355
ARTICLE Quorum-sensing gene luxS regulates flagella expression and Shiga-like toxin production in F18ab Escherichia coli
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by San Diego (UCSD) on 06/07/15 For personal use only.
Yang Yang, Mingxu Zhou, Huayan Hou, Jun Zhu, Fenghua Yao, Xinjun Zhang, Xiaofang Zhu, Philip R. Hardwidge, and Guoqiang Zhu
Abstract: To investigate the effect of the luxS gene on the expression of virulence factors in Shiga-like toxin producing and verotoxin-producing Escherichia coli, the luxS gene from E. coli 107/86 (wild type, O139:H1:F18ab, Stx2e) was deleted. The successful deletion of luxS was confirmed by bioluminescence assays. The luxS deletion mutant exhibited changed flagella-related phenotypes, like impaired expression of flagella, decreased flagella motility, reduced biofilm formation, and reduced ability to induce pro-immunity response in host cells, which were restored after complementation with the intact luxS gene. The mutant strain also displayed attenuated production of Stx2e. This study provides new information to the crucial function of luxS in regulating Shiga-like toxin producing E. coli virulence. Key words: Escherichia coli, luxS, quorum sensing, flagella. Résumé : Afin d’examiner l’importance du gène luxS dans l’expression de facteurs de virulence chez des Escherichia coli producteurs de toxine de type Shiga et de vérotoxine (STEC et VTEC), on a délété le gène luxS d’E. coli 107/86 (type sauvage, O139:H1:F18ab, Stx2e). La délétion de luxS a été confirmée par des analyses de bioluminescence. Le mutant délétionnel luxS a présenté des phénotypes flagellaires altérés, dont une expression déficience du flagelle, une mobilité flagellaire moindre, une formation de biofilm amenuisée et une capacité réduite d’induction de la réponse pro-immunitaire chez les cellules hôtes. Le tout a été rétabli a` la suite d’une complémentation avec le gène luxS intact. La souche mutante se caractérisait également par une diminution de la production de Stx2e. La présente étude fournit de nouvelles informations quant a` la fonction cruciale de luxS dans la régulation de la virulence du STEC. [Traduit par la Rédaction] Mots-clés : Escherichia coli, luxS, détection du quorum, flagelles.
Introduction Both porcine edema disease and post-weaning diarrhea caused by Shiga-like toxigenic (STEC) or verotoxigenic Escherichia coli result in important morbidity and mortality (Fairbrother et al. 2005; Nagy and Fekete 2005). As a result, the pig industry has suffered huge economic losses (Imberechts et al. 1996). Infections with STEC F18ab+ strains, which produce Shiga toxin 2e (Stx2e), strongly correlate with edema disease (Imberechts et al. 1994). The quorum-sensing (QS) system is a bacterial communication system that controls the expression of multiple genes in response to bacterial population density. Small chemical signal molecules called autoinducers (AIs) are produced, released, and detected in the QS process. Gram-positive and Gram-negative bacteria share the QS-II system, which regulates the expression of multiple genes through AI-2 (Boyen et al. 2009). AI-2, first discovered in Vibrio harveyi, has recently been suggested to represent a kind of new type of language used by both Gram-negative and Gram-positive bacteria. Although LuxS is an important integral component in the activated methyl cycle pathway, its function as AI-2 synthase was also identified widely among bacteria (De Keersmaecker et al. 2006). LuxS, with the Pfs protein (5=-methylthioadenosine/ S-adenosylhomocysteine nucleosidase) is involved in AI-2 biosynthesis derived from S-adenosylmethionine (Sperandio et al. 2001). AI-2 can be detected by its ability to induce luminescence in
the AI-2 reporter strain V. harveyi BB170. In many pathogenic bacteria, AI-2 plays an important role in regulating bacterial virulence strategies, including type III secretion systems, pathogenicity, and biofilm formation (Walters and Sperandio 2006). Previous studies demonstrated that the QS-II system is essential for the expression of type III-secreted proteins and other pathogenicity factors in enterohaemorrhagic E. coli, enteropathogenic E. coli, and rabbit enteropathogenic E. coli (Zhu et al. 2007). Meanwhile, flagella regulation of QS-II was also exhibited (Sperandio et al. 2002; Clarke et al. 2006; Gonzalez et al. 2006). Flagella have been reported to be an important virulence factor in E. coli and have crucial functions in pathogenesis (Duan et al. 2012a, 2013), such as providing bacterial motility and, in some cases, contributing to bacterial colonization of host cells (Arora et al. 1998; Giron et al. 2002) and to penetration of the mucosal layer (Dons et al. 2004; Parthasarathy et al. 2007). It has also been proposed that flagella allow enteric bacteria to exploit inflammation to compete with intestinal microbiota in vivo (Stecher et al. 2004, 2008; Duan et al. 2012a). However, a conflict existed in the regulation process between luxS and flagella. Some researchers have pointed out that the luxS mutant represses flagella expression in O157:H7 (Sperandio et al. 2002; Kim et al. 2010), but in a study by Ling et al. (2010), increased flagella expression was displayed in the absence of luxS in E. coli K12. To investigate this conflict further, Haigh et al. (2013) constructed mutants in different strains
Received 9 March 2014. Revision received 6 April 2014. Accepted 16 April 2014. Y. Yang, M. Zhou, H. Hou, J. Zhu, F. Yao, X. Zhang, and G. Zhu. College of Veterinary Medicine, Yangzhou University, Yangzhou 225009, People’s Republic of China; Jiangsu Co-Innovation Center for Important Animal Infectious Diseases and Zoonoses, Yangzhou 225009, People’s Republic of China. X. Zhu. Department of Dermatology of Clinical Medical School, Yangzhou University, Yangzhou 225009, People’s Republic of China. P.R. Hardwidge. College of Veterinary Medicine, Kansas State University, Manhattan, KS 66506, USA. Corresponding author: Guoqiang Zhu (e-mail: [email protected] and [email protected]). Can. J. Microbiol. 60: 355–361 (2014) dx.doi.org/10.1139/cjm-2014-0178
Published at www.nrcresearchpress.com/cjm on 17 April 2014.
356
with various mutant strategies, and they concluded that the contradiction was caused by the diversity of host strain backgrounds and polar-mutate strategies. In infection, besides flagella, Stx2e is another important virulence factor; it is released into the gut lumen, disrupts intestinal mucosa function, and finally causes edema disease (Frydendahl 2002; Mainil et al. 2002). To further explore the role of luxS in the pathogenicity of STEC 107/86, in the present study, we constructed a luxS-deletion mutation in wildtype (WT) E. coli 107/86 and determined the possible role of luxS in pathogenicity.
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by San Diego (UCSD) on 06/07/15 For personal use only.
Materials and methods Bacterial strain and growth conditions Escherichia coli 107/86 (WT, O139:H1:F18ab, Stx2e) (Bertschinger et al. 1990) was routinely cultured in Luria broth or on Luria agar plates at 37 °C. Vibrio harveyi strains BB120 and BB170 were kindly provided by Yongjie Liu (Nanjing Agricultural University). Vibrio harveyi BB120 culture supernatant was used as a positive control. Vibrio harveyi BB170 was used for the bioassay to detect AI-2. Both V. harveyi strains were cultivated in modified autoinducer bioassay medium (Han and Lu 2009). Porcine neonatal jejunal epithelial cell line IPEC-J2 cells were cultured in media containing RPMI 1640-F12 (1:1) (Gibco) supplemented with 10% newborn calf serum (Gibco) and maintained at 37 °C and 5% CO2. Human colorectal adenocarcinoma epithelial cells (Caco-2) were cultivated in Dulbecco’s minimal Eagle medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Gibco) at 37 °C and 5% CO2. All other reagents and chemicals were purchased from Sigma (USA). Construction of F18ab⌬luxS and F18ab⌬luxS/pluxS The F18ab⌬luxS was constructed using Red-based recombination system with the ⌬LuxS-1, ⌬LuxS-2 primers and plasmids pKD3, pKD46, and pCP20 (Datsenko and Wanner 2000). The final deletion of luxS was confirmed by DNA sequencing. LuxS-1 and LuxS-2 primers (Table 1) were used to generate complement plasmid pBR-luxS, which was transformed into F18ab⌬luxS, to restore AI-2 producing ability in mutant strain. The mutant strain F18ab⌬luxS and complementary strain F18ab⌬luxS/pluxS were used in the future work. Bioluminescence detection in AI-2 bioassay Cell-free culture supernatants were prepared from F18ab WT, F18ab⌬luxS, F18ab⌬luxS/pluxS, positive control BB120, and negative control DH5␣ as described by Han and Lu (2009). Luminescence values were measured with a Tecan GENios Plus microplate reader in luminescence mode (TECAN GmbH, Austria). Motility assay As described previously, strains were seeded in the middle of motility plates (Sperandio et al. 2002). The motility halos were measured to evaluate motility in each strain. Bacterial adherence assays The adherence of F18ab WT to IPEC-J2 cells was determined using a quantitative adhesion assay (Scaletsky et al. 1984; Duan et al. 2013). After Triton X-110 treatment, the number of bacteria adhered to IPEC-J2 cells was enumerated. Bacterial invasion assays The cell monolayer was co-incubated with 107 CFU bacteria for 2 h, gently washed 3 times with phosphate-buffered saline (PBS), and supplemented with a 140 mg/mL concentration of gentamicin in the medium for an additional 2 h to kill extracellular bacteria. After Triton X-110 treatment, the number of bacteria that invaded IPEC-J2 cells was enumerated (Duan et al. 2012b, 2013).
