RESEARCH LETTER
Rapid and sensitive detection of Phytophthora colocasiae responsible for the taro leaf blight using conventional and real-time PCR assay Vishnu S. Nath1, Vinayaka M. Hegde1, Muthulekshmi L. Jeeva1, Raj S. Misra2, Syamala S. Veena1, Mithun Raj1, Suresh K. Unnikrishnan3 & Sree S. Darveekaran1 1
Division of Crop Protection, Central Tuber Crops Research Institute, Thiruvananthapuram, India; 2Regional Centre of CTCRI, Bhubaneswar, India and 3Regional Centre for DNA Fingerprinting, Rajiv Gandhi Centre for Biotechnology, Thiruvananthapuram, India
Correspondence: Vinayaka M. Hegde, Division of Crop Protection, Central Tuber Crops Research Institute, Thiruvananthapuram -695017, Kerala, India. Tel.: +91 9447245649; fax: +91 471 2590063; e-mail: [email protected]
MICROBIOLOGY LETTERS
Present address: Vinayaka M. Hegde, Division of Crop Protection Central Plantation Crops Research Institute, CPCRI Kasaragod, 671124, Kerala, India Received 26 November 2013; revised 25 January 2014; accepted 28 January 2014. Final version published online 24 February 2014. DOI: 10.1111/1574-6968.12395
Abstract Conventional and real-time PCR assays were developed for sensitive and specific detection of Phytophthora colocasiae, an oomycete pathogen that causes leaf blight and corm rot of taro. A set of three primer pairs was designed from regions of the RAS-related protein (Ypt1), G protein alpha-subunit (GPA1) and phospho-ribosylanthranilate isomerase (TRP1) genes. In conventional PCR, the lower limit of detection was 50 pg DNA, whereas in real-time PCR, the detection limit was 12.5 fg for the primer based on Ypt1 gene. The cycle threshold values were linearly correlated with the concentration of the target DNA (range of R2 = 0.911–0.999). All the primer sets were successful in detecting P. colocasie from naturally infected leaves and tubers of taro. Phytophthora colocasiae was detected from artificially infested samples after 18 and 15 h of postinoculation in conventional and real-time PCR assay, respectively. The developed PCR assay proved to be a robust and reliable technique to detect P. colocasiae in taro planting material and for assessing the distribution of pathogen within fields, thus aid in mitigating taro leaf blight.
Editor: David Studholme Keywords disease management; Phytophthora colocasiae; qPCR; single-copy genes; specific detection; SYBR green assay.
Introduction Taro [(Colocasia esculenta (L.) Schott] is a major root crop of the family Araceae with wide distribution in tropics. Leaf blight caused by Phytophthora colocasiae Raciborski is the most devastating disease of taro (Misra et al., 2008). The disease affects the leaves and petioles of taro plants, resulting in extensive damage of the foliage. The disease has become a major limiting factor in taro production worldwide including India, causing yield reductions to the magnitude of 50% every year (Misra et al., 2008). In addition to the leaf blight disease, P. colocasiae also causes serious postharvest decay of corms. ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
Cultural practices and metalaxyl-based fungicides have been unsuccessful in protecting the crop or have proved too expensive (Misra, 1999). Also, development of resistance to fungicide is another major threat (Cohen & Coffey, 1986; Nath et al., 2012). Moreover, exploitation of host resistance is limited due to the lack of other desirable economic and market value traits. Although there are alternative methods to chemical fungicides, such as the application of antagonistic microorganisms, it is essential to monitor the disease development. In this context, there is a clear need for reliable, accurate and rapid diagnostic method for effective management of this devastating disease. FEMS Microbiol Lett 352 (2014) 174–183
175
Specific detection of P. colocasiae
The methods employed to isolate and identify P. colocasiae often involve direct isolation on semi-selective media from infected plant tissue or baiting from soil with leaf discs followed by isolation (Tsao, 1983; Erwin & Ribeiro, 1996). However, the efficiency of these methods varies with respect to the environmental conditions and phase of the disease in samples used for isolation, making these detection methods laborious and time-consuming. Moreover, species identification is cumbersome and putative colonies of P. colocasiae may be confused with other Phytophthora species that share similar morphology, often requiring skilled taxonomists to reliably identify the pathogen. Although commercially available serological kits can be used for the detection of Phytophthora species, they can detect only to the genus level and some show crossreactivity with species of Pythium making the technique unreliable (McCartney et al., 2003; O’Brien et al., 2009). In recent years, conventional and real-time PCR has become firmly established in the repertoire of techniques available for plant disease diagnosis offering higher levels of specificity and sensitivity than most previously described methods. A conventional PCR assay is reported for P. colocasiae based on the internal transcribed spacer (ITS) region of ribosomal DNA (Mishra et al., 2010). However, preliminary tests with this assay indicated potential problems with amplification and specificity when using DNA from recent isolates of P. colocasiae and other Phytophthora species (V.S. Nath, V.M. Hegde, M.L. Jeeva, R.S. Misra, S.S. Veena and M. Raj, Unpublished). It has been reported that the number of rDNA copies fluctuates with age and stage of growth of the organism and this inconsistency may affect the accurate quantification of pathogen and potential comparison between samples (Attallah et al., 2007). Moreover, our recent study has shown that ITS region is highly variable in P. colocasiae with considerable amount of genetic diversity existing among isolates obtained from fine spatial scale (Nath et al., 2013). These findings suggest that ITS region may not be a suitable target for specific detection of P. colocasiae. Among other target genes proposed to identify and detect Phytophthora spp., single-copy genes could be of great interest. Many of these genes possess conserved exons and very variable introns suitable for the development of molecular markers for almost all Phytophthora species (Schena & Cooke, 2006). In view of this, the main focus of this research was the development of a conventional and real-time PCR assay for faster, sensitive and efficient detection of P. colocasiae to compliment routine diagnosis and assist management practices to mitigate taro leaf blight. To the best of our knowledge, this is the first time that three target regions have been focused on the development of specific PCR detection of P. colocasiae. FEMS Microbiol Lett 352 (2014) 174–183
Materials and methods Biological materials
Lists of microorganism used for testing the specificity of the primers are presented in Table 1. Isolates of P. colocasiae used in this study were isolated from taro blight samples collected from various geographical boundaries of India during a period of 2007–2012. Isolation and maintenance of the P. colocasiae isolates were performed as previously described (Nath et al., 2013). The isolates were confirmed to species level by ITS amplification and sequencing using universal ITS1 and ITS4 primers (White et al., 1990). Genomic DNA extraction
Phytophthora colocasiae, other Phytophthora and fungal strains were grown in potato dextrose agar medium (PDA; 250 g L1 potato, 20 g L1 dextrose and 20 g L1 agar). DNA was extracted from 5 to 7 days old cultures using a Genomic DNA purification kit (Fermentas, EU) according to manufacturer’s instructions. DNA from healthy and diseased leaves of taro was also extracted using the same kit. Bacterial cultures were grown overnight at 37 °C in Luria–Bertani broth, and genomic DNA was extracted by the method of Sambrook et al. (1989). DNA was extracted from soil using an UltraCleanTM soil DNA isolation kit (MoBio laboratories, Carlsbad, CA) following manufacturer’s instructions. DNA extracted from various sources was quantified using Quant-iTTM Assay kit (Invitrogen) following manufacturer’s instructions. The integrity of the DNA was assessed by agarose gel electrophoresis and stored at 20 °C until further use. PCR amplification and sequencing
The genomic regions of representative isolates of P. colocasiae were amplified using primer pairs corresponding to three target regions viz. TRP1 (encodes a bifunctional enzyme of the tryptophan biosynthetic pathway), RASYpt (monomeric GTP-binding proteins, essential in specific steps of vesicle transport and secretion) and GPA1 (GTP-binding proteins that participate in diverse signal transduction pathways) genes (Ioos et al., 2006). The PCR products were purified using a QIAquick Gel extraction kit (QIAGEN, Tokyo, Japan) and cloned into the pTZ57R/T vector (InsTAclone PCR cloning kit, Fermentas, EU). They were transformed into competent DH5a cells and plated on Luria agar blue and white selective medium. The obtained white colonies were randomly subjected to colony PCR in order to confirm the presence of the insert, and those found positive were sequenced
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
176
V.S. Nath et al.
