Cellular Signalling 27 (2015) 1198–1207
Contents lists available at ScienceDirect
Cellular Signalling journal homepage: www.elsevier.com/locate/cellsig
Rap2a is a novel target gene of p53 and regulates cancer cell migration and invasion Jin-Xia Wu a, Ding-Guo Zhang a, Jun-Nian Zheng a,b,⁎, Dong-Sheng Pei a,⁎ a b
Jiangsu Key Laboratory of Biological Cancer Therapy, Xuzhou Medical College, Xuzhou 221002, China Center of Clinical Oncology, Affiliated Hospital of Xuzhou Medical College, Xuzhou 221002, China
a r t i c l e
i n f o
Article history: Received 20 November 2014 Received in revised form 6 February 2015 Accepted 23 February 2015 Available online 26 February 2015 Keywords: p53 Rap2a Invasion Migration p-Akt
a b s t r a c t The p53 transcription factor is a critical regulator of the cell cycle, DNA repair, and apoptosis. Recent evidences suggest that p53 may contribute to the regulation of cell invasion and migration. Rap2a, a member of the small GTPase superfamily, mediates diverse cellular events such as cell adhesion, migration and proliferation through various signaling pathways. In this study, we identify that Rap2a is a novel target of p53 and is induced upon DNA damage in a p53-dependent manner. Upon DNA damage, p53 directly binds to the promoter of Rap2a and activates its transcription. We show that Rap2a is significantly upregulated in many types of tumors. In addition, the ectopic expression of Rap2a enhances the migration and invasive ability of cancer cells and increases activities of matrix metalloproteinase MMP2 and MMP9. In contrast, the inactivation of Rap2a inhibits cell invasion and activities of MMP2 and MMP9. We also show that Rap2a regulates the phosphorylation level of Akt. Collectively, our results show that ectopic expression of Rap2a has a key role in enhancing migration, invasion and metastasis by upregulating p-Akt. © 2015 Elsevier Inc. All rights reserved.
1. Introduction p53 is a transcription factor whose ability to suppress tumorigenesis has been extensively studied. In response to inappropriate growth signals and various types of cellular stress, p53 binds to chromatin and activates or represses numerous downstream genes that elicit many cellular outcomes, such as cell cycle arrest, apoptosis, senescence and DNA repair [16,20,28]. Thus, p53 plays a pivotal role in maintaining genome integrity and regulating both cell growth and cell proliferation during times of stress. Emerging evidences indicate that the contribution of p53 is not restricted to its well-known anti-proliferative activities, but is extended to other stages of cancer development, i.e. the modulation of cell migration and invasion. Is p53, often dubbed “tumor suppressor,” also a suppressor of cell invasion and migration? Accumulating evidence has pointed to an alternative role of p53 in the curtailment of tumor progression and colonization of secondary sites by negatively regulating tumor cell metastasis [21,23]. Valuable clues can also be gleaned from studying the effects of wild-type p53 and its mutants on the tumor cell invasion. Mutations in p53 that result in a loss of its wild-type function in cell growth suppression often cause a gain of functions in cell migration and invasion [7,26,27]. Nagashima ⁎ Corresponding authors at: Jiangsu Key Laboratory of Biological Cancer Therapy, Xuzhou Medical College, Xuzhou 221002, China, 84 West Huai-hai Road, Xuzhou, Jiangsu, China. Tel.: +86 516 85582513. E-mail addresses: [email protected] (J.-N. Zheng), [email protected] (D.-S. Pei).
http://dx.doi.org/10.1016/j.cellsig.2015.02.026 0898-6568/© 2015 Elsevier Inc. All rights reserved.
et al. unexpectedly found that accumulation of wild-type p53 protein associated with subsequent recurrences of anaplastic meningiomas [29]. In accord with previous findings from patients, it was reported that the decreased motility of p53-deficient cells was observed in human colon and lung carcinoma cell lines [34]. Profound effects in human cancers made p53 an attractive therapeutic target. A better understanding of diverse functions of p53 is essential to elucidate its influences on the processes of migration and invasion. Rap proteins (Rap1a, b, Rap2a, b, c) belong to the Ras-related small GTP-binding protein superfamily that has mainly been implicated in many cellular processes [19,22,32]. Although Rap subfamily members bear a high structural similarity to Ras, they have distinct signaling mechanisms in time and space and show unique biological effects [13, 36]. Most notably, Rap plays a critical role in regulating the function of integrin and cell adhesion, thereby controlling cell motility and cell/matrix interactions [6,17,24]. Beyond basic studies of cell biology, an increasing number of studies in the past decade have focused on the specific roles of Rap signal in specific functions of normal tissue systems as well as in cancer. It has been reported that Rap proteins affect the tissue invasiveness and metastasis of various human cancers [10,38]. Numerous studies have shown that the effects of p53 on cell motility are largely mediated through the regulation of Rho signaling, thereby controlling actin cytoskeletal reorganization [12,14,35]. While Rap2a and Rho are members of the Ras superfamily of GTPases, we speculate that there is a relationship between p53 and Rap2a which influence the migration of tumor cells. Here, we identified Rap2a as a direct target of p53
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
and also found that Rap2a has an important role in cancer cell invasion and migration. We demonstrate that Rap2a exerts its invasive potential by regulating the phosphorylation level of Akt.
2. Materials and methods
1199
Table 1 siRNA duplexes used for knockdown of Rap2a. Name
siRNA duplexes
si-Rap2a#1 5′-GUGGACCUGGAAAGUGAGATT-3′ 5′-UCUCACUUUCCAGGUCCACTT-3′ si-Rap2a#2 5′-GACGAACUCUUUGCAGAAATT-3′ 5′-UUUCUGCAAAGAGUUCGUCTT-3′ si-Rap2a#3 5′-GCUGUUCUGCAUGUAACAUTT-3′ 5′-AUGUUACAUGCAGAACAGCTT-3′
2.1. Cell lines and growth condition U2OS (human osteosarcoma cell lines) and H1299 (human nonsmall cell lung cancer cell lines) were purchased from the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China). PC-3 and 786-O cell lines were cultured in RPMI 1640 medium (Gibco-BRL, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS, Invitrogen). The remaining cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM, Gibco) supplemented with 10% FBS.
2.2. Plasmid construction Total RNA was extracted from U2OS cells by using the Qiagen RNeasy kit (Qiagen, Germantown, MD, USA), and first-strand cDNA was synthesized by with the PrimeScript RT reagent kit (Takara) according to the manufacturer's instructions. Then, the cDNA for Rap2a was amplified using Taq polymerase, and the following primers:
2.6. Western blotting The protein samples were denatured, electrophoresed on SDS–polyacrylamide gels, transferred to nitrocellulose membranes and incubated overnight at 4 °C with primary antibodies: Rap2a (anti-rabbit, 1:500; Abcam), p53 (anti-mouse, 1:1000; Santa Cruz), p21 (anti-rabbit, 1:1000; Santa Cruz), Bcl-2 (anti-rabbit, 1:1000; Santa Cruz), Bax (antirabbit, 1:1000; Santa Cruz), Akt (anti-rabbit, 1:1000; Abcam), p-Akt (Ser473) (anti-rabbit, 1:1000; Abcam), β-actin (anti-mouse, 1:1000; Santa Cruz). After incubating with infrared-labeled secondary antibodies for 2 h at room temperature, the membranes were scanned using OdysseyTM Infrared Imager (LI-COR Biosciences, Lincoln, NE). Nonspecific binding was blocked using a 5% fat-free milk solution. Data representative of three experimental replicates is shown. We performed immunoblotting analysis with the known p53 target gene p21 as a positive control.
5′-GAAGCTTATGCGCGAGTACAAAG-3′, forward,
2.7. Chromatin immunoprecipitation assay
5′-GGAATTCCTATTGTATGTTACATG-3′, reverse.
Chromatin immunoprecipitation (ChIP) assays were performed by using the ChIP Assay Kit (Beyotime Biotechnology) and antibody against p53 (Merck Millipore). The cells which were treated with actinomycin D (5 nM for 24 h) were crosslinked with a 1% formaldehyde solution for 10 min at 37 °C. The cells were then lysed in 200 μl of SDS lysis buffer and were sonicated to generate 200–800 bp DNA fragments. After centrifugation, the cleared supernatant was diluted 10-fold with ChIP dilution buffer and was split into two equal portions; one portion was incubated with p53 antibody (1 μg) at 4 °C for 16 h and the other portion was used as a negative control (IgG). One twentieth of the volume of the total extract was used for PCR amplification as the input control. Immune complexes were precipitated, washed and eluted, and DNA–protein crosslinks were reversed by heating at 65 °C for 4 h. The DNA fragments were purified and recovered DNA was submitted for PCR amplification. Then, the DNA was amplified using Taq polymerase and certain primers (Table 2). The putative responsive elements in human Rap2a gene were predicted by p53 scan software. P1 was the sequence of the p53 responsive elements which contain “AAATATGCTCCGACCTGTCA”. P2 was the period of a random selection of the gene sequence as a negative control.
