protocol

Quadratic isothermal amplification for the detection of microRNA Ruixue Duan1,5, Xiaolei Zuo2,5, Shutao Wang3,5, Xiyun Quan4, Dongliang Chen4, Zhifei Chen1, Lei Jiang3, Chunhai Fan2 & Fan Xia1 1Key Laboratory for Large-Format Battery Materials and Systems, Ministry of

Education, School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology (HUST), Wuhan, China. 2Division of Physical Biology and Bioimaging Center, Shanghai Synchrotron Radiation Facility, Chinese Academy of Sciences (CAS) Key Laboratory of Interfacial Physics and Technology, Shanghai Institute of Applied Physics, CAS, Shanghai, China. 3Beijing National Laboratory for Molecular Sciences, Key Laboratory of Organic Solids, Institute of Chemistry, CAS, Beijing, China. 4Department of Pathology, Zhuzhou No. 1 Hospital, Hunan, China. 5These authors contributed equally to this work. Correspondence should be addressed to F.X. ([email protected]).

© 2014 Nature America, Inc. All rights reserved.

Published online 13 February 2014; doi:10.1038/nprot.2014.036

This protocol describes an isothermal amplification approach for ultrasensitive detection of specific microRNAs (miRNAs). It achieves this level of sensitivity through quadratic amplification of the target oligonucleotide by using a Bst DNA polymerase–induced strand-displacement reaction and a lambda exonuclease–aided recycling reaction. First, the target miRNA binds to a specifically designed molecular beacon, causing it to become a fluorescence emitter. A primer then binds to the activated beacon, and Bst polymerase initiates the synthesis of a double-stranded DNA segment templated on the molecular beacon. This causes the concomitant release of the target miRNA from the beacon—the first round of ‘recycling’. Second, the duplex beacon thus produced is a suitable substrate for a nicking enzyme present in solution. After the duplex beacon is nicked, the lambda exonuclease digests the beacon and releases the DNA single strand just synthesized, which is complementary to the molecular beacon, inducing the second round of recycling. The miRNA detection limit of this protocol is 10 fmol at 37 °C and 1 amol at 4 °C. This approach also affords high selectivity when applied to miRNA extracted from MCF-7 and PC3 cell lines and even from breast cancer tissue samples. Upon isolation of miRNA, the detection process can be completed in ~2 h.

INTRODUCTION miRNAs are a class of short regulatory RNAs involved in a variety of biological processes. Evidence from recent studies indicates that aberrant miRNA expression is highly correlated with the development of human cancers1. Although northern blotting technology and microarrays are the most widely used approaches for miRNA quantification, their use is limited by their low sensitivity and specificity2–4. In this context, real-time PCR has been attracting much attention because of its high sensitivity and ease of implementation5–7. However, refinements need to be applied to real-time PCR to enable researchers to detect short RNAs, and a thermal cycler is required for the amplification step. Recently, molecular beacon–assisted isothermal oligonucleotide amplification has emerged as a potentially suitable technique for the rapid and cost-effective detection of oligonucleotides8–25. However, the use of techniques such as nanoparticle-based amplifications 22,23 and rolling circle amplification 24,25 is limited by the multiple self-assembly steps required by the former and the complicated operational requirements of the latter. Techniques such as nicking endonuclease–enhanced signal amplification require special enzyme recognition sites in the target sequences12–14. Furthermore, although methods such as the L-assay15 and exonuclease III–assisted target recycling techniques16–18 have overcome the need for a target with a particular restriction site, they are not suitable for the detection of ultralow quantities of miRNA. Therefore, the demand remains high for protocols that advance the universality, sensitivity, speed and simplicity of miRNA detection. Hairpin-mediated quadratic enzymatic amplification The present protocol describes an ultrasensitive, one-pot miRNA detection process based on hairpin-mediated quadratic

enzymatic amplification (HQEA) 26. The detection system consists of a molecular beacon probe (Fig. 1), a polymerase, a nicking endonuclease and an exonuclease. The molecular beacon contains a fluorophore (the fluorescein dye FAM) located close to the 5′ terminus of the beacon and a quencher (4-([4-(Dimethylamino)phenyl]azo)benzoic acid succinimidyl ester; DABCYL) located at the 3′ terminus, so that the beacon can self-hybridize to form a stem-loop structure that holds the fluorophore and the quencher into close proximity, thus causing fluorescence to be quenched. Two phosphorothioate groups are present at the 5′ termini of the beacon and the primer, so that both oligonucleotides can resist nonspecific digestion by the exonuclease, thereby decreasing the intensity of background signals due to nonspecific fluorescence ‘unquenching’ caused by the digestion-triggered release of FAM from the self-hybridized beacon. Notably, however, the beacon also contains an endonuclease recognition site at its 5′ terminus. The linear recycling step of HQEA is induced by Bst polymerase (Fig. 2). Initially, the target miRNA hybridizes with the loop region of the molecular beacon, causing the beacon’s stem region to open and a fluorescence signal to be emitted. The Bst polymerase subsequently initiates the polymerase reaction, in which the target miRNA is displaced and a DNA duplex is synthesized by using the molecular beacon as a template. A new such cycle is initiated when the displaced miRNA binds to a second molecular beacon. As a result, the target miRNA is recycled and a new beacontemplated DNA duplex is synthesized at each new cycle. The mechanism just described does not, by itself, enable quadratic amplification. The beacon-templated DNA duplex produced during linear recycling includes, however, the recognition site of a nicking enzyme, which makes it a suitable substrate for the nature protocols | VOL.9 NO.3 | 2014 | 597

protocol

miR-21 Loop of probe 21

Stem of probe 21 Primer

FAM

© 2014 Nature America, Inc. All rights reserved.