Table 1. Isolates of Phytophthora colocasiae, other Phytophthora spp., fungal and bacterial pathogens used for screening the designed primers with conventional and real-time PCR assay Isolate code Phytophthora colocasiae P1 P3 P21* P42 P9 P4 P35 P7 P6* P23* P15 P28* P11 P32 P33 P45 P22* P16* P34 P26 P29 P36 P27 P5 P12 P2* P41 P13 P24* P40 P50 P25 P14 P39 P43 P17 P19 P30 P46 P8 P37 P44 P20* P10 P48 P47 P31 P18 P38 P49 Phytophthora genus P. capsici P. citrophthora P. parasitica
Location
District/sampling site
Year of collection
Conventional PCR
Real-time PCR
Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Andhra Pradesh Andhra Pradesh Andhra Pradesh Andhra Pradesh Andhra Pradesh Andhra Pradesh Odisha Odisha Odisha Odisha Odisha Odisha Odisha Odisha Odisha Uttar Pradesh Uttar Pradesh Uttar Pradesh Delhi Assam Assam Assam Meghalaya Meghalaya Meghalaya Meghalaya West Bengal West Bengal West Bengal West Bengal Tripura Tripura Tripura
Block 2, CTCRI field Block 1, CTCRI field Farm, CTCRI Thiruvananthapuram Thiruvananthapuram Aleppy Pathanamthitta Pathanamthitta Kottayam Kollam Haripad Idukki Calicut Block 2, CTCRI Block 2, CTCRI Calicut Calicut Veerwada Veerwada East Godawari Parudin pallam Parudin pallam Veerwada Nayagarh Khandapara RC, CTCRI RC, CTCRI Salepur Puri RC CTCRI RC CTCRI Puri Malikpur Malikpur Malikpur New Delhi Nellie Road Nellie Road Nellie Road Ribhoi Nongpoh Ribhoi Nongpoh Nadia Nadia Kalyani Kalyani West Tripura West Tripura West Tripura
2010 2010 2011 2012 2008 2011 2011 2011 2011 2010 2012 2010 2007 2012 2012 2009 2008 2010 2011 2011 2010 2011 2011 2007 2007 2008 2009 2008 2007 2008 2009 2007 2007 2008 2009 2010 2007 2010 2011 2009 2011 2011 2010 2009 2009 2008 2007 2010 2010 2011
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
FEMS Microbiol Lett 352 (2014) 174–183
177
Specific detection of P. colocasiae
Table 1. Continued Isolate code
Location
District/sampling site
Year of collection
P. araceae P. meadii P. nicotianae P. infestans P. cryptogea P. boehmeriae P. palmivora Fungal Colletotrichum capsici Sclerotium rolfsii Colletotrichum lindemuthianum Trichoderma harzianum Pythium ultimum Rhizoctonia solani Bacteria Erwinia carotovora
Conventional PCR
Real-time PCR
*Isolates selected for ITS amplification for species confirmation and characterization.
using M13 forward and reverse primers (Applied Biosystems 3500 Genetic Analyzer, Life Technologies). The nucleotide sequences obtained were processed to remove vector sequence and low-quality reads, transformed into consensus sequences with GENEIOUS PRO software version 5.6. The nucleotide sequence analysis with BLASTN (NCBI) showed 90–95% similarity among other Phytophthora species for the same gene, and a representative sequence of target genes of the isolate P 17 was submitted to the GenBank at the NCBI under the accession numbers KF848712 and KF848713. Primer design
For the development of the species-specific primers, regions of dissimilarity between the consensus of P. colocasiae and other Phytophthora, fungal and bacterial species were identified and putative P. colocasiae-specific primers
were designed using the PRIMER PREMIER software version 6.0 (Table 2). The various parameters were set uniformly for all primer pairs to facilitate similar amplification profiles. A total of four primer pairs were designed for each target gene. The primer pairs were preliminarily assessed using BLAST against the NCBI GenBank database and further by the primer BLAST program to ascertain their suitability as P. colocasiae-specific primers. Conventional PCR assay
The specificity and sensitivity of the designed primer pairs were evaluated with a conventional PCR. For specificity check, microorganisms listed in Table 1 were used as PCR templates. To determine sensitivity of the primers, ten-fold serial dilutions (25 ng lL1 initial concentration) of the P. colocasiae genomic DNA were prepared and used as a template for the PCR. Two replicates were
Table 2. List of primers used for conventional and real-time PCR assay in the present study Target species
Gene
Primer name and sequence (50 -30 )
Tm (°C)
Product size
Reference
Phytophthora spp.
RAS-Ypt
F -ATGAACCCCGAATAGTRCGTGC R - TGTTSACGTTCTCRCAGGCG F – GAGGAGATCGCGGCGCAGCG R - GCGCACATRCCGAGVTTGTG F – GGACTCTGTGCGTCCCAGATG R - ATAATTGGTGTGCAGTGCCGC PCSP-RL F- GGTGTGGACTTTGTGAGTTTCAG PCSP-RL R- AAGGGAGTTGGCACAACCATT PCSP-T F- AGCGCCTTAACGCTCCCT PCSP-T R- GAGCCCTTGAACCACTTGGG PCSP-G F-TTGGTGGCGTGTAGTCTGTG PCSP-G R- AGCTTCCGGTTGATGGTAGC
67.8 62.9 78.4 68.9 69.4 69.0 64.7 66.5 66.1 68.0 64.9 65.3
666–698
Ioos et al. (2006)
661–765
Ioos et al. (2006)
286–312
Ioos et al. (2006)
TRP1 GPA1 Phytophthora colocasiae
RAS-Ypt TRP1 GPA1
FEMS Microbiol Lett 352 (2014) 174–183
206
This study
248
This study
581
This study
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
178
used for each reaction with proper negative controls. Amplifications were performed in an Agilent sure cycler 8800 (Agilent Technologies). The PCRs were conducted in a volume of 25 lL, which included 100 ng of template DNA, 100 lM each deoxynucleotide triphosphate, 10 ng of each primer, 1.5 mM MgCl2, 19 Taq buffer (10 mM Tris-HCl pH 9.0, 50 mM KCl, 0.01% gelatin), 1 U of Taq DNA polymerase (Merck GeNei, India). The following optimized PCR regime was used: denaturation at 95 °C for 2 min, followed by 35 cycles of 95 °C for 30 s, 55 °C for 45 s, 72 °C for 1 min and a final extension at 72 °C for 8 min. The amplified products were visualized in a 1.5% agarose gel, and photographs were scanned through a Gel Doc System (Alpha imager, Alpha Innotech). Real-time PCR assay
Real-time quantitative PCR (qPCR) was performed with the Eppendroff realplex PCR system (Eppendroff, Hamburg, Germany) in a total volume of 20 lL. The reaction mixture consists of 12.5 lL of 29 SYBR green master mix (Fermentas, EU), 0.3 lM each of the forward and reverse primers and 5 lL of template DNA (25 ng lL1). The final volume of the reaction was adjusted with molecular-grade water. Thermal cycling parameters were same as for the conventional PCR. To quantify P. colocasiae genomic DNA and to evaluate the amplification efficiency and the detection limits of the qPCR assay, a 10-fold dilution series of P. colocasiae genomic DNA (25 ng lL1 initial concentration) was used to create a standard curve. The Ct values for each PCR were interpolated from the standard curves to calculate the amount of P. colocasiae DNA in a sample. Each run included nontemplate controls, in which DNA template was replaced by 5 lL molecular-grade water. All samples were run in triplicates, and results are presented as mean values SD. A melt curve analysis was performed at every run to assess the product specificity. The amplified products were resolved in a 1.5% agarose gel, and photographs were scanned through a Gel Doc System (Alpha imager, Alpha Innotech). Detection of P. colocasiae in naturally and artificially infected leaf, tuber and soil
Field samples of taro leaves and tubers either symptomatic or asymptomatic were collected from two fields of CTCRI. One field had a continuous history of leaf blight incidence, possessing visible symptoms of disease, while other field had plants that lacked symptoms. A small portion of the samples was processed by standard isolation procedure to confirm the presence of P. colocasiae (Nath et al., 2013). Soil samples adjacent to the roots of plants ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
V.S. Nath et al.
were also collected from these fields. In addition, an artificially infested soil sample was prepared by sterilizing one field sample (100 g) and adding a mycelial slurry of P. colocasiae grown in 100 mL of potato dextrose broth media. For artificial inoculation of leaves, a rapid method described by Nath et al. (2013) was used. Artificial infection of taro tubers was carried out according to Mishra et al. (2010). To determine the earliest time point at which P. colocasiae could be detected, sampling was performed at 10, 12, 15, 18, 24, 48 and 72 h postinoculation by excising a small portion (c. 50 mg of fresh tissue) from either symptomatic or asymptomatic areas of each tuber or leaf sample. Samples inoculated with sterile agar disc served as control treatments. Re-isolation was performed from all infected samples to complete Koch’s postulate. Each experiment consisted of five replicates, and the experiment was repeated twice.