Consensus sequences for the restriction enzymes ECoRI (in the forward primers) and HindIII (in the reverse primers) are underlined. The cDNA was then subcloned into the bacterial expression vector pcDNA3.1 at ECoRI and HindIII sites. The identity of the resulting clones was verified by sequencing.
2.3. Induction of Rap2a in cells U2OS and H1299 cells were treated with 5 nM actinomycin D, 15 μM cisplatin or 40 J/m2 UV for various times as indicated. Cells were then harvested for protein and mRNA analyses using immunoblotting and reverse transcription and RT-PCR, respectively.
2.4. Ectopic expression of Rap2a Cells were grown to 90% confluence before being transiently transfected with pcDNA3.1-control and pcDNA3.1-Rap2a expression plasmids using Lipofectamine 2000 (Invitrogen, Shanghai, China) according to the manufacturer's instructions. Six hours after transfection, the medium containing transfection reagents was removed and incubated in fresh medium. The Rap2a overexpressed cells were harvested for subsequent experiments.
2.5. Knockdown of Rap2a Rap2a siRNA and p53 siRNA were purchased from Gene-Pharma (Shanghai, China) and were transfected using siLentFect Lipid Reagent (Bio-Rad, Hercules, CA, USA) according to the manufacturer's instructions. Three sets of siRNA duplexes targeting human Rap2a are listed in Table 1. Unless otherwise indicated, Rap2a knockdown experiments were conducted with si-Rap2a#3. A non-specific siRNA (5′-UUCUCCGAACGU GUCACGUTT-3′, 5′-ACGUGACACGUUCGGAGAATT-3′) was transfected as a control. Knockdown efficiency was assessed by western blotting.
2.8. Cell proliferation assay For proliferation, cells were seeded (1 × 104/well) into 96-well culture plates after 6 h transfection and incubated for 24, 48, 72 and 96 h respectively. Then, 100 μl serum-free culture medium and 10 μl CCK-8 solution were added into each well, followed by incubation at 37 °C Table 2 Primers used for PCR. Name
Primer
Primer sequencing (5′ → 3′)
Rap2a (P1)
F R F R F R
TGCTGGCATCGGAATGAAC GCTCAGTACCATAAAGGTTG ATGTGACCGAGGCTATGA CAGGAGGATTTGAGTATTTC GGACTGGGCACTCTTGTC GTTCAGAGTAACAGGCTAAG
Rap2a (P2) p21
1200
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
Fig. 1. Human Rap2a gene is a p53 target gene in response to DNA damage. (A) Primary U2OS and H1299 cells were treated with actinomycin D (5 nM) for 24 h and the cells were harvested. Reverse transcription PCR analyses were performed to measure the induction of Rap2a. GAPDH was used as internal control to normalize the values. (B) Western blot analyses to measure the protein levels of Rap2a, p53, p21 and β-actin in U2OS and H1299 cells treated with actinomycin D (0, 1, 5, and 10 nM). Endogenous reference was β-actin. (C) Western blot analyses of Rap2a, p53, p21 and β-actin in U2OS and H1299 cells treated with actinomycin D (5 nM) for various times. (D) Western blot analysis of the relative protein levels of Rap2a, p53, p21 and β-actin in p53 knockdown and control cells. (E) ChIP analysis of interactions between p53 and Rap2a gene in human osteosarcoma cells. p53 binds to and transactivates the p53 responsive element (P1) in human Rap2a gene. Cells were treated with actinomycin D (5 nM for 24 h) before ChIP assays. Input DNA, 1/20 DNA of ChIP. All experiments were carried out in triplicate. *P b 0.05, **P b 0.01.
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
1201
Fig. 1 (continued).
for 2 h. Absorbance was recorded using an ELX-800 spectrometer reader (Bio-Tek Instruments, Winooski, USA). 2.9. Annexin V/FITC binding assay Cell culture and treatment were performed as described above. Cells were washed with ice-cold PBS twice and then incubated with 200 μl 1 × binding buffer containing 5 μl Annexin V-FITC for 15 min and in 300 μl 1 × binding buffer containing 5 μl propidium iodide (PI) for 5 min at room temperature in the dark. After incubation, cells were visualized under a fluorescence microscope. 2.10. Cell migration and invasion assay, scratch wound healing assay, and gelatin zymography The methods were performed as described previously [25]. 2.11. Statistical analysis All values are shown as means ± SD. Student's t-tests or one-way analysis of the variance (ANOVA) was performed for determination of P values with SPSS 16.0 software (SPSS). All experiments were performed at least three times unless otherwise indicated. P values b 0.05 were considered statistically significant.
contrast, there was no significant difference in H1299 cells. To determine whether the increased Rap2a mRNA was accompanied by increased protein expression, the Rap2a protein level was examined by an immunoblotting assay. The result demonstrated that the protein levels of Rap2a also increased in U2OS cells treated with different concentrations of actinomycin D (Fig. 1B). In addition, we observed similar induction of Rap2a in the cells treated with 5 nM actinomycin D at different time points (Fig. 1C). However, increased Rap2a expression was not observed in H1299 cells following actinomycin D treatment (Fig. 1B and C), which is consistent with the result of RT-PCR analysis. Furthermore, the induction of Rap2a by p53 was inhibited by p53 siRNA (Fig. 1D). As a transcription factor, p53 binds to specific DNA sequences in target genes to activate gene expression. The above results prompted us to investigate whether p53 regulates Rap2a expression through its direct binding to the p53 responsive elements in human Rap2a promoter region and intron. U2OS cells were treated with 5 nM actinomycin D to activate p53, and ChIP assays were performed. Crosslinked chromatin complexes from these cells were immunoprecipitated with an anti-p53 antibody. The anti-p53 antibody specifically pulled down the DNA fragment in Rap2a in U2OS cells treated with actinomycin D, but not in untreated cells (Fig. 1E). These results demonstrate that p53 directly binds to the Rap2a promoter and regulates its expression. 3.2. Rap2a is induced by cisplatin and UV in a p53-dependent manner
3. Results 3.1. Human Rap2a gene is a p53 target gene in response to DNA damage To investigate whether p53 transcriptionally regulates Rap2a gene in response to DNA damage, RT-PCR assays were performed after treatment with 5 nM actinomycin D. A pair of p53 wild-type and p53deficient human tumor cell lines, U2OS and H1299, respectively, were used. As shown in Fig. 1A, Rap2a mRNA expression levels were significantly upregulated after actinomycin D treatment in U2OS cells. In
Because p53 is a stress-inducible protein and is activated by various stresses, we investigated whether other types of stresses could also induce the upregulation of Rap2a through p53. To address this question, U2OS cells were treated with cisplatin or UV followed by western blot analysis with Rap2a and p53 antibodies. Of note, both cisplatin and UV activated and stabilized p53 in U2OS cells, as judged by the increase of p53 protein levels. The protein levels of Rap2a also increased significantly in U2OS cells treated with cisplatin or UV and this effect can be downregulated by p53 siRNA (Fig. 2).
1202
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
Fig. 2. Rap2a is induced by cisplatin and UV in a p53-dependent manner. (A) Cells were transfected with p53 siRNA or control siRNA and then exposed to actinomycin D, cisplatin and UV. Rap2a and p53 were examined 24 h after exposure. The data represent three independent experiments. (B) Densitometric analysis of Rap2a. The intensity of Rap2a was quantified by densitometry (software: Image J, NIH). The data are presented as mean ± SD from three independent experiments. **P b 0.01.
3.3. Rap2a protein expression in human tumor cell lines To investigate the profiles of Rap2a in the pathogenesis of human cancers, we determined their expression levels in human osteosarcoma cell line U2OS, lung cancer cell line H1299 and A549, breast cancer cell line MCF-7, cervical cancer cell line HELA, prostatic cancer cell line PC3, renal carcinoma cell line 786-O and liver cancer cell line HEPG2. Representative results by western blotting were illustrated in Fig. 3. Analyses of the band densities revealed that the expression levels of Rap2a were predominantly increased.
3.4. Overexpression of Rap2a promotes cancer cell invasion and migration Despite overexpressed in cancer cells, the molecular mechanism responsible for Rap2a overexpression is not well understood. To examine the effects of Rap2a on cancer cell motility, we transfected transiently Rap2a expression vector or control vector into U2OS cells (Fig. 4A). Scratch assay and transwell assays revealed a significant increase in the invasion and migration of Rap2a-overexpressing cells when compared with the control cells (Fig. 4B–D). Tumor cell invasion involves the proteolytic degradation of extracellular matrix components by tumor cellsecreted proteases, including matrix metalloproteinases (MMPs) [2]. Elevated levels of MMPs have been found in many tumors and are believed to play a pivotal role in cellular invasion and metastasis [5]. Thus, we performed gelatin zymography to measure the MMP activities in U2OS cells.
