PURII'ICATIOIi OF RECOIIBIIIAH'l' PllOTEIIiS VIm HE'lAL CHElATE ADSOllBElI'l
Erich Hochuli F. Hoffmann-La Roche AG Central Research Units CH-4002 Basel, Switzerland INTRODUCTION In 1975 Porath and co-workers introduced immobilized metal ion affinity chromatography (IMAC) for the purification of peptides and proteins (l). The principle of this technique is the coordination between the electron donor groups on a protein (peptide) surface and immobilized trans! tion me tal ions. The tridentate chelator, iminodiacetic acid, is coupled via a spacer arm to a solid support and used for the immobilization of metal ions such as Ni{II), Cu{II) or Zn{II). Porath postulated that the histidine, cysteine and tryptophan residues in proteins (peptides) are most likely to form stable coordination bonds with metal chelates at neutral pH. Present experience (2) indicates tha t histidine residues on protein surfaces are the predominant electron donor groups. In recent years very attractive genetic approaches have been developed to facilitate purification of recombinant proteins. The concept is based on the preparation of hybrid proteins by fusing the coding sequence of the protein of interest with the coding sequence of a protein with high affinity for an immobilized ligand, together with the sequence of a specific cleavage site. The expressed fusion proteins are then purified by taking advantage. of the specific binding of the affinity protein (affinity tag) to the adsorbent. After purification of the hybrid protein, the affinity tag can be split off at the designed cleavage site. This general method for purification of recombinant proteins has been demonstrated with the use of a number of differen t affinity protein-ligand systems (3-8). Al ternative purification strategies involve the synthesis of fusion proteins containing, for example, poly-arginine at their carboxy terminus Genetic Engineering, Vol. 12 Edited by J .K. Setlow Plenum Press, New York, 1990
87
88
E. HOCHULI
which allows purification by cation-exchange chr,oma tography (9). Gene fusion systems using immobilized metal ion affinity chromatography to facilitate the purification of recombinant proteins have been described recently. Smith and co-workers have purified a fusion protein comprising a His-Trp chelating peptide fused to proinsulin with the use of immobilized iminodiacetic acid charged with Ni(II) ions (10). We have developed a general purification method for recombinant proteins based on the selective interaction between a poly-His peptide fused to the protein of interest and an immobilized nitrilotriacetic acid derivative charged with Ni(II) ions (11,12). The effects of placing poly-His tags of different lengths at the carboxy as well as at the amino terminus have been investigated. Here we present a protocol for the preparation of the Ni(II)-nitrilotriacetic acid adsorbent (NTANi(II) adsorbent) and its use for the purification of poly-His fusion proteins. PREPARATION OF THE NTA-Ni(II) ADSORBENT The NTA-adsorbent is a quadridentate chelator which occupies four positions in the metal coordination sphere of, e.g. Ni(II). The remaining two ligand positions in the octahedral coordination sphere are available for selective interactions with adjacent histidines of a fusion protein (Figure 1). The NTA-adsorben t is prepared from NE -pro tec ted lysine and bromoacetic aCid. After the protecting group is removed, the lysine derivative is immobilized on epoxy-activated Sepharose CL6B. Bromoacetic aCid, NE -benzyloxycarbonyl-L-lysine and
Figure 1. Schematic representation of the nitrilotriacetic acid adsorbent (NTA-M adsorbent). The quadridentate chelator occupies four posi tions in the me tal coord ina tion sphere of a me tal ion with a coordination number of six, e.g., M = Ni(II). The remaining two ligand pOSitions X in the octahedral coordination sphere are available for selective interactions with adjacent histidines of a fusion protein.
PURIFICATION OF PROTEINS WITH METAL CHELATE ADSORBENT
89
epi bromohydrine are obtained from Fluka (Buchs, Switzerland). Sepharose CL-6B is purchased from Pharmacia. All other chemicals are of reagent grade. A 41.7 g amount of bromoacetic acid is dissolved in 150 ml of 2 M sodium hydroxide solution and cooled to OOC. A solution of 42 g of Nt -benzyloxycarbonyl-L-lysine in 225 ml of 2 M sodium hydroxide solution is slowly added dropwise at OOC with stirring. After 2 hr the cooling is stopped and the mixture is stirred overnight. It is then held at 50 0 C for 2 hr and 450. ml of 1 M hydrochloric acid are subsequently added. After the mixture has been cooled, the crystals that formed are fil tered off. The produc t is dissolved in 1 M sodium hydroxide solution and again preCipitated with the same amount of 1 M hydrochloric acid and. filtered off. White crystals (about 40 g) of N-(5-benzyloxycarbonylamino-l-carboxypentyl)iminodiacetic acid are obtained, m.p. l72-l74 0 C (dec.), [a]n = +9.9 0 (c = 1; 0.1 M sodium hydroxide). Calculated for C1BH24N20B (mol. wt. 396.4): C 54.54, H 6.10, N 7.07%; observed: C 54.50, H 6.22, N 7.05%. 10 g of the lysine derivative is then dissolved in 100 ml 0,5 M sodium hydroxide solution and, after the addition of 500 mg 5% Pd/C, hyd rogena ted a t room tempera ture and normal pressure. The catalyst is filtered off and the filtrate acidified to pH 2 with 5 M hydrochloric acid. Then 100 ml ethanol are added and the product crystallized at OOC. White crystals (about 6 g) are formed m.p. 2l6-2l70C. Calculated for ClolilBN206 (mol. wt. 262.26): C 45.BO, H 6.92, N 10.6B%; observed: C 46.01, H 6.72, N 10.63%. 100 ml of Sepharose CL-6B are washed twice on a glass suction filter with about 500 ml of water. The gel is then transferred to a 500 ml round bottom flask; the volume is made up to 200 ml with water and treated at 30 0 C for 4 hr with 16 ml of 4 M sodium hydroxide solution and B.22 ml of epibromohydrine. The activated Sepharose is subsequently filtered off, washed to neutrality with water, returned to the reaction vessel and the volume made up to 200 ml with water. .Then 5.7 g of the lysine derivative from the previous step and 10.6 g of sodium carbonate dissolved in 50 ml of water are added and the mixture is stirred slowly at 60 0 C overnight. The resul ting NTA-absorbent is filtered off and washed with water. For charging with metal ions, the resin is packed in a chromatography column and the following solutions are subsequently pumped through i t : 100 ml of aqueous 1% (w/w) NiS04· 6H20, 200 ml of water, 200 ml of 0.2 M acetic acid (containing 0.2 M sodium chloride and 0.1% Tween 20) as well as 200 ml of water. The ligand density (content of the lysine derivative) of the chelating adsorbent is determined by nitrogen elemental analysis and the amount of chelated Ni(II) ions is measured by atomic adsorption spectroscopy (11). The results of a representative preparation are given in Table 1.