Results Primer specificity and sensitivity with conventional PCR assay
The primer pairs successfully amplified P. colocasiae isolates from different regions of India in the optimized PCR condition and yielded an amplicon of c. 206, 248 and 581 bp for RAS like, TRP and GPA1 gene, respectively, when resolved on 1.5% agarose gel (Fig. 1a). Only DNA from P. colocasiae recorded amplification with the designed primers indicating that no corresponding sites of the designed primer existed in the genomic DNA of the other tested organism (Fig. 1b). Results from the dilution series of genomic DNA from the P. colocasiae pure culture showed that the specific PCR assay using the PCSP-RL, PCSP-G and PCSP-T primers could detect 50 pg, 50 pg, 0.5 ng of DNA per reaction, respectively (Table 3). Real-time PCR assay
The SYBR green PCR assay with the designed primers resulted in positive amplification of all P. colocasiae isolates tested. No amplification was detected in other Phytophthora, fungal or bacterial isolate suggesting the specificity of the designed primers. The standard fluorescent amplification representing exponential growth of PCR products was observed in each cycle, yielding threshold cycle (Ct) values that ranged from 15 to 32 for PCSP-RL, PCSP-T and PCSP-G primers (Table 3). The standard curve used to calculate the starting concentration of P. colocasiae DNA had a high correlation coefficient in the range of R2 = 0.911–0.999 for the three FEMS Microbiol Lett 352 (2014) 174–183
179
Specific detection of P. colocasiae
(a)
(b)
Fig. 1. Amplification and specificity check for the designed primers (a) Amplification of Phytophthora colocasiae isolates from various origins of India using the designed primer PCSP-RL (b) Specificity of the designed primer pairs using conventional PCR assay. Lane M 1 kb plus DNA ladder (Fermentas), Lane 1 Phytophthora colocasiae, Lane 2 Phytophthora capsici, Lane 3 Phytophthora meadii, Lane 4 Phytophthora parasitica, Lane 5 Phytophthora palmivora, Lane 6 Phytophthora citrophthora, Lane 7 Phytophthora araceae, Lane 8 Phytophthora nicotianae Lane 9 Phytophthora boehmeriae, Lane 10 Phytophthora infestans, Lane 11 Phytophthora cryptogea, Lane 12 Sclerotium rolfsii, Lane 13 Colletotrichum lindemuthianum, Lane 14 Colletotrichum capsici, Lane 15 Trichoderma harzianum, Lane 16 Pythium ultimum, Lane 17 Rhizoctonia solani, Lane 18 Erwinia carotovora, Lane 19 no DNA template.
Table 3. Sensitivity of conventional and real-time PCR assays based on the designed primer pairs for the detection of Phytophthora colocasiae DNA Real-time PCR†
Conventional PCR* Genomic DNA 1
25 ng lL 2.5 ng lL1 0.25 ng lL1 25 pg lL1 2.5 pg lL1 0.25 pg lL1 25 fg lL1 2.5 fg lL1
PCSP-RL
PCSP-T
PCSP-G
PCSP-RL
PCSP-T
PCSP-G
+ + + + +
+ + + +
+ + +
15.93 18.62 21.45 24.18 27.36 29.81 31.79 31.58
18.10 18.51 21.82 20.56 28.69 30.34
15.86 18.39 21.22 21.79 28.21 30.13 32.15
(0.25) (0.22) (0.37) (0.21) (0.32) (0.34) (0.20) (0.83)
(0.73) (0.28) (0.23) (0.07) (0.58) (0.53)
(0.07) (0.45) (0.18) (2.68) (0.52) (0.84) (0.92)
*
Conventional PCR product: + = expected PCR band present; = no PCR product. Ct values followed by SE in parenthesis.
†
primer pairs, suggesting a reproducible linear correlation between the input DNA and the Ct values. The minimum detection limit was 12.5 fg for PCSP-RL, 125 fg for PCSP-G and 1.25 pg for PCSP-T (Table 3). The melting curve analysis at the end of the cycling reactions revealed single dissociation peak at 82 °C (PCSP-RL and PCSP-T) and 86 °C (PCSP-G), indicating the specific binding of the designed primers (Fig. 2). Gel electrophoresis of the real-time PCR assay in 1.5% agarose gel showed the presence of single amplified product of the expected band size (data not shown). Negative controls
FEMS Microbiol Lett 352 (2014) 174–183
lacking DNA yielded no amplification with the designed primer pairs. Detection of P. colocasiae from naturally and artificially infected samples
Positive amplification was recorded from field symptomatic samples using the designed primers in both conventional and real-time PCR assays. In addition, putative P. colocasiae colonies could be isolated from these samples using Phytophthora selective media, which were also ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
180
V.S. Nath et al.
confirmed through PCR. Plant samples lacking visible symptoms gave negative results in PCR (Table 4). DNA extracted from plant samples inoculated with P. colocasiae yielded positive amplification in both con-
ventional and real-time PCR, whereas DNA from control experiments yielded negative results (Table 4). In addition, infected samples plated on Phytophthora selective media yielded cultures with phenotypic characteristics of P.
Fig. 2. Standard curves and melt curve analysis of the real-time PCR assay using the designed primer pairs.
Table 4. Comparison of culture based isolation, conventional and real-time PCR assays for the detection of Phytophthora colocasiae based on the designed primers
Sample Plant samples collected from field lacking leaf blight symptoms Plant samples collected from field with leaf blight symptoms Plant samples collected from artificially infested leaf and tuber Noninoculated control plant samples Soil samples from field lacking leaf blight symptoms Soil samples from field with leaf blight symptoms Artificially infested soil sample
Isolation on Phytophthora selective medium*
Conventional PCR detection†
Real-time PCR detection‡
+
+
+
+
+
+
+
+
+
+
+
*P. colocasiae was recovered from symptomatic samples. † Conventional PCR product: + = expected PCR band present; = no PCR product. ‡ Samples with Ct values < 35 = +, samples with Ct values > 35 = .
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
FEMS Microbiol Lett 352 (2014) 174–183
Specific detection of P. colocasiae
colocasiae. The earliest time point at which P. colocasiae could be detected in artificially infested samples was 18 and 15 h postinoculation in conventional and real-time PCR, respectively. Phytophthora colocasiae was detected in soil from fields containing plants with symptoms of leaf blight but not from a field lacking symptomatic plants. Phytophthora colocasiae was also detected in artificially infested soil sample using both conventional and real-time PCR (data not shown).