Our results showed that matrix metalloproteinase-2 (MMP2) and matrix metalloproteinase-2 (MMP9) secretion was significantly increased in Rap2a-overexpressing U2OS cells (Fig. 4E). 3.5. Downregulation of Rap2a inhibits cancer cell invasion and migration Our observations that ectopic expression of Rap2a promotes cell motility and enhanced the secretion of MMP2 and MMP9 in turn prompted us to investigate whether Rap2a inhibition could suppress cell migration, leading to the reduction of secretion of MMP2 and MMP9. To address this possibility, we next investigated the role of Rap2a in cancer cell migration and invasion after transfecting U2OS cells with Rap2a siRNA or control siRNA (Fig. 5A). Scratch assay and transwell assays revealed that knockdown of Rap2a inhibits cell migration and invasion (Fig. 5B–D). Similar patterns were observed in gelatin zymography (Fig. 5E). 3.6. Rap2a has no effect on the proliferation of cancer cells Based on the result from cell migration, we test whether Rap2a regulated tumor cell proliferation. Cell viability was determined by CCK-8 assay and Annexin V/PI assay. After transfecting U2OS cells with Rap2a expression vector or control vector, we did not observe an obvious effect of Rap2a on the cell proliferation. Consistent with previous result, there was no detectable difference of cell apoptosis between Rap2a siRNA and control siRNA (Fig. 6A and B). In addition, no significant
Fig. 3. Rap2a protein expression in human tumor cell lines. (A) The levels of endogenous Rap2a protein in different cancer cells were measured by western blot. (B) Densitometric analysis of Rap2a. The intensity of Rap2a was quantified by densitometry (software: Image J, NIH). The data are presented as mean ± SD from three independent experiments. *P b 0.05, **P b 0.01.
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
1203
Fig. 4. Overexpression of Rap2a promotes cancer cell invasion and migration. (A) U2OS cells were transfected with the Rap2a expressing or empty vector. Twenty-four hours post-transfection, cell lysates were prepared and the expression of Rap2a was detected by immunoblot analysis using rabbit polyclonal antibodies to Rap2a. Western blot analyses demonstrated the ectopic expression of Rap2a. (B) Scratch assay was performed after Rap2a restoration in U2OS cells. (C–D) Cell invasion was measured by using a Matrigel invasion assay following the transduction of U2OS cells with Rap2a expression plasmid. Migration assays were performed by using a similar procedure, except the polycarbonate filters were not coated with Matrigel. (E) The relative enzyme activities of cleaved-MMP2 and cleaved-MMP9 were measured by gelatin zymography analysis following transfection with a Rap2a expression vector or an empty vector. *P b 0.05, **P b 0.01.
1204
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
Fig. 5. Downregulation of Rap2a inhibits cancer cell invasion and migration. (A) U2OS cells were transiently transfected with human Rap2a siRNA using Lipofectamine 2000. Three sets of siRNA duplexes targeting human Rap2a were analyzed by immunoblotting. All transfections were independently performed thrice. Unless otherwise indicated, Rap2a knockdown experiments were conducted with si-Rap2a#3. (B) Scratch assay was performed after knockdown of Rap2a. There was significant delay in wound closure after Rap2a knockdown compared with the control. (C–D) Cell invasion was measured by a Matrigel invasion assay following transfection with Rap2a siRNA. Migration assays were performed using a similar procedure, except that the polycarbonate filters were not coated with Matrigel. (E) Gelatin zymography analysis of the relative enzyme activities of cleaved-MMP2 and cleaved-MMP9 in Rap2a knockdown and siRNA control. *P b 0.05, **P b 0.01.
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
change in the expression levels of Bcl-2, Bax and caspase-3 was found in Rap2a-transfected cells (Fig. 7). 3.7. Akt phosphorylation involved in Rap2a-mediated cancer cell migration and invasion Cell metastasis through the tissues is caused by highly integrated multistep cellular events regulated by various signaling molecules, including PI3K/Akt and MMPs [31]. Akt (also known as protein kinase B or PKB) plays a role in the regulation of cell proliferation, survival and metabolism. Dysregulation of Akt leads to diseases of major unmet medical need such as cancer, diabetes, cardiovascular and neurological diseases [18]. Growing evidence reveals that MMP2 and MMP9 secretions and invasion of tumor cells are associated with PI3K/Akt signaling pathways [31,39,40]. Blocking the PI3K/Akt pathway by PI3K inhibitor LY294002 resulted in a reduced expression of MMP2 and MMP9. Western blot analyses revealed that Rap2a overexpression significantly increased the phosphorylation of Akt. In contrast, downregulation of Rap2a decreased the phosphorylation of Akt (Fig. 7–8). 4. Discussion Tumor progression is a multistep process and cancers arise as a result of somatic mutations that produce oncogenes or affect functions of tumor suppressor genes [37]. The two fundamental features of cancer cells are uncontrolled proliferation and invasion [15]. Metastasis
1205
remains one of most complex and challenging problems of oncology. Although extensively studied for p53 in the control of cell cycle and apoptosis, recent studies have suggested that p53 is responsible for other cellular functions, in particular cell migration [26]. Overwhelming data have been accumulated on negative regulation of p53 to cell migration and invasion. However, there is also an opposite argument that loss of p53 function correlated with decreased cell migration [34]. Thus, it is not yet possible to attribute an entire function of p53 to any one of its target gene, we propose that Rap2a is a mediator of p53 in the regulation of cancer cell invasion and migration. The present study shows that Rap2a is a p53 target gene, which provides additional insight into p53-mediated tumor migration. The Rap proteins define a family of low molecular weight GTP-binding proteins that share most sequence homology with the product of the Ras proto-oncogene [30]. Since their discovery, Rap1 proteins have elicited much more interest than Rap2 proteins. Emerging evidence shows that aberrant activation of Rap1 increases proliferation and invasion of cancer cells [1,9]. Consistent with this finding, Rap1GAP inhibits cytoskeletal remodeling and motility in thyroid cancer cells [11]. More recently, however, it has been evidenced that Rap2 proteins may regulate cell adhesion similar to Rap1 protein [24]. Our data suggest that Rap2a is a novel p53 target and is regulated by p53 at the transcriptional level. DNA damage such as treatment with actinomycin D, cisplatin or UV radiation not only increases the binding of p53 to chromatin but also switches on p53 to induce Rap2a. Thus far, p53 regulates the expression of Rap2a in the presence of extrinsic DNA damage stress. As a
Fig. 6. Rap2a has no effect on the proliferation of cancer cells. (A) After the effective knockdown or ectopic expression of Rap2a, cell viability was determined by CCK-8 assay. (B) U2OS cells were transfected with Rap2a plasmid DNA or siRNA, early apoptosis (cell membrane displays green) and late nuclear apoptosis (nuclei displays red) were stained by Annexin V and PI respectively, and then observed in the fluorescence microscope (magnification × 200).
1206
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
Fig. 7. Akt phosphorylation involved in Rap2a-mediated cancer cell migration and invasion. (A) The total and phosphorylated Akt were determined by western blotting after the effective knockdown or ectopic expression of Rap2a. p-Akt level was significantly increased after Rap2a overexpression. In addition, the protein levels of Bcl-2, Bax and caspase-3 were analyzed by immunoblotting. (B) Densitometric analysis of p-Akt473. The intensity of p-Akt473 was quantified by densitometry (software: Image J, NIH). The data are presented as mean ± SD from three independent experiments. **P b 0.01.
comparison, the underlying mechanisms of p53-mediated Rap2a in the absence of DNA damage are still unknown and the rest functions of Rap2a in tumor cells will be investigated in future studies. Recently, Prabakaran et al. demonstrated that Rap2a is upregulated in invasive cells dissected from follicular thyroid cancer [33]. However, Bigler et al. suggested that the proportion of activated Rap2 was significantly reduced in prostate cancer cells [4]. The role of the activation of Rap2a in carcinogenesis remains controversial. Our result showed that Rap2a enhances migration and invasion of osteosarcoma cells and that this effect was at least partly mediated by increased MMP2 and MMP9 expression. In support of this view, immunoblotting demonstrated Rap2a is upregulated in many tumor types. In contrast, Rap2a
downregulation inhibits the migratory and invasive capacities of cancer cells. CCK-8 and Annexin V/PI assays indicated that Rap2a has no effect on the proliferation and apoptosis of cancer cells. Consistent with this conclusion, cancer cells treated with Rap2a did not show any changes in the expression levels of Bax, Bcl-2 and pro-caspased-3. These findings suggest that p53-inducible Rap2a can promote cancer cell motility. This result is consistent with a recent report that decreased motility of p53deficient cells was observed in human colon and lung carcinoma cell lines [34]. Furthermore, recent considerable data show that Rap2b, a novel p53 target, regulates p53-mediated pro-survival function [41]. Collectively, these findings seem to identify a new concept of p53 function in tumor invasion and metastasis. p53, as the “guardian of the
Fig. 8. Schematic diagram of relationship between p53 and Rap2a upon DNA damage and the role of Rap2a in tumorigenesis. (I) Upon DNA damage, p53 binds to the promoter of Rap2a and activates its transcription. (II) Rap2a increases activities of MMP2 and MMP9 and enhances the migration and invasive ability of cancer cells by upregulating p-Akt.
