Molecular and Cellular Probes (1992) 6, 495-503
Rapid, non-separation electrochemiluminescent DNA hybridization assays for PCR products, using 3'-labelled oligonucleotide probes Satyanarayana R. Gudibande, John H . Kenten,* John Link, Kenneth Friedman' and Richard J . Massey Department of Molecular Biology, IGEN Inc ., 1530 E. Jefferson St . Rockville, MD 20852, USA, and 'University of North Carolina at Chapel Hill, CB# 7600, 1071 Patients Support Tower, Chapel Hill, NC 27514, USA (Received 9 June 1992, Accepted 13 August 1992)
Described are rapid assays for the analysis of PCR products in a one step, non-separation assay based on the use of electrochemiluminescence generated from a tris-bipyridine ruthenium (II) label . The assay uses PCR incorporation of a biotinylated oligonucleotide as a primer, with the inclusion of a labelled oligonucleotide . Oligonucleotides were labelled with an N-hydroxy succinimide ester of trisbipyridine ruthenium (II) dihexafluorophosphate (Origen ®-label) by modifying the 3' and 3' 5' ends of the oligonucleotide probes . The assay makes use of the inherent thermal stability and absence of polymerase activity on such probes to allow the PCR and probe hybridization to be completed automatically on the thermocycler . The assay is concluded by the addition of PCR samples to streptavidin beads on an electrochemiluminescence analyser for binding and analysis . Target genes evaluated were the HIV-1 gag gene, and cystic fibrosis AF-508 deletion mutation . The results obtained from these assays demonstrated the detection of 10 copies of the HIV-1 gag gene, and cystic fibrosis AF-508 mutation in 1 ng of human DNA within 15 min . This assay format allows a rapid and simple determination of specific amplified DNA sequences, reducing the contamination risks due to washes and multiple pipetting .
KEYWORDS: Electrochemiluminescence, tris-bipyridine Ru(II) complex, HIV-1, DNA hybridization,
PCR, cystic fibrosis.
INTRODUCTION Early detection and diagnosis of genetic and infectious diseases are areas of importance in clinical diagnostics.' -' Although immuno-diagnostics has evolved in the last few decades to a key position in the clinical diagnostic laboratory the same can not be said of DNA diagnostics .' This failure of DNA probe diagnostics to become a significant method in the clinical laboratory is that a number of hurdles for DNA probe assay technology remain to be cleared . Limitations come from the complexity in sample
preparation and the use of radioisotopes for detection . In an effort to solve these problems, much of the recent research and development has been focused on methods and non-radioisotopic labels . As a result, several non-radioactive reporter groups have been identified having interesting chemiluminescent and fluorescent properties, and they have been used in the development of DNA probe assays both with and without enzyme amplification ."
* Author to whom correspondence should be addressed .
0890-8508/92/060495 + 09 $08 .00/0
495
© 1992 Academic Press Limited
496
S . R . Gudibande et al.
In an attempt to simplify the process and to improve the sensitivity and specificity, several assay formats have been suggested in the literature .' ,' ,"' The ultimate aim of the assay development process is to automate the system so that the assays can be performed by personnel with minimum knowledge of DNA probe assays .' DNA probe assays have been developed based on a number of approaches : hybridization protection assay developed based on the chemiluminescent detection system ; 9 the antibody recognition of DNA-RNA hybrids ;10 and assay methods have been developed with enzyme-labelled oligonucleotide probes for fluorescent and chemiluminescent detection systems 4 fi,13 On the other hand, DNA probe technology has been greatly facilitated by enzyme mediated DNA amplification systems such as PCR ." In a typical DNA probe assay the DNA sample is amplified by PCR, followed by hybridization with wild-type specific or mutation specific labelled oligonucleotide probes .', " The resultant hybrid is analysed by a suitable detection system depending on the type of label used in preparing the probe . Recent advances in many areas of PCR such as the improved thermostable polymerases, methods to control the carry-over contamination, and improvements in the thermocycler equipment have made this technique a simple, indispensable method for DNA amplification ."," in addition to the developments in the PCR technique, application of streptavidin-biotin affinity systems, and the bead based assay formats 13 have made the DNA probe assays less complex . These simplifications have made automation of such DNA probe tests possible . Earlier we have demonstrated the application of an electrochemiluminescent (ECL) detection system in immunoassays and DNA probe assays ."" The electrochemiluminescent label (Origen-label) has been used in its NHS-ester