E. HOCHULI
90
Table 1 Ligand and Metal Content of the NTA-Ni(II) Adsorbent Microequivalent/ml adsorbent NTA-ligand
7. 1
Ni(II)
9.5
The ratio of the ligand and metal ion concentration indicates that a 1:1 metal-ligand complex is formed in the adsorbent.
CLONING AND EXPRESSION OF THE POLY-HIS FUSION PROTEINS The pr inciple for cloning and expression of the poly-His fusion proteins is exemplified by mouse dihydrofolate reductase with six histidines at the carboxy terminus (DHFR-(His)6). For the construction of the plasmid pDHFR-(His)6 (12) the ~II/ HindIII fragment of plasmid pDS78/RBSII (13,14) was replaced by the synthetic adaptor encoding six histidines (Figure 2). The oligonucleotide-forming adaptor was synthesized chemically on controlled pore glass. The plasmid pDHFR-(His)6 was transformed into E. coli M 15 cells containing plasmid pDMI.l. The E. coli transform; was grown at 37 0 C in LB medium containing 100 llg/ml ampicillin and 25 llg/ml kanamycin. At OD 600 nm -0.7 isopropylI3-D-thiogalactopyranoside (IPTG) was added to a final concentration of 2 mM and the cells incubated for an additional 5 hr, before being harvested by centrifugation. The synthesis of the fusion protein DHFR-(His)2 was carried out analogously to the synthesis of DHFR-(His)6, with the synthetic adaptor encoding two histidines. In principle these plasmids can be used for the expression of any fusion protein with a poly-His tag. Thus the gene coding for DHFR can be replaced by the gene encoding a new protein of in teres t yielding a plasmid for the expression of a new protein with the affinity tag.
PURIFICATION OF THE POLY-HIS FUSION PROTEINS Adsorption of the fusion proteins to the metal chelate adsorbent has to be carried out at a pH at which the imidazole residues of the histidines are not protonated. The apparent dissociation constant pK2 (imidazole) of histidine is 5.97. Thus at pH 7 more than 91% of the imidazole residues are unprotonated.
PURIFICATION OF PROTEINS WITH METAL CHELATE ADSORBENT
91
N250PSN2S0P29 E
RBsn
bIn
dhfr 89
H
to
Xb
T1 xBgllI,xHindIlI [ CIP treatment
H
H
H
H
H
H-
GATCTCATCACCATCACCATCACTA AGTAGTGGTAGTGGTAGTGATTCGA
ligation [ transfo["mation
N2S0PSN2S0P2 9
x
E
RBSll
bIn
dhfr 89 H
6.His
to
cat
T1 DHfR: DHFR-(HiS)6:
MRGSGIM----KGSRSVNLV ~lRGSGIM----KGSRSHHHHHH
Figure 2. Construction of the plasmid used for the expression of DHFR-(His)6. The upper part of the figure shows plasmid pDS78/ RBSll and the construction of plasmid pDHFR-(His)6. All plasmids contain the regula table promotor/opera tor element N250 PS N250 P29 and the synthetic ribosomal binding site RBSII (13,14). Replacement of ~II/~dIIl fragment by the synthe tic adaptor resul ts in plasmid pDHFR-(His)6. The genes for B-lactamase, chloramphenicol acetyl transferase and mouse dihydrofola te reduc tase are denoted bla, cat and dhfr, respectively. Calf intestinal alkaline phosphatase is abbreviated with ClP. B, Bg, E, H, X and Xb denote cleavage sites for restriction enzymes ~Hl, ~II, ~Rl, ~dIIl, ~l and ~l. The amino acid sequences of DHFR (encoded by plasmid pDS78/RBSlI) and DHFR(His)6 (plasmid pDHFR-(His)6) are shown in the lower part of the figure.
E. HOCHULI
92
Therefore the fusion proteins should be loaded on the metal chelate adsorbent at neutral or slightly alkaline pH. The metal chela te adsorbent is packed into a chromatography column and equilibrated with a phosphate buffer of pH 7 to 8 prior to the loading with protein. The equilibration buffer, which itself forms no chelate with the metal ion, can contain a detergent, e.g., of the polyoxyethylene-sorbitan-fatty acid ester type (Tween). In addi tion the equil ibra tion buffer can con tain high concentrations of dissociating agents as 8 M urea or 6 M guanidine hydrochloride. In order to quench electrostatic interactions between protein and metal chelate adsorbent the buffers usually contain sodium chloride. The elution can be carried out at a constant pH-value by ligand exchange, or with linear or step pH gradients. In the first protocol the imidazole residues of the histidines in the protein are displaced by imidazole dissolved in the elution buffer. An imidazole concentration up to 100 mM may be used. In the second protocol the imidazole residues of the histidines are protonated by lowering pH and thus will reverse the capability to bind to the immobilized metal ion. Buffers, preferably acetate, up to a concentration of 0.2 M and a pH of 3 to 5, are used for this procedure. Recombinant proteins expressed in bacteria often occur in an aggregated and denatured form in the cytoplasm as granules or inclusion bodies. In this form the proteins are protec ted from proteolysis, but the inclusion bodies can only be dissolved with detergents or highly concentrated guanidine hydrochloride or urea solutions. The recovery of active proteins from such dissociating solutions is possible when they can be refolded from their unfolded conformation. The refolding of a denaturated protein in a crude extract may be much more complicated than the refolding of a purified protein. However, most of the conventional chromatographic methods cannot be used with solutions of 6 M guanidine hydrochloride or 8 M urea. Therefore the method of choice may be chromatography in 6 M guanidine hydrochloride on the NTA-Ni(II) adsorbent. Chromatography of a (His)6 Fusion Protein in 6 M Guanidine Hydrochloride Materials
37 ml NTA-Ni(II) adsorbent packed into a chromatography column (2.6 x 10 cm). Extraction buffer:
0.1 M potassium phosphate/ 0.15 M NaCl, pH 8.5, containing 6 M guanidine/HCl.
Wash buffer:
extraction buffer with the pH adjusted to 5.7.