Can. J. Microbiol. Vol. 60, 2014
Table 1. Primer used in this study. Primer name
Sequence (5=–3=) description
LuxS-1 LuxS-2 ⌬LuxS-1
5=-ATGCCGTTGTTAGATAGCTTCAC-3= 5=-CTAGATGTGCAGTTCCTGCAACT-3= 5=-TGCAGTTCGGGTGGCGAAAACAATGA ACACCCCGCATGGCGACGCAATCATG TGTAGGCTGGAGCTGCTTCG-3= 5=-TCTGATTCTGATCCTGCACTTTCAGCA CGTCTTCCATTGCCGCTTTCCCATATG AATATCCTCCTTAG-3= 5=-CGTTAAAGGCGCTAACTTCG-3= 5=-ACGGTGGTCATCAGACCTTC-3= 5=-CAGCAAGCGGTGAAGTGAA-3= 5=-AAGCGTAGCCACAGTAGCA-3= 5=-TGCAGCTCTGTGTGAAGGTG-3= 5=-ACTTCTCCACAACCCTCTGC-3= 5=-CCACGCTTTCTAGCTGTTGA-3= 5=-CTCCGAGACACTGGAAGGTG-3= 5=-CCCAGGGACCTCTCTCTAATC-3= 5=-TGAGGTACAGGCCCTCTGAT-3= 5=-GATGGGCGTGAACCATGAG-3= 5=-GAGGCATTGCTGACGATCTTG-3=
⌬LuxS-2
gapA-F gapA-R fliC-F fliC-R il8-F il8-R il10-F il10-R tnf␣-F tnf␣-R GAPDH-F GAPDH-R
Crystal violet method for quantification of biofilm formation Strains were seeded into biofilm-inducing medium in either glass test tubes or in 96-well plates as described previously (Pratt and Kolter 1998; Li et al. 2008; Duan et al. 2012b). OD600 values of each well were read to measure the amount of biofilm through attached crystal violet. Each strain was tested by 6 repetitions and the experiment was repeated 3 times. RNA extraction and fluorescence quantitative PCR Total RNA from each strain was extracted using the TRNzol method as described before (Han and Lu 2009; Duan et al. 2013). Primers designed to amplify unique sequence regions of the fliC gene were used. All data were normalized to the endogenous reference gene gapA. Meanwhile, after infection by E. coli, Caco-2 cells were subsequently lysed with Trizol, and total RNA was extracted following the standard procedure. Specific primers for amplifying genes il-8, il-10, and tnf-␣ were used, and data were normalized to the housekeeping gene gapdh. Assays were performed with ABI 7500 (Applied Biosystems, Foster City, California, USA). The data were analyzed by the 2–⌬⌬CT method. ELISA assay A monolayer of Caco-2 cells infected with the F18ab WT as well as F18ab⌬luxS and F18ab⌬luxS/pluxS were maintained in DMEM with 0.1% FBS to evaluate interleukin 8 (IL-8) and tumor necrosis factor alpha (TNF-␣) production. After 3 h of infection, cell culture supernatants were collected as descripted previously (Duan et al. 2012b), and IL-8 and TNF-␣ levels were measured in triplicate using commercial ELISA kits (R&D Systems, Minneapolis, Minnesota). PBS was added into wells containing Caco-2 cells, and supernatants were collected as negative control. Cytotoxicity to Vero cells Vero cells were seeded at 1 × 104/well in 96-well plates in DMEM (Invitrogen) containing 10% FBS, and were incubated overnight (de Sablet et al. 2008). Strains were cultured to an OD600 of 0.3, then mitomycin C was added into each tube to the final concentration of 0.25 g/mL for activating Stx2e production. After 12 h of induction, culture supernatants were filtered through a 0.22 m filter. One hundred microlitres of supernatants was added to the Vero cells and incubated for 20 h, while DMEM was added into wells as negative control. After washing with PBS, the remaining cells Published by NRC Research Press
Yang et al.
357
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by San Diego (UCSD) on 06/07/15 For personal use only.
Fig. 1. AI-2 activity was measured using the Vibrio harveyi bioluminescence assay. Samples were extracted as the OD600 of each strain reached 2.0. AI-2 activity is expressed as the fold induction of relative light units by comparing with negative control DH5␣. Vibrio harveyi BB120 served as a positive control. Statistical significance was determined by a Student’s t test based on comparison with 107/86 strain (**, P < 0.01).
were fixed with 2% formalin. Crystal violet solution (0.13%) was added for staining, and ethanol was added to resolubilize the adherent crystal violet in fixed cells. The wells were mixed thoroughly before reading at OD600.
Fig. 2. Swim motility assays. The motility diameter was measured after 12 h of growth on 0.3% swim agar plates. WT, wild type.
Statistical analysis All statistical analyses were performed using SPSS 15.0 software (SPSS Inc., Chicago, Illinois, USA). Differences in data were analyzed with a Student’s t test. In all cases, significance was defined as P < 0.05.
Results Construction and characterization of F18ab⌬luxS and F18ab⌬luxS/pluxS The luxS isogenic mutants were constructed from parent strain F18ab 107/86. luxS encodes an enzyme involved in the metabolism of S-adenosylmethionine, finally leading to the production of the AI-2 signal. When tested by bioluminescence assay, compared with the WT, the AI-2 production by F18ab⌬luxS was reduced to the background levels seen in the negative control DH5␣. Complementation of ⌬luxS with pBR-luxS restored the capacity of F18ab⌬luxS to synthesize AI-2 at levels comparable to that of the WT (Fig. 1). F18ab⌬luxS strain containing empty pBR322 plasmid showed no AI-2 activity (data not shown). Effect of luxS alters the expression of flagella and flagella-related virulence Bacterial motility was analyzed at 37 °C after 12 h growth. The motility halo of the ⌬luxS mutant was smaller (⬃50%) than that of F18ab WT and F18ab⌬luxS/pluxS (Fig. 2). This result was confirmed with data from qRT–PCR, which indicated fliC undertook a 5-fold decrease compared with WT (data not shown). In comparison with the WT strain, F18ab⌬luxS showed a significant (nearly 30%) reduction in adherence to and invasion of IPEC-J2 cells. Complementation of ⌬luxS with pBR-luxS restored the adherence and invasion capacity in F18ab⌬luxS (Fig. 3). These data suggest that deletion of luxS exerts a negative effect on the ability of E. coli to adhere to and invade epithelial cells. Since flagella exert essential functions in biofilm formation (Horie et al. 2008), the ability of strains to form biofilms was also determined. Biofilm formation on the glass tube surfaces was reduced (⬃33%) in F18ab⌬luxS, as compared with the WT and complemented strain (Fig. 4). Thus, the QS-II system seems to play an important role in the formation of E. coli biofilms. Since flagellin can induce Toll-like receptor 5 (TLR5)-dependent and TLR5-independent pro-inflammatory responses in host cells (Tallant et al. 2004; Vijay-Kumar et al. 2010), we examined the
ability of F18ab⌬luxS to activate innate immune responses in cells. The pro-inflammatory cytokines IL-8 and TNF-␣ and the antiinflammatory cytokine IL-10 were chosen as reference cytokines for the test (Yu et al. 2003). Since flagellin can activate the proinflammatory response in host cells, the anti-inflammatory cytokine IL-10 was chosen as a negative control, which was not supposed to be activated (Hayashi et al. 2001; Berin et al. 2002). Compared with Caco-2 cells infected by F18ab WT and F18ab⌬luxS/ pluxS, F18ab⌬luxS-infected Caco-2 cells exhibited an mRNA level of il-8 of nearly 47%, untouched mRNA level of negative control il-10, and an mRNA level of tnf-␣ of 58% (Fig. 5). These results were consistent with IL-8 and TNF-␣ ELISA experiments using commercial immunoassay kits following protocols (Fig. 6). In the supernatant of F18ab⌬luxS-infected Caco-2 cells, 85.47 pg of IL-8 and 23.17 pg of TNF-␣ were detected, which represented nearly 30% of the amount in WT-infected Caco-2 cells. Deletion of luxS decrease Stx2e production Cell lesions caused by Stx2e from F18ab⌬luxS was reduced by 20%, as compared with cytotoxicity from WT strain and F18ab⌬luxS/ pluxS. This result demonstrates that luxS regulates Stx2e-mediated cytotoxicity (Fig. 7).
Discussion Many studies have highlighted the significance of luxS in biological processes in many different bacteria (Atkinson et al. 2006; Published by NRC Research Press
358
Can. J. Microbiol. Vol. 60, 2014
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by San Diego (UCSD) on 06/07/15 For personal use only.
Fig. 3. Effect of luxS on 107/86 adherence to and invasion of IPEC-J2 cells. (A) Quantification of adherence of F18ab wild type (WT), F18ab⌬luxS, and F18ab⌬luxS/pluxS to IPEC-J2 cells. (B) Quantification of invasion of F18ab WT, F18ab⌬luxS, and F18ab⌬luxS/pluxS into IPEC-J2 cells. The y axes indicate mean colony-forming units (CFU) recovered from each well of 96-well plates. Statistical significance was determined by a Student’s t test based on comparison with 107/86 strain (*, P < 0.05).
Fig. 4. Effect of luxS on biofilm formation. Qualitative analyses of biofilm formation were exerted. Strain was seeded into biofilm inducing medium, and the stain results by crystal violet were observed. WT, wild type.
Waters et al. 2008; Boyen et al. 2009). Previous papers have pointed out the mechanism of regulation flagella in the QS-II system in E. coli (Sperandio et al. 2002; Clarke et al. 2006; Gonzalez et al. 2006), while different phenotypes were always observed in E. coli (Kim et al. 2010; Ling et al. 2010). Since other researchers (e.g., Haigh et al. 2013) have resolved this confliction by indicating that the diversity of phenotypes depended on genetic background of the host strain and mutation strategies, to examine the effect of luxS on virulence in F18-positive E. coli, we constructed a luxS mutant strain by the Red-based recombination system. The mutant strain displayed impaired Stx2e production and reduced flagella expression, which is consistent with a previous interpretation of the luxS effect (Haigh et al. 2013). In motility assays, extended motility halos were detected for WT and F18ab⌬luxS/pluxS, which suggested flagella expression was regulated by luxS, consistent with the data from qRT–PCR. The
Fig. 5. Transcriptional levels of various genes in Caco-2. All data were normalized to the housekeeping gene gapdh. Values indicate changed folds of expression level of genes in Caco-2 after infection of different strains, respectively, compared with phosphate-buffered saline-added Caco-2 cells. Means marked with * are significantly different at P values of 0.05. WT, wild type.
qRT–PCR method was used to confirm the decrease mRNA level of fliC, which encodes the expression of structure protein of flagella. Providing motility is not the only role of flagella. Expression of flagellin has been shown to be required for maximal bacterial adherence, colonization, and subsequent invasion (Smith et al. 2003; Duan et al. 2012b). In a previous study, IPEC-J2 is a suitable cell model for flagella-adherence experiment in vitro (Duan et al. 2013). Deleting luxS drastically reduced the adherence and invasion ability of 107/86, which were compatible with the impaired expression of flagella. Although the role of flagella in E. coli pathogenesis has not been explored sufficiently, it is known to be involved in bacterial biofilm formation (Duan et al. 2012a) in E. coli, Vibrio cholerae, and Pseudomonas aeruginosa (Rickard et al. 2006; Han Published by NRC Research Press
Yang et al.
359
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by San Diego (UCSD) on 06/07/15 For personal use only.