3′

DABCYL Recognition site of nicking enzyme

Phosphorothioates 5′

relevant endonuclease. After the DNA duplex undergoes an endonuclease-induced nicking, the 5′ terminus of the beacon, which was labeled by a phosphorothioate, is separated from the beacon, thus exposing the recognition site of lambda exonuclease. Next, the exonuclease catalyzes the stepwise removal of mononucleotides from the 5′-hydroxyl termini of the duplex DNAs, leading to the release of the newly synthesized single-stranded DNA segment complementary to the beacon. This oligonucleotide, which, similarly to the miRNA, is perfectly matched to the beacon, binds to another beacon molecule that ‘activates’ it, i.e., causing a fluorescence signal to be emitted and forming a new nicking enzyme recognition site. With each digestion cycle, a new beacon-matching DNA single strand is generated, which can activate an additional molecular beacon. Thus, once polymerization has been initiated, the polymerase will regenerate the miRNA target in the first amplification cycle, and, in the second such cycle, the nicking enzyme and lambda exonuclease will produce multiple copies of a single-stranded DNA segment whose sequence is based Figure 2 | Overview of the HQEA strategy. Please refer to the supporting information of ref. 26 to understand the analysis of mechanism and equation (‘N’ represents the recycle number); 0.5 N2 + 0.5 N represents quadratic amplification (left + right), N represents the linear amplification (right), 1 represents no amplification. In the first recycle, the target miRNA binds to the loop of molecular beacon, causing the stem to open and a fluorescence signal to be emitted. The Bst DNA polymerase then triggers strand-displacement polymerization and catalyzes the formation of a duplex beacon. In the meantime, the miRNA displaced from the molecular beacon is free to initiate a new cycle. The newly synthesized duplex beacon can be recognized and nicked by the nicking enzyme, thus starting the second recycle. When the protected nucleotides, phosphorothioates, are removed from the molecular beacon by the nicking enzyme, lambda exonuclease has the opportunity to digest the beacon probe, releasing the single-strand DNA segment complementary to the molecular beacon. It is the regeneration of the target miRNA and of multiple copies of newly synthesized beacon-templated DNA that results in quadratic amplification. Figure modified with permission from ref. 26. 598 | VOL.9 NO.3 | 2014 | nature protocols

Figure 1 | Structure of the self-hybridized molecular beacon probe 21, in which are reported the matching nucleotides of miR-21 and probe 21’s primer. The stem of probe 21 is opened when miR-21 hybridizes with the loop of the molecular beacon. An engaging primer then anneals with the open stem of probe 21, allowing the polymerization induced by Bst DNA polymerase to initiate, producing a duplex beacon that is a suitable substrate for the nicking endonuclease. Figure modified with permission from ref. 26.

on that of the miRNA target. This sequence of events kick-starts a series of cyclic chain reactions in which multiple beacons are fluorescently activated, giving rise to a steep increase in detectable fluorescence. We regard this protocol as ‘smart’ because different detection limits and tunable dynamic ranges can be achieved by regulating the temperature and choosing different enzymes or enzyme combinations (Table 1). Moreover, the protocol is generally applicable, as it has been tested using different miRNAs and on culture cells, as well as patient sample tissue, always showing great selectivity26. This protocol promises to be suitable for research and diagnostic applications that demand tunable detection range and ultrasensitive detection of miRNA. Experimental design Primer design. The primer is designed to bind to the stem region of the molecular beacon. A length of 8–11 nt is generally reasonable. A longer primer may, in fact, bind too strongly to the stem region of the molecular beacon, rendering the beacon-primer structure too stable to open; however, shorter lengths may affect the ability of the primer to bind to the unwound beacon, thus preventing the polymerase reaction to initiate. The primer we recommend in the trial run of the present protocol is composed of 8 nt (Table 2). Beacon design. Rationally designing the sequence of the molecular beacon has a pivotal role in the successful detection of target miRNAs with high sensitivity and specificity. On the one hand, the target miRNA should cause the beacon probe to unwind, and on the other hand, in the absence of the target miRNA, the beacon probe should maintain its stem-loop structure and fluorescence should be quenched. The molecular beacon probe used in this protocol has 9 bp in its stem region and 22 nt in its loop region. Furthermore, as mentioned above, the 5′ terminus of the beacon should be labeled by two phosphorothioates, so as to inhibit the probe’s nonspecific digestion by lambda exonuclease. Finally, the

Cells from cancer patients

MicroRNA

Small RNA isolation

(0.5 N 2 + 0.5 N) >> (N) >> (1)

MicroRNA Polymerase Beacon Linear recycling

Quadratic recycling Exonuclease

Nicking enzyme

Primer

protocol Table 1 | Detection limit of HQEA and type of amplification on the basis of temperature and enzymes used.

© 2014 Nature America, Inc. All rights reserved.

Detection limit

Involved Temperature enzymes

a

1

2

3

4

5

b

1

2

3

4

5

Amplification

1 amol–10 fmol

4 °C

Bst, nicking, lambda

Quadratic

100 fmol–1 nmol

37 °C

Bst, nicking, lambda

Quadratic

1–10 nmol

37 °C

Bst

Linear

25–1,000 nmol

37 °C

—

—

recognition site of the nicking enzyme should be located in the tail of the molecular beacon, a single-strand section. We have, in fact, demonstrated that if the double-stranded DNA segment of the beacon stem contains a partial sequence of the recognition site the endonuclease enzyme may initiate nonspecific digestion (Fig. 3a; ref. 26). In Figure 3a, lane 2 contains the products of a reaction in which the miRNA target can unwind a poorly designed beacon, and the Bst polymerase can initiate the amplification reaction. The products of a reaction in which no interaction occurs between the molecular beacon and the lambda exonuclease are present in lane 5. However, the products of the reactions present in lanes 3 and 4 show that the three enzymes can also process the beacon in the absence of the miRNA target, triggered by non­ specific nicking of the molecular beacon by the endonuclease. In the case just described, we redesigned the beacon sequence and exposed all the bases recognized by the nicking enzyme (Fig. 3b). In Figure 3b, the products of an amplification reaction initiated by Bst polymerase are present in lane 2. The reaction products in lanes 3 and 4 indicate that the nonspecific reaction will not be Table 2 | Oligonucleotide sequences to be used in the trial run. Name

Sequence (5′–3′)

miR-21

UAGCUUAUCAGACUGAUGUUGA

SM miR-21

UAGCUUAUAAGACUGAUGUUGA

TM miR-21

UAGCUUAUAACCCUGAUGUUGA

miR-221-3p

AGCUACAUUGUCUGCUGGGUUUC

SM miR-221-3p

AGCUACAUUGUCUGCUGAGUUUC

TM miR-221-3p

AGCUAAAUCGUCUGCUGAGUUUC

miR-210

CUGUGCGUGUGACAGCGGCUGA

RandomRNA(RM)

AGUGCUCGACAUACCGAUGAUA

Probe 21

AAGCTGAGGT-(FAM)CTTGGACATCAACATCAGTCTG ATAAGCTATGTCCAAGA-(DABCYL)

Probe 221-3p

AAGCTGAGGT-(FAM)CTTGGACAGAAACCCAGCAGA CAATGTAGCTTGTCCAAGA-(DABCYL)

Primer

TCTTGGAC

Note: Underlined bases are phosphorothioates; SM, single-base-mismatched RNA; TM, triple-basemismatched RNA. The mismatched positions for miR-21 and miR-221 are marked in bold.