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
genome”, may use many different transcriptional repression mechanisms to regulate the balance between pro- and anti-invasion signaling. Many questions remain to be addressed, however. Matrix metalloproteinases (MMPs) are a family of highly homologous, zinc- and calcium-dependent extracellular enzymes [3]. Signals from tumor cells activate the production of MMPs, which degrade the extracellular membrane, thus aiding cell migration. MMP2 and MMP9 are of particular interest because of their role in early cancer development and progression [8]. Yang et al. demonstrated that selaginella tamariscina possessed antimetastatic effects by decreasing MMP2 and MMP9 secretions via Akt signaling pathways [39]. In addition, specific inhibitor of PI3-kinase and Akt significantly reduced the IR-induced invasiveness of glioma cells on Matrigel [31]. Trying to learn more about possible pathways leading to the Rap2a-mediated upregulation of MMP2 and MMP9, we tested whether Rap2a expression could modulate PI3-kinase activity. We found that overexpression of Rap2a enhanced Akt signaling, downregulated Rap2a contributed to a decrease in p-Akt. These findings indicate the involvement of PI3K/Akt pathway in Rap2a-induced MMP2 and MMP9 expression and invasion of tumor cells. Taken together, our findings suggest that p53 induces Rap2a activation, which triggers PI3K/Akt signaling pathways, leading to increased MMP2 and MMP9 expression and heightened invasiveness of cancer cells. The regulation of metastasis and invasion represent important therapeutic targets, as the inability to control metastasis and cancer invasion remains the most formidable obstacle to successful treatment. The identification of Rap2a as an important player in p53 signaling provides potentially important clues for controlling human diseases. Conflict of interest disclosures The authors declare no conflict of interest. Acknowledgments This work was supported by the National Natural Science Foundation of China (No. 81372172), the key project of the Education Department of China (212062) and the Science and Technology Department of Jiangsu Province (BK20130231, BK20141149). References [1] C.L. Bailey, P. Kelly, P.J. Casey, Cancer Res. 69 (2009) 4962–4968. [2] P. Basset, A. Okada, M.P. Chenard, R. Kannan, I. Stoll, P. Anglard, J.P. Bellocq, M.C. Rio, Matrix Biol. 15 (1997) 535–541. [3] G. Bergers, R. Brekken, G. McMahon, T.H. Vu, T. Itoh, K. Tamaki, K. Tanzawa, P. Thorpe, S. Itohara, Z. Werb, D. Hanahan, Nat. Cell Biol. 2 (2000) 737–744. [4] D. Bigler, D. Gioeli, M.R. Conaway, M.J. Weber, D. Theodorescu, Prostate. 67 (2007) 1590–1599.
1207
[5] M. Bjorklund, E. Koivunen, Biochim. Biophys. Acta. 1755 (2005) 37–69. [6] B. Boettner, L. Van Aelst, Curr. Opin. Cell Biol. 21 (2009) 684–693. [7] H.E. Boudreau, B.W. Casterline, D.J. Burke, T.L. Leto, Br. J. Cancer. 110 (2014) 2569–2582. [8] A.F. Chambers, L.M. Matrisian, J. Natl. Cancer Inst. 89 (1997) 1260–1270. [9] C.H. Chen, H.C. Chuang, C.C. Huang, F.M. Fang, H.Y. Huang, H.T. Tsai, L.J. Su, L.Y. Shiu, S. Leu, C.Y. Chien, Am. J. Pathol. 182 (2013) 516–528. [10] N.P. Crawford, A. Ziogas, D.J. Peel, J. Hess, H. Anton-Culver, K.W. Hunter, Breast Cancer Res. 8 (2006) R16. [11] X. Dong, W. Tang, S. Stopenski, M.S. Brose, C. Korch, J.L. Meinkoth, Endocr. Relat. Cancer. 19 (2012) 575–588. [12] G. Gadea, L. Roger, C. Anguille, M. de Toledo, V. Gire, P. Roux, J. Cell Sci. 117 (2004) 6355–6364. [13] M. Gloerich, J.L. Bos, Trends Cell Biol. 21 (2011) 615–623. [14] F. Guo, Y. Zheng, Oncogene. 23 (2004) 5577–5585. [15] D. Hanahan, R.A. Weinberg, Cell. 100 (2000) 57–70. [16] P. Hasty, B.A. Christy, Pathobiol. Aging Age Relat. Dis. 3 (2013). [17] M. Hattori, N. Minato, J. Biochem. 134 (2003) 479–484. [18] I. Hers, E.E. Vincent, J.M. Tavare, Cell. Signal. 23 (2011) 1515–1527. [19] M. Itoh, C.M. Nelson, C.A. Myers, M.J. Bissell, Cancer Res. 67 (2007) 4759–4766. [20] A.J. Levine, Cell. 88 (1997) 323–331. [21] S.O. Lim, H. Kim, G. Jung, FEBS Lett. 584 (2010) 2231–2236. [22] K.B. Lin, P. Tan, S.A. Freeman, M. Lam, K.M. McNagny, M.R. Gold, Oncogene. 29 (2010) 608–615. [23] A.S. Mak, Cell Adhes. Migr. 5 (2011) 144–149. [24] S.J. McLeod, A.J. Shum, R.L. Lee, F. Takei, M.R. Gold, J. Biol. Chem. 279 (2004) 12009–12019. [25] P.J. Mei, J. Bai, H. Liu, C. Li, Y.P. Wu, Z.Q. Yu, J.N. Zheng, J. Cancer Res. Clin. Oncol. 137 (2011) 1823–1830. [26] H. Momota, Y. Narita, Y. Matsushita, Y. Miyakita, S. Shibui, Brain Tumor Pathol. 27 (2010) 95–101. [27] P.A. Muller, P.T. Caswell, B. Doyle, M.P. Iwanicki, E.H. Tan, S. Karim, N. Lukashchuk, D.A. Gillespie, R.L. Ludwig, P. Gosselin, A. Cromer, J.S. Brugge, O.J. Sansom, J.C. Norman, K.H. Vousden, Cell. 139 (2009) 1327–1341. [28] P.A. Muller, K.H. Vousden, J.C. Norman, J. Cell Biol. 192 (2011) 209–218. [29] G. Nagashima, M. Aoyagi, M. Yamamoto, S. Yamamoto, H. Wakimoto, K. Ohno, K. Yamamoto, K. Hirakawa, Acta Neurochir. 141 (1999) 53–61 (discussion 60–51). [30] S. Paganini, G.F. Guidetti, S. Catricala, P. Trionfini, S. Panelli, C. Balduini, M. Torti, Biochimie. 88 (2006) 285–295. [31] C.M. Park, M.J. Park, H.J. Kwak, H.C. Lee, M.S. Kim, S.H. Lee, I.C. Park, C.H. Rhee, S.I. Hong, Cancer Res. 66 (2006) 8511–8519. [32] H.O. Park, J. Chant, I. Herskowitz, Nature. 365 (1993) 269–274. [33] I. Prabakaran, J.R. Grau, R. Lewis, D.L. Fraker, M.A. Guvakova, J. Thyroid. Res. 2011 (2011) 979840. [34] A.A. Sablina, P.M. Chumakov, B.P. Kopnin, J. Biol. Chem. 278 (2003) 27362–27371. [35] E. Sahai, C.J. Marshall, Nat. Cell Biol. 5 (2003) 711–719. [36] S. Sasagawa, Y. Ozaki, K. Fujita, S. Kuroda, Nat. Cell Biol. 7 (2005) 365–373. [37] C.J. Sherr, Cell. 116 (2004) 235–246. [38] Y. Shimizu, Y. Hamazaki, M. Hattori, K. Doi, N. Terada, T. Kobayashi, Y. Toda, T. Yamasaki, T. Inoue, Y. Kajita, A. Maeno, T. Kamba, Y. Mikami, T. Kamoto, T. Yamada, T. Kanno, K. Yoshikawa, O. Ogawa, N. Minato, E. Nakamura, Cancer Sci. 102 (2011) 828–836. [39] J.S. Yang, C.W. Lin, Y.S. Hsieh, H.L. Cheng, K.H. Lue, S.F. Yang, K.H. Lu, Food Chem. Toxicol. 59 (2013) 801–807. [40] X. Zhang, T. Chen, J. Zhang, Q. Mao, S. Li, W. Xiong, Y. Qiu, Q. Xie, J. Ge, Cancer Sci. 103 (2012) 181–190. [41] X. Zhang, Y. He, K.H. Lee, W. Dubois, Z. Li, X. Wu, A. Kovalchuk, W. Zhang, J. Huang, Cell Cycle. 12 (2013) 1279–1291.