Discussion Early detection and identification of plant pathogens are an integral part of successful disease management. Taro leaf blight caused by Phytophthora colocasiae represents the single biggest constraint for taro production globally. A reliable method for specific detection of P. colocasiae could be of great asset to the management of leaf blight disease. Commonly used methods for the detection of Phytophthora species such as semi-selective-media-based isolations and immunological procedures like ELISA have limitations with specificity and are also time-consuming (O’Brien et al., 2009). Methods based on PCR have clear advantages of being more sensitive, robust, rapid and less labour-intensive than traditional diagnostic methods. The objective of this study was to develop and validate a conventional and real-time PCR assay for specific detection of P. colocasiae. Successful primer design for the detection of pathogen requires that the target region be unique to the organism of interest and conserved across populations of the organism of interest. The three target genes chosen for primer designing were unique with the presence of conserved coding regions flanking very variable introns appropriate for differentiating closely related species of Phytophthora (Ioos et al., 2006; Schena & Cooke, 2006). The analysis of the sequences of the genes from different isolates of the P. colocasiae showed the absence of intraspecific polymorphism that could cause problems for diagnostic assays. Phytophthora colocasiae-specific primers could be developed from all the target regions. A conventional PCR assay was used to assess the sensitivity and specificity of the designed primer pairs. The assay yielded positive amplification for all the isolates of P. colocasiae tested, independently from their geographical origin. This was an advantage over the previously reported P. colocasiae-specific primers (Mishra et al., 2010), where the primers failed to amplify recently obtained P. colocasiae isolates from India. The assay also did not cross-react with other closely related Phytophthora, fungal or bacterial species suggesting its high specificity. The detection limit of the primer pairs in the FEMS Microbiol Lett 352 (2014) 174–183
181
conventional PCR assay was 50 pg, which is low when compared to the earlier report, where the authors claim 20 pg as the detection limit (Mishra et al., 2010). This is expected because unlike assays designed on multicopy genes such as rDNA which provides increased sensitivity (Hayden et al., 2004); the present study was based on single-copy genes (Chen & Roxby, 1996; Schena & Cooke, 2006). However, methods based on single-copy genes are not affected by the number of tandem repeats as in case of multicopy genes and therefore have potential to accurately detect the pathogen biomass (Schena & Cooke, 2006). One reason for developing a conventional PCR assay is that it can be utilized in laboratories with less specialized personnel or sophisticated equipment such as real-time PCR. Nevertheless, real-time PCR is faster, more sensitive and less labour-intensive as it eliminates postPCR processing. Although reliability of the PCR assay in detecting P. colocasiae isolates from other countries was not tested due to the lack of isolates from those regions, an in silico PCR analysis was used for testing the reproducibility of the primers in amplifying P. colocasiae isolates from across the globe. To our knowledge, this is the first time that a real-time PCR assay has been developed and validated for the specific detection of P. colocasiae. The real-time PCR assay was shown to be highly sensitive as it was able to detect as low as 12.5 fg of P. colocasiae DNA. In this respect, the realtime PCR easily supersedes the conventional PCR and should help detect the pathogen presence at an early stage of infection. In addition, compared with the conventional PCR, the real-time PCR is faster, is less prone to contamination, uses chemicals not suited for routine diagnostic work (e.g. ethidium bromide) and omits the post-PCR gel electrophoresis step to visualize the results. Real-time PCR assays for detecting plant pathogens have gained considerable attention during recent years. Specific PCR assays for detecting Colletotrichum acutatum in strawberry plants (Debode et al., 2009), P. cryptogea in gerbera plants (Li et al., 2009), P. sojae in soya bean (Bienapfl et al., 2011) are a few examples among them. More importantly, realtime assay based on single-copy genes has also been described in several plant pathogens. The Ypt1 gene target region was used as a molecular marker to identify P. fragariae (Ioos et al., 2006) and to develop a multiplex real-time PCR detection method for P. ramorum, P. kernoviae, P. citricola and P. quercina (Schena & Cooke, 2006; Li et al., 2011). Recently, the same gene was used for real-time detection of P. cactorum in strawberry (Li et al., 2013). Our sampling results have shown that both the PCR assays can provide consistent detection of P. colocasiae from infected plant material and may thus be applied to more routine planting material screening. Phytophthora colocasiae was detected from artificially inoculated plant ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
182
samples as early as 18 and 15 h postinoculation in conventional and real-time PCR, respectively, even before the initiation of visible symptoms. Our detection time was 2 h later to the earlier report of Mishra et al. (2010), which is expected as their assay was based on ITS region and provides a greater sensitivity (Hayden et al., 2004). The primers also successfully detected P. colocasiae DNA in field-grown plants exhibiting symptoms of Phytophthora leaf blight. In addition, P. colocasiae was also detected in symptomatic field-grown plants when culture plate isolation produced negative results. Various factors such as unfavourable environmental conditions, the presence of other microorganisms, phase of the symptom in the samples and ageing plants can lead to false negatives when using culture methods (O’Brien et al., 2009). Finally, the primers were also efficient in detecting P. colocasiae from soil samples collected from fields exhibiting symptoms of leaf blight and also from soil artificially infested in the laboratory. In conclusion, this study shows that the developed conventional and real-time PCR assays are highly efficient, reliable and rapid methods for the detection of P. colocasiae from a wide range of plant samples including soil. Both methods represent useful tools for in-depth study of the biology and epidemiology of the P. colocasiae populations. The primers and the assay methods described here will be useful for rapid and sensitive detection of P. colocasiae in taro planting material. Furthermore, the present PCR assays could assist further research to determine the inoculum concentration thresholds of P. colocasiae in taro growing areas in predicting the risk of disease development. This will lead to better disease management strategies as appropriate preventive measures can be identified more quickly before the spread of P. colocasiae can take place.
Acknowledgements The funding provided for conducting the research work by the Indian Council of Agricultural Research, New Delhi, under IISR outreach programme is gratefully acknowledged. The authors wish to thank Dr. M. N. Sheela, Head, Division of Crop Improvement, CTCRI for providing the real-time PCR facility. The authors express their deep gratitude to the anonymous reviewers for their valuable suggestions in improving the manuscript.
References Attallah ZK, Bae J, Jansky SH, Rouse DI & Stevenson WR (2007) Multiplex real-time quantitative PCR to detect and quantify Verticillium dahliae colonization in potato lines that differ in response to Verticillium wilt. Phytopathology 97: 865–872.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
V.S. Nath et al.
Bienapfl JC, Malvick DK & Percich JA (2011) Specific molecular detection of Phytophthora sojae using conventional and real-time PCR. Fungal biol 115: 733–740. Chen Y & Roxby R (1996) Characterization of a Phytophthora infestans gene involved in the vesicle transport. Gene 181: 89–94. Cohen Y & Coffey MD (1986) Systemic fungicides and the control of Oomycetes. Annu Rev Phytopathol 24: 311–338. Debode J, Baeyen W, Van HS, Creemers P, Heungens K & Maes M (2009) Quantitative detection and monitoring of Colletotrichum acutatum in strawberry leaves using realtime PCR. Plant Pathol 58: 504–514. Erwin DC & Ribeiro OK (1996) Phytophthora Diseases Worldwide. APS Press, St. Paul, MN. Hayden KJ, Rizzo D, Tse J & Garbelotto M (2004) Detection and quantification of Phytophthora ramorum from California forests using a real-time polymerase chain reaction assay. Phytopathology 94: 1075–1083. Ioos R, Andrieux A, Marcßais B & Frey P (2006) Genetic characterization of the natural hybrid species Phytophthora alni as inferred from nuclear and mitochondrial DNA analyses. Fungal Genet Biol 43: 511–529. Li Y, Minerdi D, Garibaldi A & Gullino ML (2009) Molecular detection of Phytophthora cryptogea on Calendula officinalis and Gerbera jamesonii artificially inoculated with zoospores. J Phytopathol 157: 438–445. Li M, Asano T, Suga H & Kageyama K (2011) A multiplex PCR for the detection of Phytophthora nicotianae and P. cactorum, and a survey of their occurrence in strawberry production areas of Japan. Plant Dis 95: 1270–1278. Li M, Inada M, Watanabe H, Suga H & Kageyama K (2013) Simultaneous detection and quantification of Phytophthora nicotianae and P. cactorum and distribution analyses in strawberry greenhouses by Duplex Real-time PCR. Microbes Environ 28: 195–203. McCartney HA, Foster SJ, Fraaije BA & Ward E (2003) Molecular diagnostics for fungal plant pathogens. Pest Manag Sci 59: 129–142. Mishra AK, Jeeva ML, Pravi V, Misra RS & Hegde V (2010) Rapid and sensitive detection of Phytophthora colocasiae associated with leaf blight of taro by species-specific polymerase chain reaction assay. Ann Microbiol 60: 209–215. Misra RS (1999) Management of Phytophthora leaf blight disease of taro. Tropical Tuber Crops: Food Security and Nutrition (Balagopalan C, Nair TVR, Sunderesan S, Premkumat T & Lakshmi KR, eds), pp 460–469. Oxford and IBH, New Delhi, India. Misra RS, Sharma K & Mishra AK (2008) Phytophthora leaf blight of Taro (Colocasia esculenta) – a review. Asian Australas J Plant Sci Biotechnol 2: 55–63. Nath VS, Sankar MS, Hegde VM, Jeeva ML, Misra RS, Veena SS & Raj M (2012) Evaluation of fungicides on Indian isolates of Phytophthora colocasiae causing leaf blight of taro. Arch Phytopathol Plant Prot http://dx.doi.org/10.1080/ 03235408.2012.749688.
