1416
Rapid Detection of Cytomegalovirus DNA in Cerebrospinal Fluid of AIDS Patients with Neurologic Disorders Joel Gozlan, Jean-Michel Salord, Etienne Roullet, Marielle Baudrimont, Francoise Caburet, Odile Picard, Marie-Caroline Meyohas, Claudine Duvivier, Christine Jacomet, and Jean-Claude Petit
Services de Bacteriologic- Virologic. Maladies Infectieuses. Neurologic. Anatomo-Pathologie, and Medecine Interne, Hiipital Saint-Antoine; Service des Maladies Infectieuses, Hopital Rothschild. Paris. France
Cytomegalovirus (CMV) is the most common opportunistic viral pathogen in AIDS patients. Retinitis and gastrointestinal tract disturbances are the main clinical manifestations ofCMV disease in this context, but involvement of both the peripheral and central nervous system (CNS) can occur. A CMV-related encephalitis was present in up to 33% of AIDS patients in autopsy series [1], and several neurologic syndromes can be caused by CMV, including encephalitis [2], polyradiculomyelitis [3], and peripheral neuropathy [4]. Virologic diagnosis of these diseases is problematic. Culture of cerebrospinal fluid (CSF) is insensitive [5], and histologic techniques are aggressive and can be unreliable. Stereotaxic brain biopsy requires the presence of lesions visible by computed tomography or magnetic resonance imaging, but these are infrequent in CMV encephalitis. Peripheral nerve biopsies can be informative, but the distal nerve sampled may be spared in CMV -related peripheral neuropathy or radiculopathy. As a result, these diseases are frequently discovered after death; however, they are likely to become more frequent as AIDS patients survive longer. Early antiviral therapy has potential benefit for some of these disorders [6], and an accurate diagnostic test would therefore be useful. For this purpose, we used the polymerase chain reaction (PCR)
Received 26 May 1992; revised I September 1992. Presented in part: Third European Conference on Clinical Aspects and Treatment of HIV Infection, Paris, March 1992. Financial support: Assistance Publique-Hopitaux de Paris. Reprints or correspondence: Dr. Joel Gozlan, Service de BacteriologieVirologie, Hopital Saint-Antoine. 184 rue du Faubourg Saint-Antoine, 75571 Paris cedex 12, France. The Journal of Infectious Diseases 1992;166:1416-21 © 1992 by The University of Chicago. All rightsreserved. 0022-1899/92/6606-0033$01.00
technique to detect CMV DNA sequences in CSF samples, and determined its value in human immunodeficiency virus (HIV)-infected individuals with neurologic disorders.
Patients, Materials, and Methods Patients A retrospective study was conducted using CSF samples from HIV-infected patients sent to our laboratory for viral culture from September 1990 to January 1992. Frozen material was available for 82 specimens from 67 patients, representing 71%of CSF samples obtained during the study period; all these samples were included. The study population was a mean of 39 years old with a sex ratio (M:F) of 5.7; 81% had AIDS at the time of lumbar puncture, and the mean CD4+ blood lymphocyte count was 73/mm3. Clinical, immunologic, virologic and, when available, pathologic data were studied to assess the clinical relevance of the PCR results. Fourteen samples from our CSF bank were used as controls; they had been obtained from AIDS patients with other documented neurologic diseases proven by culture of CSF (cryptococcosis, 2; tuberculosis, 3; Candida meningitis, 1; herpes simplex virus [HSV] encephalitis, 2; and varicella-zoster virus [VZV] encephalitis, I), by histopathologic evaluation of the brain (lymphoma, 3; progressive multifocal leukoencephalopathy [PMLj, I), or by detection of intrathecal synthesis of specific antibodies (syphilis, I). Virus Isolation and Detection of Early Antigen Foci Conventional virus isolation and detection of early antigen foci (DEAF) were done on all CSF samples. For virus isolation, confluent human foreskin fibroblasts were inoculated with 500 p,L of CSF and observed for 4 weeks for the cytopathic effect of
Downloaded from http://jid.oxfordjournals.org/ at University of Sussex on February 9, 2015
A polymerase chain reaction (PCR)-based method was used to detect cytomegalovirus (CMV) DNA in 82 cerebrospinal fluid (CSF) samples from 67 patients infected by human immunodeficiency virus (HIV). The test was positive for 14 patients, 8 of whom had CMV-related neurologic disease proven by viral culture of CSF or histologic examination. Encephalitis was the most frequent manifestation in patients with positive PCR results, but CMV DNA was also present in some patients with peripheral neuropathy or polyradiculomyelitis. All patients with proven CMV neurologic disease were positive by PCR. In contrast, viral culture was negative for 4 of the 8 patients and pathologic studies were available only for 5. The specificity of the PCR-based assay could not be assessed precisely because of the lack of a reference standard, but the results correlated well with clinical course and results of the other methods. These findings suggest that the PCR-based method may be a useful noninvasive tool for the rapid diagnosis ofCMV-related neurologic disease.
JID 1992; 166 (December)
Concise Communications
CMY. For DEAF, 2-4 wells of 24 multiwell plates containing the same confluent fibroblasts were inoculated with 100 ILL of CSF, centrifuged at 2300 g for 45 min, and cultivated for 24 h at 37°C. An immediate-early CMY antigen was then detected using a monoclonal antibody (clone E 13; Clonatec Biosoft, Paris) in a classical immunoperoxidase reaction described elsewhere [7]. Pathologic Studies
PCR Assay DNA extraction. A sample (200 ILL) of CSF was boiled at 95°C for 15 min. DNA was then precipitated by adding 20 ILL of 3 M sodium acetate and 450 ILL ofabsolute ethanol and incubating at -80°C for I h. The pellet obtained by centrifugation (12,000 g for 30 min) was air-dried and resuspended in 30 ILL of distilled water. Primers and probes. Two different sets of primers and probes were synthesized in the pp65 kDa-encoding gene [8] (primers CS I [TTGGTATCGCAGTACACGCC] and CS2 [GCAGCGCGTACACA TAGATC], giving amplification of a 181-bp segment recognized by oligoprobe CS3 [CGGCGACAATCAGCTGCAGGTGCAGCACACGTACTT]), and in the major capsid protein (MCP)-encoding gene [9] (primers CMCP I [GTGATCCGACTGGGCGAAAA] and CMCP2 [GAGCGCGTCCACAAAGTCTA], giving amplification of a 263-bp segment recognized by oligoprobe CMCP3 [GCCCGAGGATCGCGGTTACACCACGGTGGAAAGCAAAGT]). Amplification. The extracted DNA ( 10 ILL) was amplified in a reaction mixture containing 50 pmol of each primer, 10 mM TRIS-HCI (pH 8.3), 50 mM KCl, 1.5 mM MgCl z, 0.2 mM of each dNTP, and 1.25 units of cloned Taq polymerase (PerkinElmer Cetus, Norwalk, CT) in a total volume of 100 ILL. Samples were covered by 100 ILL of paraffin oil, denatured for 5 min at 94°C, and amplified for 40 cycles in a thermal cycler apparatus as follows: I min at 94°C for denaturation, I min at 60°C for annealing, and I min at noc for polymerization. This last step was extended to 10 min on the last cycle to ensure completion of the amplified products. peR product analysis. Aliquots (20 ILL) of each amplification mixture were electrophoretically separated in 2% agarose gels, directly stained with ethidium bromide, and then transferred in alkaline conditions to nylon membranes (Hybond N+;
Amersham, Les Viis, France). The membranes were prehybridized for I h at 68°C in a buffer containing 6X standard saline citrate, 2.5X Denhart's solution, 0.1%SDS, 0.5 mMEDTA, and 200 llg/mL sonicated salmon-sperm DNA and then hybridized with 5 X 105 cpm/rnl, of 3zP-kinase-labeled oligoprobe (CMCP3 or CS3). After 4 h at 68°C, the blots were washed and exposed to radiographic film at -70°C for 16 h. Prevention of contamination. We followed standard recommendations to prevent contamination, particularly the physical separation of the nucleic acid extraction, PCR preparation, and PCR product analysis steps. We used filtered tips to avoid DNA aerosols.