Figure 3 | Results from various experiments with different reaction components. (a) Nonspecific fluorescence is observed when a double-stranded segment of the molecular beacon stem contains a partial recognition sequence (underlined) of the nicking enzyme. Beacon probe: 5′-AAGCTGAGGAATCTATCAACATCAGTCTGATAAGCTATAGATTCCTC-3′; Primer: 5′-GAGGAATC-3′ (phosphorothioates are shown in bold; miR-21: 5′-UAGCUUAUCAGACUGAUGUUGA-3′. Lane 1, beacon  +  target; lane 2, beacon  +  target  +  Bst large-fragment DNA polymerase (the length of the duplex products is 47 bp); lane 3, beacon  +  target  +  Bst large-fragment DNA polymerase  +  Nb.BbvCI endonuclease  +  lambda exonuclease; lane 4, beacon  +  Bst large-fragment DNA polymerase  +  Nb.BbvCI endonuclease  +  lambda exonuclease; lane 5, beacon  +  lambda exonuclease. (b) Effects of different enzymes on the amplification reaction within 40 min. Primer and mir-21 sequences are the same as in a. Lane 1, reaction mixture without any enzyme; lane 2, reaction mixture containing only Bst large-fragment DNA polymerase; lane 3, reaction mixture containing only Nb.BbvCI endonuclease; lane 4, reaction mixture containing only lambda exonuclease; lane 5, reaction mixture containing Bst large-fragment DNA polymerase, NbBvC1 endonuclease and lambda exonuclease simultaneously (the length of the duplex products of lane 2 and lane 5 is 49 bp) Figure modified with permission from ref. 26.

triggered by either nicking enzyme or lambda exonuclease, respectively. These results show that the proposed protocol is initiated by the polymerase, and that further signal amplification obviously relies on the nicking endonuclease and lambda exonuclease. Given how vital the correct design of the molecular beacon is, do consider taking advantage of the design support offered by the DINAMelt Web Server (http://mfold.rit.albany.edu/?q=DINAMelt/ Quickfold). See also the TROUBLESHOOTING section. Protocol overview Here we provide detailed instructions on how to extract RNA from either tissue samples or cultured cells and, subsequently, on how to enrich the samples with short RNA species. We also provide directions on how to perform HQEA in the ‘classical’ way or via quantitative PCR (qPCR). In the final section of the PROCEDURE, we report the steps necessary to perform a gel electrophoresis experiment on the reaction products and thus confirm the presence of the target miRNA in the original mixture via the appearance of fluorescent oligonucleotides of the expected length. We advise readers to implement a trial run of the protocol by using the synthetic miRNAs, as well as the related molecular beacons and primers, reported in Table 2. This initial run will help researchers familiarize themselves with the protocol before using it to detect their actual miRNA targets. Please note that, given that this trial run uses a solution of synthetic miRNA as the target, experimenters will need to start the PROCEDURE at nature protocols | VOL.9 NO.3 | 2014 | 599

protocol Step 19 as opposed to Step 1. With regard to the oligonucleotides reported in Table 2, please note that we used miR-21 and miR-221 to illustrate the generality of our protocol, and we used singlebase-mismatched RNA (SM RNA), triple-base-mismatched RNA (TM RNA), miR-210 and a random RNA segment to investigate

the specificity of our strategy. Probe 21 is the molecular beacon that can hybridize with miR-21, and probe 221 is the molecular beacon that can hybridize with miR-221. Probe 21, miR-21, SM miR-21, and TM miR-21 primers can be used to implement the trial run of the protocol.

© 2014 Nature America, Inc. All rights reserved.

MATERIALS REAGENTS  CRITICAL Design the molecular probe and its relevant primer on the basis of the directions reported in the Experimental design and the known sequence of the target miRNA. Once these oligonucleotides have been designed, order them from a suitable supplier (for instance, TaKaRa Bio). • Bst DNA polymerase, large fragment (New England BioLabs, cat. no. M0275S; 8,000 U ml − 1)  CRITICAL Store it at –20 °C or on ice. • Nb.BbvCI nicking endonuclease (10,000 U ml − 1; New England BioLabs, cat. no. R0631S)  CRITICAL Store it at –20 °C or on ice. • Lambda exonuclease (New England BioLabs, cat. no. M0262S; 5,000 U ml − 1)  CRITICAL Store it at –20 °C or on ice. • NEB buffer 2 (10×; New England BioLabs, cat. no. B7002S; 500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2 and 10 mM DTT, pH 7.9) • dNTPs (TaKaRa Bio, cat. no. D4030RA) • mirVana miRNA isolation kit (Ambion, cat. no. AM 1560)  CRITICAL If kit no. AM 1561 is ordered, then acid-phenol:chloroform (cat. no. AM9720) should be purchased. • RNAlater solution (Ambion, cat. no. AM 7020) • DNA loading buffer (TaKaRa Bio, cat. no. 9156) • Diethylpyrocarbonate (DEPC)-treated water (TaKaRa Bio, cat. no. D602A) • BSA (TaKaRa Bio, cat. no. D2320)  CRITICAL Store it at –20 °C or on ice. • RNase inhibitor (TaKaRa Bio, cat. no. 2313A)  CRITICAL Store it at –20 °C or on ice. • Wash solution 1 (Reagent Setup) • Wash solution 2/3 (Reagent Setup) • DNase, RNase-free pipette tips (KirGen, cat. no. KG 1111; KG 1112; KG 1113) • FBS (Wisent, cat. no. 086-150) • DMEM, high glucose (Wisent, cat. no. 319-005-CL) • PBS (Wisent, cat. no. 311-010-CL) • Penicillin-streptomycin (Wisent, cat. no. 450-201-EL) • Trypsin (Wisent, cat. no. 325-043-EL) • Acrylamide 30% (wt/vol) (Sunshine Biotechnology, cat. no. SN319-1) • Ammonium persulfate (Sigma, cat. no. A 3678) • N,N,N′,N′-Tetramethylethylenediamine (TEMED; Sigma, cat. no. T9281) • Ethanol, anhydrous (100% ethanol; Sangon, cat. no. 64-17-5) • TBE buffer, 5× (Sangon) • SYBR Green 1 (Tiandz, cat. no. 3280) • Breast cancer and paired normal adjacent tissues (the pathology department of a reliable hospital)  CRITICAL Adhere to all ethical and safety regulations for working with human tissues. Obtain informed consent, where applicable, from human donors. • Cancer cell lines (official cell centers or reliable scientific cell laboratories) EQUIPMENT • Spectrophotometer (F-4500 fluorometer, Hitachi) (Excitation and emission wavelengths of 490 and 515 nm, respectively, with 5-nm bandwidths. The emission spectra are obtained by exciting the samples at 490 nm and scanning the emission from 500 to 600 nm.)

