottom). The arrow indicates the R, of strictosidine.
cell lysates, and column fractions. Strictosidine synthase was assayed by observing the formation of strictosidine in incubations containing 150 pg of tryptamine, 300 pg of secologanin, and enzyme in a total volume of 150 ~1 of potassium phosphate buffer, pH 6.5. After incubation at 37°C for 1 h, the reaction mixtures were lyophilized and extracted with 50 ~1 methanol. The methanol extract was spotted on silica gel TLC plates which were developed in an acetone:methanol:diethylamine (7:2:1) solvent system. The plates were dried thoroughly and strictosidine formation was monitored by illumination of the dried plates at 302 nm on a uv transilluminator (Haake-Buchler UVT). The bright yellow fluorescent spot was observed only from incubations containing enzyme and had the same R, as authentic strictosidine. The fluorescent spot was purified by TLC and demonstrated to be strictosidine by mass spectrometry and ‘H NMR analysis of its tetraacetate-lactam derivative. A methanol extract of a preparative scale enzymatic reaction was also prepared and analyzed by HPLC and
NMR. The product with the same retention time and ‘H NMR spectrum as authentic strictosidine was isolated by HPLC. The vincoside epimer was not observed in the enzymatic reactions, whereas a product corresponding to vincoside was observed in samples that had been prepared by the chemical condensation of tryptamine and secologanin. These observations further confirm that the strictosidine seen in the fluorescence assay is the product of enzymatic coupling of tryptamine and secologanin.
FIG.
6. Autoradiogram of TLC-separated products of reactions containing “C-labeled tryptamine, secologanin, and varying amounts of purified enzyme. The reactions contained 0.5,1.0,2.0,4.0, or 8.0 pg of strictosidine synthase (lanes l-5, respectively) and were incubated for 10 min as described under Materials and Methods.
298
ROESSNER TABLE The
Stage
Purification
of purification
Volume
Cell lysate 8 M urea solution (after washes) Dialysate Note.
n.d.,
not
of Recombinant
(ml)
Strictosidine
Synthase
Concentration (w/ml)
ET
AL.
1 from
1.0 Liter Total
protein (ms)
of
E. coli Strain
XA90
Specific activity (nkat/mg)
Bearing
pRD1 Total
activity (nkat)
40
4.5
180
n.d.
n.d.
40 40
0.9 0.7
36 28
n.d. -30
n.d. -840
determined.
To determine specific activity, a series of dilutions of the enzyme was incubated for 10 min at 37°C with 1.25 mM secologanin, 0.25 InM tryptamine, and 0.2 PCi 14Clabeled tryptamine (0.025 mM) in 150 ~1 phosphate buffer. The samples were rapidly frozen in liquid nitrogen, lyophilized, and then chromatographed on TLC plates as described above. An autoradiogram of the TLC plate was then prepared to determine at what enzyme concentration 100% of the tryptamine had been converted to strictosidine. One nanokatal is the amount of enzyme required to synthesize 1 nmol of strictosidine in 1 s under the conditions described. Purification of strictosidine synthase. XASO(pRD1) cells were grown at 37°C in LB medium containing 50 pg/ml ampicillin to an OD,,, of 0.5 and then induced by the addition of IPTG to 0.1 mM. The cultures were grown for a further 2 h at 37°C and the cells collected by centrifugation. The ceil pellets were suspended in & vol of 0.1 M phosphate buffer, pH 8.0, containing 5.0 mM EDTA and 50 pg/ml lysozyme and incubated at room temperature for 30 min. The cells were then disrupted by sonication and the lysates centrifuged for 10 min at 10,000 rpm in a Sorvall SS-34 rotor. The pellet, containing most of the enzyme, was washed once with phosphate buffer and once with 0.1 M Tris-HCl buffer, pH 8.0, containing 3 M urea. The pellet was then suspended in 0.1 M Tris-HCl buffer, pH 8.0, containing 8 M urea and allowed to stand at room temperature for 15 h. The solution was centrifuged at 37,000 rpm in a Beckman Ti 45 rotor and dialyzed extensively against two changes of 100 vol each of 0.1 M Tris-HCl, pH 8.0. The dialysate was again centrifuged at 37,000 rpm in the Ti 45 rotor, the clear supernatant loaded onto a DEAE-Sephacel or a MonoQ lO/lO FPLC column equilibrated with 0.020 M phosphate buffer, pH 8.0, and the protein eluted with a O-O.5 M KC1 linear gradient. The active fractions were combined and concentrated by ultrafiltration with an Amicon concentrator fit with a PM10 membrane. Strictosidine synthase activity was also observed in the soluble fraction, but attempts to purify it proved tedious and resulted in poor yields. Other procedures. Protein concentrations were determined by the procedure of Bradford (12). SDS-