Statistical Analysis Data were compared using XZ analysis for categories and the Mann-Whitney test for continuous values. P ~ .05 was considered significant.
Results Viral Culture CMY was isolated from 6 (7.3%) of the 82 CSF samples, collected from 4 (5.9%) of the 67 patients. Cultures were positive within a mean of 17.6 days (range, 8-25). Of these 6 positive samples, 5 were also positive for DEAF.
Pathologic Studies Brain necropsy. Lesions attributable to CMY were present in 4 patients: Gross examination showed periventricular necrosis isolated in 3 and associated with focal necrotic lesions of the parietal lobe white matter in I. Light microscopy showed numerous cells containing CMY inclusions in the periventricular lesions of the 4'patients. In I, multinucleated giant cells, characteristic of HIY encephalitis, were found. Immunocytochemical detection of CMY antigen confirmed the light microscopy findings. Examination of the other brains revealed toxoplasmosis in 2, hemorragic lesions in I, bacterial abscess in I, and no lesions in I. Peripheral nerve biopsies. CMY inclusions were present in I case (described in [4]), whereas no lesions were seen in the other 2. Stereotaxic brain biopsies. Characteristic histologic lesions ofPML were observed in all 3 patients who underwent this procedure.
PCR Specificity and sensitivity. The specificity of the PCR method was shown by the correct size of the amplified DNA and by experiments on DNA from uninfected human cells or from cells infected by related human herpes viruses (HSY-I, HSY-2, YZY, Epstein-Barr virus, and human herpesvirus 6),
Downloaded from http://jid.oxfordjournals.org/ at University of Sussex on February 9, 2015
Nine autopsies were done. Brains were fixed for 6 weeks in 10%buffered formalin, and serial sections were prepared at l-cm intervals. Standard sections were embedded in paraffin and stained with hematoxylin-eosin. An immediate-early CMY antigen was detected by immunocytochemical staining of the paraffin sections with the monoclonal antibody E13. Three patients underwent peripheral nerve biopsy. Superficial branches of peroneal nerve were sampled and embedded in paraffin for light microscopy and in epon for electron microscopy. Paraffin sections were stained with hematoxylin-eosin and Masson's trichrome. Three patients had computed tomographyguided stereotaxic brain biopsy. Samples were embedded in paraffin and stained with hematoxylin-eosin.
1417
Concise Communications
1418
(n = 53) to investigate CNS disorders in 39 cases (encephali-
tis, 16; fever with meningeal signs, 10; myelitis or radiculopathies, 6; seizures, 5; focal signs, 2), peripheral nervous system disorders in 4 cases, and mixed signs in I. In 9 cases, lumbar puncture was done to investigate unexplained fever (6), extraneural cryptococcosis (2), or lymphoma (I). Of these 53 patients, 5 were viremic and had extraneural CMV disease at the time oflumbar puncture (retinitis, 3; colitis, 2). None had proven CMV neurologic disease. CSF cultures were negative in every case, and pathologic examination, done in 7 cases (necropsy, 4; stereotaxic cerebral biopsy, 3), was also negative for CMV. Finally, 21 patients had another documented neurologic disease (toxoplasmosis, 6; cryptococcosis, 4; PML, 3; lymphoma, 2; tuberculosis, syphilis, HSV encephalitis, discopathy, and medullar ischemia, I each) partly or fully explaining the disorders for which lumbar puncture was done. PCR-positive and -negative patients were similar in terms ofmean age, sex ratio, proportion ofpatients with AIDS, and CD4+ blood lymphocyte count. In contrast, a PCR-positive result was significantly associated with viremia (P < .00 I, x 2 test) and extraneural CMV disease (P = .004, x 2 test). Characteristics ofCSF. In the 22 PCR-positive CSF samples, the mean cell count was 41 nucleated cells (NC)/mm 3
Table 1.
Clinical characteristics of 14 patients with human immunodeficiency virus infection and neurologic disorders who were positive for cytomegalovirus (CMV) by polymerase chain reaction. C04+
Patient no., age
(fmm')
1,53
47
2,47
NO
+
3,34 4, 36
10 13
+ +
Esophagitis!
5. 28 6, 40
20 I
+ +
Retinitis! Retinitis-
7,25
16
+
8, 49
16
9.42 10,45 I I. 30 12,41 13,41 14,33
5 5 48 NO 49 32
Viremia
Extraneural CMV disease
Neurologic disorder
Treatment, outcome
Final diagnosis, diagnostic test
Ganciclovir, died'
CMV. nerve biopsy
Ganciclovir, died'
CMV, CSF culture, brain autopsy CMV. CSF culture CMV, CSF culture
Ganciclovir, improved Foscarnet, died
CMV, CSF culture CMV. brain autopsy
Retinitis!
Peripheral neuropathy, encephalitis Peripheral neuropathy, encephalitis Myeloradiculitis Encephalitis, brain-stem disorder Brain-stem disorder Encephalitis. myeloradiculitis. peripheral neuropathy Encephalitis
Ganciclovir, died
+
Retinitis-
Encephalitis
Ganciclovir, died
+ +
Gastritis' Retinitis!
Encephalitis Encephalitis Encephalitis Encephalitis Encephalitis Myeloradiculitis. peripheral neuropathy
None, died Ganciclovir, died None. alive None. died None, died Ganciclovir, stabilized
CMV, brain autopsy CMV, brain autopsy Toxoplasmosis Unknown Unknown Unknown Unknown Unknown
NO
+ +
NOTE. -l-, positive; -, negative. , Concomitant with neurologic disorder. t Relapsed during neurologic disorder. ~ Previous history. , Initial improvement during therapy.