Contents lists available at ScienceDirect
Cellular Signalling journal homepage: www.elsevier.com/locate/cellsig
Rap2a is a novel target gene of p53 and regulates cancer cell migration and invasion Jin-Xia Wu a, Ding-Guo Zhang a, Jun-Nian Zheng a,b,⁎, Dong-Sheng Pei a,⁎ a b
Jiangsu Key Laboratory of Biological Cancer Therapy, Xuzhou Medical College, Xuzhou 221002, China Center of Clinical Oncology, Affiliated Hospital of Xuzhou Medical College, Xuzhou 221002, China
a r t i c l e
i n f o
Article history: Received 20 November 2014 Received in revised form 6 February 2015 Accepted 23 February 2015 Available online 26 February 2015 Keywords: p53 Rap2a Invasion Migration p-Akt
a b s t r a c t The p53 transcription factor is a critical regulator of the cell cycle, DNA repair, and apoptosis. Recent evidences suggest that p53 may contribute to the regulation of cell invasion and migration. Rap2a, a member of the small GTPase superfamily, mediates diverse cellular events such as cell adhesion, migration and proliferation through various signaling pathways. In this study, we identify that Rap2a is a novel target of p53 and is induced upon DNA damage in a p53-dependent manner. Upon DNA damage, p53 directly binds to the promoter of Rap2a and activates its transcription. We show that Rap2a is significantly upregulated in many types of tumors. In addition, the ectopic expression of Rap2a enhances the migration and invasive ability of cancer cells and increases activities of matrix metalloproteinase MMP2 and MMP9. In contrast, the inactivation of Rap2a inhibits cell invasion and activities of MMP2 and MMP9. We also show that Rap2a regulates the phosphorylation level of Akt. Collectively, our results show that ectopic expression of Rap2a has a key role in enhancing migration, invasion and metastasis by upregulating p-Akt. © 2015 Elsevier Inc. All rights reserved.
1. Introduction p53 is a transcription factor whose ability to suppress tumorigenesis has been extensively studied. In response to inappropriate growth signals and various types of cellular stress, p53 binds to chromatin and activates or represses numerous downstream genes that elicit many cellular outcomes, such as cell cycle arrest, apoptosis, senescence and DNA repair [16,20,28]. Thus, p53 plays a pivotal role in maintaining genome integrity and regulating both cell growth and cell proliferation during times of stress. Emerging evidences indicate that the contribution of p53 is not restricted to its well-known anti-proliferative activities, but is extended to other stages of cancer development, i.e. the modulation of cell migration and invasion. Is p53, often dubbed “tumor suppressor,” also a suppressor of cell invasion and migration? Accumulating evidence has pointed to an alternative role of p53 in the curtailment of tumor progression and colonization of secondary sites by negatively regulating tumor cell metastasis [21,23]. Valuable clues can also be gleaned from studying the effects of wild-type p53 and its mutants on the tumor cell invasion. Mutations in p53 that result in a loss of its wild-type function in cell growth suppression often cause a gain of functions in cell migration and invasion [7,26,27]. Nagashima ⁎ Corresponding authors at: Jiangsu Key Laboratory of Biological Cancer Therapy, Xuzhou Medical College, Xuzhou 221002, China, 84 West Huai-hai Road, Xuzhou, Jiangsu, China. Tel.: +86 516 85582513. E-mail addresses: [email protected] (J.-N. Zheng), [email protected] (D.-S. Pei).
http://dx.doi.org/10.1016/j.cellsig.2015.02.026 0898-6568/© 2015 Elsevier Inc. All rights reserved.
et al. unexpectedly found that accumulation of wild-type p53 protein associated with subsequent recurrences of anaplastic meningiomas [29]. In accord with previous findings from patients, it was reported that the decreased motility of p53-deficient cells was observed in human colon and lung carcinoma cell lines [34]. Profound effects in human cancers made p53 an attractive therapeutic target. A better understanding of diverse functions of p53 is essential to elucidate its influences on the processes of migration and invasion. Rap proteins (Rap1a, b, Rap2a, b, c) belong to the Ras-related small GTP-binding protein superfamily that has mainly been implicated in many cellular processes [19,22,32]. Although Rap subfamily members bear a high structural similarity to Ras, they have distinct signaling mechanisms in time and space and show unique biological effects [13, 36]. Most notably, Rap plays a critical role in regulating the function of integrin and cell adhesion, thereby controlling cell motility and cell/matrix interactions [6,17,24]. Beyond basic studies of cell biology, an increasing number of studies in the past decade have focused on the specific roles of Rap signal in specific functions of normal tissue systems as well as in cancer. It has been reported that Rap proteins affect the tissue invasiveness and metastasis of various human cancers [10,38]. Numerous studies have shown that the effects of p53 on cell motility are largely mediated through the regulation of Rho signaling, thereby controlling actin cytoskeletal reorganization [12,14,35]. While Rap2a and Rho are members of the Ras superfamily of GTPases, we speculate that there is a relationship between p53 and Rap2a which influence the migration of tumor cells. Here, we identified Rap2a as a direct target of p53
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
and also found that Rap2a has an important role in cancer cell invasion and migration. We demonstrate that Rap2a exerts its invasive potential by regulating the phosphorylation level of Akt.
2. Materials and methods
1199
Table 1 siRNA duplexes used for knockdown of Rap2a. Name
siRNA duplexes
si-Rap2a#1 5′-GUGGACCUGGAAAGUGAGATT-3′ 5′-UCUCACUUUCCAGGUCCACTT-3′ si-Rap2a#2 5′-GACGAACUCUUUGCAGAAATT-3′ 5′-UUUCUGCAAAGAGUUCGUCTT-3′ si-Rap2a#3 5′-GCUGUUCUGCAUGUAACAUTT-3′ 5′-AUGUUACAUGCAGAACAGCTT-3′
2.1. Cell lines and growth condition U2OS (human osteosarcoma cell lines) and H1299 (human nonsmall cell lung cancer cell lines) were purchased from the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China). PC-3 and 786-O cell lines were cultured in RPMI 1640 medium (Gibco-BRL, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS, Invitrogen). The remaining cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM, Gibco) supplemented with 10% FBS.
2.2. Plasmid construction Total RNA was extracted from U2OS cells by using the Qiagen RNeasy kit (Qiagen, Germantown, MD, USA), and first-strand cDNA was synthesized by with the PrimeScript RT reagent kit (Takara) according to the manufacturer's instructions. Then, the cDNA for Rap2a was amplified using Taq polymerase, and the following primers:
2.6. Western blotting The protein samples were denatured, electrophoresed on SDS–polyacrylamide gels, transferred to nitrocellulose membranes and incubated overnight at 4 °C with primary antibodies: Rap2a (anti-rabbit, 1:500; Abcam), p53 (anti-mouse, 1:1000; Santa Cruz), p21 (anti-rabbit, 1:1000; Santa Cruz), Bcl-2 (anti-rabbit, 1:1000; Santa Cruz), Bax (antirabbit, 1:1000; Santa Cruz), Akt (anti-rabbit, 1:1000; Abcam), p-Akt (Ser473) (anti-rabbit, 1:1000; Abcam), β-actin (anti-mouse, 1:1000; Santa Cruz). After incubating with infrared-labeled secondary antibodies for 2 h at room temperature, the membranes were scanned using OdysseyTM Infrared Imager (LI-COR Biosciences, Lincoln, NE). Nonspecific binding was blocked using a 5% fat-free milk solution. Data representative of three experimental replicates is shown. We performed immunoblotting analysis with the known p53 target gene p21 as a positive control.
5′-GAAGCTTATGCGCGAGTACAAAG-3′, forward,
2.7. Chromatin immunoprecipitation assay
5′-GGAATTCCTATTGTATGTTACATG-3′, reverse.
Chromatin immunoprecipitation (ChIP) assays were performed by using the ChIP Assay Kit (Beyotime Biotechnology) and antibody against p53 (Merck Millipore). The cells which were treated with actinomycin D (5 nM for 24 h) were crosslinked with a 1% formaldehyde solution for 10 min at 37 °C. The cells were then lysed in 200 μl of SDS lysis buffer and were sonicated to generate 200–800 bp DNA fragments. After centrifugation, the cleared supernatant was diluted 10-fold with ChIP dilution buffer and was split into two equal portions; one portion was incubated with p53 antibody (1 μg) at 4 °C for 16 h and the other portion was used as a negative control (IgG). One twentieth of the volume of the total extract was used for PCR amplification as the input control. Immune complexes were precipitated, washed and eluted, and DNA–protein crosslinks were reversed by heating at 65 °C for 4 h. The DNA fragments were purified and recovered DNA was submitted for PCR amplification. Then, the DNA was amplified using Taq polymerase and certain primers (Table 2). The putative responsive elements in human Rap2a gene were predicted by p53 scan software. P1 was the sequence of the p53 responsive elements which contain “AAATATGCTCCGACCTGTCA”. P2 was the period of a random selection of the gene sequence as a negative control.