FEMS Microbiol Lett 352 (2014) 174–183
Specific detection of P. colocasiae
Nath VS, Sankar MS, Hegde VM, Jeeva ML, Misra RS & Veena SS (2013) Molecular evidence supports hypervariability in Phytophthora colocasiae associated with leaf blight of taro. Eur J Plant Pathol 136: 483–494. O’Brien PA, Williams N & Hardy GESJ (2009) Detecting Phytophthora. Crit Rev Microbiol 35: 169–181. Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Schena L & Cooke DEL (2006) Assessing the potential of regions of the nuclear and mitochondrial genome to develop a “molecular tool box” for the detection and
FEMS Microbiol Lett 352 (2014) 174–183
183
characterization of Phytophthora species. J Microbiol Methods 67: 70–85. Tsao PH (1983) Factors affecting isolation and quantitation of Phytophthora from soil. Phytophthora: Its Biology, Taxonomy, Ecology, and Pathology (Erwin DC, Bartnicki-Garcia S & Tsao PH, eds), pp. 219–236. The American Phytopathological Society, St. Paul, MN. White TJ, Bruns T, Lee S & Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications (Innes MA, Gefland DH, Sninsky J, & White TJ, eds), pp. 315–322. Academic, SanDiego, CA.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
Rapid and sensitive detection of Phytophthora colocasiae responsible for the taro leaf blight using conventional and real-time PCR assay Vishnu S. Nath1, Vinayaka M. Hegde1, Muthulekshmi L. Jeeva1, Raj S. Misra2, Syamala S. Veena1, Mithun Raj1, Suresh K. Unnikrishnan3 & Sree S. Darveekaran1 1
Division of Crop Protection, Central Tuber Crops Research Institute, Thiruvananthapuram, India; 2Regional Centre of CTCRI, Bhubaneswar, India and 3Regional Centre for DNA Fingerprinting, Rajiv Gandhi Centre for Biotechnology, Thiruvananthapuram, India
Correspondence: Vinayaka M. Hegde, Division of Crop Protection, Central Tuber Crops Research Institute, Thiruvananthapuram -695017, Kerala, India. Tel.: +91 9447245649; fax: +91 471 2590063; e-mail: [email protected]
MICROBIOLOGY LETTERS
Present address: Vinayaka M. Hegde, Division of Crop Protection Central Plantation Crops Research Institute, CPCRI Kasaragod, 671124, Kerala, India Received 26 November 2013; revised 25 January 2014; accepted 28 January 2014. Final version published online 24 February 2014. DOI: 10.1111/1574-6968.12395
Abstract Conventional and real-time PCR assays were developed for sensitive and specific detection of Phytophthora colocasiae, an oomycete pathogen that causes leaf blight and corm rot of taro. A set of three primer pairs was designed from regions of the RAS-related protein (Ypt1), G protein alpha-subunit (GPA1) and phospho-ribosylanthranilate isomerase (TRP1) genes. In conventional PCR, the lower limit of detection was 50 pg DNA, whereas in real-time PCR, the detection limit was 12.5 fg for the primer based on Ypt1 gene. The cycle threshold values were linearly correlated with the concentration of the target DNA (range of R2 = 0.911–0.999). All the primer sets were successful in detecting P. colocasie from naturally infected leaves and tubers of taro. Phytophthora colocasiae was detected from artificially infested samples after 18 and 15 h of postinoculation in conventional and real-time PCR assay, respectively. The developed PCR assay proved to be a robust and reliable technique to detect P. colocasiae in taro planting material and for assessing the distribution of pathogen within fields, thus aid in mitigating taro leaf blight.
Editor: David Studholme Keywords disease management; Phytophthora colocasiae; qPCR; single-copy genes; specific detection; SYBR green assay.
Introduction Taro [(Colocasia esculenta (L.) Schott] is a major root crop of the family Araceae with wide distribution in tropics. Leaf blight caused by Phytophthora colocasiae Raciborski is the most devastating disease of taro (Misra et al., 2008). The disease affects the leaves and petioles of taro plants, resulting in extensive damage of the foliage. The disease has become a major limiting factor in taro production worldwide including India, causing yield reductions to the magnitude of 50% every year (Misra et al., 2008). In addition to the leaf blight disease, P. colocasiae also causes serious postharvest decay of corms. ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
Cultural practices and metalaxyl-based fungicides have been unsuccessful in protecting the crop or have proved too expensive (Misra, 1999). Also, development of resistance to fungicide is another major threat (Cohen & Coffey, 1986; Nath et al., 2012). Moreover, exploitation of host resistance is limited due to the lack of other desirable economic and market value traits. Although there are alternative methods to chemical fungicides, such as the application of antagonistic microorganisms, it is essential to monitor the disease development. In this context, there is a clear need for reliable, accurate and rapid diagnostic method for effective management of this devastating disease. FEMS Microbiol Lett 352 (2014) 174–183
175
Specific detection of P. colocasiae
The methods employed to isolate and identify P. colocasiae often involve direct isolation on semi-selective media from infected plant tissue or baiting from soil with leaf discs followed by isolation (Tsao, 1983; Erwin & Ribeiro, 1996). However, the efficiency of these methods varies with respect to the environmental conditions and phase of the disease in samples used for isolation, making these detection methods laborious and time-consuming. Moreover, species identification is cumbersome and putative colonies of P. colocasiae may be confused with other Phytophthora species that share similar morphology, often requiring skilled taxonomists to reliably identify the pathogen. Although commercially available serological kits can be used for the detection of Phytophthora species, they can detect only to the genus level and some show crossreactivity with species of Pythium making the technique unreliable (McCartney et al., 2003; O’Brien et al., 2009). In recent years, conventional and real-time PCR has become firmly established in the repertoire of techniques available for plant disease diagnosis offering higher levels of specificity and sensitivity than most previously described methods. A conventional PCR assay is reported for P. colocasiae based on the internal transcribed spacer (ITS) region of ribosomal DNA (Mishra et al., 2010). However, preliminary tests with this assay indicated potential problems with amplification and specificity when using DNA from recent isolates of P. colocasiae and other Phytophthora species (V.S. Nath, V.M. Hegde, M.L. Jeeva, R.S. Misra, S.S. Veena and M. Raj, Unpublished). It has been reported that the number of rDNA copies fluctuates with age and stage of growth of the organism and this inconsistency may affect the accurate quantification of pathogen and potential comparison between samples (Attallah et al., 2007). Moreover, our recent study has shown that ITS region is highly variable in P. colocasiae with considerable amount of genetic diversity existing among isolates obtained from fine spatial scale (Nath et al., 2013). These findings suggest that ITS region may not be a suitable target for specific detection of P. colocasiae. Among other target genes proposed to identify and detect Phytophthora spp., single-copy genes could be of great interest. Many of these genes possess conserved exons and very variable introns suitable for the development of molecular markers for almost all Phytophthora species (Schena & Cooke, 2006). In view of this, the main focus of this research was the development of a conventional and real-time PCR assay for faster, sensitive and efficient detection of P. colocasiae to compliment routine diagnosis and assist management practices to mitigate taro leaf blight. To the best of our knowledge, this is the first time that three target regions have been focused on the development of specific PCR detection of P. colocasiae. FEMS Microbiol Lett 352 (2014) 174–183
Materials and methods Biological materials
Lists of microorganism used for testing the specificity of the primers are presented in Table 1. Isolates of P. colocasiae used in this study were isolated from taro blight samples collected from various geographical boundaries of India during a period of 2007–2012. Isolation and maintenance of the P. colocasiae isolates were performed as previously described (Nath et al., 2013). The isolates were confirmed to species level by ITS amplification and sequencing using universal ITS1 and ITS4 primers (White et al., 1990). Genomic DNA extraction
Phytophthora colocasiae, other Phytophthora and fungal strains were grown in potato dextrose agar medium (PDA; 250 g L1 potato, 20 g L1 dextrose and 20 g L1 agar). DNA was extracted from 5 to 7 days old cultures using a Genomic DNA purification kit (Fermentas, EU) according to manufacturer’s instructions. DNA from healthy and diseased leaves of taro was also extracted using the same kit. Bacterial cultures were grown overnight at 37 °C in Luria–Bertani broth, and genomic DNA was extracted by the method of Sambrook et al. (1989). DNA was extracted from soil using an UltraCleanTM soil DNA isolation kit (MoBio laboratories, Carlsbad, CA) following manufacturer’s instructions. DNA extracted from various sources was quantified using Quant-iTTM Assay kit (Invitrogen) following manufacturer’s instructions. The integrity of the DNA was assessed by agarose gel electrophoresis and stored at 20 °C until further use. PCR amplification and sequencing
The genomic regions of representative isolates of P. colocasiae were amplified using primer pairs corresponding to three target regions viz. TRP1 (encodes a bifunctional enzyme of the tryptophan biosynthetic pathway), RASYpt (monomeric GTP-binding proteins, essential in specific steps of vesicle transport and secretion) and GPA1 (GTP-binding proteins that participate in diverse signal transduction pathways) genes (Ioos et al., 2006). The PCR products were purified using a QIAquick Gel extraction kit (QIAGEN, Tokyo, Japan) and cloned into the pTZ57R/T vector (InsTAclone PCR cloning kit, Fermentas, EU). They were transformed into competent DH5a cells and plated on Luria agar blue and white selective medium. The obtained white colonies were randomly subjected to colony PCR in order to confirm the presence of the insert, and those found positive were sequenced
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
176
V.S. Nath et al.