Retinitis. colitis' Retinitis"
Ganciclovir, stabilized Ganciclovir, died'
Downloaded from http://jid.oxfordjournals.org/ at University of Sussex on February 9, 2015
which gave consistently negative results (data not shown). Moreover, none ofthe 14 control CSF specimens from AIDS patients with other documented neurologic diseases yielded amplified DNA. To evaluate the sensitivity of the method, we amplified serial dilutions ofCMV DNA in a negative CSF sample. Viral DNA (10 fg) could be detected in the two genes tested (data not shown). PCR on CSFfrom HI V-infected patients. There was complete concordance between the two human CMV sequences. Among the 82 CSF samples tested, 22 (26.8%) collected from 14 patients (20.9%) were positive by PCR. The main clinical and biologic characteristics of the PCRpositive patients (n = 14) are summarized in table I. The neurologic disorder was exclusively central in 10 and mixed (central and peripheral) in 4. Of the 13 patients tested, II were viremic, and 7 had documented CMV disease (retinitis in 6 and esophagitis in I). CMV-related neurologic disease was proven in 8 cases by viral culture ofthe CSF (n = 4), pathologic studies (n = 5), or both. In I case (patient 9), postmortem examination of the brain revealed toxoplasmosis but no lesions attributable to CMV. In 2 cases (patients 2 and 14), peripheral nerve biopsies were also negative for CMV. Lumbar puncture was done on the PCR-negative patients
JID 1992; 166 (December)
lID 1992;166 (December)
Concise Communications
(range, 0-580 NC/mm 3) ; pleiocytosis > 10 NC/mm 3 was present in 6 of 21 samples, with a predominance of neutrophils in 3 (twice in patient 2, once in patient 3) and lymphocytes in 3 (twice in patient 4, once in patient 5). The mean protein concentration was 1.32 giL (range, 0.23-2.67 giL), and values were elevated (>0.5 g/L) in 19 of21 samples. In this PCR-positive subgroup, NC counts were significantly higher (P < .001, Mann-Whitney test) in the culture-positive specimens (mean, 163 NC/mm 3) than in the culture-negative specimens (mean, 3.3 NC/mm 3) , as was the protein con-
1419
centration (2.62 and 0.81 giL, respectively; P < .05, MannWhitney test). In contrast, there was no statistical difference in these parameters between the PCR-positive and -negative CSF samples (data not shown). Follow-up of patients receiving anti-CMV therapy. CSF samples taken before and after the start of treatment were available for 3 patients with proven CMV-related neurologic disease (patients 2-4). Figure 1 summarizes their relevant clinical and virologic data. As shown, CMV DNA was detected in all the samples but 1, even after ganciclovir was
Patient 2 Improvement
+ +
CSF PCR
+
+
+
+
+
,Ii
4 CSFn01
Weeks 0 after onset
Patient 4 Clinical course Viremia
Encephalitis
Improvement
Relapse (no CSF collected)
+ +
CSFcultures
+
+
4
6 CSF n02
+
, I , ,·1->-1WmM
CSF PCR Anti-CMV treatment
~
....
I
Weeks after onset
Death
+
CSF culture
Figure 1. Clinical course and virologic data for 3 patients with proven cytomegalovirus (CMV)-related neurologic disease. Cerebrospinal fluid (CSF) samples taken before and during therapy were used. Viremia and results of CSF culture and polymerase chain reaction are shown serially compared with clinical outcome.
Encephalitis
o
CSF n01
7
17
CSF n03
Patient 3 Meningoradiculitis
Clinical course Viremia
Stabilization +
CSFcultures
+
CSF PCR
+
,I
.F=;;...---..........I====............
Anti-eMV treatment Weeks after onset
o
I
CSFn01
7
8
CSF n02
Ganciclovir therapy:
...................1induction doses
Foscarnettherapy:
~
induction doses
....................1maintenance doses
Downloaded from http://jid.oxfordjournals.org/ at University of Sussex on February 9, 2015
Peripheral neuropathy
Clinical course Viremia
1420
Concise Communications
Discussion There is a broad spectrum ofCMV-related neurologic diseases in AIDS and diagnosis is often difficult: Symptoms are not specific, while reference diagnostic tests (i.e., CSF culture and neuropathologic studies) are respectively insensitive and poorly suited to routine use. We describe here a PCR-based technique with proven sensitivity and specificity in vitro. Applied to the CSF of AIDS patients, this method detected CMV DNA in 26%of the unselected samples tested. This proportion is very similar to the generally acknowledged frequency of CMV encephalitis in AIDS patients at necropsy and underlines the importance of this problem. Viral DNA was detected from patients with various neurologic syndromes, including encephalitis, myeloradiculitis, and peripheral neuropathies. Moreover, in 4 cases (patients 1,2,6, and 14), progression from one syndrome to another, together with combined presentations involving both the central and peripheral nervous systems, suggest that CMVrelated neurologic disorders may be a single entity with various clinical expressions. The likely portal of entry of CMV into the CNS is the brain capillary endothelium [1], but its presence in the CSF, probably due to involvement of the choroid plexus, could lead to secondary dissemination to the CNS and partly explain the polymorphous presentation. CNS involvement appeared as a part of disseminated CMV disease in most cases, with frequent extraneurallocalizations and viremia. This agrees with previous pathologic studies revealing frequent systemic CMV infection in patients with CMV encephalitis [10].