Consensus sequences for the restriction enzymes ECoRI (in the forward primers) and HindIII (in the reverse primers) are underlined. The cDNA was then subcloned into the bacterial expression vector pcDNA3.1 at ECoRI and HindIII sites. The identity of the resulting clones was verified by sequencing.
2.3. Induction of Rap2a in cells U2OS and H1299 cells were treated with 5 nM actinomycin D, 15 μM cisplatin or 40 J/m2 UV for various times as indicated. Cells were then harvested for protein and mRNA analyses using immunoblotting and reverse transcription and RT-PCR, respectively.
2.4. Ectopic expression of Rap2a Cells were grown to 90% confluence before being transiently transfected with pcDNA3.1-control and pcDNA3.1-Rap2a expression plasmids using Lipofectamine 2000 (Invitrogen, Shanghai, China) according to the manufacturer's instructions. Six hours after transfection, the medium containing transfection reagents was removed and incubated in fresh medium. The Rap2a overexpressed cells were harvested for subsequent experiments.
2.5. Knockdown of Rap2a Rap2a siRNA and p53 siRNA were purchased from Gene-Pharma (Shanghai, China) and were transfected using siLentFect Lipid Reagent (Bio-Rad, Hercules, CA, USA) according to the manufacturer's instructions. Three sets of siRNA duplexes targeting human Rap2a are listed in Table 1. Unless otherwise indicated, Rap2a knockdown experiments were conducted with si-Rap2a#3. A non-specific siRNA (5′-UUCUCCGAACGU GUCACGUTT-3′, 5′-ACGUGACACGUUCGGAGAATT-3′) was transfected as a control. Knockdown efficiency was assessed by western blotting.
2.8. Cell proliferation assay For proliferation, cells were seeded (1 × 104/well) into 96-well culture plates after 6 h transfection and incubated for 24, 48, 72 and 96 h respectively. Then, 100 μl serum-free culture medium and 10 μl CCK-8 solution were added into each well, followed by incubation at 37 °C Table 2 Primers used for PCR. Name
Primer
Primer sequencing (5′ → 3′)
Rap2a (P1)
F R F R F R
TGCTGGCATCGGAATGAAC GCTCAGTACCATAAAGGTTG ATGTGACCGAGGCTATGA CAGGAGGATTTGAGTATTTC GGACTGGGCACTCTTGTC GTTCAGAGTAACAGGCTAAG
Rap2a (P2) p21
1200
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
Fig. 1. Human Rap2a gene is a p53 target gene in response to DNA damage. (A) Primary U2OS and H1299 cells were treated with actinomycin D (5 nM) for 24 h and the cells were harvested. Reverse transcription PCR analyses were performed to measure the induction of Rap2a. GAPDH was used as internal control to normalize the values. (B) Western blot analyses to measure the protein levels of Rap2a, p53, p21 and β-actin in U2OS and H1299 cells treated with actinomycin D (0, 1, 5, and 10 nM). Endogenous reference was β-actin. (C) Western blot analyses of Rap2a, p53, p21 and β-actin in U2OS and H1299 cells treated with actinomycin D (5 nM) for various times. (D) Western blot analysis of the relative protein levels of Rap2a, p53, p21 and β-actin in p53 knockdown and control cells. (E) ChIP analysis of interactions between p53 and Rap2a gene in human osteosarcoma cells. p53 binds to and transactivates the p53 responsive element (P1) in human Rap2a gene. Cells were treated with actinomycin D (5 nM for 24 h) before ChIP assays. Input DNA, 1/20 DNA of ChIP. All experiments were carried out in triplicate. *P b 0.05, **P b 0.01.
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
1201
Fig. 1 (continued).
for 2 h. Absorbance was recorded using an ELX-800 spectrometer reader (Bio-Tek Instruments, Winooski, USA). 2.9. Annexin V/FITC binding assay Cell culture and treatment were performed as described above. Cells were washed with ice-cold PBS twice and then incubated with 200 μl 1 × binding buffer containing 5 μl Annexin V-FITC for 15 min and in 300 μl 1 × binding buffer containing 5 μl propidium iodide (PI) for 5 min at room temperature in the dark. After incubation, cells were visualized under a fluorescence microscope. 2.10. Cell migration and invasion assay, scratch wound healing assay, and gelatin zymography The methods were performed as described previously [25]. 2.11. Statistical analysis All values are shown as means ± SD. Student's t-tests or one-way analysis of the variance (ANOVA) was performed for determination of P values with SPSS 16.0 software (SPSS). All experiments were performed at least three times unless otherwise indicated. P values b 0.05 were considered statistically significant.
contrast, there was no significant difference in H1299 cells. To determine whether the increased Rap2a mRNA was accompanied by increased protein expression, the Rap2a protein level was examined by an immunoblotting assay. The result demonstrated that the protein levels of Rap2a also increased in U2OS cells treated with different concentrations of actinomycin D (Fig. 1B). In addition, we observed similar induction of Rap2a in the cells treated with 5 nM actinomycin D at different time points (Fig. 1C). However, increased Rap2a expression was not observed in H1299 cells following actinomycin D treatment (Fig. 1B and C), which is consistent with the result of RT-PCR analysis. Furthermore, the induction of Rap2a by p53 was inhibited by p53 siRNA (Fig. 1D). As a transcription factor, p53 binds to specific DNA sequences in target genes to activate gene expression. The above results prompted us to investigate whether p53 regulates Rap2a expression through its direct binding to the p53 responsive elements in human Rap2a promoter region and intron. U2OS cells were treated with 5 nM actinomycin D to activate p53, and ChIP assays were performed. Crosslinked chromatin complexes from these cells were immunoprecipitated with an anti-p53 antibody. The anti-p53 antibody specifically pulled down the DNA fragment in Rap2a in U2OS cells treated with actinomycin D, but not in untreated cells (Fig. 1E). These results demonstrate that p53 directly binds to the Rap2a promoter and regulates its expression. 3.2. Rap2a is induced by cisplatin and UV in a p53-dependent manner
3. Results 3.1. Human Rap2a gene is a p53 target gene in response to DNA damage To investigate whether p53 transcriptionally regulates Rap2a gene in response to DNA damage, RT-PCR assays were performed after treatment with 5 nM actinomycin D. A pair of p53 wild-type and p53deficient human tumor cell lines, U2OS and H1299, respectively, were used. As shown in Fig. 1A, Rap2a mRNA expression levels were significantly upregulated after actinomycin D treatment in U2OS cells. In
Because p53 is a stress-inducible protein and is activated by various stresses, we investigated whether other types of stresses could also induce the upregulation of Rap2a through p53. To address this question, U2OS cells were treated with cisplatin or UV followed by western blot analysis with Rap2a and p53 antibodies. Of note, both cisplatin and UV activated and stabilized p53 in U2OS cells, as judged by the increase of p53 protein levels. The protein levels of Rap2a also increased significantly in U2OS cells treated with cisplatin or UV and this effect can be downregulated by p53 siRNA (Fig. 2).
1202
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
Fig. 2. Rap2a is induced by cisplatin and UV in a p53-dependent manner. (A) Cells were transfected with p53 siRNA or control siRNA and then exposed to actinomycin D, cisplatin and UV. Rap2a and p53 were examined 24 h after exposure. The data represent three independent experiments. (B) Densitometric analysis of Rap2a. The intensity of Rap2a was quantified by densitometry (software: Image J, NIH). The data are presented as mean ± SD from three independent experiments. **P b 0.01.
3.3. Rap2a protein expression in human tumor cell lines To investigate the profiles of Rap2a in the pathogenesis of human cancers, we determined their expression levels in human osteosarcoma cell line U2OS, lung cancer cell line H1299 and A549, breast cancer cell line MCF-7, cervical cancer cell line HELA, prostatic cancer cell line PC3, renal carcinoma cell line 786-O and liver cancer cell line HEPG2. Representative results by western blotting were illustrated in Fig. 3. Analyses of the band densities revealed that the expression levels of Rap2a were predominantly increased.
3.4. Overexpression of Rap2a promotes cancer cell invasion and migration Despite overexpressed in cancer cells, the molecular mechanism responsible for Rap2a overexpression is not well understood. To examine the effects of Rap2a on cancer cell motility, we transfected transiently Rap2a expression vector or control vector into U2OS cells (Fig. 4A). Scratch assay and transwell assays revealed a significant increase in the invasion and migration of Rap2a-overexpressing cells when compared with the control cells (Fig. 4B–D). Tumor cell invasion involves the proteolytic degradation of extracellular matrix components by tumor cellsecreted proteases, including matrix metalloproteinases (MMPs) [2]. Elevated levels of MMPs have been found in many tumors and are believed to play a pivotal role in cellular invasion and metastasis [5]. Thus, we performed gelatin zymography to measure the MMP activities in U2OS cells.