93
PURIFICATION OF PROTEINS WITH METAL CHELATE ADSORBENT
Elution buffer:
0.1 M sodium acetate/0.15 M NaCl, pH 4.8, con taining 6 M guanidine/HCl.
3 g !. ~ cell s, con taining a (His}6 fusion protein recovered from the broth medium by centrifugation (4,000 x g, 10 min, 4 0 C} , are stirred in 30 ml extraction buffer for 1 hr at room temperature with a magnetic stirrer. After centrifugation (10,000 x g, 30 min, 4 0 C) , the supernatant is directly loaded with a peri s tal tic pump (flow ra te 70 ml/hr) on to the NTA-Ni{ II} column equilibrated with 150 ml extraction buffer. Col limn effluent is monitored with a UV monitor (280 nm) and strip chart recorder. The loaded column is washed with 200 ml extraction buffer, then wash buffer until UV-absorbance is back to zero again. Then the column is eluted with elution buffer and fractions collected with a fraction collector. The fractions are analyzed for protein content, for purity by SDS-PAGE (IS) and for activity. The solvent of the purified protein may be exchanged by dialysis or by gel fil tra tion. Proteins prepared wi th this protocol are suitable for direct immunization to generate antibodies. As a representative example the chromatography of DHFR-(His}6 in 6 M guanidine hydrochloride is shown in Figure 3. The efficiency of the different poly-His affinity tags is dependent on the solvent system used throughout the chromatography (12). The (His}6-tag is perfectly suited to chromatography in 6 M guanidine hydrochloride. But in physiological buffer systems, such as phosphate buffer without dissociating agents, the (His}6 -fusion proteins often bind too strongly to the NTANi(II) absorbent and elution of the product may be difficult. On the other hand the (His}2 tag does not bind in 6 M guanidine hydrochloride but works perfectly in physiological buffers. Therefore the (His}2 tag at the carboxy terminus may be the chelating peptide of choice for the purification of recombinant proteins produced in a soluble form. These proteins are not protected from proteolysis, and use of protease inhibitors in the extraction buffer may be necessary. Chromatography of a (His}2 Fusion Protein in a Physiological Buffer Materials
260 ml NTA-Ni{II) adsorbent packed chromatographic column (5 x 16 cm).
into
a
Extraction buffer:
0.1 M sodium phosphate/O.l M NaCl, pH 8, con ta ining O. 1% Tween-20 and 10 ~M PMSF.
Elution buffer:
0.1 M sodium acetate/O.l M NaCl, pH 5.0, containing 0.1% Tween-20.
94
E. HOCHULI
- ----
---
--
- " ' - '';
..
~-:---
_.- ,e -- -- _-
--
-;-. -:.:= .:.:::-:-: ..._- ---
-:---:.-:::~:::=--::.~-::::::-~-
.• . • • . - - -
1";" '::":':"';=:
-:-=:=--==~.:..
.=::-::-:
__ :---::.-----+tI-~-:-:-._-."-_::. ~_=== 45-
31- _
21 -
5
10
13
M
DeB
A
Figure 3. Chromatography of DHFR-(His)6 in 6 M guanidine hydrochloride. 26 ml crude extract obtained from 3 g biomass were purified on a 37 ml NTA-Ni(II) column (2.6 x 10 em). The column was developed wi th a pH step gradient. Collec ted fractions (35 ml) were analyzed by SDS-PAGE. M: standard molecular weight markers. A:!. ~ extract containing DHFR-(His)6' B: fractions 1-5, C: fractions 8-11, D: fraction 13. 30 g E. coli cells, containing a soluble fusion protein with two His a t t~arboxy terminus, are recovered from the broth medium by centrifugation (4,000 x g, 10 min, 4 0 C) , and broken open by sonication in 180 ml extraction buffer. A sonicator W375 from Ul trasonic Inc, New York, wi th a 0.5 inch probe or a similar apparatus is used for 15 min at OOC. After removal of the cell debris by centrifugation (10,000 x g, 30 min, 4°C), the
95
PURIFICATION OF PROTEINS WITH METAL CHELATE ADSORBENT
Table 2 Purification of DHFR-(His)2 on the NTA-Ni{II) column Activity (U)
Recovery (%)
Sp. Act. (U/mg)
7306
100
2.4
Column flow through
704
9
0.3
Eluted DHFR- (His) 2
6439
88
Crude ex trac t
9.0*
The DHFR activity was assayed by reduction of dihydrofolate with NADPH (12). One uni t (U) converts 1 Jlmole of dihydrofola te to tetrahydrofolate per minute. *DHFR purified on a Methotrexate-Sepharose affinity column had a specific activity of 10.3 U/mg. The DHFR-(His)2 had a purity of 90% •
supernatant is directly loaded with a peristaltic pump (flow rate 180 ml/hr) onto the NTA-Ni(II) column equilibrated with 1 liter extraction buffer. Column effluent is monitored with a UV monitor (280 nm) and strip chart recorder. The loaded column is washed with extraction buffer until UV-absorbance is back to zero again. The column is eluted with a 1 liter pH gradient from 8 to 5 (500 ml extraction buffer to 500 ml elution buffer) with the use of a gradient mixer. Fractions are collected with a fraction collector and analyzed for protein content, purity (by SDS-PAGE) and activity. The purification of DHFR-(His)2 with this protocol is summarized in Table 2. Cleavage of the His-tag with Carboxypeptidase A (CPA) CPA rapidly releases amino acids wi th an aroma tic or large al ipha tic s ide chain from the carboxy termini of polypeptide chains. This enzyme can therefore be used to cleave off the Histag at the carboxy terminus. The purified hybrid protein is dialyzed against 0.05 M Tris/HC1, pH 8. The protein, at a concentration of about 2 mg/ml, is then incubated at room temperature with bovine pancreatic CPA (1 mg CPA for 50 mg protein). The reaction is followed by measurement of released his tide. When the theoretical amount of amino acids has been removed the protein can be precipitated, such as with (NH4)2S04. When purified DHFR-(His)2 was treated with CPA, two equivalents of His and one equivalent of Ser were released (12). This result is in good agreement with the expected release of amino acids according to the carboxy terminal amino acid sequence
96
E. HOCHULI
····Ser-Arg-Ser-His-His of the fusion protein, since Arg is expected not to be digested with CPA. However, this method has limitations. The reaction with CPA only stops completely at the position of a basic amino acid. Therefore the procedure is only suited for the production of an authentic protein with a basic amino acid at the carboxy terminus. Other enzymatic and chemical methods to cleave off affinity tags have been described (3). All these methods have limitations. Present experience indicates that there is no general cleavage method available. The optimal procedure must be determined on a case-by-case basis, after analysis of the amino acid sequence of the protein of interest. REGENERATION OF THE NTA-Ni(II) COLUMN Materials
Rinse buffer:
0.2 M acetic acid/0.2 M NaCl containing O.l% Tween-20.
EDTA solution:
O. 1 M disodium te traaceta te.
Ni(II) solution: After every chromatography cycle the NTA-N1(II) column is washed with two column volumes (CV) of rinse buffer followed by two CV of water. Then the column is equilibrated with the appropriate extraction buffer. Afte·r about five chromatography cycles it is convenient to strip the nickel ions with 1 CV of EDTA solution. Then the column is washed subsequently with the following solutions: four CV of water, one CV of Ni(II) solution, two CV of water, two CV of rinse buffer and two CV of water. Then the column is equilibrated with the appropriate extraction buffer. CONCLUDING REMARKS We have shown that fusion proteins comprising a protein of interest and a poly-His peptide can be purified very easily on a NTA-Ni(II) adsorbent. Placement of 2 to 6 histidines at the carboxy as well as at the amino terminus has been investigated. The efficiency of different poly-His affinity tags depends on the buffer solutions used throughout the chromatography. The (His)6 tag at the carboxy or amino terminus of the protein of interest, in combination with a buffer containing 6 M guanidine hydrochloride, is appropriate for the purification of proteins which are formed in inclusion bodies. For proteins which are produced in a soluble form the (His)2 tag at the carboxy terminus is recommended together with a physiological buffer. Orienting
PURIFICATION OF PROTEINS WITH METAL CHELATE ADSORBENT
97
experiments have shown that the purification protocol is also compatible with reducing agents such as mercaptoethanol at concentrations up to 10 mM. Such buffers are usually prepared freshly every day. To split off the affinity tag from the protein of interest, a specific chemical or enzymatic cleavage site may be introduced at the junction (3). These methods are successful in several instances, but often have limitations by poor cleavage yields or by unwanted cleavage that occurs within the desired protein sequence. If the protein of interest already comprises the amino acid sequence of the cleavage site, the product will be degraded. We exploited carboxypeptidase A for the removal of the (His)2 tag a t the carboxy terminus. Thi s enzyme c·an be used f or the production of authentic proteins which comprise an amino acid with basic side chain at the carboxy terminus. From present experience it can be concluded that the optimal procedure for removal of the affinity tag must be determined on a case-by-case basis, after analysis of the amino acid sequence of the protein of interest. Several affinity protein-ligand systems have been developed for the purification of recombinant proteins. However the relatively large affinity proteins described might be a general disadvantage. Small affinity peptides can be more favorable. The observation tha t the (His) 2 tag at the carboxy terminus has only a small effect on the enzymatic activity of DHFR (see Table 2) indicates that the poly-His peptides have minimal effect on the structure of the protein of interest. For many applications the removal of the affinity tag might not be necessary. Poly-His fusion proteins are well suited for direct immunization to generate antibodies against the protein of in terest. Recombinant proteins expressed in bacteria often form inclusion bodies. A refolding step is necessary for the purification of active protein from inclusion bodies. Proteins formed in inclusion bodies can easily be dissolved in 6 M guanidine hydrochloride and then purified on the NTA-Ni(ll) column. In addition it is possible to do refolding experiments in situ in the column. In the adsorbed form the protein mol ;Cules-are separated in space and therefore the problem of protein aggregation during the refolding process is minimized. In conclusion we believe that the method described is an attractive addition to the range of modern purification procedures for heterologously-produced proteins. REFERENCES 1
Porath, J., Carlsson, J., Olsson, 1. and Belfrage, G. (1975) Nature (London) 258, 598-599.
98 2
E.HOCHUU
Hemdan, S.E., Zhao, Y., Sulkowski, E. and Porath, J. (1989) Proc. Nat. Acad. Sci. U.S.A. 86, 1811-1815. 3 Moks, T., Abrahmsen, L., OesterlSf, B., Josephson,S., Oestling, M., Enfors, 5.0., Persson, 1., Nilsson, B. and Uhlen, M. (1987) Bio/Technology 5, 379-382. 4 Nyg ren, P. -A., El iasson, M., Palmcran tz, E., Abrahmsen, L. and Uhlen, M. (1988) J. Mol. Recognition 1, 6-74. 5 Ullman, A. (1984) Gene 29, 27-31. 6 di Guan, C., Li, P., Riggs, P.D. and Inouye, H. (1988) Gene 67, 21-30. 7 Smith, D.B. and Johnson, K.S. (1988) Gene 67, 31-40. 8 Germinio, I. and Bastia, D. (1984) Proc. Nat. Acad. Sci. U.S. A. 81, 4692 -46 96. 9 Sassenfeld, H.M. and Brewer, S.J. (1984) Bio/Technology 2, 76 -80. 10 Smith, M.C., Furman, T.C., Ingolia, T.D. and Pidgeon, C. (1988) J. Bio1. Chem. 263, 7211-7215. 11 Hochuli, E., D8beli, H. and Schacher, A. (1987) J. Chromatogr. 411, 177-184. 12 Hochuli, E., Bannwarth, W., D8beli, H., Gentz, R. and StUber, D. (1988) Bio/Technology 6, 1321-1325. 13 Bujard, H., Gentz, R., Lanzer, M., StUber, D., MUller, M., Ibrahimi, I., Haeuptle, M.-T. and Dobberstein, B. (1987) Methods in Enzymology 155, 416-433. 14 Lanzer, M. and Bujard, .H. (1988) Proc. Nat. Acad. Sci. U.S.A. 85, 8973-8977. 15 Laemmli, U.K. (1970) Nature (London) 227, 680-685.