Table 1. Isolates of Phytophthora colocasiae, other Phytophthora spp., fungal and bacterial pathogens used for screening the designed primers with conventional and real-time PCR assay Isolate code Phytophthora colocasiae P1 P3 P21* P42 P9 P4 P35 P7 P6* P23* P15 P28* P11 P32 P33 P45 P22* P16* P34 P26 P29 P36 P27 P5 P12 P2* P41 P13 P24* P40 P50 P25 P14 P39 P43 P17 P19 P30 P46 P8 P37 P44 P20* P10 P48 P47 P31 P18 P38 P49 Phytophthora genus P. capsici P. citrophthora P. parasitica
Location
District/sampling site
Year of collection
Conventional PCR
Real-time PCR
Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Kerala Andhra Pradesh Andhra Pradesh Andhra Pradesh Andhra Pradesh Andhra Pradesh Andhra Pradesh Odisha Odisha Odisha Odisha Odisha Odisha Odisha Odisha Odisha Uttar Pradesh Uttar Pradesh Uttar Pradesh Delhi Assam Assam Assam Meghalaya Meghalaya Meghalaya Meghalaya West Bengal West Bengal West Bengal West Bengal Tripura Tripura Tripura
Block 2, CTCRI field Block 1, CTCRI field Farm, CTCRI Thiruvananthapuram Thiruvananthapuram Aleppy Pathanamthitta Pathanamthitta Kottayam Kollam Haripad Idukki Calicut Block 2, CTCRI Block 2, CTCRI Calicut Calicut Veerwada Veerwada East Godawari Parudin pallam Parudin pallam Veerwada Nayagarh Khandapara RC, CTCRI RC, CTCRI Salepur Puri RC CTCRI RC CTCRI Puri Malikpur Malikpur Malikpur New Delhi Nellie Road Nellie Road Nellie Road Ribhoi Nongpoh Ribhoi Nongpoh Nadia Nadia Kalyani Kalyani West Tripura West Tripura West Tripura
2010 2010 2011 2012 2008 2011 2011 2011 2011 2010 2012 2010 2007 2012 2012 2009 2008 2010 2011 2011 2010 2011 2011 2007 2007 2008 2009 2008 2007 2008 2009 2007 2007 2008 2009 2010 2007 2010 2011 2009 2011 2011 2010 2009 2009 2008 2007 2010 2010 2011
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
FEMS Microbiol Lett 352 (2014) 174–183
177
Specific detection of P. colocasiae
Table 1. Continued Isolate code
Location
District/sampling site
Year of collection
P. araceae P. meadii P. nicotianae P. infestans P. cryptogea P. boehmeriae P. palmivora Fungal Colletotrichum capsici Sclerotium rolfsii Colletotrichum lindemuthianum Trichoderma harzianum Pythium ultimum Rhizoctonia solani Bacteria Erwinia carotovora
Conventional PCR
Real-time PCR
*Isolates selected for ITS amplification for species confirmation and characterization.
using M13 forward and reverse primers (Applied Biosystems 3500 Genetic Analyzer, Life Technologies). The nucleotide sequences obtained were processed to remove vector sequence and low-quality reads, transformed into consensus sequences with GENEIOUS PRO software version 5.6. The nucleotide sequence analysis with BLASTN (NCBI) showed 90–95% similarity among other Phytophthora species for the same gene, and a representative sequence of target genes of the isolate P 17 was submitted to the GenBank at the NCBI under the accession numbers KF848712 and KF848713. Primer design
For the development of the species-specific primers, regions of dissimilarity between the consensus of P. colocasiae and other Phytophthora, fungal and bacterial species were identified and putative P. colocasiae-specific primers
were designed using the PRIMER PREMIER software version 6.0 (Table 2). The various parameters were set uniformly for all primer pairs to facilitate similar amplification profiles. A total of four primer pairs were designed for each target gene. The primer pairs were preliminarily assessed using BLAST against the NCBI GenBank database and further by the primer BLAST program to ascertain their suitability as P. colocasiae-specific primers. Conventional PCR assay
The specificity and sensitivity of the designed primer pairs were evaluated with a conventional PCR. For specificity check, microorganisms listed in Table 1 were used as PCR templates. To determine sensitivity of the primers, ten-fold serial dilutions (25 ng lL1 initial concentration) of the P. colocasiae genomic DNA were prepared and used as a template for the PCR. Two replicates were
Table 2. List of primers used for conventional and real-time PCR assay in the present study Target species
Gene
Primer name and sequence (50 -30 )
Tm (°C)
Product size
Reference
Phytophthora spp.
RAS-Ypt
F -ATGAACCCCGAATAGTRCGTGC R - TGTTSACGTTCTCRCAGGCG F – GAGGAGATCGCGGCGCAGCG R - GCGCACATRCCGAGVTTGTG F – GGACTCTGTGCGTCCCAGATG R - ATAATTGGTGTGCAGTGCCGC PCSP-RL F- GGTGTGGACTTTGTGAGTTTCAG PCSP-RL R- AAGGGAGTTGGCACAACCATT PCSP-T F- AGCGCCTTAACGCTCCCT PCSP-T R- GAGCCCTTGAACCACTTGGG PCSP-G F-TTGGTGGCGTGTAGTCTGTG PCSP-G R- AGCTTCCGGTTGATGGTAGC
67.8 62.9 78.4 68.9 69.4 69.0 64.7 66.5 66.1 68.0 64.9 65.3
666–698
Ioos et al. (2006)
661–765
Ioos et al. (2006)
286–312
Ioos et al. (2006)
TRP1 GPA1 Phytophthora colocasiae
RAS-Ypt TRP1 GPA1
FEMS Microbiol Lett 352 (2014) 174–183
206
This study
248
This study
581
This study
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
178
used for each reaction with proper negative controls. Amplifications were performed in an Agilent sure cycler 8800 (Agilent Technologies). The PCRs were conducted in a volume of 25 lL, which included 100 ng of template DNA, 100 lM each deoxynucleotide triphosphate, 10 ng of each primer, 1.5 mM MgCl2, 19 Taq buffer (10 mM Tris-HCl pH 9.0, 50 mM KCl, 0.01% gelatin), 1 U of Taq DNA polymerase (Merck GeNei, India). The following optimized PCR regime was used: denaturation at 95 °C for 2 min, followed by 35 cycles of 95 °C for 30 s, 55 °C for 45 s, 72 °C for 1 min and a final extension at 72 °C for 8 min. The amplified products were visualized in a 1.5% agarose gel, and photographs were scanned through a Gel Doc System (Alpha imager, Alpha Innotech). Real-time PCR assay
Real-time quantitative PCR (qPCR) was performed with the Eppendroff realplex PCR system (Eppendroff, Hamburg, Germany) in a total volume of 20 lL. The reaction mixture consists of 12.5 lL of 29 SYBR green master mix (Fermentas, EU), 0.3 lM each of the forward and reverse primers and 5 lL of template DNA (25 ng lL1). The final volume of the reaction was adjusted with molecular-grade water. Thermal cycling parameters were same as for the conventional PCR. To quantify P. colocasiae genomic DNA and to evaluate the amplification efficiency and the detection limits of the qPCR assay, a 10-fold dilution series of P. colocasiae genomic DNA (25 ng lL1 initial concentration) was used to create a standard curve. The Ct values for each PCR were interpolated from the standard curves to calculate the amount of P. colocasiae DNA in a sample. Each run included nontemplate controls, in which DNA template was replaced by 5 lL molecular-grade water. All samples were run in triplicates, and results are presented as mean values SD. A melt curve analysis was performed at every run to assess the product specificity. The amplified products were resolved in a 1.5% agarose gel, and photographs were scanned through a Gel Doc System (Alpha imager, Alpha Innotech). Detection of P. colocasiae in naturally and artificially infected leaf, tuber and soil
Field samples of taro leaves and tubers either symptomatic or asymptomatic were collected from two fields of CTCRI. One field had a continuous history of leaf blight incidence, possessing visible symptoms of disease, while other field had plants that lacked symptoms. A small portion of the samples was processed by standard isolation procedure to confirm the presence of P. colocasiae (Nath et al., 2013). Soil samples adjacent to the roots of plants ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
V.S. Nath et al.
were also collected from these fields. In addition, an artificially infested soil sample was prepared by sterilizing one field sample (100 g) and adding a mycelial slurry of P. colocasiae grown in 100 mL of potato dextrose broth media. For artificial inoculation of leaves, a rapid method described by Nath et al. (2013) was used. Artificial infection of taro tubers was carried out according to Mishra et al. (2010). To determine the earliest time point at which P. colocasiae could be detected, sampling was performed at 10, 12, 15, 18, 24, 48 and 72 h postinoculation by excising a small portion (c. 50 mg of fresh tissue) from either symptomatic or asymptomatic areas of each tuber or leaf sample. Samples inoculated with sterile agar disc served as control treatments. Re-isolation was performed from all infected samples to complete Koch’s postulate. Each experiment consisted of five replicates, and the experiment was repeated twice.