Fig. 6. Interleukin 8 (IL-8) and tumor necrosis factor alpha (TNF-␣) concentration measurement. Caco-2 cells were infected by F18ab wild type (WT), F18ab⌬luxS, and F18ab⌬luxS/pluxS. The supernatants of cells were collected and exerted ELISA method to measure IL-8 and TNF-␣ concentration. In negative control team, phosphate-buffered saline was added into Caco-2 cells and the supernatant was detected. Means marked with * are significantly different at P values of 0.05.
Fig. 7. Accumulated death of Vero cells determined by crystal violet staining method. Percent cytotoxicity = (ADMEM – Aexp) / ADMEM × 100, where Aexp is the absorbance of test samples, ADMEM is the absorbance of negative control in which DMEM was added instead of Stx2e. Values are means of the results of 4 independent experiments. Error bars indicate standard deviations. Means marked with * are significantly different at P values of 0.05 compared with data from 107/86 strain.
and Lu 2009; Blehert et al. 2003). The luxS mutant strain formed biofilms much more weakly than WT and F18ab⌬luxS/pluxS. In many cases, biofilm formation is related to many essential virulence factors contributing to colonization, immune escape, and antibiotic resistance (Pratt and Kolter 1998; Li et al. 2007, 2008). We assumed that through deletion of luxS, many properties of pathogenesis have been adjusted from decreased flagella expression. Flagellin is generally considered as one of the pathogen-associated molecular patterns, which can trigger pro-inflammatory responses both in vitro and in vivo through the TLR5 pathway. TLR5 stimulates the transcription of pro-inflammatory genes dependent on both nuclear factor B and mitogen-activated protein kinase signaling pathways, namely p38, JNK, and ERK1/2 (Yu et al. 2003;
Tallant et al. 2004; Salazar-Gonzalez and Navarro-Garcia 2011; Pott and Hornef 2012). Recently, flagellin was shown to have TLR5independent pro-inflammatory activity that depends on 2 related intracellular pattern recognition receptors, apoptosis inhibitory protein 5 (Naip5) and ice protease-activating factor (Ipaf), which are members of the NAIP, CIITA, HET-E, and TP-1 proteins (NACHT) leucine-rich repeat-containing receptor (NLR) family (Miao et al. 2006; Ren et al. 2006). Pro-inflammatory cytokines IL-8, TNF-␣, and anti-inflammatory cytokine IL-10 were chosen to be reference cytokines for our detection. From qRT–PCR and ELISA, we could conclude reduction of cytokines was mainly from flagella expression regulated by QS-II. Besides flagella, Stx2e toxin is another important virulence factor in F18-positive E. coli. The Shiga and Shiga-like toxins inhibit Published by NRC Research Press
360
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by San Diego (UCSD) on 06/07/15 For personal use only.
protein synthesis by cleaving a specific adenine residue in the 28S subunit of eukaryotic rRNA (Endo et al. 1988; Lindgren et al. 1994). In E. coli 107/86, luxS affected Stx2e expression; therefore, deleting luxS reduced Vero cells cytotoxicity, as compared with cells treated with WT E. coli 107/86. The result was consistent with previous data (Jeon and Itoh 2007; Kim et al. 2010) and confirmed the important roles of luxS upon pathogenesis of E. coli. In conclusion, this study demonstrated that luxS affects the expression of flagella and Stx2e toxin, 2 important STEC virulence factors. In STEC, the attenuated virulence may partly derive from the suppressed expression of fliC and decreased Stx2e production. This study provides insight into virulence genes regulated by luxS.
Acknowledgements This study was supported by the Chinese National Science Foundation (grants 31072136, 30771603, and 31270171); the Genetically Modified Organisms Technology Major Project of China (grant 2014ZX08006-001B); a project founded by the Priority Academic Program of Development Jiangsu High Education Institution, Program for ChangJiang Scholars and Innovative Research Team In University “PCSIRT” (grant IRT0978); 948 Program from Ministry of Agriculture of the People’s Republic of China (grant 2011-G24); and program granted for scientific innovation research of college graduate in Jangsu province (grant CXLX12 0937). Conflict of interest: the authors or their institution do not have any relationships that may influence or bias the results and data presented in this manuscript.
References Arora, S.K., Ritchings, B.W., Almira, E.C., Lory, S., and Ramphal, R. 1998. The Pseudomonas aeruginosa flagellar cap protein, FliD, is responsible for mucin adhesion. Infect. Immun. 66(3): 1000–1007. PMID:9488388. Atkinson, S., Chang, C.Y., Sockett, R.E., Camara, M., and Williams, P. 2006. Quorum sensing in Yersinia enterocolitica controls swimming and swarming motility. J. Bacteriol. 188(4): 1451–1461. doi:10.1128/JB.188.4.1451-1461.2006. PMID:16452428. Berin, M.C., Darfeuille-Michaud, A., Egan, L.J., Miyamoto, Y., and Kagnoff, M.F. 2002. Role of EHEC O157:H7 virulence factors in the activation of intestinal epithelial cell NF-B and MAP kinase pathways and the upregulated expression of interleukin 8. Cell. Microbiol. 4(10): 635–648. doi:10.1046/j.1462-5822. 2002.00218.x. PMID:12366401. Bertschinger, H.U., Bachmann, M., Mettler, C., Pospischil, A., Schraner, E.M., Stamm, M., et al. 1990. Adhesive fimbriae produced in vivo by Escherichia coli O139:K12(B):H1 associated with enterotoxaemia in pigs. Vet. Microbiol. 25(2– 3): 267–281. doi:10.1016/0378-1135(90)90083-8. PMID:1980757. Blehert, D.S., Palmer, R.J., Xavier, J.B., Almeida, J.S., and Kolenbrander, P.E. 2003. Autoinducer 2 production by Streptococcus gordonii DL1 and the biofilm phenotype of a luxS mutant are influenced by nutritional conditions. J. Bacteriol. 185(16): 4851–4860. doi:10.1128/JB.185.16.4851-4860.2003. PMID:12897005. Boyen, F., Eeckhaut, V., Van Immerseel, F., Pasmans, F., Ducatelle, R., and Haesebrouck, F. 2009. Quorum sensing in veterinary pathogens: mechanisms, clinical importance and future perspectives. Vet. Microbiol. 135(3–4): 187–195. doi:10.1016/j.vetmic.2008.12.025. PMID:19185433. Clarke, M.B., Hughes, D.T., Zhu, C., Boedeker, E.C., and Sperandio, V. 2006. The QseC sensor kinase: a bacterial adrenergic receptor. Proc. Natl. Acad. Sci. U.S.A. 103(27): 10420–10425. doi:10.1073/pnas.0604343103. PMID:16803956. Datsenko, K.A., and Wanner, B.L. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97(12): 6640–6645. doi:10.1073/pnas.120163297. PMID:10829079. De Keersmaecker, S.C., Sonck, K., and Vanderleyden, J. 2006. Let LuxS speak up in AI-2 signaling. Trends Microbiol. 14(3): 114–119. doi:10.1016/j.tim.2006.01. 003. PMID:16459080. de Sablet, T., Bertin, Y., Vareille, M., Girardeau, J.P., Garrivier, A., Gobert, A.P., et al. 2008. Differential expression of stx2 variants in Shiga toxin-producing Escherichia coli belonging to seropathotypes A and C. Microbiology, 154(1): 176–186. doi:10.1099/mic.0.2007/009704-0. PMID:18174136. Dons, L., Eriksson, E., Jin, Y., Rottenberg, M.E., Kristensson, K., Larsen, C.N., et al. 2004. Role of flagellin and the two-component CheA/CheY system of Listeria monocytogenes in host cell invasion and virulence. Infect. Immun. 72(6): 3237– 3244. doi:10.1128/IAI.72.6.3237-3244.2004. PMID:15155625. Duan, Q., Zhou, M., Zhu, L., and Zhu, G. 2012a. Flagella and bacterial pathogenicity. J. Basic Microbiol. 52: 1–8. doi:10.1002/jobm.201290001. PMID:22359233. Duan, Q., Zhou, M., Zhu, X., Bao, W., Wu, S., Ruan, X., et al. 2012b. The flagella of F18ab Escherichia coli is a virulence factor that contributes to infection in a IPEC-J2 cell model in vitro. Vet. Microbiol. 160(1–2): 132–140. doi:10.1016/j. vetmic.2012.05.015. PMID:22658629.