Erich Hochuli F. Hoffmann-La Roche AG Central Research Units CH-4002 Basel, Switzerland INTRODUCTION In 1975 Porath and co-workers introduced immobilized metal ion affinity chromatography (IMAC) for the purification of peptides and proteins (l). The principle of this technique is the coordination between the electron donor groups on a protein (peptide) surface and immobilized trans! tion me tal ions. The tridentate chelator, iminodiacetic acid, is coupled via a spacer arm to a solid support and used for the immobilization of metal ions such as Ni{II), Cu{II) or Zn{II). Porath postulated that the histidine, cysteine and tryptophan residues in proteins (peptides) are most likely to form stable coordination bonds with metal chelates at neutral pH. Present experience (2) indicates tha t histidine residues on protein surfaces are the predominant electron donor groups. In recent years very attractive genetic approaches have been developed to facilitate purification of recombinant proteins. The concept is based on the preparation of hybrid proteins by fusing the coding sequence of the protein of interest with the coding sequence of a protein with high affinity for an immobilized ligand, together with the sequence of a specific cleavage site. The expressed fusion proteins are then purified by taking advantage. of the specific binding of the affinity protein (affinity tag) to the adsorbent. After purification of the hybrid protein, the affinity tag can be split off at the designed cleavage site. This general method for purification of recombinant proteins has been demonstrated with the use of a number of differen t affinity protein-ligand systems (3-8). Al ternative purification strategies involve the synthesis of fusion proteins containing, for example, poly-arginine at their carboxy terminus Genetic Engineering, Vol. 12 Edited by J .K. Setlow Plenum Press, New York, 1990
87
88
E. HOCHULI
which allows purification by cation-exchange chr,oma tography (9). Gene fusion systems using immobilized metal ion affinity chromatography to facilitate the purification of recombinant proteins have been described recently. Smith and co-workers have purified a fusion protein comprising a His-Trp chelating peptide fused to proinsulin with the use of immobilized iminodiacetic acid charged with Ni(II) ions (10). We have developed a general purification method for recombinant proteins based on the selective interaction between a poly-His peptide fused to the protein of interest and an immobilized nitrilotriacetic acid derivative charged with Ni(II) ions (11,12). The effects of placing poly-His tags of different lengths at the carboxy as well as at the amino terminus have been investigated. Here we present a protocol for the preparation of the Ni(II)-nitrilotriacetic acid adsorbent (NTANi(II) adsorbent) and its use for the purification of poly-His fusion proteins. PREPARATION OF THE NTA-Ni(II) ADSORBENT The NTA-adsorbent is a quadridentate chelator which occupies four positions in the metal coordination sphere of, e.g. Ni(II). The remaining two ligand positions in the octahedral coordination sphere are available for selective interactions with adjacent histidines of a fusion protein (Figure 1). The NTA-adsorben t is prepared from NE -pro tec ted lysine and bromoacetic aCid. After the protecting group is removed, the lysine derivative is immobilized on epoxy-activated Sepharose CL6B. Bromoacetic aCid, NE -benzyloxycarbonyl-L-lysine and
Figure 1. Schematic representation of the nitrilotriacetic acid adsorbent (NTA-M adsorbent). The quadridentate chelator occupies four posi tions in the me tal coord ina tion sphere of a me tal ion with a coordination number of six, e.g., M = Ni(II). The remaining two ligand pOSitions X in the octahedral coordination sphere are available for selective interactions with adjacent histidines of a fusion protein.
PURIFICATION OF PROTEINS WITH METAL CHELATE ADSORBENT
89
epi bromohydrine are obtained from Fluka (Buchs, Switzerland). Sepharose CL-6B is purchased from Pharmacia. All other chemicals are of reagent grade. A 41.7 g amount of bromoacetic acid is dissolved in 150 ml of 2 M sodium hydroxide solution and cooled to OOC. A solution of 42 g of Nt -benzyloxycarbonyl-L-lysine in 225 ml of 2 M sodium hydroxide solution is slowly added dropwise at OOC with stirring. After 2 hr the cooling is stopped and the mixture is stirred overnight. It is then held at 50 0 C for 2 hr and 450. ml of 1 M hydrochloric acid are subsequently added. After the mixture has been cooled, the crystals that formed are fil tered off. The produc t is dissolved in 1 M sodium hydroxide solution and again preCipitated with the same amount of 1 M hydrochloric acid and. filtered off. White crystals (about 40 g) of N-(5-benzyloxycarbonylamino-l-carboxypentyl)iminodiacetic acid are obtained, m.p. l72-l74 0 C (dec.), [a]n = +9.9 0 (c = 1; 0.1 M sodium hydroxide). Calculated for C1BH24N20B (mol. wt. 396.4): C 54.54, H 6.10, N 7.07%; observed: C 54.50, H 6.22, N 7.05%. 10 g of the lysine derivative is then dissolved in 100 ml 0,5 M sodium hydroxide solution and, after the addition of 500 mg 5% Pd/C, hyd rogena ted a t room tempera ture and normal pressure. The catalyst is filtered off and the filtrate acidified to pH 2 with 5 M hydrochloric acid. Then 100 ml ethanol are added and the product crystallized at OOC. White crystals (about 6 g) are formed m.p. 2l6-2l70C. Calculated for ClolilBN206 (mol. wt. 262.26): C 45.BO, H 6.92, N 10.6B%; observed: C 46.01, H 6.72, N 10.63%. 100 ml of Sepharose CL-6B are washed twice on a glass suction filter with about 500 ml of water. The gel is then transferred to a 500 ml round bottom flask; the volume is made up to 200 ml with water and treated at 30 0 C for 4 hr with 16 ml of 4 M sodium hydroxide solution and B.22 ml of epibromohydrine. The activated Sepharose is subsequently filtered off, washed to neutrality with water, returned to the reaction vessel and the volume made up to 200 ml with water. .Then 5.7 g of the lysine derivative from the previous step and 10.6 g of sodium carbonate dissolved in 50 ml of water are added and the mixture is stirred slowly at 60 0 C overnight. The resul ting NTA-absorbent is filtered off and washed with water. For charging with metal ions, the resin is packed in a chromatography column and the following solutions are subsequently pumped through i t : 100 ml of aqueous 1% (w/w) NiS04· 6H20, 200 ml of water, 200 ml of 0.2 M acetic acid (containing 0.2 M sodium chloride and 0.1% Tween 20) as well as 200 ml of water. The ligand density (content of the lysine derivative) of the chelating adsorbent is determined by nitrogen elemental analysis and the amount of chelated Ni(II) ions is measured by atomic adsorption spectroscopy (11). The results of a representative preparation are given in Table 1.