Although all the CSF samples were cultured for virus, a precise determination of the sensitivity of the PCR-based technique cannot be done because only 15 ofthe 67 patients studied had a histopathologic analysis of their CNS. Nevertheless, that method is likely to be very sensitive because all the proven cases in this retrospective study were positive by PCR. In comparison, the sensitivity of viral culture was only 50%. Insufficient virus burden in the CSF or incomplete virions, inadequate transport or storage conditions, or possible complex formation with specific antibodies may explain the negativity of the culture. The number of nucleated cells present in the CSF correlated with culture positivity, showing the importance of cell-associated virus for viral culture. In contrast, this parameter had no bearing on the PCR results, suggesting the possible presence of circulating cell-free virus particles or DNA in the CSF. Despite this lack of sensitivity, viral culture remains a useful technique, especially when DEAF is used, as it can allow a diagnosis within 24 hand enable antiviral therapy to be started rapidly (4 cases in this study). The specificity of the PCR-based method is more difficult to evaluate because of the lack of a reliable reference standard. Among the 6 patients whose CSF was positive by PCR and negative by culture, 4 had a neurologic disorder consistent with CMV disease, in association with viremia and/or an extraneural site ofCMV infection and no other documented etiologic agent. The case of the other 2 patients is less clear. The first (patient 11) had unexplained, isolated encephalitis with the persistent absence of viremia. This did not rule out CMV encephalitis, since similar cases have been reported [11], and the patient is therefore being closely monitored. The second patient (no. 9) died rapidly with encephalitis and recurrence of viremia, but postmortem examination revealed cerebral toxoplasmosis and no, lesions attributable to CMV. The reasons for this discordance are unclear: Contamination is always a possibility with PCR, but the sample was consistently and clearly positive with the two genes tested, and controls were negative. Positivity of PCR assay of CSF directly linked to viremia seems unlikely, since 5 of the 52 patients who were negative by our assay were viremic at the time oflumbar puncture. Furthermore, although the precise sites of CMV latency are still unknown, the presence of CMV DNA in brain or CSF is uncommon. The last possibility is recent-onset CMV-related encephalitis, with no lesions visible at autopsy but with viral DNA in the CSF. Apart from these cases, our PCR results correlated well with clinical status and the results of the other diagnostic tests. This is in agreement with preliminary data from Cinque et al. [12], who found that PCR was quite specific in this setting. The onset of neurologic disease during anti-CMV treatment, together with the nonresponsiveness of some syndromes to the drugs used, raises the question of management. Pharmacokinetic studies of available drugs have indicated variable concentrations in the CSF [13, 14],
Downloaded from http://jid.oxfordjournals.org/ at University of Sussex on February 9, 2015
started, whereas viral cultures (CSF or blood) rapidly became negative during treatment. This persistence of DNA was found in the 2 patients with a quick and fatal relapse, despite specific therapy. With regard to the clinical outcome, the case of patient 2 was highly instructive: He was admitted for a l-month history of progressive multifocal neuropathy associated with bladder paralysis and viremia. The first CSF specimen contained an elevated protein concentration (1.48 g/L) and showed marked pleyocytosis (310 NC/mm 3 ) , with a predominance of neutrophils. DEAF was positive, allowing prompt ganciclovir treatment. The neuropathy improved, and the second CSF specimen, collected 1 month later, had normal cellularity and yielded no virus on culture. His clinical status remained stable for 6 weeks on maintenance therapy, when he was readmitted for fever and confusion without focal symptoms. The third CSF specimen was then again positive for DEAF and culture, suggesting a causal role of CMV in the encephalitis. A further induction course of ganciclovir had no effect on the CNS disease, and the patient died 4 weeks later, despite a last-minute switch from ganciclovir to foscarnet. Postmortem necropsy showed a CMV-related periventricular encephalitis.
JID 1992; 166 (December)
JID 1992; 166 (December)
Concise Communications
Acknowledgments
We thank Bertand Guidet and Frederic Barbut for helpful advice, Christine Morel, Mireille Petit, Martine Auzary, and Christian Declerck for technical assistance, and David Young for revision of English. References I. Wiley CA, Nelson JA, Role of human immunodeficiency virus and cytomegalovirus in AIDS encephalitis. Am J Patho11988; 133:I:7381.
2. Masdeu JC, Small CB, Weiss J, Elkin CM, Llena J, Mesa-Tejada R. Multifocal cytomegalovirus encephalitis in AIDS. Ann Neurol 1988;23:97-9. 3. de Gans J, Tiessens G, Portegies P, Tutuarima JA, Troost D. Predominance of polymorphonuclear leukocytes in cerebrospinal fluid of AIDS patients with cytomegalovirus polyradiculomyelitis. J Acquir Immune Defic Syndr 1990;3: 1155-8. 4. Said G, Lacroix C, Chemouilli P, et al. Cytomegalovirus neuropathy in acquired immunodeficiency syndrome: a clinical and pathological study. Ann NeuroI1991;29: 139-45. 5. Mcintosh K. Diagnostic virology. In: Fields BN, Knipe DM, eds. Virology. 2nd ed. New York: Raven Press, 1990:423-4. 6. de Gans J, Portegies P, Tiessens G, Troost D, Danner SA, Lange JMA, Therapy for cytomegalovirus polyradiculomyelitis in patients with AIDS: treatment with ganciclovir. AIDS 1990;4:421-5. 7. Alpert G, Mazeron MC, Colimon R, Plotkin S. Rapid detection of human cytomegalovirus in the urine of humans. J Infect Dis 1985; 152:631-3. 8. RUgerB, Klages S, Walla B, et al. Primary structure and transcription of the genes coding for the two virion phospho proteins pp65 and pp71 of human cytomegalovirus. J ViroI1987;67:446-53. 9. Chee M, Rudolph SA, Plachter B, Barrell B, Jahn G. Identification of the major capsid protein genes of human cytomegalovirus. J Virol 1989;63: 1345-53. 10. Vinters HV, Kwok MK, Ho HW, et al. Cytomegalovirus in the nervous system of patients with the acquired immune deficiency syndrome. Brain 1989; 112:245-68. II. Castagna A, Vago L, Accordini A, Moscatelli G, Costanzi G, Lazzarin A. CMV encephalitis in AIDS patients: a clinico-pathologicalcorrelation. In: Program and abstracts: VII International Conference on AIDS (Florence). Rome: Istituto Superiore di Sanita, 1991. 12. Cinque P, Vago L Brytting M, et al. Diagnosis of cytomegalovirus infection of the central nervous system in patients with AIDS by DNA amplification from cerebrospinal fluid. J Infect Dis 1992; 166:1408-11. 13. Fletcher C, Sawchuk R, Chinnock B, de Miranda P, Balfour H. Human pharmacokinetics of the antiviral drug DHPG. Clin Pharmacol Ther 1986;40:281-6. 14. Sjovall J, Karlsson A, Ogenstad S, Sandstrom E, Saarimaki M. Pharmacokinetics and absorption of'foscarnet after intravenous and oral administration to patients with human immunodeficiency virus. Clin Pharmacol Ther 1988;44:65-73. 15. Nelson JA, Reynolds-Kohler C, Oldstone MBA, Wiley CA. HIV and HCMV coinfect brain cells in patients with AIDS. Virology 1988; 165:286-90.
Downloaded from http://jid.oxfordjournals.org/ at University of Sussex on February 9, 2015
whereas few clinical data are available. Ganciclovir seems to be effective for polyradiculomyelitis [6] and, in our experience, for peripheral neuropathies. However, CMV-related encephalitis is much more difficult to control, as shown by the course of patient 2. Acquisition of resistance to ganciclovir is possible, but we have observed (patients 7 and 8) differences in the course of neurologic and concomitant extraneural CMV disease, suggesting another explanation linked more directly to the neurologic site of infection. The possible importance of cofactors and particularly HIV-related encephalitis must be considered. The frequent association, often in the same brain area, ofCMV encephalitis and multinucleated giant cells characteristic of HIV infection has been reported, and some authors [2] have suggested that the interactions between HIV and CMV in vitro could be of relevance to the brains of AIDS patients. The coinfection of a single nerve cell by the two viruses in vivo [15] supports this hypothesis, which could account for the poor activity of anti-CMV drugs on CMV encephalitis. Finally, the optimum treatment protocols with ganciclovir or foscarnet for CMV-related encephalitis may be different from those used for retinitis or colitis. Given the increasing frequency of these diseases, animal models or clinical trials of new dosages or new routes of administration are now required. Such trials have been hampered by diagnostic difficulties, but the PCR could provide a valuable tool for patient selection if its specificity is confirmed. A prospective study is now underway in our hospital to answer this question.