or phosphoramidite form to label oligonucleotides .", " The Origen-label has an interesting photophysical property of luminescing upon electrochemical excitation . The mechanism by which a photon is generated in an ECL reaction in the case of tris-bipyridine ruthenium(ll) complex has been demonstrated earlier ." The DNA melting experiments using oligonucleotides modified with Origen-label have indicated that the Origen-label does not interfere with the DNA hybridization ." We have also subjected the Origen-label labelled oligonucleotide samples to 40 cycles of 1 min at 95 ° C, and 1 min at 60° C in a thermocycler. The ECL intensity of the oligonucleotide samples were measured before and after the thermocycler treatment and found that there was no significant difference." This property of stability of the Origen-label to high temperatures has played an important role in developing a one step,
non-separation assay format that required the label to be stable to the PCR reaction conditions . Also, the development of an aqueous buffer chemistry to perform the ECL assays at physiological pH has greatly facilitated the development of immunoassays and DNA probe assays .' A combination of all the aforementioned developments and photophysical properties of Origen-label have enabled the development of successful rapid, sensitive and versatile immuno and DNA probe assays ."" The assay formats that we describe here make use oligonucleotide probes modified with Origen-label at either a 3', or 3' and 5' ends . The 3'-labelled probes do not get incorporated into the PCR products and, hence, remain available at the end of the amplification process for hybridization and detection . This addition of the labelled probe before the PCR speeds up the process of analysis as the probe is available to hybridize with the PCR product at the end of the amplification cycles . The hybridized products are captured by streptavidin coated beads in Origenassay buffer through a 15 min incubation at room temperature on an Origen-analyser (IGEN, Inc .), followed by automated ECL analysis of the samples . This avoidance of post-PCR addition of reagents prevents contamination problems, human interference and, hence, the method lends itself to automation . We have used the assay format to analyse the PCR products of HIV-1 gag gene and cystic fibrosis (CF) gene . In the case of cystic fibrosis the study included the samples from 15 patients who were already tested for the genetic disorder . The samples used were from five normal individuals, five heterozygous for AF-508 deletion mutation and five homozygous for A-508 deletion mutation . Also, the study involves the analysis of normal and AF-508 deletion mutation in CF synthetic genes .
MATERIALS AND METHODS Chemicals The nucleoside phosphoramidites for the oligonucleotide synthesis were purchased from BioGenex Labs (San Ramon, CA, USA); the 3'-amino modified controlled pore glass solid matrix, and the 5'-amino modifying reagents, biotin NHS-ester were purchased from Clontech Laboratories Inc . (Palo Alto, CA, USA); the Origen-NHS ester and Origen-assay buffers were obtained from IGEN, Inc . (Rockville, MD, USA); Microparticles, Dynal M-280 beads coated with streptavidin was purchased from P and S Biochemicals (Gaithersburg, MD, USA) ; and all other reagents were purchased in their purest grade from reputed chemical companies .
Rapid assays for PCR analysis
Instruments The automated DNA synthesizer Model 380B (Applied Biosystems Inc ., Foster City, CA, USA) was used in the synthesis of oligonucleotides . The ECL intensity was measured on the Origen-I analyser (IGEN, Inc . Rockville, MD, USA), and a DNA Thermal Cycler (Perkin-Elmer Cetus, Norwalk, CT, USA) was used for PCR amplification of DNA samples .
Oligonucleotide synthesis The oligonucleotide probes, primers and CF synthetic genes were synthesized on an automated DNA synthesizer Model 380B using 2-cyanoethyl phosphoramidite chemistry . 20 The 3'-amino modification on the oligonucleotide containing three carbon spacer arm was introduced by using 3'-amino modified solid matrix. The 5'-amino modification containing six carbon spacer arm was incorporated using a 5'-amino modifier at the end of the oligonucleotide synthesis . The oligonucleotides probes and primers synthesized were sequences of 20-30 bases in length with appropriate 5' and 3' modifications . The oligonucleotides synthesized for the study of HIV-1 gag gene were SK38 and SK39 as primers, and SK19 as the probe . In the case of cystic fibrosis the oligonucleotides CFF and CFR were used as primers . CFN2 and CFD2 were used as probes specific for normal and OF-508 deletion mutant gene, respectively. In addition to this, two fairly long sequences, a normal gene with 92 bases and a mutant gene with 89 bases were synthesized on an automated DNA synthesizer . The CF synthetic gene sequences were purified by HPLC on a
Table 1 .