Can. J. Microbiol. Vol. 60, 2014
Duan, Q., Zhou, M., Zhu, X., Yang, Y., Zhu, J., Bao, W., et al. 2013. Flagella from F18+Escherichia coli play a role in adhesion to pig epithelial cell lines. Microb. Pathog. 55: 32–38. doi:10.1016/j.micpath.2012.09.010. PMID:23046699. Endo, Y., Tsurugi, K., Yutsudo, T., Takeda, Y., Ogasawara, T., and Igarashi, K. 1988. Site of action of a Vero toxin (VT2) from Escherichia coli O157:H7 and of Shiga toxin on eukaryotic ribosomes. RNA N-glycosidase activity of the toxins. Eur. J. Biochem. 171(1–2): 45–50. doi:10.1111/j.1432-1033.1988.tb13756.x. PMID:3276522. Fairbrother, J.M., Nadeau, E., and Gyles, C.L. 2005. Escherichia coli in postweaning diarrhea in pigs: an update on bacterial types, pathogenesis, and prevention strategies. Anim. Health Res. Rev. 6(1): 17–39. doi:10.1079/AHR2005105. PMID: 16164007. Frydendahl, K. 2002. Prevalence of serogroups and virulence genes in Escherichia coli associated with postweaning diarrhoea and edema disease in pigs and a comparison of diagnostic approaches. Vet. Microbiol. 85(2): 169–182. doi:10. 1016/S0378-1135(01)00504-1. PMID:11844623. Giron, J.A., Torres, A.G., Freer, E., and Kaper, J.B. 2002. The flagella of enteropathogenic Escherichia coli mediate adherence to epithelial cells. Mol. Microbiol. 44(2): 361–379. doi:10.1046/j.1365-2958.2002.02899.x. PMID:11972776. Gonzalez, B.A., Zuo, R., Hashimoto, Y., Yang, L., Bentley, W.E., and Wood, T.K. 2006. Autoinducer 2 controls biofilm formation in Escherichia coli through a novel motility quorum-sensing regulator (MqsR, B3022). J. Bacteriol. 188(1): 305–316. doi:10.1128/JB.188.1.305-316.2006. PMID:16352847. Haigh, R., Kumar, B., Sandrini, S., and Freestone, P. 2013. Mutation design and strain background influence the phenotype of Escherichia coli luxS mutants. Mol. Microbiol. 88(5): 951–969. doi:10.1111/mmi.12237. PMID:23651217. Han, X.G., and Lu, C.P. 2009. Detection of autoinducer-2 and analysis of the profile of luxS and pfs transcription in Streptococcus suis serotype 2. Curr. Microbiol. 58(2): 146–152. doi:10.1007/s00284-008-9291-9. PMID:18956225. Hayashi, F., Smith, K.D., Ozinsky, A., Hawn, T.R., Yi, E.C., Goodlett, D.R., et al. 2001. The innate immune response to bacterial flagellin is mediated by Tolllike receptor 5. Nature, 410(6832): 1099–1103. doi:10.1038/35074106. PMID: 11323676. Horie, M., Ogawa, H., Yoshida, Y., Yamada, K., Hara, A., Ozawa, K., et al. 2008. Inactivation and morphological changes of avian influenza virus by copper ions. Arch. Virol. 153(8): 1467–1472. doi:10.1007/s00705-008-0154-2. PMID: 18592130. Imberechts, H., Bertschinger, H.U., Stamm, M., Sydler, T., Pohl, P., De Greve, H., et al. 1994. Prevalence of F107 fimbriae on Escherichia coli isolated from pigs with oedema disease or postweaning diarrhoea. Vet. Microbiol. 40(3–4): 219– 230. doi:10.1016/0378-1135(94)90111-2. PMID:7941287. Imberechts, H., Wild, P., Charlier, G., De Greve, H., Lintermans, P., and Pohl, P. 1996. Characterization of F18 fimbrial genes fedE and fedF involved in adhesion and length of enterotoxemic Escherichia coli strain 107/86. Microb. Pathog. 21(3): 183–192. doi:10.1006/mpat.1996.0053. PMID:8878015. Jeon, B., and Itoh, K. 2007. Production of shiga toxin by a luxS mutant of Escherichia coli O157:H7 in vivo and in vitro. Microbiol. Immunol. 51(4): 391–396. doi:10.1111/j.1348-0421.2007.tb03926.x. PMID:17446678. Kim, J.C., Yoon, J.W., Kim, J.B., Oh, K.H., Park, M.S., Lee, B.K., and Cho, S.H. 2010. Omics-based analysis of the luxS mutation in a clinical isolate of Escherichia coli O157:H7 in Korea. J. Microbiol. Biotechnol. 20(2): 415–424. PMID:20208450. Li, J., Attila, C., Wang, L., Wood, T.K., Valdes, J.J., and Bentley, W.E. 2007. Quorum sensing in Escherichia coli is signaled by AI-2/LsrR: effects on small RNA and biofilm architecture. J. Bacteriol. 189(16): 6011–6020. doi:10.1128/JB.00014-07. PMID:17557827. Li, L., Zhou, R., Li, T., Kang, M., Wan, Y., Xu, Z., and Chen, H. 2008. Enhanced biofilm formation and reduced virulence of Actinobacillus pleuropneumoniae luxS mutant. Microb. Pathog. 45(3): 192–200. doi:10.1016/j.micpath.2008.05. 008. PMID:18585450. Lindgren, S.W., Samuel, J.E., Schmitt, C.K., and O’Brien, A.D. 1994. The specific activities of Shiga-like toxin type II (SLT-II) and SLT-II-related toxins of enterohemorrhagic Escherichia coli differ when measured by Vero cell cytotoxicity but not by mouse lethality. Infect. Immun. 62(2): 623–631. PMID:8300218. Ling, H., Kang, A., Tan, M.H., Qi, X., and Chang, M.W. 2010. The absence of the luxS gene increases swimming motility and flagella synthesis in Escherichia coli K12. Biochem. Biophys. Res. Commun. 401(4): 521–526. doi:10.1016/j.bbrc.2010. 09.080. PMID:20875395. Mainil, J.G., Jacquemin, E., Pohl, P., Kaeckenbeeck, A., and Benz, I. 2002. DNA sequences coding for the F18 fimbriae and AIDA adhesin are localised on the same plasmid in Escherichia coli isolates from piglets. Vet. Microbiol. 86(4): 303–311. doi:10.1016/S0378-1135(02)00019-6. PMID:11955780. Miao, E.A., Alpuche-Aranda, C.M., Dors, M., Clark, A.E., Bader, M.W., Miller, S.I., et al. 2006. Cytoplasmic flagellin activates caspase-1 and secretion of interleukin 1 via Ipaf. Nat. Immunol. 7(6): 569–575. doi:10.1038/ni1344. PMID: 16648853. Nagy, B., and Fekete, P.Z. 2005. Enterotoxigenic Escherichia coli in veterinary medicine. Int. J. Med. Microbiol. 295(6–7): 443–454. doi:10.1016/j.ijmm.2005. 07.003. PMID:16238018. Parthasarathy, G., Yao, Y., and Kim, K.S. 2007. Flagella promote Escherichia coli K1 association with and invasion of human brain microvascular endothelial cells. Infect. Immun. 75(6): 2937–2945. doi:10.1128/IAI.01543-06. PMID:17371850. Pott, J., and Hornef, M. 2012. Innate immune signalling at the intestinal epithePublished by NRC Research Press
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by San Diego (UCSD) on 06/07/15 For personal use only.
Yang et al.
lium in homeostasis and disease. EMBO Rep. 13(8): 684–698. doi:10.1038/ embor.2012.96. PMID:22801555. Pratt, L.A., and Kolter, R. 1998. Genetic analysis of Escherichia coli biofilm formation: roles of flagella, motility, chemotaxis and type I pili. Mol. Microbiol. 30(2): 285–293. doi:10.1046/j.1365-2958.1998.01061.x. PMID:9791174. Ren, T., Zamboni, D.S., Roy, C.R., Dietrich, W.F., and Vance, R.E. 2006. Flagellindeficient Legionella mutants evade caspase-1- and Naip5-mediated macrophage immunity. PLoS Pathog. 2(3): e18. doi:10.1371/journal.ppat.0020018. PMID:16552444. Rickard, A.H., Palmer, R.J., Blehert, D.S., Campagna, S.R., Semmelhack, M.F., Egland, P.G., et al. 2006. Autoinducer 2: a concentration-dependent signal for mutualistic bacterial biofilm growth. Mol. Microbiol. 60(6): 1446–1456. doi: 10.1111/j.1365-2958.2006.05202.x. PMID:16796680. Salazar-Gonzalez, H., and Navarro-Garcia, F. 2011. Intimate adherence by enteropathogenic Escherichia coli modulates TLR5 localization and proinflammatory host response in intestinal epithelial cells. Scand. J. Immunol. 73(4): 268–283. doi:10.1111/j.1365-3083.2011.02507.x. PMID:21204905. Scaletsky, I.C., Silva, M.L., and Trabulsi, L.R. 1984. Distinctive patterns of adherence of enteropathogenic Escherichia coli to HeLa cells. Infect. Immun. 45(2): 534–536. PMID:6146569. Smith, K.D., Andersen-Nissen, E., Hayashi, F., Strobe, K., Bergman, M.A., Barrett, S.L., et al. 2003. Toll-like receptor 5 recognizes a conserved site on flagellin required for protofilament formation and bacterial motility. Nat. Immunol. 4(12): 1247–1253. doi:10.1038/ni1011. PMID:14625549. Sperandio, V., Torres, A.G., Giron, J.A., and Kaper, J.B. 2001. Quorum sensing is a global regulatory mechanism in enterohemorrhagic Escherichia coli O157:H7. J. Bacteriol. 183(17): 5187–5197. doi:10.1128/JB.183.17.5187-5197.2001. PMID: 11489873. Sperandio, V., Torres, A.G., and Kaper, J.B. 2002. Quorum sensing Escherichia coli regulators B and C (QseBC): a novel two-component regulatory system involved in the regulation of flagella and motility by quorum sensing in E. coli. Mol. Microbiol. 43(3): 809–821. doi:10.1046/j.1365-2958.2002.02803.x. PMID: 11929534.
361
Stecher, B., Hapfelmeier, S., Muller, C., Kremer, M., Stallmach, T., and Hardt, W.D. 2004. Flagella and chemotaxis are required for efficient induction of Salmonella enterica serovar Typhimurium colitis in streptomycin-pretreated mice. Infect. Immun. 72(7): 4138–4150. doi:10.1128/IAI.72.7.4138-4150.2004. PMID:15213159. Stecher, B., Barthel, M., Schlumberger, M.C., Haberli, L., Rabsch, W., Kremer, M., and Hardt, W.-D. 2008. Motility allows S. Typhimurium to benefit from the mucosal defence. Cell. Microbiol. 10(5): 1166–1180. doi:10.1111/j.1462-5822. 2008.01118.x. PMID:18241212. Tallant, T., Deb, A., Kar, N., Lupica, J., de Veer, M.J., and DiDonato, J.A. 2004. Flagellin acting via TLR5 is the major activator of key signaling pathways leading to NF-B and proinflammatory gene program activation in intestinal epithelial cells. BMC Microbiol. 4: 33. doi:10.1186/1471-2180-4-33. PMID: 15324458. Vijay-Kumar, M., Carvalho, F.A., Aitken, J.D., Fifadara, N.H., and Gewirtz, A.T. 2010. TLR5 or NLRC4 is necessary and sufficient for promotion of humoral immunity by flagellin. Eur. J. Immunol. 40(12): 3528–3534. doi:10.1002/eji. 201040421. PMID:21072873. Walters, M., and Sperandio, V. 2006. Quorum sensing in Escherichia coli and Salmonella. Int. J. Med. Microbiol. 296(2–3): 125–131. doi:10.1016/j.ijmm.2006. 01.041. PMID:16487745. Waters, C.M., Lu, W., Rabinowitz, J.D., and Bassler, B.L. 2008. Quorum sensing controls biofilm formation in Vibrio cholerae through modulation of cyclic di-GMP levels and repression of vpsT. J. Bacteriol. 190(7): 2527–2536. doi:10. 1128/JB.01756-07. PMID:18223081. Yu, Y., Zeng, H., Lyons, S., Carlson, A., Merlin, D., Neish, A.S., et al. 2003. TLR5mediated activation of p38 MAPK regulates epithelial IL-8 expression via posttranscriptional mechanism. Am. J. Physiol. Gastrointest. Liver Physiol. 285(2): G282–G290. doi:10.1152/ajpgi.00503.2002. PMID:12702497. Zhu, C., Feng, S., Sperandio, V., Yang, Z., Thate, T.E., Kaper, J.B., et al. 2007. The possible influence of LuxS in the in vivo virulence of rabbit enteropathogenic Escherichia coli. Vet. Microbiol. 125(3–4): 313–322. doi:10.1016/j.vetmic.2007.05. 030. PMID:17643872.