1421
Rapid Detection of Cytomegalovirus DNA in Cerebrospinal Fluid of AIDS Patients with Neurologic Disorders Joel Gozlan, Jean-Michel Salord, Etienne Roullet, Marielle Baudrimont, Francoise Caburet, Odile Picard, Marie-Caroline Meyohas, Claudine Duvivier, Christine Jacomet, and Jean-Claude Petit
Services de Bacteriologic- Virologic. Maladies Infectieuses. Neurologic. Anatomo-Pathologie, and Medecine Interne, Hiipital Saint-Antoine; Service des Maladies Infectieuses, Hopital Rothschild. Paris. France
Cytomegalovirus (CMV) is the most common opportunistic viral pathogen in AIDS patients. Retinitis and gastrointestinal tract disturbances are the main clinical manifestations ofCMV disease in this context, but involvement of both the peripheral and central nervous system (CNS) can occur. A CMV-related encephalitis was present in up to 33% of AIDS patients in autopsy series [1], and several neurologic syndromes can be caused by CMV, including encephalitis [2], polyradiculomyelitis [3], and peripheral neuropathy [4]. Virologic diagnosis of these diseases is problematic. Culture of cerebrospinal fluid (CSF) is insensitive [5], and histologic techniques are aggressive and can be unreliable. Stereotaxic brain biopsy requires the presence of lesions visible by computed tomography or magnetic resonance imaging, but these are infrequent in CMV encephalitis. Peripheral nerve biopsies can be informative, but the distal nerve sampled may be spared in CMV -related peripheral neuropathy or radiculopathy. As a result, these diseases are frequently discovered after death; however, they are likely to become more frequent as AIDS patients survive longer. Early antiviral therapy has potential benefit for some of these disorders [6], and an accurate diagnostic test would therefore be useful. For this purpose, we used the polymerase chain reaction (PCR)
Received 26 May 1992; revised I September 1992. Presented in part: Third European Conference on Clinical Aspects and Treatment of HIV Infection, Paris, March 1992. Financial support: Assistance Publique-Hopitaux de Paris. Reprints or correspondence: Dr. Joel Gozlan, Service de BacteriologieVirologie, Hopital Saint-Antoine. 184 rue du Faubourg Saint-Antoine, 75571 Paris cedex 12, France. The Journal of Infectious Diseases 1992;166:1416-21 © 1992 by The University of Chicago. All rightsreserved. 0022-1899/92/6606-0033$01.00
technique to detect CMV DNA sequences in CSF samples, and determined its value in human immunodeficiency virus (HIV)-infected individuals with neurologic disorders.
Patients, Materials, and Methods Patients A retrospective study was conducted using CSF samples from HIV-infected patients sent to our laboratory for viral culture from September 1990 to January 1992. Frozen material was available for 82 specimens from 67 patients, representing 71%of CSF samples obtained during the study period; all these samples were included. The study population was a mean of 39 years old with a sex ratio (M:F) of 5.7; 81% had AIDS at the time of lumbar puncture, and the mean CD4+ blood lymphocyte count was 73/mm3. Clinical, immunologic, virologic and, when available, pathologic data were studied to assess the clinical relevance of the PCR results. Fourteen samples from our CSF bank were used as controls; they had been obtained from AIDS patients with other documented neurologic diseases proven by culture of CSF (cryptococcosis, 2; tuberculosis, 3; Candida meningitis, 1; herpes simplex virus [HSV] encephalitis, 2; and varicella-zoster virus [VZV] encephalitis, I), by histopathologic evaluation of the brain (lymphoma, 3; progressive multifocal leukoencephalopathy [PMLj, I), or by detection of intrathecal synthesis of specific antibodies (syphilis, I). Virus Isolation and Detection of Early Antigen Foci Conventional virus isolation and detection of early antigen foci (DEAF) were done on all CSF samples. For virus isolation, confluent human foreskin fibroblasts were inoculated with 500 p,L of CSF and observed for 4 weeks for the cytopathic effect of
Downloaded from http://jid.oxfordjournals.org/ at University of Sussex on February 9, 2015
A polymerase chain reaction (PCR)-based method was used to detect cytomegalovirus (CMV) DNA in 82 cerebrospinal fluid (CSF) samples from 67 patients infected by human immunodeficiency virus (HIV). The test was positive for 14 patients, 8 of whom had CMV-related neurologic disease proven by viral culture of CSF or histologic examination. Encephalitis was the most frequent manifestation in patients with positive PCR results, but CMV DNA was also present in some patients with peripheral neuropathy or polyradiculomyelitis. All patients with proven CMV neurologic disease were positive by PCR. In contrast, viral culture was negative for 4 of the 8 patients and pathologic studies were available only for 5. The specificity of the PCR-based assay could not be assessed precisely because of the lack of a reference standard, but the results correlated well with clinical course and results of the other methods. These findings suggest that the PCR-based method may be a useful noninvasive tool for the rapid diagnosis ofCMV-related neurologic disease.
JID 1992; 166 (December)
Concise Communications
CMY. For DEAF, 2-4 wells of 24 multiwell plates containing the same confluent fibroblasts were inoculated with 100 ILL of CSF, centrifuged at 2300 g for 45 min, and cultivated for 24 h at 37°C. An immediate-early CMY antigen was then detected using a monoclonal antibody (clone E 13; Clonatec Biosoft, Paris) in a classical immunoperoxidase reaction described elsewhere [7]. Pathologic Studies
PCR Assay DNA extraction. A sample (200 ILL) of CSF was boiled at 95°C for 15 min. DNA was then precipitated by adding 20 ILL of 3 M sodium acetate and 450 ILL ofabsolute ethanol and incubating at -80°C for I h. The pellet obtained by centrifugation (12,000 g for 30 min) was air-dried and resuspended in 30 ILL of distilled water. Primers and probes. Two different sets of primers and probes were synthesized in the pp65 kDa-encoding gene [8] (primers CS I [TTGGTATCGCAGTACACGCC] and CS2 [GCAGCGCGTACACA TAGATC], giving amplification of a 181-bp segment recognized by oligoprobe CS3 [CGGCGACAATCAGCTGCAGGTGCAGCACACGTACTT]), and in the major capsid protein (MCP)-encoding gene [9] (primers CMCP I [GTGATCCGACTGGGCGAAAA] and CMCP2 [GAGCGCGTCCACAAAGTCTA], giving amplification of a 263-bp segment recognized by oligoprobe CMCP3 [GCCCGAGGATCGCGGTTACACCACGGTGGAAAGCAAAGT]). Amplification. The extracted DNA ( 10 ILL) was amplified in a reaction mixture containing 50 pmol of each primer, 10 mM TRIS-HCI (pH 8.3), 50 mM KCl, 1.5 mM MgCl z, 0.2 mM of each dNTP, and 1.25 units of cloned Taq polymerase (PerkinElmer Cetus, Norwalk, CT) in a total volume of 100 ILL. Samples were covered by 100 ILL of paraffin oil, denatured for 5 min at 94°C, and amplified for 40 cycles in a thermal cycler apparatus as follows: I min at 94°C for denaturation, I min at 60°C for annealing, and I min at noc for polymerization. This last step was extended to 10 min on the last cycle to ensure completion of the amplified products. peR product analysis. Aliquots (20 ILL) of each amplification mixture were electrophoretically separated in 2% agarose gels, directly stained with ethidium bromide, and then transferred in alkaline conditions to nylon membranes (Hybond N+;
Amersham, Les Viis, France). The membranes were prehybridized for I h at 68°C in a buffer containing 6X standard saline citrate, 2.5X Denhart's solution, 0.1%SDS, 0.5 mMEDTA, and 200 llg/mL sonicated salmon-sperm DNA and then hybridized with 5 X 105 cpm/rnl, of 3zP-kinase-labeled oligoprobe (CMCP3 or CS3). After 4 h at 68°C, the blots were washed and exposed to radiographic film at -70°C for 16 h. Prevention of contamination. We followed standard recommendations to prevent contamination, particularly the physical separation of the nucleic acid extraction, PCR preparation, and PCR product analysis steps. We used filtered tips to avoid DNA aerosols.