Vydac-C4 reverse phase column using following mobile phases : (a) 0-1 M triethylammonium acetate pH 6 . 75 ; and (b) 50% of 0 . 1 M triethylammonium acetate pH 6 . 75 and 50% acetonitrile with a running gradient of 10-40% mobile phase B in 30 min . Prior to loading on the column, the samples were denatured by heating with 10% deionized formamide in loading buffer for 3 min in a water bath at boiling . The fractions containing the oligonucleotides were pooled and the solvent was removed by speed-vac . The residual pellet was quantitated after reconstituting in water . The nucleotide sequences of the primers, probes and the synthetic genes are listed in Table 1 . Labelling of oligonucleotides The biotin and Origen-label were introduced onto the amino modified oligonucleotides after complete deprotection and preliminary purification on BiogelP6 chromatography, by using corresponding N-hydroxy succinimide derivatives . In a typical OrigenNHS-ester labelling reaction 0-1 µmol of oligonucleotide was reacted with 0 . 5 µmol of Origen-NHS-ester using 80% dimethysulfoxide in phosphate buffered saline, pH 7 . 4 . The biotinylation was carried out essentially the same way using 50% dimethylst .ilfoxide in phosphate buffered saline pH 7 . 4 . The labelled oligonucleotides were precipitated with ethanol and washed with 70% ethanol to remove the unreacted label . The resulting pellet was quantitated after reconstituting the same in water for further use . The oligonucleotide primers SK39 and CFF were biotinylated, and probes SK19, CFN2 and CFD2 were rnodified with Origen-label .
Sequences of oligonucleotide primers and probes used in the study
HIV-1 gag gene primers : SK38 5' -ATAATCCACCTAT000AGTAGGAGAAAT SK39 5' - TTTGGTCCTTGTCTTATGTCCAGAATGC HIV-1 gag gene probes : SK19 5' -ATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTAC CF Primers : CFF 5'-GACTTCACTTATAATGATGA CFR 5' -CTCTTCTAGTTGGCATGCT CF Probes: CFN2 5' -GAAACACCAAAGATGATATT CFD2 5' -AACACCAATGATATTTTCTTT CF Synthetic genes: CF Normal 5' -GACTTCACTTCTAATGATGATAAAGAAAATATCATCTTTGGT CTTTCCTATGATGAATATAGATACAGAA000AGCATGCCAACTAGA AGAG
CF OF-508
5' -GACTTCACTTCTAATGATGATAAAGAAAATATCATTGGT -
Mutant
GTTTCCTATGATGAATATAGATACAGAAGCGAGCATGCCAACTAGA AGAG
497
498
S . R. Gudibande et al.
Polymerase chain reaction The polymerase chain reactions were performed according to the published procedures 21 incorporating the following modifications . The volume of a typical PCR reaction was 25 pl containing 75 ng of primers, and 250 ng of target DNA . The PCR reaction for the HIV-1 gag gene was performed using 75 ng of biotinylated SK39, 75 ng of SK38 primers, and 1 . 25 ng of Origen-labelled SK19 probe . The thermocycler was programmed as follows : 95 ° C for 1 min, 60°C for 1 min, and the amplification was carried out for 40 cycles . The amplification was followed by a denaturing step of 95 ° C for 1 min and a hybridization step of 60° C for 30 min . The PCR for the CF patients' samples and CF synthetic genes were performed as described elsewhere 2 2 In a reaction volume of 25 pl, 75 ng of CFR, 75 ng of biotinylated CFF and 5 ng of either 3'labelled or 3'- and 5'-Origen-labelled CFN2 or CFD2 probes were used . The thermocycler was set for 30 cycles of 94° C for 1 min, 55 ° C for 2 min, 72 ° C for 2 min . At the end of 30 cycles a denaturing step of 98 ° C for 5 min, followed by a hybridization step of 30 min at 65 ° C was introduced . In the case of synthetic genes, the concentration of synthetic DNA was matched to that of the concentration of single copy genes in normal human DNA, i .e . 3 X 10 5 copies per pg of DNA . Hence, 12 fg of synthetic DNA along with 100 ng of salmon sperm DNA (as non-specific carrier DNA) was used in the PCR amplification reactions .