Published by NRC Research Press
ARTICLE Quorum-sensing gene luxS regulates flagella expression and Shiga-like toxin production in F18ab Escherichia coli
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by San Diego (UCSD) on 06/07/15 For personal use only.
Yang Yang, Mingxu Zhou, Huayan Hou, Jun Zhu, Fenghua Yao, Xinjun Zhang, Xiaofang Zhu, Philip R. Hardwidge, and Guoqiang Zhu
Abstract: To investigate the effect of the luxS gene on the expression of virulence factors in Shiga-like toxin producing and verotoxin-producing Escherichia coli, the luxS gene from E. coli 107/86 (wild type, O139:H1:F18ab, Stx2e) was deleted. The successful deletion of luxS was confirmed by bioluminescence assays. The luxS deletion mutant exhibited changed flagella-related phenotypes, like impaired expression of flagella, decreased flagella motility, reduced biofilm formation, and reduced ability to induce pro-immunity response in host cells, which were restored after complementation with the intact luxS gene. The mutant strain also displayed attenuated production of Stx2e. This study provides new information to the crucial function of luxS in regulating Shiga-like toxin producing E. coli virulence. Key words: Escherichia coli, luxS, quorum sensing, flagella. Résumé : Afin d’examiner l’importance du gène luxS dans l’expression de facteurs de virulence chez des Escherichia coli producteurs de toxine de type Shiga et de vérotoxine (STEC et VTEC), on a délété le gène luxS d’E. coli 107/86 (type sauvage, O139:H1:F18ab, Stx2e). La délétion de luxS a été confirmée par des analyses de bioluminescence. Le mutant délétionnel luxS a présenté des phénotypes flagellaires altérés, dont une expression déficience du flagelle, une mobilité flagellaire moindre, une formation de biofilm amenuisée et une capacité réduite d’induction de la réponse pro-immunitaire chez les cellules hôtes. Le tout a été rétabli a` la suite d’une complémentation avec le gène luxS intact. La souche mutante se caractérisait également par une diminution de la production de Stx2e. La présente étude fournit de nouvelles informations quant a` la fonction cruciale de luxS dans la régulation de la virulence du STEC. [Traduit par la Rédaction] Mots-clés : Escherichia coli, luxS, détection du quorum, flagelles.
Introduction Both porcine edema disease and post-weaning diarrhea caused by Shiga-like toxigenic (STEC) or verotoxigenic Escherichia coli result in important morbidity and mortality (Fairbrother et al. 2005; Nagy and Fekete 2005). As a result, the pig industry has suffered huge economic losses (Imberechts et al. 1996). Infections with STEC F18ab+ strains, which produce Shiga toxin 2e (Stx2e), strongly correlate with edema disease (Imberechts et al. 1994). The quorum-sensing (QS) system is a bacterial communication system that controls the expression of multiple genes in response to bacterial population density. Small chemical signal molecules called autoinducers (AIs) are produced, released, and detected in the QS process. Gram-positive and Gram-negative bacteria share the QS-II system, which regulates the expression of multiple genes through AI-2 (Boyen et al. 2009). AI-2, first discovered in Vibrio harveyi, has recently been suggested to represent a kind of new type of language used by both Gram-negative and Gram-positive bacteria. Although LuxS is an important integral component in the activated methyl cycle pathway, its function as AI-2 synthase was also identified widely among bacteria (De Keersmaecker et al. 2006). LuxS, with the Pfs protein (5=-methylthioadenosine/ S-adenosylhomocysteine nucleosidase) is involved in AI-2 biosynthesis derived from S-adenosylmethionine (Sperandio et al. 2001). AI-2 can be detected by its ability to induce luminescence in
the AI-2 reporter strain V. harveyi BB170. In many pathogenic bacteria, AI-2 plays an important role in regulating bacterial virulence strategies, including type III secretion systems, pathogenicity, and biofilm formation (Walters and Sperandio 2006). Previous studies demonstrated that the QS-II system is essential for the expression of type III-secreted proteins and other pathogenicity factors in enterohaemorrhagic E. coli, enteropathogenic E. coli, and rabbit enteropathogenic E. coli (Zhu et al. 2007). Meanwhile, flagella regulation of QS-II was also exhibited (Sperandio et al. 2002; Clarke et al. 2006; Gonzalez et al. 2006). Flagella have been reported to be an important virulence factor in E. coli and have crucial functions in pathogenesis (Duan et al. 2012a, 2013), such as providing bacterial motility and, in some cases, contributing to bacterial colonization of host cells (Arora et al. 1998; Giron et al. 2002) and to penetration of the mucosal layer (Dons et al. 2004; Parthasarathy et al. 2007). It has also been proposed that flagella allow enteric bacteria to exploit inflammation to compete with intestinal microbiota in vivo (Stecher et al. 2004, 2008; Duan et al. 2012a). However, a conflict existed in the regulation process between luxS and flagella. Some researchers have pointed out that the luxS mutant represses flagella expression in O157:H7 (Sperandio et al. 2002; Kim et al. 2010), but in a study by Ling et al. (2010), increased flagella expression was displayed in the absence of luxS in E. coli K12. To investigate this conflict further, Haigh et al. (2013) constructed mutants in different strains
Received 9 March 2014. Revision received 6 April 2014. Accepted 16 April 2014. Y. Yang, M. Zhou, H. Hou, J. Zhu, F. Yao, X. Zhang, and G. Zhu. College of Veterinary Medicine, Yangzhou University, Yangzhou 225009, People’s Republic of China; Jiangsu Co-Innovation Center for Important Animal Infectious Diseases and Zoonoses, Yangzhou 225009, People’s Republic of China. X. Zhu. Department of Dermatology of Clinical Medical School, Yangzhou University, Yangzhou 225009, People’s Republic of China. P.R. Hardwidge. College of Veterinary Medicine, Kansas State University, Manhattan, KS 66506, USA. Corresponding author: Guoqiang Zhu (e-mail: [email protected] and [email protected]). Can. J. Microbiol. 60: 355–361 (2014) dx.doi.org/10.1139/cjm-2014-0178
Published at www.nrcresearchpress.com/cjm on 17 April 2014.
356
with various mutant strategies, and they concluded that the contradiction was caused by the diversity of host strain backgrounds and polar-mutate strategies. In infection, besides flagella, Stx2e is another important virulence factor; it is released into the gut lumen, disrupts intestinal mucosa function, and finally causes edema disease (Frydendahl 2002; Mainil et al. 2002). To further explore the role of luxS in the pathogenicity of STEC 107/86, in the present study, we constructed a luxS-deletion mutation in wildtype (WT) E. coli 107/86 and determined the possible role of luxS in pathogenicity.
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by San Diego (UCSD) on 06/07/15 For personal use only.
Materials and methods Bacterial strain and growth conditions Escherichia coli 107/86 (WT, O139:H1:F18ab, Stx2e) (Bertschinger et al. 1990) was routinely cultured in Luria broth or on Luria agar plates at 37 °C. Vibrio harveyi strains BB120 and BB170 were kindly provided by Yongjie Liu (Nanjing Agricultural University). Vibrio harveyi BB120 culture supernatant was used as a positive control. Vibrio harveyi BB170 was used for the bioassay to detect AI-2. Both V. harveyi strains were cultivated in modified autoinducer bioassay medium (Han and Lu 2009). Porcine neonatal jejunal epithelial cell line IPEC-J2 cells were cultured in media containing RPMI 1640-F12 (1:1) (Gibco) supplemented with 10% newborn calf serum (Gibco) and maintained at 37 °C and 5% CO2. Human colorectal adenocarcinoma epithelial cells (Caco-2) were cultivated in Dulbecco’s minimal Eagle medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Gibco) at 37 °C and 5% CO2. All other reagents and chemicals were purchased from Sigma (USA). Construction of F18ab⌬luxS and F18ab⌬luxS/pluxS The F18ab⌬luxS was constructed using Red-based recombination system with the ⌬LuxS-1, ⌬LuxS-2 primers and plasmids pKD3, pKD46, and pCP20 (Datsenko and Wanner 2000). The final deletion of luxS was confirmed by DNA sequencing. LuxS-1 and LuxS-2 primers (Table 1) were used to generate complement plasmid pBR-luxS, which was transformed into F18ab⌬luxS, to restore AI-2 producing ability in mutant strain. The mutant strain F18ab⌬luxS and complementary strain F18ab⌬luxS/pluxS were used in the future work. Bioluminescence detection in AI-2 bioassay Cell-free culture supernatants were prepared from F18ab WT, F18ab⌬luxS, F18ab⌬luxS/pluxS, positive control BB120, and negative control DH5␣ as described by Han and Lu (2009). Luminescence values were measured with a Tecan GENios Plus microplate reader in luminescence mode (TECAN GmbH, Austria). Motility assay As described previously, strains were seeded in the middle of motility plates (Sperandio et al. 2002). The motility halos were measured to evaluate motility in each strain. Bacterial adherence assays The adherence of F18ab WT to IPEC-J2 cells was determined using a quantitative adhesion assay (Scaletsky et al. 1984; Duan et al. 2013). After Triton X-110 treatment, the number of bacteria adhered to IPEC-J2 cells was enumerated. Bacterial invasion assays The cell monolayer was co-incubated with 107 CFU bacteria for 2 h, gently washed 3 times with phosphate-buffered saline (PBS), and supplemented with a 140 mg/mL concentration of gentamicin in the medium for an additional 2 h to kill extracellular bacteria. After Triton X-110 treatment, the number of bacteria that invaded IPEC-J2 cells was enumerated (Duan et al. 2012b, 2013).