Statistical Analysis Data were compared using XZ analysis for categories and the Mann-Whitney test for continuous values. P ~ .05 was considered significant.
Results Viral Culture CMY was isolated from 6 (7.3%) of the 82 CSF samples, collected from 4 (5.9%) of the 67 patients. Cultures were positive within a mean of 17.6 days (range, 8-25). Of these 6 positive samples, 5 were also positive for DEAF.
Pathologic Studies Brain necropsy. Lesions attributable to CMY were present in 4 patients: Gross examination showed periventricular necrosis isolated in 3 and associated with focal necrotic lesions of the parietal lobe white matter in I. Light microscopy showed numerous cells containing CMY inclusions in the periventricular lesions of the 4'patients. In I, multinucleated giant cells, characteristic of HIY encephalitis, were found. Immunocytochemical detection of CMY antigen confirmed the light microscopy findings. Examination of the other brains revealed toxoplasmosis in 2, hemorragic lesions in I, bacterial abscess in I, and no lesions in I. Peripheral nerve biopsies. CMY inclusions were present in I case (described in [4]), whereas no lesions were seen in the other 2. Stereotaxic brain biopsies. Characteristic histologic lesions ofPML were observed in all 3 patients who underwent this procedure.
PCR Specificity and sensitivity. The specificity of the PCR method was shown by the correct size of the amplified DNA and by experiments on DNA from uninfected human cells or from cells infected by related human herpes viruses (HSY-I, HSY-2, YZY, Epstein-Barr virus, and human herpesvirus 6),
Downloaded from http://jid.oxfordjournals.org/ at University of Sussex on February 9, 2015
Nine autopsies were done. Brains were fixed for 6 weeks in 10%buffered formalin, and serial sections were prepared at l-cm intervals. Standard sections were embedded in paraffin and stained with hematoxylin-eosin. An immediate-early CMY antigen was detected by immunocytochemical staining of the paraffin sections with the monoclonal antibody E13. Three patients underwent peripheral nerve biopsy. Superficial branches of peroneal nerve were sampled and embedded in paraffin for light microscopy and in epon for electron microscopy. Paraffin sections were stained with hematoxylin-eosin and Masson's trichrome. Three patients had computed tomographyguided stereotaxic brain biopsy. Samples were embedded in paraffin and stained with hematoxylin-eosin.
1417
Concise Communications
1418
(n = 53) to investigate CNS disorders in 39 cases (encephali-
tis, 16; fever with meningeal signs, 10; myelitis or radiculopathies, 6; seizures, 5; focal signs, 2), peripheral nervous system disorders in 4 cases, and mixed signs in I. In 9 cases, lumbar puncture was done to investigate unexplained fever (6), extraneural cryptococcosis (2), or lymphoma (I). Of these 53 patients, 5 were viremic and had extraneural CMV disease at the time oflumbar puncture (retinitis, 3; colitis, 2). None had proven CMV neurologic disease. CSF cultures were negative in every case, and pathologic examination, done in 7 cases (necropsy, 4; stereotaxic cerebral biopsy, 3), was also negative for CMV. Finally, 21 patients had another documented neurologic disease (toxoplasmosis, 6; cryptococcosis, 4; PML, 3; lymphoma, 2; tuberculosis, syphilis, HSV encephalitis, discopathy, and medullar ischemia, I each) partly or fully explaining the disorders for which lumbar puncture was done. PCR-positive and -negative patients were similar in terms ofmean age, sex ratio, proportion ofpatients with AIDS, and CD4+ blood lymphocyte count. In contrast, a PCR-positive result was significantly associated with viremia (P < .00 I, x 2 test) and extraneural CMV disease (P = .004, x 2 test). Characteristics ofCSF. In the 22 PCR-positive CSF samples, the mean cell count was 41 nucleated cells (NC)/mm 3
Table 1.
Clinical characteristics of 14 patients with human immunodeficiency virus infection and neurologic disorders who were positive for cytomegalovirus (CMV) by polymerase chain reaction. C04+
Patient no., age
(fmm')
1,53
47
2,47
NO
+
3,34 4, 36
10 13
+ +
Esophagitis!
5. 28 6, 40
20 I
+ +
Retinitis! Retinitis-
7,25
16
+
8, 49
16
9.42 10,45 I I. 30 12,41 13,41 14,33
5 5 48 NO 49 32
Viremia
Extraneural CMV disease
Neurologic disorder
Treatment, outcome
Final diagnosis, diagnostic test
Ganciclovir, died'
CMV. nerve biopsy
Ganciclovir, died'
CMV, CSF culture, brain autopsy CMV. CSF culture CMV, CSF culture
Ganciclovir, improved Foscarnet, died
CMV, CSF culture CMV. brain autopsy
Retinitis!
Peripheral neuropathy, encephalitis Peripheral neuropathy, encephalitis Myeloradiculitis Encephalitis, brain-stem disorder Brain-stem disorder Encephalitis. myeloradiculitis. peripheral neuropathy Encephalitis
Ganciclovir, died
+
Retinitis-
Encephalitis
Ganciclovir, died
+ +
Gastritis' Retinitis!
Encephalitis Encephalitis Encephalitis Encephalitis Encephalitis Myeloradiculitis. peripheral neuropathy
None, died Ganciclovir, died None. alive None. died None, died Ganciclovir, stabilized
CMV, brain autopsy CMV, brain autopsy Toxoplasmosis Unknown Unknown Unknown Unknown Unknown
NO
+ +
NOTE. -l-, positive; -, negative. , Concomitant with neurologic disorder. t Relapsed during neurologic disorder. ~ Previous history. , Initial improvement during therapy.