• Gel Logic 112 UV transilluminator • Vortexer (IKA, vortex 1) • CO2 incubator (Heal Force 151) • Electrophoresis power supply (Wealtec, ELITE 300) • Inverted microsope (BM-37XB) • ThermoMixer, Comfort (Eppendorf) • Microcentrifuge (Sigma, 1-14) • Autoclave (Sanshen) • Motorized rotor-sator homogenizer (Kimble chase, 749540-0000) • Microfluorometer cell (Beijing Junrui, cat. no. G-554) • Hemocytometer (Qingjing, cat. no. XB-K-25) REAGENT SETUP Wash solution 1  Add 21 ml of anhydrous ethanol to the bottle labeled ‘miRNA wash solution 1’ (included in the miRVana kit); mix it well and mark the empty box on the label to indicate that the ethanol has been added.  CRITICAL Store it at room temperature (25–30 °C) for up to 1 month. For longer-term storage, store it at 4 °C but warm it to room temperature before use. Wash solution 2/3  Add 40 ml of ACS-grade 100% ethanol to the bottle labeled ‘wash solution 2/3’ (provided by miRVana kit); mix it well and mark the empty box on the label to indicate that the ethanol has been added.  CRITICAL Store it at room temperature (25–30 °C) for up to 1 month. For longer-term storage, store it at 4 °C but warm it to room temperature before use. Molecular beacon  Prepare a 100 µM stock solution of the molecular beacon (probe 21 or 221-3p) in NEB buffer 2 and store it at –20 °C for about 6 months. Dilute the stock solution to 10 µM to prepare a working solution of the molecular beacon and store it at 4 °C for about 1 month. Right before it is needed for the protocol, incubate the working solution of molecular beacon at 65 °C for 10 min by using the Comfort ThermoMixer, and then turn off the instrument and slowly cool ( >1 h) the beacon probe to room temperature. See the troubleshooting section. miRNA from cancer cell lines or tissues  Extract miRNAs by using the mirVana miRNA isolation kit and RNAlater solution according to the manufacturer’s directions (see PROCEDURE). Precooled PBS for tissue perfusion  Place 10 ml of PBS in the refrigerator at  − 4 °C for at least 30 min. Please note that it is not necessary to precool the RNAlater solution (http://tools.lifetechnologies.com/content/sfs/ manuals/cms_056069.pdf). FBS in DMEM, 10% (vol/vol)  Place 50 ml of FBS in 500 ml of DMEM. This culture medium can be stored at  − 4 °C for about 1 month. miRNA solutions  Prepare a 100 µM stock solution of the oligonucleotide solutions (mir-21, SM miR-21, TM miR-21, miR-221-3p, SM miR-221-3p, TM miR-221-3p, Mir-210, random RNA or primer) in DEPC-treated water and store it at –80 °C for about 6 months. Primer solution  Prepare a 100 µM stock solution of the primer solutions and store it at –20 °C. The solution can be stored at –20 °C for about 1 month.

PROCEDURE  CRITICAL Steps 1–6 are performed according to the relevant directions in the manufacturer’s manual of the mirVana miRNA isolation kit (http://tools.lifetechnologies.com/content/sfs/manuals/fm_1560.pdf). miRNA extraction 1| Extract miRNA from biological samples according to option A for tissue samples, or according to option B for cultured cells. (A) miRNA extraction from tissues ● TIMING ~25 h ? TROUBLESHOOTING (i) Collect fresh samples of human breast cancer and paired normal adjacent tissues ( > 2 cm from cancer tissue); remove as much extraneous material as possible. For example, when you are collecting tissues, please advise the surgeon to 600 | VOL.9 NO.3 | 2014 | nature protocols

© 2014 Nature America, Inc. All rights reserved.