PAGE was performed by the procedure of Laemmli (13). Protein sequencing was performed with an Applied Biosystems 470A pulsed liquid protein sequencer. PCR primers were synthesized with an Applied Biosystems 391 PCR-MATE DNA synthesizer. FPLC was performed with a Waters 650 Advanced Protein Purification System using Pharmacia columns. RESULTS AND DISCUSSION Expression of strictosidine synthase in E. coli. Strictosidine synthase has been shown by ultrastructural immunolocalization to be associated with plant vacuoles (7). To effect transport across the endoplasmic reticulum and into the vacuole, it is normally synthesized with a signal peptide which is, presumably, removed by signal peptidase during transport. It is possible that the prokaryotic E. coli transport signal-processing system would not recognize a signal intended to direct the transport of an enzyme into a plant vacuole, and failure to remove the signal could result in decreased enzymic activity. With the expression cassette polymerase chain reaction technique, it is possible to construct expression vectors that will direct the expression of all or just portions of a protein (8). Therefore, we constructed our strictosidine synthase expression vector, pRD1 (Fig. 2), to contain E. coli transcriptional signals from plasmid pHNl+ and designed the expression cassette polymer chain reaction primers such that the protein expressed from the recombinant plasmid would contain a methionine residue immediately followed by the amino acids of the processed enzyme which were predicted from the DNA sequence (6). Determination of the nucleotide sequence of the strictosidine synthase gene in pRD1, isolated from cells from which the enzyme is purified as described below, revealed the expected sequence (6) with two variations: an A to T change at base 843 and a C to T change at base 977. These changes result in altering Ser to Arg and Ser to Phe, respectively. When induced with IPTG, E. coli strain XASO(pRD1) displayed a new protein band with an M, of about 34,000 on SDS-PAGE gels that was not seen in uninduced cells. A time course of the expression demonstrated that
PURIFICATION
OF
RECOMBINANT
collecting the cells 2 h after induction provided good expression of the new protein band (Fig. 3). After being grown in the presence of IPTG for 2 h, the whole cells displayed strictosidine synthase activity as was demonstrated by the appearance of strictosidine, as analyzed by TLC and NMR, in incubations containing the substrates and cells bearing pRD1 but not in incubations containing substrates and control cells bearing pHNl+ with no insert (Fig. 4). A cell-free extract prepared by sonication of the cells followed by centrifugation at 12,000g had an activity about four times higher than that of whole cells (not shown). This enzymatic activity was in the soluble fraction even though most of the protein associated with the induced band was found in the insoluble fraction (Fig. 5, lane 2), presumably in the form of inclusion bodies. However, only a very small portion of the protein was soluble as there was not enough to be seen by SDS-PAGE and attempts to purify it required up to eight different steps and resulted in less than 1 mg of 50% pure enzyme from 8 liters of cells. Solubilization, soluble protein
renaturation, and purification to form active strictosidine
of the insynthase.
Since most of the expressed enzyme was found to be in the insoluble fraction, in vitro denaturation and refolding of the inactive enzyme were performed to recover the enzyme in an active form. The insoluble pellets were washed with buffer and 3 M urea, solubilized in 8 M urea, and then dialyzed against 0.1 M Tris-HCI, pH 8.0 as described under Materials and Methods. The enzyme at this stage was >90% pure as judged by SDS-PAGE (Fig. 5, lane 4) and was active. When analyzed by the assay based on the conversion of 14C-labeled tryptamine to strictosidine described under Materials and Methods, the amount of labeled tryptamine consumed and of labeled strictosidine produced was proportional to the amount of enzyme added (Fig. 6), and the specific activity of the denatured and refolded enzyme was estimated to be about 30 nkat/mg (Fig. 6 and Table 1). This is a rough estimation of specific activity as it is determined under conditions of limiting substrate and by estimation of the relative intensity of spots on an autoradiogram. Attempts to further purify the enzyme by anionexchange chromatography, which could remove improperly folded enzyme, on either a DEAE-Sephacel column or a MonoQ 10110 FPLC column resulted in no increase in the purity (Fig. 4, lane 5) or in the specific activity but resulted in substantial loss of enzyme due to precipitation of the enzyme at the top of the column. Therefore, our normal purification scheme, which we have performed one or two times a month over the past 6 months, does not include an anion-exchange chromatography step. The enzyme can be stored at -2O’C for up to 3 months with little loss of activity. The ready availability of the active recombinant enzyme is highly advantageous for the synthesis of strictosidine, which can be