E. HOCHULI
90
Table 1 Ligand and Metal Content of the NTA-Ni(II) Adsorbent Microequivalent/ml adsorbent NTA-ligand
7. 1
Ni(II)
9.5
The ratio of the ligand and metal ion concentration indicates that a 1:1 metal-ligand complex is formed in the adsorbent.
CLONING AND EXPRESSION OF THE POLY-HIS FUSION PROTEINS The pr inciple for cloning and expression of the poly-His fusion proteins is exemplified by mouse dihydrofolate reductase with six histidines at the carboxy terminus (DHFR-(His)6). For the construction of the plasmid pDHFR-(His)6 (12) the ~II/ HindIII fragment of plasmid pDS78/RBSII (13,14) was replaced by the synthetic adaptor encoding six histidines (Figure 2). The oligonucleotide-forming adaptor was synthesized chemically on controlled pore glass. The plasmid pDHFR-(His)6 was transformed into E. coli M 15 cells containing plasmid pDMI.l. The E. coli transform; was grown at 37 0 C in LB medium containing 100 llg/ml ampicillin and 25 llg/ml kanamycin. At OD 600 nm -0.7 isopropylI3-D-thiogalactopyranoside (IPTG) was added to a final concentration of 2 mM and the cells incubated for an additional 5 hr, before being harvested by centrifugation. The synthesis of the fusion protein DHFR-(His)2 was carried out analogously to the synthesis of DHFR-(His)6, with the synthetic adaptor encoding two histidines. In principle these plasmids can be used for the expression of any fusion protein with a poly-His tag. Thus the gene coding for DHFR can be replaced by the gene encoding a new protein of in teres t yielding a plasmid for the expression of a new protein with the affinity tag.
PURIFICATION OF THE POLY-HIS FUSION PROTEINS Adsorption of the fusion proteins to the metal chelate adsorbent has to be carried out at a pH at which the imidazole residues of the histidines are not protonated. The apparent dissociation constant pK2 (imidazole) of histidine is 5.97. Thus at pH 7 more than 91% of the imidazole residues are unprotonated.
PURIFICATION OF PROTEINS WITH METAL CHELATE ADSORBENT
91
N250PSN2S0P29 E
RBsn
bIn
dhfr 89
H
to
Xb
T1 xBgllI,xHindIlI [ CIP treatment
H
H
H
H
H
H-
GATCTCATCACCATCACCATCACTA AGTAGTGGTAGTGGTAGTGATTCGA
ligation [ transfo["mation
N2S0PSN2S0P2 9
x
E
RBSll
bIn
dhfr 89 H
6.His
to
cat
T1 DHfR: DHFR-(HiS)6:
MRGSGIM----KGSRSVNLV ~lRGSGIM----KGSRSHHHHHH
Figure 2. Construction of the plasmid used for the expression of DHFR-(His)6. The upper part of the figure shows plasmid pDS78/ RBSll and the construction of plasmid pDHFR-(His)6. All plasmids contain the regula table promotor/opera tor element N250 PS N250 P29 and the synthetic ribosomal binding site RBSII (13,14). Replacement of ~II/~dIIl fragment by the synthe tic adaptor resul ts in plasmid pDHFR-(His)6. The genes for B-lactamase, chloramphenicol acetyl transferase and mouse dihydrofola te reduc tase are denoted bla, cat and dhfr, respectively. Calf intestinal alkaline phosphatase is abbreviated with ClP. B, Bg, E, H, X and Xb denote cleavage sites for restriction enzymes ~Hl, ~II, ~Rl, ~dIIl, ~l and ~l. The amino acid sequences of DHFR (encoded by plasmid pDS78/RBSlI) and DHFR(His)6 (plasmid pDHFR-(His)6) are shown in the lower part of the figure.
E. HOCHULI
92
Therefore the fusion proteins should be loaded on the metal chelate adsorbent at neutral or slightly alkaline pH. The metal chela te adsorbent is packed into a chromatography column and equilibrated with a phosphate buffer of pH 7 to 8 prior to the loading with protein. The equilibration buffer, which itself forms no chelate with the metal ion, can contain a detergent, e.g., of the polyoxyethylene-sorbitan-fatty acid ester type (Tween). In addi tion the equil ibra tion buffer can con tain high concentrations of dissociating agents as 8 M urea or 6 M guanidine hydrochloride. In order to quench electrostatic interactions between protein and metal chelate adsorbent the buffers usually contain sodium chloride. The elution can be carried out at a constant pH-value by ligand exchange, or with linear or step pH gradients. In the first protocol the imidazole residues of the histidines in the protein are displaced by imidazole dissolved in the elution buffer. An imidazole concentration up to 100 mM may be used. In the second protocol the imidazole residues of the histidines are protonated by lowering pH and thus will reverse the capability to bind to the immobilized metal ion. Buffers, preferably acetate, up to a concentration of 0.2 M and a pH of 3 to 5, are used for this procedure. Recombinant proteins expressed in bacteria often occur in an aggregated and denatured form in the cytoplasm as granules or inclusion bodies. In this form the proteins are protec ted from proteolysis, but the inclusion bodies can only be dissolved with detergents or highly concentrated guanidine hydrochloride or urea solutions. The recovery of active proteins from such dissociating solutions is possible when they can be refolded from their unfolded conformation. The refolding of a denaturated protein in a crude extract may be much more complicated than the refolding of a purified protein. However, most of the conventional chromatographic methods cannot be used with solutions of 6 M guanidine hydrochloride or 8 M urea. Therefore the method of choice may be chromatography in 6 M guanidine hydrochloride on the NTA-Ni(II) adsorbent. Chromatography of a (His)6 Fusion Protein in 6 M Guanidine Hydrochloride Materials
37 ml NTA-Ni(II) adsorbent packed into a chromatography column (2.6 x 10 cm). Extraction buffer:
0.1 M potassium phosphate/ 0.15 M NaCl, pH 8.5, containing 6 M guanidine/HCl.
Wash buffer:
extraction buffer with the pH adjusted to 5.7.