protocol remove adipose tissue from the heart and to remove the gall bladder from the liver. Please note that the normal (noncancerous) tissue samples are meant to be used as controls.  CRITICAL STEP For good yield of intact RNA, collect the tissue quickly. (ii) (Optional) If you think that the tissue samples contain an excessive amount of blood cells, such that they may affect the accuracy of the experiments (for example, a large amount of blood cells may unduly increase the apparent weight of tissues), perfuse the tissue with cold PBS. (iii) Quickly cut the tissue to ≤0.5 cm in at least one dimension for good penetration of the RNAlater solution. (iv) Place the fresh tissue in 5–10 volumes of RNAlater solution, and then store the resulting mixture at 4 °C for 24 h and then at  − 20 °C until further use.  PAUSE POINT Samples can be stored in RNAlater solution at –20 °C indefinitely. (v) Remove the tissue sample from the RNAlater solution and weigh it.  CRITICAL STEP miRNA from the collected tissue is unstable. To protect it from enzymatic degradation, the RNAlater solution should be added right away to the tissue sample, before the actual procedure (including the weighing of samples) is initiated. In addition, the RNAlater solution does not disrupt the structure of tissues, and thus tissue that has been equilibrated in RNAlater solution can be removed from the solution, sectioned into smaller pieces and returned to RNAlater solution, if desired. (vi) Place the tissue sample into a homogenization vessel on ice and, for every 0.1 g of tissue, add 1 ml of ‘lysis/binding buffer’ (provided in the miRVana kit). (vii) While keeping the sample cold, thoroughly disrupt the tissue in lysis/binding buffer by using a motorized rotor-stator homogenizer. Then proceed to Step 2, organic extraction. (B) miRNA extraction from cultured cells ● TIMING ~0.5 h (i) Trypsinize the cells to detach them: add 500 µl of trypsin-EDTA solution to the cultured cells and incubate them for about 2 min at 37 °C. (ii) Inactivate the trypsin by adding 10 ml of DMEM medium containing 10% (vol/vol) FBS and mix the solution for about 30 s at room temperature. Pellet the cells at 10,000g at room temperature for 3 min in a microcentrifuge, and then discard the supernatant. (iii) Wash the cells by gently resuspending them in ~1 ml of room-temperature PBS, and then count the cells with a hemocytometer. Next, pellet the cells at low speed (1,000g for 3 min) and at room temperature. Place the centrifuge tubes containing the cell pellets and supernatant PBS on ice and proceed within a few minutes with the next step. (iv) Remove the PBS and add 300–600 µl of lysis/binding solution for 100–107 cells. (v) Vortex the resulting mixture vigorously to completely lyse the cells and to obtain a homogeneous lysate. Next, proceed to Step 2, organic extraction. Organic extraction ● TIMING ~20 min 2| Add a one-tenth volume of ‘miRNA homogenate additive’ (included in the miRVana kit) to the homogeneous lysate from Step 1A(vii) or Step1B(v). Mix well by vortexing or by inverting the tube several times. Incubate the resulting mixture for 10 min on ice. 3| Add a volume of acid-phenol:chloroform that is equal to the lysate volume before the addition of the miRNA homogenate additive.  CRITICAL STEP Be sure to collect the heavier phase at the bottom of the separation funnel, as this is the organic, acid-phenol:chloroform phase. 4| Vortex the sample from Step 3 for 30–60 s to mix it. 5| Centrifuge the sample for 5 min at maximum speed (10,000g) at room temperature to separate the aqueous and organic phases. 6| Carefully remove the aqueous (upper) phase without disturbing the lower phase, and then transfer it to a fresh tube (supplied with the miRVana kit). Note the volume removed. Enrichment of small RNAs ● TIMING ~20 min 7| Preheat DEPC-treated water to 95 °C, making sure that the preheating does not last long enough for the entire amount of water to evaporate before it is used in Step 18.

nature protocols | VOL.9 NO.3 | 2014 | 601

protocol 8| Add a one-third volume of 100% ethanol to the sample from Step 6 and mix it thoroughly.  CRITICAL STEP The 100% ethanol must be at room temperature; otherwise, the efficiency of the extraction will be decreased. 9| Pass the aqueous sample from Step 8 through a filter cartridge (provided in the isolation kit) and collect the filtrate. 10| Place a filter cartridge into one of the collection tubes supplied in the miRVana kit. 11| Pipet the lysate/ethanol mixture from Step 9 onto the filter cartridge. 12| Centrifuge the cartridge for ~15 s at 10,000g at room temperature to force the mixture through the filter. 13| Collect the filtrate and measure its total volume.

© 2014 Nature America, Inc. All rights reserved.

14| Add a two-thirds volume of room temperature 100% ethanol and mix it thoroughly. 15| Pipet the mixture onto a second filter cartridge, and then centrifuge for ~15 s at 10,000g at room temperature to filter the mixture and discard the flow-through. 16| Add 700 µl of wash solution 1 to the filter cartridge and centrifuge it for 5–10 s at 10,000g at room temperature. Discard the flow-through from the collection tube and place the filter cartridge back in the original collection tube. 17| Wash the filter twice with two 500-µl aliquots of wash solution 2/3. After discarding the flow-through from the second wash, place the filter cartridge back in the original collection tube and centrifuge the assembly for 1 min at 12,000g at room temperature to remove residual fluid from the filter. 18| Transfer the filter cartridge into a fresh collection tube. Apply 100 µl of preheated (95 °C, see Step 7 above), nuclease-free water to the center of the filter and close the cap. Centrifuge the tube for 20–30 s at 12,000g at room temperature to recover the RNA. Collect the eluate, which contains the RNA, and store it at –20 °C or at a lower temperature.  PAUSE POINT The extracted miRNA can be stored at –20 °C for several weeks. Instrument setup ● TIMING ~10 min 19| Turn on the spectrophotometer and select the appropriate filters for fluorescence acquisition. In the present protocol, the excitation wavelength for the 6-FAM fluorophore on the molecular beacon is 490 nm and the fluorescence emission is monitored at 515 nm, respectively, with 5-nm bandwidths. ? TROUBLESHOOTING 20| Program the water bath to incubate the reaction at 37 °C. Sample preparation and analysis 21| Detect the presence of miRNA in the sample according to option A, which is the typical approach we implement in HQEA (Figs. 4–8), or according to option B. (A) miRNA detection by fluorescence spectrophotometry ● TIMING ~2 h (i) For each miRNA-containing sample, prepare a 50-µl reaction mixture as described in the following table. Reagents DEPC-treated water

Volume (l) 27.5

Initial concentration —

NEB buffer 2, 10×

5

As provided by manufacturer

dNTPs

2

10 mM

Beacon

2.5

10 µM

RNase inhibitor

0.5

20 U

BSA

0.5

10 µg µl − 1

602 | VOL.9 NO.3 | 2014 | nature protocols

protocol

© 2014 Nature America, Inc. All rights reserved.