Assay format The schematic diagram of the assay format is as shown in the Fig. 1 . Symmetric type PCR was performed using equal amounts of unlabelled and biotinlabelled primers . The probes were added to the reaction mixture at the beginning of the PCR . The probes carried the Origen-label at either the 3'-end, or the 3'- and 5'-ends of the oligonucleotides . The samples used for the HIV-1 gag gene PCR were the dilutions of the positive HIV-1 control DNA provided in the Gene Amp® kit supplied by Perkin-Elmer Cetus. In the case of cystic fibrosis, human DNA isolated from individual chorionic membranes was supplied by Sigma Chemical Co . (St Louis, MO, USA); DNA isolated from individual CF patients was received from the University of North Carolina, and the synthetic genes made on the automated DNA synthesizer were used as samples for PCR reaction . The PCR amplifications of samples were carried out in duplicates . Following the PCR amplification, the probes modified with Origen-label present in the reaction
mixture hybridize with the target DNA during the hybridization step of 30 min incubation at 65 ° C . In the case of HIV-1 gag gene following the PCR amplification, the duplicate samples were combined, and 2 pl of the reaction mixture was added to the 240 pd of Origen-assay buffer containing 15 Rg of streptavidin coated Dynal M-280 beads . The PCR product of CF samples were analysed in an identical manner in 240 µ1 of Origen assay buffer containing 30% of deionized formamide and 15 pg of streptavidin coated Dynal M-280 beads . The ECL intensity of the samples were measured after 15 min incubation with shaking at room temperature on the Origen-analyser .
ECL analysis of samples on the Origen-analyser We have described earlier the principal components of an Origen-analyser and the methods used to generate light." Briefly, the Origen-analyser consists of an electrode, a photomultiplier tube, tubings and an associated pump all controlled through a computer interface . The electrochemiluminescence reaction occurs on the surface of the electrode and this property has been used with our earlier versions of the assay formats without sample separations ."" The light generated is detected and quantitated using the photomultiplier tube . In the present version of the Origen-analyser we added a magnet to apply a magnetic field at the surface of the electrode, which allows more effective collection of the magnetic beads from the entire sample . The samples for the ECL analysis are drawn through the electrode chamber with the magnetic field applied at the electrode surface . This facilitates in concentrating the magnetic beads on the surface of the electrode as the sample flows through the system followed by Origenassay buffer . With the capture of the beads onto the electrode surface the sample is subject to ECL analysis. Following the ECL analysis of the captured beads the sample is flushed from the electrode chamber in preparation for the next sample.
RESULTS AND DISCUSSIONS HIV-1 infection and the cystic fibrosis genetic disorder are two common serious diseases where detection of the disease state is valuable . In the case of HIV-1, the viral infection leads to a fatal disease state known as Acquired Immune Deficiency Syndrome (AIDS) . 23' 24 AIDS is the result of a complex interaction between the process of viral infection and the host's response .25 The virus has been known to infect cells with CD4 receptor including, T-helper lymphocytes,
49 9
Rapid assays for PCR analysis
PCR reaction
B
Polymerase extension Biotin oligo II1I1I
I
I
I 1111111 l label oligo
' IIIIII1
_0
Polymerase extension
Oligo
Denature to separate strands
I I I I I I I
B
Origen
i
1 V
label oligo
Hybridize
Origen label oligo
Binding to beads then assay BS
1111111
Origen
Streptavidin bead
label oligo Light generated
Schematic representation of the rapid non-separation type ECL assay format . Symmetric type PCR was run using a biotinylated primer and an unlabelled primer . The probes used were modified with Origen-label at either 3' or at 3' and 5' ends of the oligonucleotides . At the end of the PCR cycles a denaturing step and a hybridization step were added to the format . An aliquot of 2 lal of the PCR amplified product was added to 240 µl of Origen assay buffer containing 15 .tg of streptavidin coated Dynal M-280 beads . The ECL analysis was performed on an Origen-analyser after 15 min incubation with shaking on the analyser . Fig . 1 .
monocytes, macrophages, and glial cells ." The virus was discovered in 1983 '23,24 and its genome has been cloned and sequenced . The viral genome encodes for several regulatory proteins in addition to reverse transcriptase, viral envelope and capsid proteins . 27 PCR has been used in the amplification of various regions of the viral genome for developing DNA probe assay formats that would facilitate an early detection of viral infection . 10-28,29 Unlike HIV-1 infection, cystic fibrosis is the most common autosomal recessive genetic disorder in the Caucasian population . The disease affects with a frequency of 1 in 2500 live births and a calculated carrier frequency of 5% . 30 The gene responsible for cystic fibrosis has been identified recently ." , " The locus of this gene spans 250 kb and has been assigned to the long arm of chromosome 7, band q31 . Although several mutations have been identified, the major mutation that accounts for about 70% of CF cases is a 3 by deletion resulting in the loss of a phenylalanine at the 508
position in the gene product . DNA probe assays have been developed based on PCR amplification of the region flanking the 508 deletion mutation .23,33 In a typical DNA probe assay using PCR amplification, the sample is first immobilized, then a labelled oligonucleotide probe is added at the end along with the other reagents necessary for the hybridization and analysis . Here, we have designed an assay format in order to eliminate this post-PCR immobilization, the addition of probe and other reagents that would delay the process of analysis . The probes that we have synthesized contain Origen-label at either the 3'-end, or at 3'- and 5'-ends of the oligonucleotides . As a result of 3'-end labelling, the oligonucleotides are unable to incorporate into the PCR product . Hence, the obvious advantage of using the 3'-labelled oligonucleotide probes is that the probe can be added at the beginning of the PCR reaction and it will remain as an independent entity at the end of the PCR cycles . The intrinsic thermal and chemical stabi-