93
PURIFICATION OF PROTEINS WITH METAL CHELATE ADSORBENT
Elution buffer:
0.1 M sodium acetate/0.15 M NaCl, pH 4.8, con taining 6 M guanidine/HCl.
3 g !. ~ cell s, con taining a (His}6 fusion protein recovered from the broth medium by centrifugation (4,000 x g, 10 min, 4 0 C} , are stirred in 30 ml extraction buffer for 1 hr at room temperature with a magnetic stirrer. After centrifugation (10,000 x g, 30 min, 4 0 C) , the supernatant is directly loaded with a peri s tal tic pump (flow ra te 70 ml/hr) on to the NTA-Ni{ II} column equilibrated with 150 ml extraction buffer. Col limn effluent is monitored with a UV monitor (280 nm) and strip chart recorder. The loaded column is washed with 200 ml extraction buffer, then wash buffer until UV-absorbance is back to zero again. Then the column is eluted with elution buffer and fractions collected with a fraction collector. The fractions are analyzed for protein content, for purity by SDS-PAGE (IS) and for activity. The solvent of the purified protein may be exchanged by dialysis or by gel fil tra tion. Proteins prepared wi th this protocol are suitable for direct immunization to generate antibodies. As a representative example the chromatography of DHFR-(His}6 in 6 M guanidine hydrochloride is shown in Figure 3. The efficiency of the different poly-His affinity tags is dependent on the solvent system used throughout the chromatography (12). The (His}6-tag is perfectly suited to chromatography in 6 M guanidine hydrochloride. But in physiological buffer systems, such as phosphate buffer without dissociating agents, the (His}6 -fusion proteins often bind too strongly to the NTANi(II) absorbent and elution of the product may be difficult. On the other hand the (His}2 tag does not bind in 6 M guanidine hydrochloride but works perfectly in physiological buffers. Therefore the (His}2 tag at the carboxy terminus may be the chelating peptide of choice for the purification of recombinant proteins produced in a soluble form. These proteins are not protected from proteolysis, and use of protease inhibitors in the extraction buffer may be necessary. Chromatography of a (His}2 Fusion Protein in a Physiological Buffer Materials
260 ml NTA-Ni{II) adsorbent packed chromatographic column (5 x 16 cm).
into
a
Extraction buffer:
0.1 M sodium phosphate/O.l M NaCl, pH 8, con ta ining O. 1% Tween-20 and 10 ~M PMSF.
Elution buffer:
0.1 M sodium acetate/O.l M NaCl, pH 5.0, containing 0.1% Tween-20.
94
E. HOCHULI
- ----
---
--
- " ' - '';
..
~-:---
_.- ,e -- -- _-
--
-;-. -:.:= .:.:::-:-: ..._- ---
-:---:.-:::~:::=--::.~-::::::-~-
.• . • • . - - -
1";" '::":':"';=:
-:-=:=--==~.:..
.=::-::-:
__ :---::.-----+tI-~-:-:-._-."-_::. ~_=== 45-
31- _
21 -
5
10
13
M
DeB
A
Figure 3. Chromatography of DHFR-(His)6 in 6 M guanidine hydrochloride. 26 ml crude extract obtained from 3 g biomass were purified on a 37 ml NTA-Ni(II) column (2.6 x 10 em). The column was developed wi th a pH step gradient. Collec ted fractions (35 ml) were analyzed by SDS-PAGE. M: standard molecular weight markers. A:!. ~ extract containing DHFR-(His)6' B: fractions 1-5, C: fractions 8-11, D: fraction 13. 30 g E. coli cells, containing a soluble fusion protein with two His a t t~arboxy terminus, are recovered from the broth medium by centrifugation (4,000 x g, 10 min, 4 0 C) , and broken open by sonication in 180 ml extraction buffer. A sonicator W375 from Ul trasonic Inc, New York, wi th a 0.5 inch probe or a similar apparatus is used for 15 min at OOC. After removal of the cell debris by centrifugation (10,000 x g, 30 min, 4°C), the
95
PURIFICATION OF PROTEINS WITH METAL CHELATE ADSORBENT
Table 2 Purification of DHFR-(His)2 on the NTA-Ni{II) column Activity (U)
Recovery (%)
Sp. Act. (U/mg)
7306
100
2.4
Column flow through
704
9
0.3
Eluted DHFR- (His) 2
6439
88
Crude ex trac t
9.0*
The DHFR activity was assayed by reduction of dihydrofolate with NADPH (12). One uni t (U) converts 1 Jlmole of dihydrofola te to tetrahydrofolate per minute. *DHFR purified on a Methotrexate-Sepharose affinity column had a specific activity of 10.3 U/mg. The DHFR-(His)2 had a purity of 90% •
supernatant is directly loaded with a peristaltic pump (flow rate 180 ml/hr) onto the NTA-Ni(II) column equilibrated with 1 liter extraction buffer. Column effluent is monitored with a UV monitor (280 nm) and strip chart recorder. The loaded column is washed with extraction buffer until UV-absorbance is back to zero again. The column is eluted with a 1 liter pH gradient from 8 to 5 (500 ml extraction buffer to 500 ml elution buffer) with the use of a gradient mixer. Fractions are collected with a fraction collector and analyzed for protein content, purity (by SDS-PAGE) and activity. The purification of DHFR-(His)2 with this protocol is summarized in Table 2. Cleavage of the His-tag with Carboxypeptidase A (CPA) CPA rapidly releases amino acids wi th an aroma tic or large al ipha tic s ide chain from the carboxy termini of polypeptide chains. This enzyme can therefore be used to cleave off the Histag at the carboxy terminus. The purified hybrid protein is dialyzed against 0.05 M Tris/HC1, pH 8. The protein, at a concentration of about 2 mg/ml, is then incubated at room temperature with bovine pancreatic CPA (1 mg CPA for 50 mg protein). The reaction is followed by measurement of released his tide. When the theoretical amount of amino acids has been removed the protein can be precipitated, such as with (NH4)2S04. When purified DHFR-(His)2 was treated with CPA, two equivalents of His and one equivalent of Ser were released (12). This result is in good agreement with the expected release of amino acids according to the carboxy terminal amino acid sequence
96
E. HOCHULI
····Ser-Arg-Ser-His-His of the fusion protein, since Arg is expected not to be digested with CPA. However, this method has limitations. The reaction with CPA only stops completely at the position of a basic amino acid. Therefore the procedure is only suited for the production of an authentic protein with a basic amino acid at the carboxy terminus. Other enzymatic and chemical methods to cleave off affinity tags have been described (3). All these methods have limitations. Present experience indicates that there is no general cleavage method available. The optimal procedure must be determined on a case-by-case basis, after analysis of the amino acid sequence of the protein of interest. REGENERATION OF THE NTA-Ni(II) COLUMN Materials
Rinse buffer:
0.2 M acetic acid/0.2 M NaCl containing O.l% Tween-20.
EDTA solution:
O. 1 M disodium te traaceta te.
Ni(II) solution: After every chromatography cycle the NTA-N1(II) column is washed with two column volumes (CV) of rinse buffer followed by two CV of water. Then the column is equilibrated with the appropriate extraction buffer. Afte·r about five chromatography cycles it is convenient to strip the nickel ions with 1 CV of EDTA solution. Then the column is washed subsequently with the following solutions: four CV of water, one CV of Ni(II) solution, two CV of water, two CV of rinse buffer and two CV of water. Then the column is equilibrated with the appropriate extraction buffer. CONCLUDING REMARKS We have shown that fusion proteins comprising a protein of interest and a poly-His peptide can be purified very easily on a NTA-Ni(II) adsorbent. Placement of 2 to 6 histidines at the carboxy as well as at the amino terminus has been investigated. The efficiency of different poly-His affinity tags depends on the buffer solutions used throughout the chromatography. The (His)6 tag at the carboxy or amino terminus of the protein of interest, in combination with a buffer containing 6 M guanidine hydrochloride, is appropriate for the purification of proteins which are formed in inclusion bodies. For proteins which are produced in a soluble form the (His)2 tag at the carboxy terminus is recommended together with a physiological buffer. Orienting
PURIFICATION OF PROTEINS WITH METAL CHELATE ADSORBENT
97
experiments have shown that the purification protocol is also compatible with reducing agents such as mercaptoethanol at concentrations up to 10 mM. Such buffers are usually prepared freshly every day. To split off the affinity tag from the protein of interest, a specific chemical or enzymatic cleavage site may be introduced at the junction (3). These methods are successful in several instances, but often have limitations by poor cleavage yields or by unwanted cleavage that occurs within the desired protein sequence. If the protein of interest already comprises the amino acid sequence of the cleavage site, the product will be degraded. We exploited carboxypeptidase A for the removal of the (His)2 tag a t the carboxy terminus. Thi s enzyme c·an be used f or the production of authentic proteins which comprise an amino acid with basic side chain at the carboxy terminus. From present experience it can be concluded that the optimal procedure for removal of the affinity tag must be determined on a case-by-case basis, after analysis of the amino acid sequence of the protein of interest. Several affinity protein-ligand systems have been developed for the purification of recombinant proteins. However the relatively large affinity proteins described might be a general disadvantage. Small affinity peptides can be more favorable. The observation tha t the (His) 2 tag at the carboxy terminus has only a small effect on the enzymatic activity of DHFR (see Table 2) indicates that the poly-His peptides have minimal effect on the structure of the protein of interest. For many applications the removal of the affinity tag might not be necessary. Poly-His fusion proteins are well suited for direct immunization to generate antibodies against the protein of in terest. Recombinant proteins expressed in bacteria often form inclusion bodies. A refolding step is necessary for the purification of active protein from inclusion bodies. Proteins formed in inclusion bodies can easily be dissolved in 6 M guanidine hydrochloride and then purified on the NTA-Ni(ll) column. In addition it is possible to do refolding experiments in situ in the column. In the adsorbed form the protein mol ;Cules-are separated in space and therefore the problem of protein aggregation during the refolding process is minimized. In conclusion we believe that the method described is an attractive addition to the range of modern purification procedures for heterologously-produced proteins. REFERENCES 1
Porath, J., Carlsson, J., Olsson, 1. and Belfrage, G. (1975) Nature (London) 258, 598-599.
98 2
E.HOCHUU
Hemdan, S.E., Zhao, Y., Sulkowski, E. and Porath, J. (1989) Proc. Nat. Acad. Sci. U.S.A. 86, 1811-1815. 3 Moks, T., Abrahmsen, L., OesterlSf, B., Josephson,S., Oestling, M., Enfors, 5.0., Persson, 1., Nilsson, B. and Uhlen, M. (1987) Bio/Technology 5, 379-382. 4 Nyg ren, P. -A., El iasson, M., Palmcran tz, E., Abrahmsen, L. and Uhlen, M. (1988) J. Mol. Recognition 1, 6-74. 5 Ullman, A. (1984) Gene 29, 27-31. 6 di Guan, C., Li, P., Riggs, P.D. and Inouye, H. (1988) Gene 67, 21-30. 7 Smith, D.B. and Johnson, K.S. (1988) Gene 67, 31-40. 8 Germinio, I. and Bastia, D. (1984) Proc. Nat. Acad. Sci. U.S. A. 81, 4692 -46 96. 9 Sassenfeld, H.M. and Brewer, S.J. (1984) Bio/Technology 2, 76 -80. 10 Smith, M.C., Furman, T.C., Ingolia, T.D. and Pidgeon, C. (1988) J. Bio1. Chem. 263, 7211-7215. 11 Hochuli, E., D8beli, H. and Schacher, A. (1987) J. Chromatogr. 411, 177-184. 12 Hochuli, E., Bannwarth, W., D8beli, H., Gentz, R. and StUber, D. (1988) Bio/Technology 6, 1321-1325. 13 Bujard, H., Gentz, R., Lanzer, M., StUber, D., MUller, M., Ibrahimi, I., Haeuptle, M.-T. and Dobberstein, B. (1987) Methods in Enzymology 155, 416-433. 14 Lanzer, M. and Bujard, .H. (1988) Proc. Nat. Acad. Sci. U.S.A. 85, 8973-8977. 15 Laemmli, U.K. (1970) Nature (London) 227, 680-685.