Bst DNA polymerase

2

16 U

Nb.BbvCI nicking endonuclease

1.5

15 U

Lambda exonuclease

2.5

12.5 U

Primer

2

100 µM

Target miRNA solution from Step 18 (or prepared from purchased oligonucleotides)

5

Variable

 CRITICAL STEP Add the reagents in the order they are reported in the table. If the reagents are not added in the specified order, the background noise will increase. ? TROUBLESHOOTING (ii) Initiate the reaction by incubating the mixture in the ThermoMixer at 37 °C for 2 h. ? TROUBLESHOOTING (iii) Dilute the reaction mixture to a total volume of 250 µl with DEPC-treated water, and then detect the fluorescence it emanates by using a microfluorometer cell (350 µl). (B) Detection by qPCR ● TIMING ~50 min (i) HQEA can also be implemented by performing qPCR in a volume of 10 µl by preparing the reaction mixture described in the following table. In this case, perform HQEA at 37 °C and monitor the reaction fluorescence intensity at intervals of 30 s. Reagents

Volume (l)

Initial concentration

DEPC-treated water

5

—

NEB buffer 2, 10×

1

—

dNTPs

0.4

10 mM

Beacon

0.5

10 mM

RNase inhibitor

0.1

4U

BSA

0.1

2 µg µl − 1

Bst DNA polymerase

0.4

3.2 U

Nb.BbvCI nicking endonuclease

0.3

3U

Lambda exonuclease

0.8

4U

Primer

0.4

100 µM

1

Variable

Target miRNA solution from Step 18 (or prepared from purchased oligonucleotides)

Gel electrophoresis ● TIMING ~2 h 22| Store the reaction product at –20 °C or analyze it immediately (Step 23).  PAUSE POINT The reaction product can be stored at –20 °C for several days, but our suggestion is to analyze it as soon as possible. 23| Prepare a 10% (wt/vol) polyacrylamide gel. The quantities of the components are as follows: 5.5 ml of DEPC-treated water, 3.3 ml of 30% (wt/vol) acrylamide, 2 ml of 5× TBE, 0.11 ml of ammonium persulfate and 0.01 ml of TEMED. 24| Mix 10 µl of the reaction product with 2 µl of the DNA loading buffer and 2 µl of SYBR Green 1. 25| Load the solution prepared in Step 24 onto the gel. 26| Run the gel in 1× TBE buffer at 100 V for 120 min (1× TBE buffer is prepared from the 5× TBE buffer).

nature protocols | VOL.9 NO.3 | 2014 | 603

protocol 27| Illuminate the gel with a Gel Logic 112 UV transilluminator and then photograph the gel. To interpret the results of this experiment, please see the discussion in Experimental design and the photographs reported in Figure 3. ? TROUBLESHOOTING Troubleshooting advice can be found in Table 3.

© 2014 Nature America, Inc. All rights reserved.

Table 3 | Troubleshooting table. Step

Problem

Possible reason

Solution

1A

Weak fluorescence signals

miRNA may be degraded if tissues are not disrupted rapidly and thoroughly

Disrupt the tissues thoroughly

19

Opening the slit widths will allow more light through the detector. Increasing the photomultiplier tube voltage will also enhance the fluorescence signals’ intensity. However, implementing both strategies can increase the background signal so much that a weak signal may remain so even after subtracting the background

Adjust the voltage and slit band of the fluorescence spectrophotometer

21A(i)

If the concentrations of enzymes, molecular beacons or primers are too low, the amplification may not be initiated

Adjust the concentrations of each reaction component

21A(ii)

In the present strategy, the reaction efficiency of the first recycle is lower compared with the second recycle. Extending the reaction time can ensure that the fluorescence signal is released more efficiently

Extend the reaction time

A misfolded molecular beacon can also fluoresce

Incubate the beacon at 65 °C for 10 min, and then slowly cool it to room temperature

INTRODUCTION (‘Beacon design’)

The design of the molecular beacon and its primer is such that either the target miRNA does not unwind the beacon or the latter loses its stem-loop structure (and becomes fluorescent) in the absence of the target miRNA

Carefully design the molecular beacon, and double-check the design of the beacon and primer to confirm their compatibility

21A(ii)

If the reaction has progressed too long, nonspecific fluorescence signals will be detected and increase in intensity

Do not allow the reaction to progress too long. Two hours at 37 °C will be appropriate

Reagent Setup

Nonspecific fluorescent signals

● TIMING Step 1A, miRNA extraction from tissues: ~25 h Step 1B, miRNA extraction from cultured cells: ~0.5 h Steps 2–6, organic extraction: ~20 min Steps 7–18, enrichment of small RNAs: ~20 min Steps 19 and 20, instrument setup: ~10 min Step 21A, miRNA detection by fluorescence spectrophotometry: ~2 h Step 21B, detection by qPCR: ~50 min Steps 22–27, gel electrophoresis: ~2 h ANTICIPATED RESULTS HQEA achieves quadratic amplification for the ultrasensitive detection of miRNAs in only one step. The present protocol was used to detect synthetic miR-21 with a detection limit of 10 fmol at 37 °C and 1 amol at 4 °C (Fig. 4; ref. 26). We also demonstrated that it can also be used to analyze small amounts of miRNA from cancer cell lines (Fig. 5). For example, we

604 | VOL.9 NO.3 | 2014 | nature protocols

protocol a

b

1.0

1.05

0.75

0.8

0.60

0

0

60

0

50

0

40

0

30

20

0

10

Number of MCF-7 cells

Figure 4 | Sensitivity of the HQEA approach at different reaction temperatures. (a) Fluorescence intensity detected in the presence of a control and of various concentrations of miR-21 after a reaction time of 2 h at 37 °C. The concentration of probe 21 is 500 nM. (b) Fluorescence intensity detected in the presence of a control and of various concentrations of miR-21 after a reaction time of 50 h at 4 °C. The concentration of probe 21 is 500 nM. The detection limit is 10 fmol at 37 °C and 1 amol at 4 °C. Figure modified with permission from ref. 26. a.u., arbitrary units.

0

1, 0 00 1, 0 20 1, 0 40 1, 0 60 0

0

80

0

60

40

0

20

10

miR-21 concentration

0

fM

fM

aM

1

1

C on

C on

0.90

0.9

0.7

0

0.4

aM

0.4

10

0.6

aM

0.6

10

0.8

tro l

0.8

Intensity (a.u.)