Retinitis. colitis' Retinitis"
Ganciclovir, stabilized Ganciclovir, died'
Downloaded from http://jid.oxfordjournals.org/ at University of Sussex on February 9, 2015
which gave consistently negative results (data not shown). Moreover, none ofthe 14 control CSF specimens from AIDS patients with other documented neurologic diseases yielded amplified DNA. To evaluate the sensitivity of the method, we amplified serial dilutions ofCMV DNA in a negative CSF sample. Viral DNA (10 fg) could be detected in the two genes tested (data not shown). PCR on CSFfrom HI V-infected patients. There was complete concordance between the two human CMV sequences. Among the 82 CSF samples tested, 22 (26.8%) collected from 14 patients (20.9%) were positive by PCR. The main clinical and biologic characteristics of the PCRpositive patients (n = 14) are summarized in table I. The neurologic disorder was exclusively central in 10 and mixed (central and peripheral) in 4. Of the 13 patients tested, II were viremic, and 7 had documented CMV disease (retinitis in 6 and esophagitis in I). CMV-related neurologic disease was proven in 8 cases by viral culture ofthe CSF (n = 4), pathologic studies (n = 5), or both. In I case (patient 9), postmortem examination of the brain revealed toxoplasmosis but no lesions attributable to CMV. In 2 cases (patients 2 and 14), peripheral nerve biopsies were also negative for CMV. Lumbar puncture was done on the PCR-negative patients
JID 1992; 166 (December)
lID 1992;166 (December)
Concise Communications
(range, 0-580 NC/mm 3) ; pleiocytosis > 10 NC/mm 3 was present in 6 of 21 samples, with a predominance of neutrophils in 3 (twice in patient 2, once in patient 3) and lymphocytes in 3 (twice in patient 4, once in patient 5). The mean protein concentration was 1.32 giL (range, 0.23-2.67 giL), and values were elevated (>0.5 g/L) in 19 of21 samples. In this PCR-positive subgroup, NC counts were significantly higher (P < .001, Mann-Whitney test) in the culture-positive specimens (mean, 163 NC/mm 3) than in the culture-negative specimens (mean, 3.3 NC/mm 3) , as was the protein con-
1419
centration (2.62 and 0.81 giL, respectively; P < .05, MannWhitney test). In contrast, there was no statistical difference in these parameters between the PCR-positive and -negative CSF samples (data not shown). Follow-up of patients receiving anti-CMV therapy. CSF samples taken before and after the start of treatment were available for 3 patients with proven CMV-related neurologic disease (patients 2-4). Figure 1 summarizes their relevant clinical and virologic data. As shown, CMV DNA was detected in all the samples but 1, even after ganciclovir was
Patient 2 Improvement
+ +
CSF PCR
+
+
+
+
+
,Ii
4 CSFn01
Weeks 0 after onset
Patient 4 Clinical course Viremia
Encephalitis
Improvement
Relapse (no CSF collected)
+ +
CSFcultures
+
+
4
6 CSF n02
+
, I , ,·1->-1WmM
CSF PCR Anti-CMV treatment
~
....
I
Weeks after onset
Death
+
CSF culture
Figure 1. Clinical course and virologic data for 3 patients with proven cytomegalovirus (CMV)-related neurologic disease. Cerebrospinal fluid (CSF) samples taken before and during therapy were used. Viremia and results of CSF culture and polymerase chain reaction are shown serially compared with clinical outcome.
Encephalitis
o
CSF n01
7
17
CSF n03
Patient 3 Meningoradiculitis
Clinical course Viremia
Stabilization +
CSFcultures
+
CSF PCR
+
,I
.F=;;...---..........I====............
Anti-eMV treatment Weeks after onset
o
I
CSFn01
7
8
CSF n02
Ganciclovir therapy:
...................1induction doses
Foscarnettherapy:
~
induction doses
....................1maintenance doses
Downloaded from http://jid.oxfordjournals.org/ at University of Sussex on February 9, 2015
Peripheral neuropathy
Clinical course Viremia
1420
Concise Communications
Discussion There is a broad spectrum ofCMV-related neurologic diseases in AIDS and diagnosis is often difficult: Symptoms are not specific, while reference diagnostic tests (i.e., CSF culture and neuropathologic studies) are respectively insensitive and poorly suited to routine use. We describe here a PCR-based technique with proven sensitivity and specificity in vitro. Applied to the CSF of AIDS patients, this method detected CMV DNA in 26%of the unselected samples tested. This proportion is very similar to the generally acknowledged frequency of CMV encephalitis in AIDS patients at necropsy and underlines the importance of this problem. Viral DNA was detected from patients with various neurologic syndromes, including encephalitis, myeloradiculitis, and peripheral neuropathies. Moreover, in 4 cases (patients 1,2,6, and 14), progression from one syndrome to another, together with combined presentations involving both the central and peripheral nervous systems, suggest that CMVrelated neurologic disorders may be a single entity with various clinical expressions. The likely portal of entry of CMV into the CNS is the brain capillary endothelium [1], but its presence in the CSF, probably due to involvement of the choroid plexus, could lead to secondary dissemination to the CNS and partly explain the polymorphous presentation. CNS involvement appeared as a part of disseminated CMV disease in most cases, with frequent extraneurallocalizations and viremia. This agrees with previous pathologic studies revealing frequent systemic CMV infection in patients with CMV encephalitis [10].