Results Primer specificity and sensitivity with conventional PCR assay
The primer pairs successfully amplified P. colocasiae isolates from different regions of India in the optimized PCR condition and yielded an amplicon of c. 206, 248 and 581 bp for RAS like, TRP and GPA1 gene, respectively, when resolved on 1.5% agarose gel (Fig. 1a). Only DNA from P. colocasiae recorded amplification with the designed primers indicating that no corresponding sites of the designed primer existed in the genomic DNA of the other tested organism (Fig. 1b). Results from the dilution series of genomic DNA from the P. colocasiae pure culture showed that the specific PCR assay using the PCSP-RL, PCSP-G and PCSP-T primers could detect 50 pg, 50 pg, 0.5 ng of DNA per reaction, respectively (Table 3). Real-time PCR assay
The SYBR green PCR assay with the designed primers resulted in positive amplification of all P. colocasiae isolates tested. No amplification was detected in other Phytophthora, fungal or bacterial isolate suggesting the specificity of the designed primers. The standard fluorescent amplification representing exponential growth of PCR products was observed in each cycle, yielding threshold cycle (Ct) values that ranged from 15 to 32 for PCSP-RL, PCSP-T and PCSP-G primers (Table 3). The standard curve used to calculate the starting concentration of P. colocasiae DNA had a high correlation coefficient in the range of R2 = 0.911–0.999 for the three FEMS Microbiol Lett 352 (2014) 174–183
179
Specific detection of P. colocasiae
(a)
(b)
Fig. 1. Amplification and specificity check for the designed primers (a) Amplification of Phytophthora colocasiae isolates from various origins of India using the designed primer PCSP-RL (b) Specificity of the designed primer pairs using conventional PCR assay. Lane M 1 kb plus DNA ladder (Fermentas), Lane 1 Phytophthora colocasiae, Lane 2 Phytophthora capsici, Lane 3 Phytophthora meadii, Lane 4 Phytophthora parasitica, Lane 5 Phytophthora palmivora, Lane 6 Phytophthora citrophthora, Lane 7 Phytophthora araceae, Lane 8 Phytophthora nicotianae Lane 9 Phytophthora boehmeriae, Lane 10 Phytophthora infestans, Lane 11 Phytophthora cryptogea, Lane 12 Sclerotium rolfsii, Lane 13 Colletotrichum lindemuthianum, Lane 14 Colletotrichum capsici, Lane 15 Trichoderma harzianum, Lane 16 Pythium ultimum, Lane 17 Rhizoctonia solani, Lane 18 Erwinia carotovora, Lane 19 no DNA template.
Table 3. Sensitivity of conventional and real-time PCR assays based on the designed primer pairs for the detection of Phytophthora colocasiae DNA Real-time PCR†
Conventional PCR* Genomic DNA 1
25 ng lL 2.5 ng lL1 0.25 ng lL1 25 pg lL1 2.5 pg lL1 0.25 pg lL1 25 fg lL1 2.5 fg lL1
PCSP-RL
PCSP-T
PCSP-G
PCSP-RL
PCSP-T
PCSP-G
+ + + + +
+ + + +
+ + +
15.93 18.62 21.45 24.18 27.36 29.81 31.79 31.58
18.10 18.51 21.82 20.56 28.69 30.34
15.86 18.39 21.22 21.79 28.21 30.13 32.15
(0.25) (0.22) (0.37) (0.21) (0.32) (0.34) (0.20) (0.83)
(0.73) (0.28) (0.23) (0.07) (0.58) (0.53)
(0.07) (0.45) (0.18) (2.68) (0.52) (0.84) (0.92)
*
Conventional PCR product: + = expected PCR band present; = no PCR product. Ct values followed by SE in parenthesis.
†
primer pairs, suggesting a reproducible linear correlation between the input DNA and the Ct values. The minimum detection limit was 12.5 fg for PCSP-RL, 125 fg for PCSP-G and 1.25 pg for PCSP-T (Table 3). The melting curve analysis at the end of the cycling reactions revealed single dissociation peak at 82 °C (PCSP-RL and PCSP-T) and 86 °C (PCSP-G), indicating the specific binding of the designed primers (Fig. 2). Gel electrophoresis of the real-time PCR assay in 1.5% agarose gel showed the presence of single amplified product of the expected band size (data not shown). Negative controls
FEMS Microbiol Lett 352 (2014) 174–183
lacking DNA yielded no amplification with the designed primer pairs. Detection of P. colocasiae from naturally and artificially infected samples
Positive amplification was recorded from field symptomatic samples using the designed primers in both conventional and real-time PCR assays. In addition, putative P. colocasiae colonies could be isolated from these samples using Phytophthora selective media, which were also ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
180
V.S. Nath et al.
confirmed through PCR. Plant samples lacking visible symptoms gave negative results in PCR (Table 4). DNA extracted from plant samples inoculated with P. colocasiae yielded positive amplification in both con-
ventional and real-time PCR, whereas DNA from control experiments yielded negative results (Table 4). In addition, infected samples plated on Phytophthora selective media yielded cultures with phenotypic characteristics of P.
Fig. 2. Standard curves and melt curve analysis of the real-time PCR assay using the designed primer pairs.
Table 4. Comparison of culture based isolation, conventional and real-time PCR assays for the detection of Phytophthora colocasiae based on the designed primers
Sample Plant samples collected from field lacking leaf blight symptoms Plant samples collected from field with leaf blight symptoms Plant samples collected from artificially infested leaf and tuber Noninoculated control plant samples Soil samples from field lacking leaf blight symptoms Soil samples from field with leaf blight symptoms Artificially infested soil sample
Isolation on Phytophthora selective medium*
Conventional PCR detection†
Real-time PCR detection‡
+
+
+
+
+
+
+
+
+
+
+
*P. colocasiae was recovered from symptomatic samples. † Conventional PCR product: + = expected PCR band present; = no PCR product. ‡ Samples with Ct values < 35 = +, samples with Ct values > 35 = .
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
FEMS Microbiol Lett 352 (2014) 174–183
Specific detection of P. colocasiae
colocasiae. The earliest time point at which P. colocasiae could be detected in artificially infested samples was 18 and 15 h postinoculation in conventional and real-time PCR, respectively. Phytophthora colocasiae was detected in soil from fields containing plants with symptoms of leaf blight but not from a field lacking symptomatic plants. Phytophthora colocasiae was also detected in artificially infested soil sample using both conventional and real-time PCR (data not shown).