STRICTOSIDINE
299
SYNTHASE
used as substrate for the next enzyme in the pathway and for NMR studies of enzyme-substrate intermediates. We now have the capability to purify more enzyme activity from a single liter of a 2-h-induced culture of bacterial cells (about 2.5 g of cells) as was previously reported to be possible (4) starting with 1 kg of C. roseus cells, which requires a complex growth medium and usually 2 weeks to grow. The purification procedure is also greatly simplified, requiring only washing, denaturation, and refolding of the insoluble enzyme. Characterization of purified strictosidine synthase. The sequence of the first 10 amino acids of the
purified enzyme was found to be Met-Ser-Pro-IleLeu-Lys-Lys-Ile-Phe-Ile, corresponding exactly to the sequence predicted from the nucleotide sequence. The lV, of the protein usually appeared to be about 34,000 (Fig. 2), slightly less than the 36,074-Da molecular weight predicted from the nucleotide sequence of the gene. A similar M, for the enzyme has also been reported in two previous reports on the expression of strictosidine synthase in heterologous systems (5,7) and may be an inherent property of the enzyme or due to proteolytic processing. In each of these works the enzyme was reported to retain activity, but in neither case was it purified or sequenced nor was a specific activity reported. The enzyme isolated from C. roseus is glycosylated, a process which E. coli is unable to perform, but it has been reported that chemical removal of the sugar moiety has no effect on the activity of the native enzyme (4). ACKNOWLEDGMENTS We thank Dr. Gregory Verdine (Harvard University) for XA90 and pHNl+, Dr. J. St&k& (Universitiit Miinchen) for a sample of purified strictosidine, the Advanced DNA Technologies Laboratory (Biology Department, Texas A&M University) for synthesizing oligonucleotides, the Biotechnology Support Laboratory (Entomology Department, Texas A&M University) for peptide sequencing, and NIH for financial support.
REFERENCES 1. Battersby, A. R., Burnett, A. R., and Parsons, P. G. (1969) Alkaloid biosynthesis. Part XV. Partial synthesis and isolation of vincoside and isovincoside: Biosynthesis of the three major classes of indole alkaloids from vincoside. J. Chem. Sot. C, 1193-1200. 2. Stock& J., and Zenk, M. H. (1977) Isovincoside (strictosidine), the key intermediate in the enzymatic formation of indole alkaloids. FEBS Lett. 79, 233-237. 3. Mizukami, Purification condensing S~ZLS cultured 4. Pfitzner, synthase
H., Nordlov, H., Lee, S. L., and Scott, A. I. (1979) and properties of strictosidine synthase (an enzyme tryptamine and secologanin) from Cantharanthus rocells. Biochemistry l&3760-3763.
U., and Zenk, M. H. (1989) Homogeneous isoenzymes from cell suspension cultures
strictosidine of Cuthar-
anthus roseus. Planta Med. 56, 525-530. 5. Kutchan,
T. M. (1989)
Expression
of enzymatically
active
cloned
300
ROESSNER strictosidine in Escherichia
synthase from the higher plant Rauuolfia coli. FEBS Lett. 257, 127-130.
6. McKnight, T. D., Roessner, C. A., Devagupta, Nessler, C. L. (1990) Nucleotide sequence the vacuolar protein strictosidine synthase roseus. Nucleic Acids Res. 18, 4939.
serpentina
R., Scott, A. I., and of a cDNA encoding from Catharanthus
7. McKnight, T. D., Bergey, D. R., Burnett, R. J., and Nessler, C. L. (1991) Expression of enzymatically active and correctly targeted strictosidine synthase in transgenic tobacco plants. Planta. 185, 148-152. 8. MacFerrin, K. D., Terranova, M. P., Schreiber, S. L., and Verdine, G. L. (1990) Overproduction and dissection of proteins by the expression-cassette polymerase chain reaction. Proc. Nutl. Acud. Sci. USA 87, 1937.
ET
AL
9. Schreiber, S. L., and Verdine, G. L. (1991) Protein overproduction for organic chemists. Tetrahedron 47, 2543. 10. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) “Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 11. Renaudin, J-P. (1985) Extraction and fluorimetric detection after high-performance liquid chromatography of indole alkaloids from cultured cells of Cutharanthus roseus. Physiol. Veg. 23,381388. 12. Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254. 13. Laemmli, assembly
U. K. (1970) Cleavage of structural proteins during of the head of bacteriophage T4. Nature 277,680-685.
the