Can. J. Microbiol. Vol. 60, 2014
Table 1. Primer used in this study. Primer name
Sequence (5=–3=) description
LuxS-1 LuxS-2 ⌬LuxS-1
5=-ATGCCGTTGTTAGATAGCTTCAC-3= 5=-CTAGATGTGCAGTTCCTGCAACT-3= 5=-TGCAGTTCGGGTGGCGAAAACAATGA ACACCCCGCATGGCGACGCAATCATG TGTAGGCTGGAGCTGCTTCG-3= 5=-TCTGATTCTGATCCTGCACTTTCAGCA CGTCTTCCATTGCCGCTTTCCCATATG AATATCCTCCTTAG-3= 5=-CGTTAAAGGCGCTAACTTCG-3= 5=-ACGGTGGTCATCAGACCTTC-3= 5=-CAGCAAGCGGTGAAGTGAA-3= 5=-AAGCGTAGCCACAGTAGCA-3= 5=-TGCAGCTCTGTGTGAAGGTG-3= 5=-ACTTCTCCACAACCCTCTGC-3= 5=-CCACGCTTTCTAGCTGTTGA-3= 5=-CTCCGAGACACTGGAAGGTG-3= 5=-CCCAGGGACCTCTCTCTAATC-3= 5=-TGAGGTACAGGCCCTCTGAT-3= 5=-GATGGGCGTGAACCATGAG-3= 5=-GAGGCATTGCTGACGATCTTG-3=
⌬LuxS-2
gapA-F gapA-R fliC-F fliC-R il8-F il8-R il10-F il10-R tnf␣-F tnf␣-R GAPDH-F GAPDH-R
Crystal violet method for quantification of biofilm formation Strains were seeded into biofilm-inducing medium in either glass test tubes or in 96-well plates as described previously (Pratt and Kolter 1998; Li et al. 2008; Duan et al. 2012b). OD600 values of each well were read to measure the amount of biofilm through attached crystal violet. Each strain was tested by 6 repetitions and the experiment was repeated 3 times. RNA extraction and fluorescence quantitative PCR Total RNA from each strain was extracted using the TRNzol method as described before (Han and Lu 2009; Duan et al. 2013). Primers designed to amplify unique sequence regions of the fliC gene were used. All data were normalized to the endogenous reference gene gapA. Meanwhile, after infection by E. coli, Caco-2 cells were subsequently lysed with Trizol, and total RNA was extracted following the standard procedure. Specific primers for amplifying genes il-8, il-10, and tnf-␣ were used, and data were normalized to the housekeeping gene gapdh. Assays were performed with ABI 7500 (Applied Biosystems, Foster City, California, USA). The data were analyzed by the 2–⌬⌬CT method. ELISA assay A monolayer of Caco-2 cells infected with the F18ab WT as well as F18ab⌬luxS and F18ab⌬luxS/pluxS were maintained in DMEM with 0.1% FBS to evaluate interleukin 8 (IL-8) and tumor necrosis factor alpha (TNF-␣) production. After 3 h of infection, cell culture supernatants were collected as descripted previously (Duan et al. 2012b), and IL-8 and TNF-␣ levels were measured in triplicate using commercial ELISA kits (R&D Systems, Minneapolis, Minnesota). PBS was added into wells containing Caco-2 cells, and supernatants were collected as negative control. Cytotoxicity to Vero cells Vero cells were seeded at 1 × 104/well in 96-well plates in DMEM (Invitrogen) containing 10% FBS, and were incubated overnight (de Sablet et al. 2008). Strains were cultured to an OD600 of 0.3, then mitomycin C was added into each tube to the final concentration of 0.25 g/mL for activating Stx2e production. After 12 h of induction, culture supernatants were filtered through a 0.22 m filter. One hundred microlitres of supernatants was added to the Vero cells and incubated for 20 h, while DMEM was added into wells as negative control. After washing with PBS, the remaining cells Published by NRC Research Press
Yang et al.
357
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by San Diego (UCSD) on 06/07/15 For personal use only.
Fig. 1. AI-2 activity was measured using the Vibrio harveyi bioluminescence assay. Samples were extracted as the OD600 of each strain reached 2.0. AI-2 activity is expressed as the fold induction of relative light units by comparing with negative control DH5␣. Vibrio harveyi BB120 served as a positive control. Statistical significance was determined by a Student’s t test based on comparison with 107/86 strain (**, P < 0.01).
were fixed with 2% formalin. Crystal violet solution (0.13%) was added for staining, and ethanol was added to resolubilize the adherent crystal violet in fixed cells. The wells were mixed thoroughly before reading at OD600.
Fig. 2. Swim motility assays. The motility diameter was measured after 12 h of growth on 0.3% swim agar plates. WT, wild type.
Statistical analysis All statistical analyses were performed using SPSS 15.0 software (SPSS Inc., Chicago, Illinois, USA). Differences in data were analyzed with a Student’s t test. In all cases, significance was defined as P < 0.05.
Results Construction and characterization of F18ab⌬luxS and F18ab⌬luxS/pluxS The luxS isogenic mutants were constructed from parent strain F18ab 107/86. luxS encodes an enzyme involved in the metabolism of S-adenosylmethionine, finally leading to the production of the AI-2 signal. When tested by bioluminescence assay, compared with the WT, the AI-2 production by F18ab⌬luxS was reduced to the background levels seen in the negative control DH5␣. Complementation of ⌬luxS with pBR-luxS restored the capacity of F18ab⌬luxS to synthesize AI-2 at levels comparable to that of the WT (Fig. 1). F18ab⌬luxS strain containing empty pBR322 plasmid showed no AI-2 activity (data not shown). Effect of luxS alters the expression of flagella and flagella-related virulence Bacterial motility was analyzed at 37 °C after 12 h growth. The motility halo of the ⌬luxS mutant was smaller (⬃50%) than that of F18ab WT and F18ab⌬luxS/pluxS (Fig. 2). This result was confirmed with data from qRT–PCR, which indicated fliC undertook a 5-fold decrease compared with WT (data not shown). In comparison with the WT strain, F18ab⌬luxS showed a significant (nearly 30%) reduction in adherence to and invasion of IPEC-J2 cells. Complementation of ⌬luxS with pBR-luxS restored the adherence and invasion capacity in F18ab⌬luxS (Fig. 3). These data suggest that deletion of luxS exerts a negative effect on the ability of E. coli to adhere to and invade epithelial cells. Since flagella exert essential functions in biofilm formation (Horie et al. 2008), the ability of strains to form biofilms was also determined. Biofilm formation on the glass tube surfaces was reduced (⬃33%) in F18ab⌬luxS, as compared with the WT and complemented strain (Fig. 4). Thus, the QS-II system seems to play an important role in the formation of E. coli biofilms. Since flagellin can induce Toll-like receptor 5 (TLR5)-dependent and TLR5-independent pro-inflammatory responses in host cells (Tallant et al. 2004; Vijay-Kumar et al. 2010), we examined the
ability of F18ab⌬luxS to activate innate immune responses in cells. The pro-inflammatory cytokines IL-8 and TNF-␣ and the antiinflammatory cytokine IL-10 were chosen as reference cytokines for the test (Yu et al. 2003). Since flagellin can activate the proinflammatory response in host cells, the anti-inflammatory cytokine IL-10 was chosen as a negative control, which was not supposed to be activated (Hayashi et al. 2001; Berin et al. 2002). Compared with Caco-2 cells infected by F18ab WT and F18ab⌬luxS/ pluxS, F18ab⌬luxS-infected Caco-2 cells exhibited an mRNA level of il-8 of nearly 47%, untouched mRNA level of negative control il-10, and an mRNA level of tnf-␣ of 58% (Fig. 5). These results were consistent with IL-8 and TNF-␣ ELISA experiments using commercial immunoassay kits following protocols (Fig. 6). In the supernatant of F18ab⌬luxS-infected Caco-2 cells, 85.47 pg of IL-8 and 23.17 pg of TNF-␣ were detected, which represented nearly 30% of the amount in WT-infected Caco-2 cells. Deletion of luxS decrease Stx2e production Cell lesions caused by Stx2e from F18ab⌬luxS was reduced by 20%, as compared with cytotoxicity from WT strain and F18ab⌬luxS/ pluxS. This result demonstrates that luxS regulates Stx2e-mediated cytotoxicity (Fig. 7).
Discussion Many studies have highlighted the significance of luxS in biological processes in many different bacteria (Atkinson et al. 2006; Published by NRC Research Press
358
Can. J. Microbiol. Vol. 60, 2014
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by San Diego (UCSD) on 06/07/15 For personal use only.
Fig. 3. Effect of luxS on 107/86 adherence to and invasion of IPEC-J2 cells. (A) Quantification of adherence of F18ab wild type (WT), F18ab⌬luxS, and F18ab⌬luxS/pluxS to IPEC-J2 cells. (B) Quantification of invasion of F18ab WT, F18ab⌬luxS, and F18ab⌬luxS/pluxS into IPEC-J2 cells. The y axes indicate mean colony-forming units (CFU) recovered from each well of 96-well plates. Statistical significance was determined by a Student’s t test based on comparison with 107/86 strain (*, P < 0.05).
Fig. 4. Effect of luxS on biofilm formation. Qualitative analyses of biofilm formation were exerted. Strain was seeded into biofilm inducing medium, and the stain results by crystal violet were observed. WT, wild type.
Waters et al. 2008; Boyen et al. 2009). Previous papers have pointed out the mechanism of regulation flagella in the QS-II system in E. coli (Sperandio et al. 2002; Clarke et al. 2006; Gonzalez et al. 2006), while different phenotypes were always observed in E. coli (Kim et al. 2010; Ling et al. 2010). Since other researchers (e.g., Haigh et al. 2013) have resolved this confliction by indicating that the diversity of phenotypes depended on genetic background of the host strain and mutation strategies, to examine the effect of luxS on virulence in F18-positive E. coli, we constructed a luxS mutant strain by the Red-based recombination system. The mutant strain displayed impaired Stx2e production and reduced flagella expression, which is consistent with a previous interpretation of the luxS effect (Haigh et al. 2013). In motility assays, extended motility halos were detected for WT and F18ab⌬luxS/pluxS, which suggested flagella expression was regulated by luxS, consistent with the data from qRT–PCR. The
Fig. 5. Transcriptional levels of various genes in Caco-2. All data were normalized to the housekeeping gene gapdh. Values indicate changed folds of expression level of genes in Caco-2 after infection of different strains, respectively, compared with phosphate-buffered saline-added Caco-2 cells. Means marked with * are significantly different at P values of 0.05. WT, wild type.
qRT–PCR method was used to confirm the decrease mRNA level of fliC, which encodes the expression of structure protein of flagella. Providing motility is not the only role of flagella. Expression of flagellin has been shown to be required for maximal bacterial adherence, colonization, and subsequent invasion (Smith et al. 2003; Duan et al. 2012b). In a previous study, IPEC-J2 is a suitable cell model for flagella-adherence experiment in vitro (Duan et al. 2013). Deleting luxS drastically reduced the adherence and invasion ability of 107/86, which were compatible with the impaired expression of flagella. Although the role of flagella in E. coli pathogenesis has not been explored sufficiently, it is known to be involved in bacterial biofilm formation (Duan et al. 2012a) in E. coli, Vibrio cholerae, and Pseudomonas aeruginosa (Rickard et al. 2006; Han Published by NRC Research Press
Yang et al.
359
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by San Diego (UCSD) on 06/07/15 For personal use only.