1.0

miR-21 concentration

Number of PC3 cells

Figure 5 | Sensitivity performance of HQEA in the detection of miRNA extracts from cancer cell lines. (a,b) Sensitivity investigation for HQEA applied to the detection of miRNA extracted from the MCF-7 cell line (0, 3, 15, 30, 150, 300 and 1,500 cells) (a) and from the PC3 cell line (0, 6, 30, 60, 300 and 600 cells) (b). Concentration of the probe 21 is 500 nM, and the reaction time is 2 h. Error bars show s.d., calculated from three independent experiments. Figure modified with permission from ref. 26.

isolated miR-21 from 2 × 105, 3 × 106 and 1.43 × 106 MCF-7 cancer cells according to the directions for the mirVana miRNA isolation kit, and we ultimately obtained extract solutions of 80, 90 and 90 µl, respectively. We then gradually diluted the extract solutions to produce samples of single-cell concentration26. Finally, we have demonstrated that the miRNA from as few as three MCF-7 cells can be detected26. HQEA will proceed with specificity as long as a functional molecular probe has been designed rationally. Figure 6 shows that HQEA enables researchers to discriminate single-nucleotide polymorphisms present in miR-21 and miR-221. Moreover, this protocol can potentially be used to analyze the expression pattern of miRNAs in different cancer cell lines (Fig. 7). The control experiments to demonstrate the specificity and accuracy of the protocol are summarized in Table 4. This protocol holds great promise in the diagnosis of cancer with great selectivity. Figure 8 shows how fluorescence signals from cancerous tissue samples (Fig. 8b) can be distinguished easily from those from normal tissue samples (Fig. 8a) by using this technique. It also demonstrates that this technique gives experimenters the ability to discriminate cancerous from normal tissue samples (Fig. 8c).

b 1.2

1.0

0.8 0.6

1 22

22

iR m

PM

SM

m

iR

iR

22

1

1

0 21 iR

m TM

m

iR

21

l tro on C

21

iR

m

iR m

SM

PM

1 m

iR

22

21 iR

iR

TM

l tro on

0.6

3

PC

C2 C1

e ob Pr 221

Figure 6 | Specificity of probes 21 and 221 for the detection of target miRNAs with or without mismatching bases. (a) Fluorescence intensity of HQEA reaction mixtures containing probe 21 and 10 nM single-basemismatched miR-21 (SM), 10 nM three-base-mismatched miR-21 (TM), 10 nM perfectly matched miR-21 (PM), 10 nM miR-210 and 10 nM miR-221. The reaction time is 45 min. (b) Fluorescence intensity of HQEA reaction mixtures containing probe 221 and 10 nM single-base-mismatched miR-221 (SM), 10 nM three-base-mismatched miR-221 (TM), 10 nM perfectly matched miR-221 (PM), 10 nM miR-210 and 10 nM miR-21. The reaction time is 45 min. Error bars show s.d., calculated from three independent experiments. Figure modified with permission from ref. 26.

F-7

MC

e ob Pr 21

m

0.8

m

0.2

21

0.2

21

0.4

0

0.4

Intensity (a.u.)

0.6

C

1.0

1.0

0.8

m

a Intensity (a.u.)

© 2014 Nature America, Inc. All rights reserved.

b

1.0

tro 10 l 10 fM 0 fM 1 pM 10 10 pM 0 pM 1 n 10 M n 10 M 0 nM

Intensity (a.u.)

a

Figure 7 | Specificity of probe 21 and probe 221 for different cell types. Probe 21 is the molecular beacon that can bind to miR-21, and probe 221 is the molecular beacon that can bind to miR-221. The reaction time is 45 min. Data in C1 are from a reaction mixture that contains no target miRNA; data in C2 are from a control sample containing miR-21 or miR-221 digested by RNase. These results show that mir-21 is mainly expressed in MCF-7 cells, whereas mir-221 is mainly expressed in PC3 cells. Figure modified with permission from ref. 26.

nature protocols | VOL.9 NO.3 | 2014 | 605

protocol Table 4 | Control experiments used in this strategy. Control experiment

Purpose

Results

Bst + T

To investigate whether the beacon design is reasonable

Duplex products

Illustration Fig. 3b

Lambda + T

To investigate whether the beacon design is reasonable

No Duplex products

Fig. 3b

Bst + lambda + nick

To investigate whether the beacon design is reasonable

No Duplex products

Fig. 3b

Bst + lambda + nick + T

To investigate whether the beacon design is reasonable

Duplex products

Fig. 3b

Other miRNA

To investigate the specificity of the strategy

No fluorescence

Fig. 6

Different cell lines

To investigate the specificity of the strategy

No or low fluorescence

Fig. 7

Base-mismatched T

To investigate the specificity of the strategy

No or low fluorescence

Fig. 6

Sample digested by RNase

To investigate the specificity of the strategy

No or low fluorescence

Fig. 7

Acknowledgments This research was supported by initiatory financial support from HUST, the National Basic Research Program of China (2013CB933000), the 100 Talents Program from the CAS, the Shanghai Pujiang Project (grant no. 13PJ1410700 to X. Z.), the 1,000 Young Talents program (to F. X.) and the National Natural Science Foundation (21375042). AUTHOR CONTRIBUTIONS R.D., F.X., X.Z., L.J., S.W., Z.C., C.F., X.Q. and D.C. conceived the projects, designed and conducted experiments, analyzed the data and wrote the manuscript. R.D., X.Z. and S.W. contributed equally to this work. COMPETING FINANCIAL INTERESTS The authors declare no competing financial interests. Reprints and permissions information is available online at http://www.nature. com/reprints/index.html. 1. He, L. & Hannon, G.J. MicroRNAs: small RNAs with a big role in gene regulation. Nat. Rev. Genet. 5, 522–531 (2004). 2. Válóczi, A. et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).

606 | VOL.9 NO.3 | 2014 | nature protocols

:1

C

on

tro

r4 ce

ce

an C

an C

ce an

r1

Cancer 2

C

ce

C

C

on

tro

4

3

al m or

N

N

or

m

al m or

N

al

2

1

l

al

tro

or N

on

m

Cancer 1

1

0.4

5:

0.4

0.4

10

0.6

1

0.6

1

0.6

1:

0.8

0:

0.8

l

0.8

r3

1.0

r2

c

1.0

l

b 1.0

an

a Intensity (a.u.)