Although all the CSF samples were cultured for virus, a precise determination of the sensitivity of the PCR-based technique cannot be done because only 15 ofthe 67 patients studied had a histopathologic analysis of their CNS. Nevertheless, that method is likely to be very sensitive because all the proven cases in this retrospective study were positive by PCR. In comparison, the sensitivity of viral culture was only 50%. Insufficient virus burden in the CSF or incomplete virions, inadequate transport or storage conditions, or possible complex formation with specific antibodies may explain the negativity of the culture. The number of nucleated cells present in the CSF correlated with culture positivity, showing the importance of cell-associated virus for viral culture. In contrast, this parameter had no bearing on the PCR results, suggesting the possible presence of circulating cell-free virus particles or DNA in the CSF. Despite this lack of sensitivity, viral culture remains a useful technique, especially when DEAF is used, as it can allow a diagnosis within 24 hand enable antiviral therapy to be started rapidly (4 cases in this study). The specificity of the PCR-based method is more difficult to evaluate because of the lack of a reliable reference standard. Among the 6 patients whose CSF was positive by PCR and negative by culture, 4 had a neurologic disorder consistent with CMV disease, in association with viremia and/or an extraneural site ofCMV infection and no other documented etiologic agent. The case of the other 2 patients is less clear. The first (patient 11) had unexplained, isolated encephalitis with the persistent absence of viremia. This did not rule out CMV encephalitis, since similar cases have been reported [11], and the patient is therefore being closely monitored. The second patient (no. 9) died rapidly with encephalitis and recurrence of viremia, but postmortem examination revealed cerebral toxoplasmosis and no, lesions attributable to CMV. The reasons for this discordance are unclear: Contamination is always a possibility with PCR, but the sample was consistently and clearly positive with the two genes tested, and controls were negative. Positivity of PCR assay of CSF directly linked to viremia seems unlikely, since 5 of the 52 patients who were negative by our assay were viremic at the time oflumbar puncture. Furthermore, although the precise sites of CMV latency are still unknown, the presence of CMV DNA in brain or CSF is uncommon. The last possibility is recent-onset CMV-related encephalitis, with no lesions visible at autopsy but with viral DNA in the CSF. Apart from these cases, our PCR results correlated well with clinical status and the results of the other diagnostic tests. This is in agreement with preliminary data from Cinque et al. [12], who found that PCR was quite specific in this setting. The onset of neurologic disease during anti-CMV treatment, together with the nonresponsiveness of some syndromes to the drugs used, raises the question of management. Pharmacokinetic studies of available drugs have indicated variable concentrations in the CSF [13, 14],
Downloaded from http://jid.oxfordjournals.org/ at University of Sussex on February 9, 2015
started, whereas viral cultures (CSF or blood) rapidly became negative during treatment. This persistence of DNA was found in the 2 patients with a quick and fatal relapse, despite specific therapy. With regard to the clinical outcome, the case of patient 2 was highly instructive: He was admitted for a l-month history of progressive multifocal neuropathy associated with bladder paralysis and viremia. The first CSF specimen contained an elevated protein concentration (1.48 g/L) and showed marked pleyocytosis (310 NC/mm 3 ) , with a predominance of neutrophils. DEAF was positive, allowing prompt ganciclovir treatment. The neuropathy improved, and the second CSF specimen, collected 1 month later, had normal cellularity and yielded no virus on culture. His clinical status remained stable for 6 weeks on maintenance therapy, when he was readmitted for fever and confusion without focal symptoms. The third CSF specimen was then again positive for DEAF and culture, suggesting a causal role of CMV in the encephalitis. A further induction course of ganciclovir had no effect on the CNS disease, and the patient died 4 weeks later, despite a last-minute switch from ganciclovir to foscarnet. Postmortem necropsy showed a CMV-related periventricular encephalitis.
JID 1992; 166 (December)
JID 1992; 166 (December)
Concise Communications
Acknowledgments
We thank Bertand Guidet and Frederic Barbut for helpful advice, Christine Morel, Mireille Petit, Martine Auzary, and Christian Declerck for technical assistance, and David Young for revision of English. References I. Wiley CA, Nelson JA, Role of human immunodeficiency virus and cytomegalovirus in AIDS encephalitis. Am J Patho11988; 133:I:7381.
2. Masdeu JC, Small CB, Weiss J, Elkin CM, Llena J, Mesa-Tejada R. Multifocal cytomegalovirus encephalitis in AIDS. Ann Neurol 1988;23:97-9. 3. de Gans J, Tiessens G, Portegies P, Tutuarima JA, Troost D. Predominance of polymorphonuclear leukocytes in cerebrospinal fluid of AIDS patients with cytomegalovirus polyradiculomyelitis. J Acquir Immune Defic Syndr 1990;3: 1155-8. 4. Said G, Lacroix C, Chemouilli P, et al. Cytomegalovirus neuropathy in acquired immunodeficiency syndrome: a clinical and pathological study. Ann NeuroI1991;29: 139-45. 5. Mcintosh K. Diagnostic virology. In: Fields BN, Knipe DM, eds. Virology. 2nd ed. New York: Raven Press, 1990:423-4. 6. de Gans J, Portegies P, Tiessens G, Troost D, Danner SA, Lange JMA, Therapy for cytomegalovirus polyradiculomyelitis in patients with AIDS: treatment with ganciclovir. AIDS 1990;4:421-5. 7. Alpert G, Mazeron MC, Colimon R, Plotkin S. Rapid detection of human cytomegalovirus in the urine of humans. J Infect Dis 1985; 152:631-3. 8. RUgerB, Klages S, Walla B, et al. Primary structure and transcription of the genes coding for the two virion phospho proteins pp65 and pp71 of human cytomegalovirus. J ViroI1987;67:446-53. 9. Chee M, Rudolph SA, Plachter B, Barrell B, Jahn G. Identification of the major capsid protein genes of human cytomegalovirus. J Virol 1989;63: 1345-53. 10. Vinters HV, Kwok MK, Ho HW, et al. Cytomegalovirus in the nervous system of patients with the acquired immune deficiency syndrome. Brain 1989; 112:245-68. II. Castagna A, Vago L, Accordini A, Moscatelli G, Costanzi G, Lazzarin A. CMV encephalitis in AIDS patients: a clinico-pathologicalcorrelation. In: Program and abstracts: VII International Conference on AIDS (Florence). Rome: Istituto Superiore di Sanita, 1991. 12. Cinque P, Vago L Brytting M, et al. Diagnosis of cytomegalovirus infection of the central nervous system in patients with AIDS by DNA amplification from cerebrospinal fluid. J Infect Dis 1992; 166:1408-11. 13. Fletcher C, Sawchuk R, Chinnock B, de Miranda P, Balfour H. Human pharmacokinetics of the antiviral drug DHPG. Clin Pharmacol Ther 1986;40:281-6. 14. Sjovall J, Karlsson A, Ogenstad S, Sandstrom E, Saarimaki M. Pharmacokinetics and absorption of'foscarnet after intravenous and oral administration to patients with human immunodeficiency virus. Clin Pharmacol Ther 1988;44:65-73. 15. Nelson JA, Reynolds-Kohler C, Oldstone MBA, Wiley CA. HIV and HCMV coinfect brain cells in patients with AIDS. Virology 1988; 165:286-90.
Downloaded from http://jid.oxfordjournals.org/ at University of Sussex on February 9, 2015
whereas few clinical data are available. Ganciclovir seems to be effective for polyradiculomyelitis [6] and, in our experience, for peripheral neuropathies. However, CMV-related encephalitis is much more difficult to control, as shown by the course of patient 2. Acquisition of resistance to ganciclovir is possible, but we have observed (patients 7 and 8) differences in the course of neurologic and concomitant extraneural CMV disease, suggesting another explanation linked more directly to the neurologic site of infection. The possible importance of cofactors and particularly HIV-related encephalitis must be considered. The frequent association, often in the same brain area, ofCMV encephalitis and multinucleated giant cells characteristic of HIV infection has been reported, and some authors [2] have suggested that the interactions between HIV and CMV in vitro could be of relevance to the brains of AIDS patients. The coinfection of a single nerve cell by the two viruses in vivo [15] supports this hypothesis, which could account for the poor activity of anti-CMV drugs on CMV encephalitis. Finally, the optimum treatment protocols with ganciclovir or foscarnet for CMV-related encephalitis may be different from those used for retinitis or colitis. Given the increasing frequency of these diseases, animal models or clinical trials of new dosages or new routes of administration are now required. Such trials have been hampered by diagnostic difficulties, but the PCR could provide a valuable tool for patient selection if its specificity is confirmed. A prospective study is now underway in our hospital to answer this question.
1421