Discussion Early detection and identification of plant pathogens are an integral part of successful disease management. Taro leaf blight caused by Phytophthora colocasiae represents the single biggest constraint for taro production globally. A reliable method for specific detection of P. colocasiae could be of great asset to the management of leaf blight disease. Commonly used methods for the detection of Phytophthora species such as semi-selective-media-based isolations and immunological procedures like ELISA have limitations with specificity and are also time-consuming (O’Brien et al., 2009). Methods based on PCR have clear advantages of being more sensitive, robust, rapid and less labour-intensive than traditional diagnostic methods. The objective of this study was to develop and validate a conventional and real-time PCR assay for specific detection of P. colocasiae. Successful primer design for the detection of pathogen requires that the target region be unique to the organism of interest and conserved across populations of the organism of interest. The three target genes chosen for primer designing were unique with the presence of conserved coding regions flanking very variable introns appropriate for differentiating closely related species of Phytophthora (Ioos et al., 2006; Schena & Cooke, 2006). The analysis of the sequences of the genes from different isolates of the P. colocasiae showed the absence of intraspecific polymorphism that could cause problems for diagnostic assays. Phytophthora colocasiae-specific primers could be developed from all the target regions. A conventional PCR assay was used to assess the sensitivity and specificity of the designed primer pairs. The assay yielded positive amplification for all the isolates of P. colocasiae tested, independently from their geographical origin. This was an advantage over the previously reported P. colocasiae-specific primers (Mishra et al., 2010), where the primers failed to amplify recently obtained P. colocasiae isolates from India. The assay also did not cross-react with other closely related Phytophthora, fungal or bacterial species suggesting its high specificity. The detection limit of the primer pairs in the FEMS Microbiol Lett 352 (2014) 174–183
181
conventional PCR assay was 50 pg, which is low when compared to the earlier report, where the authors claim 20 pg as the detection limit (Mishra et al., 2010). This is expected because unlike assays designed on multicopy genes such as rDNA which provides increased sensitivity (Hayden et al., 2004); the present study was based on single-copy genes (Chen & Roxby, 1996; Schena & Cooke, 2006). However, methods based on single-copy genes are not affected by the number of tandem repeats as in case of multicopy genes and therefore have potential to accurately detect the pathogen biomass (Schena & Cooke, 2006). One reason for developing a conventional PCR assay is that it can be utilized in laboratories with less specialized personnel or sophisticated equipment such as real-time PCR. Nevertheless, real-time PCR is faster, more sensitive and less labour-intensive as it eliminates postPCR processing. Although reliability of the PCR assay in detecting P. colocasiae isolates from other countries was not tested due to the lack of isolates from those regions, an in silico PCR analysis was used for testing the reproducibility of the primers in amplifying P. colocasiae isolates from across the globe. To our knowledge, this is the first time that a real-time PCR assay has been developed and validated for the specific detection of P. colocasiae. The real-time PCR assay was shown to be highly sensitive as it was able to detect as low as 12.5 fg of P. colocasiae DNA. In this respect, the realtime PCR easily supersedes the conventional PCR and should help detect the pathogen presence at an early stage of infection. In addition, compared with the conventional PCR, the real-time PCR is faster, is less prone to contamination, uses chemicals not suited for routine diagnostic work (e.g. ethidium bromide) and omits the post-PCR gel electrophoresis step to visualize the results. Real-time PCR assays for detecting plant pathogens have gained considerable attention during recent years. Specific PCR assays for detecting Colletotrichum acutatum in strawberry plants (Debode et al., 2009), P. cryptogea in gerbera plants (Li et al., 2009), P. sojae in soya bean (Bienapfl et al., 2011) are a few examples among them. More importantly, realtime assay based on single-copy genes has also been described in several plant pathogens. The Ypt1 gene target region was used as a molecular marker to identify P. fragariae (Ioos et al., 2006) and to develop a multiplex real-time PCR detection method for P. ramorum, P. kernoviae, P. citricola and P. quercina (Schena & Cooke, 2006; Li et al., 2011). Recently, the same gene was used for real-time detection of P. cactorum in strawberry (Li et al., 2013). Our sampling results have shown that both the PCR assays can provide consistent detection of P. colocasiae from infected plant material and may thus be applied to more routine planting material screening. Phytophthora colocasiae was detected from artificially inoculated plant ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
182
samples as early as 18 and 15 h postinoculation in conventional and real-time PCR, respectively, even before the initiation of visible symptoms. Our detection time was 2 h later to the earlier report of Mishra et al. (2010), which is expected as their assay was based on ITS region and provides a greater sensitivity (Hayden et al., 2004). The primers also successfully detected P. colocasiae DNA in field-grown plants exhibiting symptoms of Phytophthora leaf blight. In addition, P. colocasiae was also detected in symptomatic field-grown plants when culture plate isolation produced negative results. Various factors such as unfavourable environmental conditions, the presence of other microorganisms, phase of the symptom in the samples and ageing plants can lead to false negatives when using culture methods (O’Brien et al., 2009). Finally, the primers were also efficient in detecting P. colocasiae from soil samples collected from fields exhibiting symptoms of leaf blight and also from soil artificially infested in the laboratory. In conclusion, this study shows that the developed conventional and real-time PCR assays are highly efficient, reliable and rapid methods for the detection of P. colocasiae from a wide range of plant samples including soil. Both methods represent useful tools for in-depth study of the biology and epidemiology of the P. colocasiae populations. The primers and the assay methods described here will be useful for rapid and sensitive detection of P. colocasiae in taro planting material. Furthermore, the present PCR assays could assist further research to determine the inoculum concentration thresholds of P. colocasiae in taro growing areas in predicting the risk of disease development. This will lead to better disease management strategies as appropriate preventive measures can be identified more quickly before the spread of P. colocasiae can take place.
Acknowledgements The funding provided for conducting the research work by the Indian Council of Agricultural Research, New Delhi, under IISR outreach programme is gratefully acknowledged. The authors wish to thank Dr. M. N. Sheela, Head, Division of Crop Improvement, CTCRI for providing the real-time PCR facility. The authors express their deep gratitude to the anonymous reviewers for their valuable suggestions in improving the manuscript.
References Attallah ZK, Bae J, Jansky SH, Rouse DI & Stevenson WR (2007) Multiplex real-time quantitative PCR to detect and quantify Verticillium dahliae colonization in potato lines that differ in response to Verticillium wilt. Phytopathology 97: 865–872.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
V.S. Nath et al.
Bienapfl JC, Malvick DK & Percich JA (2011) Specific molecular detection of Phytophthora sojae using conventional and real-time PCR. Fungal biol 115: 733–740. Chen Y & Roxby R (1996) Characterization of a Phytophthora infestans gene involved in the vesicle transport. Gene 181: 89–94. Cohen Y & Coffey MD (1986) Systemic fungicides and the control of Oomycetes. Annu Rev Phytopathol 24: 311–338. Debode J, Baeyen W, Van HS, Creemers P, Heungens K & Maes M (2009) Quantitative detection and monitoring of Colletotrichum acutatum in strawberry leaves using realtime PCR. Plant Pathol 58: 504–514. Erwin DC & Ribeiro OK (1996) Phytophthora Diseases Worldwide. APS Press, St. Paul, MN. Hayden KJ, Rizzo D, Tse J & Garbelotto M (2004) Detection and quantification of Phytophthora ramorum from California forests using a real-time polymerase chain reaction assay. Phytopathology 94: 1075–1083. Ioos R, Andrieux A, Marcßais B & Frey P (2006) Genetic characterization of the natural hybrid species Phytophthora alni as inferred from nuclear and mitochondrial DNA analyses. Fungal Genet Biol 43: 511–529. Li Y, Minerdi D, Garibaldi A & Gullino ML (2009) Molecular detection of Phytophthora cryptogea on Calendula officinalis and Gerbera jamesonii artificially inoculated with zoospores. J Phytopathol 157: 438–445. Li M, Asano T, Suga H & Kageyama K (2011) A multiplex PCR for the detection of Phytophthora nicotianae and P. cactorum, and a survey of their occurrence in strawberry production areas of Japan. Plant Dis 95: 1270–1278. Li M, Inada M, Watanabe H, Suga H & Kageyama K (2013) Simultaneous detection and quantification of Phytophthora nicotianae and P. cactorum and distribution analyses in strawberry greenhouses by Duplex Real-time PCR. Microbes Environ 28: 195–203. McCartney HA, Foster SJ, Fraaije BA & Ward E (2003) Molecular diagnostics for fungal plant pathogens. Pest Manag Sci 59: 129–142. Mishra AK, Jeeva ML, Pravi V, Misra RS & Hegde V (2010) Rapid and sensitive detection of Phytophthora colocasiae associated with leaf blight of taro by species-specific polymerase chain reaction assay. Ann Microbiol 60: 209–215. Misra RS (1999) Management of Phytophthora leaf blight disease of taro. Tropical Tuber Crops: Food Security and Nutrition (Balagopalan C, Nair TVR, Sunderesan S, Premkumat T & Lakshmi KR, eds), pp 460–469. Oxford and IBH, New Delhi, India. Misra RS, Sharma K & Mishra AK (2008) Phytophthora leaf blight of Taro (Colocasia esculenta) – a review. Asian Australas J Plant Sci Biotechnol 2: 55–63. Nath VS, Sankar MS, Hegde VM, Jeeva ML, Misra RS, Veena SS & Raj M (2012) Evaluation of fungicides on Indian isolates of Phytophthora colocasiae causing leaf blight of taro. Arch Phytopathol Plant Prot http://dx.doi.org/10.1080/ 03235408.2012.749688.
FEMS Microbiol Lett 352 (2014) 174–183
Specific detection of P. colocasiae
Nath VS, Sankar MS, Hegde VM, Jeeva ML, Misra RS & Veena SS (2013) Molecular evidence supports hypervariability in Phytophthora colocasiae associated with leaf blight of taro. Eur J Plant Pathol 136: 483–494. O’Brien PA, Williams N & Hardy GESJ (2009) Detecting Phytophthora. Crit Rev Microbiol 35: 169–181. Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Schena L & Cooke DEL (2006) Assessing the potential of regions of the nuclear and mitochondrial genome to develop a “molecular tool box” for the detection and
FEMS Microbiol Lett 352 (2014) 174–183
183
characterization of Phytophthora species. J Microbiol Methods 67: 70–85. Tsao PH (1983) Factors affecting isolation and quantitation of Phytophthora from soil. Phytophthora: Its Biology, Taxonomy, Ecology, and Pathology (Erwin DC, Bartnicki-Garcia S & Tsao PH, eds), pp. 219–236. The American Phytopathological Society, St. Paul, MN. White TJ, Bruns T, Lee S & Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications (Innes MA, Gefland DH, Sninsky J, & White TJ, eds), pp. 315–322. Academic, SanDiego, CA.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