Fig. 6. Interleukin 8 (IL-8) and tumor necrosis factor alpha (TNF-␣) concentration measurement. Caco-2 cells were infected by F18ab wild type (WT), F18ab⌬luxS, and F18ab⌬luxS/pluxS. The supernatants of cells were collected and exerted ELISA method to measure IL-8 and TNF-␣ concentration. In negative control team, phosphate-buffered saline was added into Caco-2 cells and the supernatant was detected. Means marked with * are significantly different at P values of 0.05.
Fig. 7. Accumulated death of Vero cells determined by crystal violet staining method. Percent cytotoxicity = (ADMEM – Aexp) / ADMEM × 100, where Aexp is the absorbance of test samples, ADMEM is the absorbance of negative control in which DMEM was added instead of Stx2e. Values are means of the results of 4 independent experiments. Error bars indicate standard deviations. Means marked with * are significantly different at P values of 0.05 compared with data from 107/86 strain.
and Lu 2009; Blehert et al. 2003). The luxS mutant strain formed biofilms much more weakly than WT and F18ab⌬luxS/pluxS. In many cases, biofilm formation is related to many essential virulence factors contributing to colonization, immune escape, and antibiotic resistance (Pratt and Kolter 1998; Li et al. 2007, 2008). We assumed that through deletion of luxS, many properties of pathogenesis have been adjusted from decreased flagella expression. Flagellin is generally considered as one of the pathogen-associated molecular patterns, which can trigger pro-inflammatory responses both in vitro and in vivo through the TLR5 pathway. TLR5 stimulates the transcription of pro-inflammatory genes dependent on both nuclear factor B and mitogen-activated protein kinase signaling pathways, namely p38, JNK, and ERK1/2 (Yu et al. 2003;
Tallant et al. 2004; Salazar-Gonzalez and Navarro-Garcia 2011; Pott and Hornef 2012). Recently, flagellin was shown to have TLR5independent pro-inflammatory activity that depends on 2 related intracellular pattern recognition receptors, apoptosis inhibitory protein 5 (Naip5) and ice protease-activating factor (Ipaf), which are members of the NAIP, CIITA, HET-E, and TP-1 proteins (NACHT) leucine-rich repeat-containing receptor (NLR) family (Miao et al. 2006; Ren et al. 2006). Pro-inflammatory cytokines IL-8, TNF-␣, and anti-inflammatory cytokine IL-10 were chosen to be reference cytokines for our detection. From qRT–PCR and ELISA, we could conclude reduction of cytokines was mainly from flagella expression regulated by QS-II. Besides flagella, Stx2e toxin is another important virulence factor in F18-positive E. coli. The Shiga and Shiga-like toxins inhibit Published by NRC Research Press
360
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by San Diego (UCSD) on 06/07/15 For personal use only.
protein synthesis by cleaving a specific adenine residue in the 28S subunit of eukaryotic rRNA (Endo et al. 1988; Lindgren et al. 1994). In E. coli 107/86, luxS affected Stx2e expression; therefore, deleting luxS reduced Vero cells cytotoxicity, as compared with cells treated with WT E. coli 107/86. The result was consistent with previous data (Jeon and Itoh 2007; Kim et al. 2010) and confirmed the important roles of luxS upon pathogenesis of E. coli. In conclusion, this study demonstrated that luxS affects the expression of flagella and Stx2e toxin, 2 important STEC virulence factors. In STEC, the attenuated virulence may partly derive from the suppressed expression of fliC and decreased Stx2e production. This study provides insight into virulence genes regulated by luxS.
Acknowledgements This study was supported by the Chinese National Science Foundation (grants 31072136, 30771603, and 31270171); the Genetically Modified Organisms Technology Major Project of China (grant 2014ZX08006-001B); a project founded by the Priority Academic Program of Development Jiangsu High Education Institution, Program for ChangJiang Scholars and Innovative Research Team In University “PCSIRT” (grant IRT0978); 948 Program from Ministry of Agriculture of the People’s Republic of China (grant 2011-G24); and program granted for scientific innovation research of college graduate in Jangsu province (grant CXLX12 0937). Conflict of interest: the authors or their institution do not have any relationships that may influence or bias the results and data presented in this manuscript.
References Arora, S.K., Ritchings, B.W., Almira, E.C., Lory, S., and Ramphal, R. 1998. The Pseudomonas aeruginosa flagellar cap protein, FliD, is responsible for mucin adhesion. Infect. Immun. 66(3): 1000–1007. PMID:9488388. Atkinson, S., Chang, C.Y., Sockett, R.E., Camara, M., and Williams, P. 2006. Quorum sensing in Yersinia enterocolitica controls swimming and swarming motility. J. Bacteriol. 188(4): 1451–1461. doi:10.1128/JB.188.4.1451-1461.2006. PMID:16452428. Berin, M.C., Darfeuille-Michaud, A., Egan, L.J., Miyamoto, Y., and Kagnoff, M.F. 2002. Role of EHEC O157:H7 virulence factors in the activation of intestinal epithelial cell NF-B and MAP kinase pathways and the upregulated expression of interleukin 8. Cell. Microbiol. 4(10): 635–648. doi:10.1046/j.1462-5822. 2002.00218.x. PMID:12366401. Bertschinger, H.U., Bachmann, M., Mettler, C., Pospischil, A., Schraner, E.M., Stamm, M., et al. 1990. Adhesive fimbriae produced in vivo by Escherichia coli O139:K12(B):H1 associated with enterotoxaemia in pigs. Vet. Microbiol. 25(2– 3): 267–281. doi:10.1016/0378-1135(90)90083-8. PMID:1980757. Blehert, D.S., Palmer, R.J., Xavier, J.B., Almeida, J.S., and Kolenbrander, P.E. 2003. Autoinducer 2 production by Streptococcus gordonii DL1 and the biofilm phenotype of a luxS mutant are influenced by nutritional conditions. J. Bacteriol. 185(16): 4851–4860. doi:10.1128/JB.185.16.4851-4860.2003. PMID:12897005. Boyen, F., Eeckhaut, V., Van Immerseel, F., Pasmans, F., Ducatelle, R., and Haesebrouck, F. 2009. Quorum sensing in veterinary pathogens: mechanisms, clinical importance and future perspectives. Vet. Microbiol. 135(3–4): 187–195. doi:10.1016/j.vetmic.2008.12.025. PMID:19185433. Clarke, M.B., Hughes, D.T., Zhu, C., Boedeker, E.C., and Sperandio, V. 2006. The QseC sensor kinase: a bacterial adrenergic receptor. Proc. Natl. Acad. Sci. U.S.A. 103(27): 10420–10425. doi:10.1073/pnas.0604343103. PMID:16803956. Datsenko, K.A., and Wanner, B.L. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97(12): 6640–6645. doi:10.1073/pnas.120163297. PMID:10829079. De Keersmaecker, S.C., Sonck, K., and Vanderleyden, J. 2006. Let LuxS speak up in AI-2 signaling. Trends Microbiol. 14(3): 114–119. doi:10.1016/j.tim.2006.01. 003. PMID:16459080. de Sablet, T., Bertin, Y., Vareille, M., Girardeau, J.P., Garrivier, A., Gobert, A.P., et al. 2008. Differential expression of stx2 variants in Shiga toxin-producing Escherichia coli belonging to seropathotypes A and C. Microbiology, 154(1): 176–186. doi:10.1099/mic.0.2007/009704-0. PMID:18174136. Dons, L., Eriksson, E., Jin, Y., Rottenberg, M.E., Kristensson, K., Larsen, C.N., et al. 2004. Role of flagellin and the two-component CheA/CheY system of Listeria monocytogenes in host cell invasion and virulence. Infect. Immun. 72(6): 3237– 3244. doi:10.1128/IAI.72.6.3237-3244.2004. PMID:15155625. Duan, Q., Zhou, M., Zhu, L., and Zhu, G. 2012a. Flagella and bacterial pathogenicity. J. Basic Microbiol. 52: 1–8. doi:10.1002/jobm.201290001. PMID:22359233. Duan, Q., Zhou, M., Zhu, X., Bao, W., Wu, S., Ruan, X., et al. 2012b. The flagella of F18ab Escherichia coli is a virulence factor that contributes to infection in a IPEC-J2 cell model in vitro. Vet. Microbiol. 160(1–2): 132–140. doi:10.1016/j. vetmic.2012.05.015. PMID:22658629.