Our results showed that matrix metalloproteinase-2 (MMP2) and matrix metalloproteinase-2 (MMP9) secretion was significantly increased in Rap2a-overexpressing U2OS cells (Fig. 4E). 3.5. Downregulation of Rap2a inhibits cancer cell invasion and migration Our observations that ectopic expression of Rap2a promotes cell motility and enhanced the secretion of MMP2 and MMP9 in turn prompted us to investigate whether Rap2a inhibition could suppress cell migration, leading to the reduction of secretion of MMP2 and MMP9. To address this possibility, we next investigated the role of Rap2a in cancer cell migration and invasion after transfecting U2OS cells with Rap2a siRNA or control siRNA (Fig. 5A). Scratch assay and transwell assays revealed that knockdown of Rap2a inhibits cell migration and invasion (Fig. 5B–D). Similar patterns were observed in gelatin zymography (Fig. 5E). 3.6. Rap2a has no effect on the proliferation of cancer cells Based on the result from cell migration, we test whether Rap2a regulated tumor cell proliferation. Cell viability was determined by CCK-8 assay and Annexin V/PI assay. After transfecting U2OS cells with Rap2a expression vector or control vector, we did not observe an obvious effect of Rap2a on the cell proliferation. Consistent with previous result, there was no detectable difference of cell apoptosis between Rap2a siRNA and control siRNA (Fig. 6A and B). In addition, no significant
Fig. 3. Rap2a protein expression in human tumor cell lines. (A) The levels of endogenous Rap2a protein in different cancer cells were measured by western blot. (B) Densitometric analysis of Rap2a. The intensity of Rap2a was quantified by densitometry (software: Image J, NIH). The data are presented as mean ± SD from three independent experiments. *P b 0.05, **P b 0.01.
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
1203
Fig. 4. Overexpression of Rap2a promotes cancer cell invasion and migration. (A) U2OS cells were transfected with the Rap2a expressing or empty vector. Twenty-four hours post-transfection, cell lysates were prepared and the expression of Rap2a was detected by immunoblot analysis using rabbit polyclonal antibodies to Rap2a. Western blot analyses demonstrated the ectopic expression of Rap2a. (B) Scratch assay was performed after Rap2a restoration in U2OS cells. (C–D) Cell invasion was measured by using a Matrigel invasion assay following the transduction of U2OS cells with Rap2a expression plasmid. Migration assays were performed by using a similar procedure, except the polycarbonate filters were not coated with Matrigel. (E) The relative enzyme activities of cleaved-MMP2 and cleaved-MMP9 were measured by gelatin zymography analysis following transfection with a Rap2a expression vector or an empty vector. *P b 0.05, **P b 0.01.
1204
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
Fig. 5. Downregulation of Rap2a inhibits cancer cell invasion and migration. (A) U2OS cells were transiently transfected with human Rap2a siRNA using Lipofectamine 2000. Three sets of siRNA duplexes targeting human Rap2a were analyzed by immunoblotting. All transfections were independently performed thrice. Unless otherwise indicated, Rap2a knockdown experiments were conducted with si-Rap2a#3. (B) Scratch assay was performed after knockdown of Rap2a. There was significant delay in wound closure after Rap2a knockdown compared with the control. (C–D) Cell invasion was measured by a Matrigel invasion assay following transfection with Rap2a siRNA. Migration assays were performed using a similar procedure, except that the polycarbonate filters were not coated with Matrigel. (E) Gelatin zymography analysis of the relative enzyme activities of cleaved-MMP2 and cleaved-MMP9 in Rap2a knockdown and siRNA control. *P b 0.05, **P b 0.01.
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
change in the expression levels of Bcl-2, Bax and caspase-3 was found in Rap2a-transfected cells (Fig. 7). 3.7. Akt phosphorylation involved in Rap2a-mediated cancer cell migration and invasion Cell metastasis through the tissues is caused by highly integrated multistep cellular events regulated by various signaling molecules, including PI3K/Akt and MMPs [31]. Akt (also known as protein kinase B or PKB) plays a role in the regulation of cell proliferation, survival and metabolism. Dysregulation of Akt leads to diseases of major unmet medical need such as cancer, diabetes, cardiovascular and neurological diseases [18]. Growing evidence reveals that MMP2 and MMP9 secretions and invasion of tumor cells are associated with PI3K/Akt signaling pathways [31,39,40]. Blocking the PI3K/Akt pathway by PI3K inhibitor LY294002 resulted in a reduced expression of MMP2 and MMP9. Western blot analyses revealed that Rap2a overexpression significantly increased the phosphorylation of Akt. In contrast, downregulation of Rap2a decreased the phosphorylation of Akt (Fig. 7–8). 4. Discussion Tumor progression is a multistep process and cancers arise as a result of somatic mutations that produce oncogenes or affect functions of tumor suppressor genes [37]. The two fundamental features of cancer cells are uncontrolled proliferation and invasion [15]. Metastasis
1205
remains one of most complex and challenging problems of oncology. Although extensively studied for p53 in the control of cell cycle and apoptosis, recent studies have suggested that p53 is responsible for other cellular functions, in particular cell migration [26]. Overwhelming data have been accumulated on negative regulation of p53 to cell migration and invasion. However, there is also an opposite argument that loss of p53 function correlated with decreased cell migration [34]. Thus, it is not yet possible to attribute an entire function of p53 to any one of its target gene, we propose that Rap2a is a mediator of p53 in the regulation of cancer cell invasion and migration. The present study shows that Rap2a is a p53 target gene, which provides additional insight into p53-mediated tumor migration. The Rap proteins define a family of low molecular weight GTP-binding proteins that share most sequence homology with the product of the Ras proto-oncogene [30]. Since their discovery, Rap1 proteins have elicited much more interest than Rap2 proteins. Emerging evidence shows that aberrant activation of Rap1 increases proliferation and invasion of cancer cells [1,9]. Consistent with this finding, Rap1GAP inhibits cytoskeletal remodeling and motility in thyroid cancer cells [11]. More recently, however, it has been evidenced that Rap2 proteins may regulate cell adhesion similar to Rap1 protein [24]. Our data suggest that Rap2a is a novel p53 target and is regulated by p53 at the transcriptional level. DNA damage such as treatment with actinomycin D, cisplatin or UV radiation not only increases the binding of p53 to chromatin but also switches on p53 to induce Rap2a. Thus far, p53 regulates the expression of Rap2a in the presence of extrinsic DNA damage stress. As a
Fig. 6. Rap2a has no effect on the proliferation of cancer cells. (A) After the effective knockdown or ectopic expression of Rap2a, cell viability was determined by CCK-8 assay. (B) U2OS cells were transfected with Rap2a plasmid DNA or siRNA, early apoptosis (cell membrane displays green) and late nuclear apoptosis (nuclei displays red) were stained by Annexin V and PI respectively, and then observed in the fluorescence microscope (magnification × 200).
1206
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
Fig. 7. Akt phosphorylation involved in Rap2a-mediated cancer cell migration and invasion. (A) The total and phosphorylated Akt were determined by western blotting after the effective knockdown or ectopic expression of Rap2a. p-Akt level was significantly increased after Rap2a overexpression. In addition, the protein levels of Bcl-2, Bax and caspase-3 were analyzed by immunoblotting. (B) Densitometric analysis of p-Akt473. The intensity of p-Akt473 was quantified by densitometry (software: Image J, NIH). The data are presented as mean ± SD from three independent experiments. **P b 0.01.
comparison, the underlying mechanisms of p53-mediated Rap2a in the absence of DNA damage are still unknown and the rest functions of Rap2a in tumor cells will be investigated in future studies. Recently, Prabakaran et al. demonstrated that Rap2a is upregulated in invasive cells dissected from follicular thyroid cancer [33]. However, Bigler et al. suggested that the proportion of activated Rap2 was significantly reduced in prostate cancer cells [4]. The role of the activation of Rap2a in carcinogenesis remains controversial. Our result showed that Rap2a enhances migration and invasion of osteosarcoma cells and that this effect was at least partly mediated by increased MMP2 and MMP9 expression. In support of this view, immunoblotting demonstrated Rap2a is upregulated in many tumor types. In contrast, Rap2a
downregulation inhibits the migratory and invasive capacities of cancer cells. CCK-8 and Annexin V/PI assays indicated that Rap2a has no effect on the proliferation and apoptosis of cancer cells. Consistent with this conclusion, cancer cells treated with Rap2a did not show any changes in the expression levels of Bax, Bcl-2 and pro-caspased-3. These findings suggest that p53-inducible Rap2a can promote cancer cell motility. This result is consistent with a recent report that decreased motility of p53deficient cells was observed in human colon and lung carcinoma cell lines [34]. Furthermore, recent considerable data show that Rap2b, a novel p53 target, regulates p53-mediated pro-survival function [41]. Collectively, these findings seem to identify a new concept of p53 function in tumor invasion and metastasis. p53, as the “guardian of the
Fig. 8. Schematic diagram of relationship between p53 and Rap2a upon DNA damage and the role of Rap2a in tumorigenesis. (I) Upon DNA damage, p53 binds to the promoter of Rap2a and activates its transcription. (II) Rap2a increases activities of MMP2 and MMP9 and enhances the migration and invasive ability of cancer cells by upregulating p-Akt.