Figure 8 | Selectivity and accuracy of the HQEA approach for the detection of miRNA extracted from human tissues. (a) Fluorescence intensities after miRNA extraction from four normal (noncancerous) tissue samples. (b) Fluorescence intensities after miRNA extraction from four breast cancer tissue samples. Images taken at ×100 magnification (lower half of the figure) are breast cancer tissues (stained with hematoxylin and eosin); cancer 1: invasive ductal carcinoma of the breast, cancer 2: invasive ductal carcinoma of the breast, cancer 3: invasive ductal carcinoma of the breast, cancer 4: intraductal carcinoma of the breast. (c) Fluorescence intensities of mixtures of miRNA solutions extracted from normal tissue samples and cancer tissue samples; the concentration ratios are 0:1, 1:1, 5:1 and 10:1, respectively. All images were taken at ×100 magnification. Error bars in a–c show s.d., calculated from three independent experiments. Figure modified with permission from ref. 26.

C

© 2014 Nature America, Inc. All rights reserved.

T, target; Bst, Bst polymerase; nick, Nb.BbvCI nicking endonuclease; lambda, lambda exonuclease.

Cancer 3

Cancer 4

3. Lee, J., Cho, H. & Jung, Y. Fabrication of a structure-specific RNA binder for array detection of label-free microRNA. Angew. Chem. Int. Ed. 49, 8662–8665 (2010). 4. Lee, I. et al. Discriminating single-base difference miRNA expressions using microarray Probe Design Guru (ProDeG). Nucleic Acids Res. 36, e27 (2008). 5. Chen, C. et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005). 6. Li, J. et al. Real-time polymerase chain reaction microRNA detection based on enzymatic stem-loop probes ligation. Anal. Chem. 81, 5446–5451 (2009). 7. Jia, H., Li, Z., Liu, C. & Cheng, Y. Ultrasensitive detection of microRNAs by exponential isothermal amplification. Angew. Chem. Int. Ed. 49, 5498–5501 (2010). 8. Song, S. et al. Gold-nanoparticle-based multicolor nanobeacons for sequence-specific DNA analysis. Angew. Chem. Int. Ed. 48, 1–5 (2009). 9. Wang, K.M. et al. Molecular engineering of DNA: molecular beacons. Angew. Chem. Int. Ed. 948, 856–870 (2009). 10. Wei, F. et al. Electrochemical detection of low-copy-number salivary RNA based on specific signal amplification with a hairpin probe. Nucleic Acids Res. 36, e65 (2008).

© 2014 Nature America, Inc. All rights reserved.

protocol 11. Zhang, X., Wang, Z., Xing, H., Xiang, Y. & Lu, Y. Catalytic and molecular beacons for amplied detection of metal ions and organic molecules with high sensitivity. Anal. Chem. 82, 5005–5011 (2010). 12. Li, J., Chu, Y., Lee, B.Y.H. & Xie, X.S. Enzymatic signal amplification of molecular beacons for sensitive DNA detection. Nucleic Acids Res. 36, e36 (2008). 13. Kiesling, T. et al. Sequence-specific detection of DNA using nicking endonuclease signal amplification (NESA). Nucleic Acids Res. 35, e117 (2007). 14. Van Ness, J., Van Ness, L.K. & Galas, D.J. Isothermal reactions for the amplification of oligonucleotides. Proc. Natl. Acad. Sci. USA 100, 4504–4509 (2003). 15. Hosoda, K. et al. A novel sequence-specific RNA quantification method using nicking endonuclease, dual-labeled fluorescent DNA probe, and conformation-interchangeable oligo-DNA. RNA 14, 584–592 (2008). 16. Zuo, X., Xia, F., Xiao, Y. & Plaxco, K.W. Sensitive and selective amplified fluorescence DNA detection based on exonuclease III-aided target recycling. J. Am. Chem. Soc. 132, 1816–1818 (2010). 17. Freeman, R., Liu, X. & Willner, I. Amplified multiplexed analysis of DNA by the exonuclease III-catalyzed regeneration of the target DNA in the presence of functionalized semiconductor quantum dots. Nano Lett. 11, 4456–4461 (2011). 18. Zuo, X., et al. Two-step, PCR-free telomerase detection using exonuclease III–aided target recycling. Chembiochem. 12, 2745–2747 (2011).

19. Connolly, A.R. & Trau, M. Isothermal detection of DNA by beacon-assisted detection amplification. Angew. Chem. Int. Ed. 49, 2720–2723 (2010). 20. Guo, Q. et al. Sensitive fluorescence detection of nucleic acids based on isothermal circular strand-displacement polymerization reaction. Nucleic Acids Res. 37, e20 (2009). 21. Connolly, A.R. & Trau, M. Rapid DNA detection by beacon-assisted detection amplification. Nat. Protoc. 6, 772–778 (2011). 22. Fang, S., Lee, H.J., Wark, A.W. & Corn, R.M. Attomole microarray detection of microRNAs by nanoparticle-amplified SPR imaging measurements of Surface polyadenylation reactions. J. Am. Chem. Soc. 128, 14044–14046 (2006). 23. Li, J., Schachermeyer, S., Wang, Y., Yin, Y. & Zhong, W. Detection of microRNA by fluorescence amplification based on cation-exchange in nanocrystals. Anal. Chem. 81, 9723–9729 (2009). 24. Zhou, Y. et al. A dumbbell probe-mediated rolling-circle amplification strategy for highly sensitive microRNA detection. Nucleic Acids Res. 38, e156 (2010). 25. Cheng, Y. et al. Highly sensitive determination of microRNA using target-primed and branched rolling-circle amplification. Angew. Chem. Int. Ed. 121, 3318–3322 (2009). 26. Duan, R. et al. Lab in a tube: ultrasensitive detection of microRNAs at the single-cell level and in breast cancer patients using quadratic isothermal amplification. J. Am. Chem. Soc. 135, 4604–4607 (2013).

nature protocols | VOL.9 NO.3 | 2014 | 607