Can. J. Microbiol. Vol. 60, 2014
Duan, Q., Zhou, M., Zhu, X., Yang, Y., Zhu, J., Bao, W., et al. 2013. Flagella from F18+Escherichia coli play a role in adhesion to pig epithelial cell lines. Microb. Pathog. 55: 32–38. doi:10.1016/j.micpath.2012.09.010. PMID:23046699. Endo, Y., Tsurugi, K., Yutsudo, T., Takeda, Y., Ogasawara, T., and Igarashi, K. 1988. Site of action of a Vero toxin (VT2) from Escherichia coli O157:H7 and of Shiga toxin on eukaryotic ribosomes. RNA N-glycosidase activity of the toxins. Eur. J. Biochem. 171(1–2): 45–50. doi:10.1111/j.1432-1033.1988.tb13756.x. PMID:3276522. Fairbrother, J.M., Nadeau, E., and Gyles, C.L. 2005. Escherichia coli in postweaning diarrhea in pigs: an update on bacterial types, pathogenesis, and prevention strategies. Anim. Health Res. Rev. 6(1): 17–39. doi:10.1079/AHR2005105. PMID: 16164007. Frydendahl, K. 2002. Prevalence of serogroups and virulence genes in Escherichia coli associated with postweaning diarrhoea and edema disease in pigs and a comparison of diagnostic approaches. Vet. Microbiol. 85(2): 169–182. doi:10. 1016/S0378-1135(01)00504-1. PMID:11844623. Giron, J.A., Torres, A.G., Freer, E., and Kaper, J.B. 2002. The flagella of enteropathogenic Escherichia coli mediate adherence to epithelial cells. Mol. Microbiol. 44(2): 361–379. doi:10.1046/j.1365-2958.2002.02899.x. PMID:11972776. Gonzalez, B.A., Zuo, R., Hashimoto, Y., Yang, L., Bentley, W.E., and Wood, T.K. 2006. Autoinducer 2 controls biofilm formation in Escherichia coli through a novel motility quorum-sensing regulator (MqsR, B3022). J. Bacteriol. 188(1): 305–316. doi:10.1128/JB.188.1.305-316.2006. PMID:16352847. Haigh, R., Kumar, B., Sandrini, S., and Freestone, P. 2013. Mutation design and strain background influence the phenotype of Escherichia coli luxS mutants. Mol. Microbiol. 88(5): 951–969. doi:10.1111/mmi.12237. PMID:23651217. Han, X.G., and Lu, C.P. 2009. Detection of autoinducer-2 and analysis of the profile of luxS and pfs transcription in Streptococcus suis serotype 2. Curr. Microbiol. 58(2): 146–152. doi:10.1007/s00284-008-9291-9. PMID:18956225. Hayashi, F., Smith, K.D., Ozinsky, A., Hawn, T.R., Yi, E.C., Goodlett, D.R., et al. 2001. The innate immune response to bacterial flagellin is mediated by Tolllike receptor 5. Nature, 410(6832): 1099–1103. doi:10.1038/35074106. PMID: 11323676. Horie, M., Ogawa, H., Yoshida, Y., Yamada, K., Hara, A., Ozawa, K., et al. 2008. Inactivation and morphological changes of avian influenza virus by copper ions. Arch. Virol. 153(8): 1467–1472. doi:10.1007/s00705-008-0154-2. PMID: 18592130. Imberechts, H., Bertschinger, H.U., Stamm, M., Sydler, T., Pohl, P., De Greve, H., et al. 1994. Prevalence of F107 fimbriae on Escherichia coli isolated from pigs with oedema disease or postweaning diarrhoea. Vet. Microbiol. 40(3–4): 219– 230. doi:10.1016/0378-1135(94)90111-2. PMID:7941287. Imberechts, H., Wild, P., Charlier, G., De Greve, H., Lintermans, P., and Pohl, P. 1996. Characterization of F18 fimbrial genes fedE and fedF involved in adhesion and length of enterotoxemic Escherichia coli strain 107/86. Microb. Pathog. 21(3): 183–192. doi:10.1006/mpat.1996.0053. PMID:8878015. Jeon, B., and Itoh, K. 2007. Production of shiga toxin by a luxS mutant of Escherichia coli O157:H7 in vivo and in vitro. Microbiol. Immunol. 51(4): 391–396. doi:10.1111/j.1348-0421.2007.tb03926.x. PMID:17446678. Kim, J.C., Yoon, J.W., Kim, J.B., Oh, K.H., Park, M.S., Lee, B.K., and Cho, S.H. 2010. Omics-based analysis of the luxS mutation in a clinical isolate of Escherichia coli O157:H7 in Korea. J. Microbiol. Biotechnol. 20(2): 415–424. PMID:20208450. Li, J., Attila, C., Wang, L., Wood, T.K., Valdes, J.J., and Bentley, W.E. 2007. Quorum sensing in Escherichia coli is signaled by AI-2/LsrR: effects on small RNA and biofilm architecture. J. Bacteriol. 189(16): 6011–6020. doi:10.1128/JB.00014-07. PMID:17557827. Li, L., Zhou, R., Li, T., Kang, M., Wan, Y., Xu, Z., and Chen, H. 2008. Enhanced biofilm formation and reduced virulence of Actinobacillus pleuropneumoniae luxS mutant. Microb. Pathog. 45(3): 192–200. doi:10.1016/j.micpath.2008.05. 008. PMID:18585450. Lindgren, S.W., Samuel, J.E., Schmitt, C.K., and O’Brien, A.D. 1994. The specific activities of Shiga-like toxin type II (SLT-II) and SLT-II-related toxins of enterohemorrhagic Escherichia coli differ when measured by Vero cell cytotoxicity but not by mouse lethality. Infect. Immun. 62(2): 623–631. PMID:8300218. Ling, H., Kang, A., Tan, M.H., Qi, X., and Chang, M.W. 2010. The absence of the luxS gene increases swimming motility and flagella synthesis in Escherichia coli K12. Biochem. Biophys. Res. Commun. 401(4): 521–526. doi:10.1016/j.bbrc.2010. 09.080. PMID:20875395. Mainil, J.G., Jacquemin, E., Pohl, P., Kaeckenbeeck, A., and Benz, I. 2002. DNA sequences coding for the F18 fimbriae and AIDA adhesin are localised on the same plasmid in Escherichia coli isolates from piglets. Vet. Microbiol. 86(4): 303–311. doi:10.1016/S0378-1135(02)00019-6. PMID:11955780. Miao, E.A., Alpuche-Aranda, C.M., Dors, M., Clark, A.E., Bader, M.W., Miller, S.I., et al. 2006. Cytoplasmic flagellin activates caspase-1 and secretion of interleukin 1 via Ipaf. Nat. Immunol. 7(6): 569–575. doi:10.1038/ni1344. PMID: 16648853. Nagy, B., and Fekete, P.Z. 2005. Enterotoxigenic Escherichia coli in veterinary medicine. Int. J. Med. Microbiol. 295(6–7): 443–454. doi:10.1016/j.ijmm.2005. 07.003. PMID:16238018. Parthasarathy, G., Yao, Y., and Kim, K.S. 2007. Flagella promote Escherichia coli K1 association with and invasion of human brain microvascular endothelial cells. Infect. Immun. 75(6): 2937–2945. doi:10.1128/IAI.01543-06. PMID:17371850. Pott, J., and Hornef, M. 2012. Innate immune signalling at the intestinal epithePublished by NRC Research Press
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by San Diego (UCSD) on 06/07/15 For personal use only.
Yang et al.
lium in homeostasis and disease. EMBO Rep. 13(8): 684–698. doi:10.1038/ embor.2012.96. PMID:22801555. Pratt, L.A., and Kolter, R. 1998. Genetic analysis of Escherichia coli biofilm formation: roles of flagella, motility, chemotaxis and type I pili. Mol. Microbiol. 30(2): 285–293. doi:10.1046/j.1365-2958.1998.01061.x. PMID:9791174. Ren, T., Zamboni, D.S., Roy, C.R., Dietrich, W.F., and Vance, R.E. 2006. Flagellindeficient Legionella mutants evade caspase-1- and Naip5-mediated macrophage immunity. PLoS Pathog. 2(3): e18. doi:10.1371/journal.ppat.0020018. PMID:16552444. Rickard, A.H., Palmer, R.J., Blehert, D.S., Campagna, S.R., Semmelhack, M.F., Egland, P.G., et al. 2006. Autoinducer 2: a concentration-dependent signal for mutualistic bacterial biofilm growth. Mol. Microbiol. 60(6): 1446–1456. doi: 10.1111/j.1365-2958.2006.05202.x. PMID:16796680. Salazar-Gonzalez, H., and Navarro-Garcia, F. 2011. Intimate adherence by enteropathogenic Escherichia coli modulates TLR5 localization and proinflammatory host response in intestinal epithelial cells. Scand. J. Immunol. 73(4): 268–283. doi:10.1111/j.1365-3083.2011.02507.x. PMID:21204905. Scaletsky, I.C., Silva, M.L., and Trabulsi, L.R. 1984. Distinctive patterns of adherence of enteropathogenic Escherichia coli to HeLa cells. Infect. Immun. 45(2): 534–536. PMID:6146569. Smith, K.D., Andersen-Nissen, E., Hayashi, F., Strobe, K., Bergman, M.A., Barrett, S.L., et al. 2003. Toll-like receptor 5 recognizes a conserved site on flagellin required for protofilament formation and bacterial motility. Nat. Immunol. 4(12): 1247–1253. doi:10.1038/ni1011. PMID:14625549. Sperandio, V., Torres, A.G., Giron, J.A., and Kaper, J.B. 2001. Quorum sensing is a global regulatory mechanism in enterohemorrhagic Escherichia coli O157:H7. J. Bacteriol. 183(17): 5187–5197. doi:10.1128/JB.183.17.5187-5197.2001. PMID: 11489873. Sperandio, V., Torres, A.G., and Kaper, J.B. 2002. Quorum sensing Escherichia coli regulators B and C (QseBC): a novel two-component regulatory system involved in the regulation of flagella and motility by quorum sensing in E. coli. Mol. Microbiol. 43(3): 809–821. doi:10.1046/j.1365-2958.2002.02803.x. PMID: 11929534.
361
Stecher, B., Hapfelmeier, S., Muller, C., Kremer, M., Stallmach, T., and Hardt, W.D. 2004. Flagella and chemotaxis are required for efficient induction of Salmonella enterica serovar Typhimurium colitis in streptomycin-pretreated mice. Infect. Immun. 72(7): 4138–4150. doi:10.1128/IAI.72.7.4138-4150.2004. PMID:15213159. Stecher, B., Barthel, M., Schlumberger, M.C., Haberli, L., Rabsch, W., Kremer, M., and Hardt, W.-D. 2008. Motility allows S. Typhimurium to benefit from the mucosal defence. Cell. Microbiol. 10(5): 1166–1180. doi:10.1111/j.1462-5822. 2008.01118.x. PMID:18241212. Tallant, T., Deb, A., Kar, N., Lupica, J., de Veer, M.J., and DiDonato, J.A. 2004. Flagellin acting via TLR5 is the major activator of key signaling pathways leading to NF-B and proinflammatory gene program activation in intestinal epithelial cells. BMC Microbiol. 4: 33. doi:10.1186/1471-2180-4-33. PMID: 15324458. Vijay-Kumar, M., Carvalho, F.A., Aitken, J.D., Fifadara, N.H., and Gewirtz, A.T. 2010. TLR5 or NLRC4 is necessary and sufficient for promotion of humoral immunity by flagellin. Eur. J. Immunol. 40(12): 3528–3534. doi:10.1002/eji. 201040421. PMID:21072873. Walters, M., and Sperandio, V. 2006. Quorum sensing in Escherichia coli and Salmonella. Int. J. Med. Microbiol. 296(2–3): 125–131. doi:10.1016/j.ijmm.2006. 01.041. PMID:16487745. Waters, C.M., Lu, W., Rabinowitz, J.D., and Bassler, B.L. 2008. Quorum sensing controls biofilm formation in Vibrio cholerae through modulation of cyclic di-GMP levels and repression of vpsT. J. Bacteriol. 190(7): 2527–2536. doi:10. 1128/JB.01756-07. PMID:18223081. Yu, Y., Zeng, H., Lyons, S., Carlson, A., Merlin, D., Neish, A.S., et al. 2003. TLR5mediated activation of p38 MAPK regulates epithelial IL-8 expression via posttranscriptional mechanism. Am. J. Physiol. Gastrointest. Liver Physiol. 285(2): G282–G290. doi:10.1152/ajpgi.00503.2002. PMID:12702497. Zhu, C., Feng, S., Sperandio, V., Yang, Z., Thate, T.E., Kaper, J.B., et al. 2007. The possible influence of LuxS in the in vivo virulence of rabbit enteropathogenic Escherichia coli. Vet. Microbiol. 125(3–4): 313–322. doi:10.1016/j.vetmic.2007.05. 030. PMID:17643872.
Published by NRC Research Press