J.-X. Wu et al. / Cellular Signalling 27 (2015) 1198–1207
genome”, may use many different transcriptional repression mechanisms to regulate the balance between pro- and anti-invasion signaling. Many questions remain to be addressed, however. Matrix metalloproteinases (MMPs) are a family of highly homologous, zinc- and calcium-dependent extracellular enzymes [3]. Signals from tumor cells activate the production of MMPs, which degrade the extracellular membrane, thus aiding cell migration. MMP2 and MMP9 are of particular interest because of their role in early cancer development and progression [8]. Yang et al. demonstrated that selaginella tamariscina possessed antimetastatic effects by decreasing MMP2 and MMP9 secretions via Akt signaling pathways [39]. In addition, specific inhibitor of PI3-kinase and Akt significantly reduced the IR-induced invasiveness of glioma cells on Matrigel [31]. Trying to learn more about possible pathways leading to the Rap2a-mediated upregulation of MMP2 and MMP9, we tested whether Rap2a expression could modulate PI3-kinase activity. We found that overexpression of Rap2a enhanced Akt signaling, downregulated Rap2a contributed to a decrease in p-Akt. These findings indicate the involvement of PI3K/Akt pathway in Rap2a-induced MMP2 and MMP9 expression and invasion of tumor cells. Taken together, our findings suggest that p53 induces Rap2a activation, which triggers PI3K/Akt signaling pathways, leading to increased MMP2 and MMP9 expression and heightened invasiveness of cancer cells. The regulation of metastasis and invasion represent important therapeutic targets, as the inability to control metastasis and cancer invasion remains the most formidable obstacle to successful treatment. The identification of Rap2a as an important player in p53 signaling provides potentially important clues for controlling human diseases. Conflict of interest disclosures The authors declare no conflict of interest. Acknowledgments This work was supported by the National Natural Science Foundation of China (No. 81372172), the key project of the Education Department of China (212062) and the Science and Technology Department of Jiangsu Province (BK20130231, BK20141149). References [1] C.L. Bailey, P. Kelly, P.J. Casey, Cancer Res. 69 (2009) 4962–4968. [2] P. Basset, A. Okada, M.P. Chenard, R. Kannan, I. Stoll, P. Anglard, J.P. Bellocq, M.C. Rio, Matrix Biol. 15 (1997) 535–541. [3] G. Bergers, R. Brekken, G. McMahon, T.H. Vu, T. Itoh, K. Tamaki, K. Tanzawa, P. Thorpe, S. Itohara, Z. Werb, D. Hanahan, Nat. Cell Biol. 2 (2000) 737–744. [4] D. Bigler, D. Gioeli, M.R. Conaway, M.J. Weber, D. Theodorescu, Prostate. 67 (2007) 1590–1599.
1207
[5] M. Bjorklund, E. Koivunen, Biochim. Biophys. Acta. 1755 (2005) 37–69. [6] B. Boettner, L. Van Aelst, Curr. Opin. Cell Biol. 21 (2009) 684–693. [7] H.E. Boudreau, B.W. Casterline, D.J. Burke, T.L. Leto, Br. J. Cancer. 110 (2014) 2569–2582. [8] A.F. Chambers, L.M. Matrisian, J. Natl. Cancer Inst. 89 (1997) 1260–1270. [9] C.H. Chen, H.C. Chuang, C.C. Huang, F.M. Fang, H.Y. Huang, H.T. Tsai, L.J. Su, L.Y. Shiu, S. Leu, C.Y. Chien, Am. J. Pathol. 182 (2013) 516–528. [10] N.P. Crawford, A. Ziogas, D.J. Peel, J. Hess, H. Anton-Culver, K.W. Hunter, Breast Cancer Res. 8 (2006) R16. [11] X. Dong, W. Tang, S. Stopenski, M.S. Brose, C. Korch, J.L. Meinkoth, Endocr. Relat. Cancer. 19 (2012) 575–588. [12] G. Gadea, L. Roger, C. Anguille, M. de Toledo, V. Gire, P. Roux, J. Cell Sci. 117 (2004) 6355–6364. [13] M. Gloerich, J.L. Bos, Trends Cell Biol. 21 (2011) 615–623. [14] F. Guo, Y. Zheng, Oncogene. 23 (2004) 5577–5585. [15] D. Hanahan, R.A. Weinberg, Cell. 100 (2000) 57–70. [16] P. Hasty, B.A. Christy, Pathobiol. Aging Age Relat. Dis. 3 (2013). [17] M. Hattori, N. Minato, J. Biochem. 134 (2003) 479–484. [18] I. Hers, E.E. Vincent, J.M. Tavare, Cell. Signal. 23 (2011) 1515–1527. [19] M. Itoh, C.M. Nelson, C.A. Myers, M.J. Bissell, Cancer Res. 67 (2007) 4759–4766. [20] A.J. Levine, Cell. 88 (1997) 323–331. [21] S.O. Lim, H. Kim, G. Jung, FEBS Lett. 584 (2010) 2231–2236. [22] K.B. Lin, P. Tan, S.A. Freeman, M. Lam, K.M. McNagny, M.R. Gold, Oncogene. 29 (2010) 608–615. [23] A.S. Mak, Cell Adhes. Migr. 5 (2011) 144–149. [24] S.J. McLeod, A.J. Shum, R.L. Lee, F. Takei, M.R. Gold, J. Biol. Chem. 279 (2004) 12009–12019. [25] P.J. Mei, J. Bai, H. Liu, C. Li, Y.P. Wu, Z.Q. Yu, J.N. Zheng, J. Cancer Res. Clin. Oncol. 137 (2011) 1823–1830. [26] H. Momota, Y. Narita, Y. Matsushita, Y. Miyakita, S. Shibui, Brain Tumor Pathol. 27 (2010) 95–101. [27] P.A. Muller, P.T. Caswell, B. Doyle, M.P. Iwanicki, E.H. Tan, S. Karim, N. Lukashchuk, D.A. Gillespie, R.L. Ludwig, P. Gosselin, A. Cromer, J.S. Brugge, O.J. Sansom, J.C. Norman, K.H. Vousden, Cell. 139 (2009) 1327–1341. [28] P.A. Muller, K.H. Vousden, J.C. Norman, J. Cell Biol. 192 (2011) 209–218. [29] G. Nagashima, M. Aoyagi, M. Yamamoto, S. Yamamoto, H. Wakimoto, K. Ohno, K. Yamamoto, K. Hirakawa, Acta Neurochir. 141 (1999) 53–61 (discussion 60–51). [30] S. Paganini, G.F. Guidetti, S. Catricala, P. Trionfini, S. Panelli, C. Balduini, M. Torti, Biochimie. 88 (2006) 285–295. [31] C.M. Park, M.J. Park, H.J. Kwak, H.C. Lee, M.S. Kim, S.H. Lee, I.C. Park, C.H. Rhee, S.I. Hong, Cancer Res. 66 (2006) 8511–8519. [32] H.O. Park, J. Chant, I. Herskowitz, Nature. 365 (1993) 269–274. [33] I. Prabakaran, J.R. Grau, R. Lewis, D.L. Fraker, M.A. Guvakova, J. Thyroid. Res. 2011 (2011) 979840. [34] A.A. Sablina, P.M. Chumakov, B.P. Kopnin, J. Biol. Chem. 278 (2003) 27362–27371. [35] E. Sahai, C.J. Marshall, Nat. Cell Biol. 5 (2003) 711–719. [36] S. Sasagawa, Y. Ozaki, K. Fujita, S. Kuroda, Nat. Cell Biol. 7 (2005) 365–373. [37] C.J. Sherr, Cell. 116 (2004) 235–246. [38] Y. Shimizu, Y. Hamazaki, M. Hattori, K. Doi, N. Terada, T. Kobayashi, Y. Toda, T. Yamasaki, T. Inoue, Y. Kajita, A. Maeno, T. Kamba, Y. Mikami, T. Kamoto, T. Yamada, T. Kanno, K. Yoshikawa, O. Ogawa, N. Minato, E. Nakamura, Cancer Sci. 102 (2011) 828–836. [39] J.S. Yang, C.W. Lin, Y.S. Hsieh, H.L. Cheng, K.H. Lue, S.F. Yang, K.H. Lu, Food Chem. Toxicol. 59 (2013) 801–807. [40] X. Zhang, T. Chen, J. Zhang, Q. Mao, S. Li, W. Xiong, Y. Qiu, Q. Xie, J. Ge, Cancer Sci. 103 (2012) 181–190. [41] X. Zhang, Y. He, K.H. Lee, W. Dubois, Z. Li, X. Wu, A. Kovalchuk, W. Zhang, J. Huang, Cell Cycle. 12 (2013) 1279–1291.