500
S. R . Gudibande et aI.
lity of the Origen-label also allows this use of the probes without concern for the loss of signal . The PCR amplification was performed on the HIV-1 gag gene DNA samples used in the assay were dilutions of the positive HIV-1 DNA provided as a control in the GeneAmp® PCR kit supplied by PerkinElmer Cetus . The ECL intensities of the samples containing varying number of HIV-1 copies appear in Fig . 2 . The results of this assay demonstrate that we can detect less than 10 copies of HIV-1 gag gene after PCR amplification . This clearly illustrates the fact that the assay format can be used to detect and quantitate HIV-1 DNA rapidly and at low concentrations of target DNA . We have shown earlier with HPV-18 DNA from HeLa cells a similar result.' $ The assay format used in the study of HPV-18 was slightly different where the target DNA was amplified by asymmetric PCR, and the probe was added at the end of the PCR amplification . The PCR for cystic fibrosis assays were performed on the DNA isolated from human HeLa cell lines . In Fig . 3, we have the graph where the DNA concentration in ng has been plotted against the ECL intensity generated by an aliquot of 2lal PCR product . The results of the ECL analysis provided us with useful information that we can conveniently amplify and detect small quantities of target DNA as little as 15 ng or less . In this case the amplified product was analysed using CFN2 oligonucleotide probes modified with Origen-label at 3'- and 5'-ends . The labelled probes have been able to hybridize with the amplified
30,000
2000
0
I I I 5 10 15
20
DNA concentration (ng)
ECL assay for the CF gene in dilutions of DNA sample isolated from human cell line (HeLa) . The PCR was performed using biotinylated CFF, unlabelled CFR primers, and CFN2 probe modified with Origen-label at 3' and 5' ends . The PCR was run for 30 cycles and samples were Fig . 3 .
analysed on an Origen-analyser after bead capture .
PCR product with desired specificity. The results also show that the assay format is suitable for the rapid detection and quantitation of small amounts of target DNA in samples . The results from this titration also demonstrated that a good correlation between the ECL intensity and DNA amount is possible . We have used this assay format to test its specificity using two synthetic genes . The DNA sequences containing normal gene sequence and AF-508 deletion mutation were synthesized on an automated DNA synthesizer . The results of such an assay would permit us to draw conclusions on the results irrespective of the nature and source of DNA sample being screened for cystic fibrosis . The concentration
T C
20,000
N
J U w
with Origen-label at the 3'-end used in the
10,000
0
100
200
300
HIVI gag gene copies per reaction Fig . 2 .
of
synthetic DNA was matched to that of the concentration of single copy genes in normal human DNA (i.e. 3 x 10 5 copies p er .tg of DNA) . The result obtained from such an experiment clearly indicated (data not shown) that the CFN2 and CFD2 probes modified
ECL assay for the HIV-1 gag gene. The
HIV-1
gag
gene . DNA samples used in the assay were dilutions of the positive HIV-1 DNA provided as a control in the GeneAmp® PCR kit supplied by Perkin-Elmer Cetus . The PCR was run for 35 cycles using biotinylated SK39, unlabelled SK38 primers, and SK19 probe modified with Origen-label at 3' and 5' ends . The samples were
analysed on an Origen-analyser .
assay
show excellent specificity hybridizing with the appropriate amplified product . The assay format was also used in the analysis of the following DNA samples : (i) DNA isolated from human chorionic membranes of 10 different individuals (Sigma Chemical Co.), and (ii) DNA samples from patients previously tested for the AF-508 cystic fibrosis disorder . In Fig. 4, the results from the analysis of 10 human DNA samples isolated from the human chorionic membranes are presented . CFN2 and CFD2 probes modified at 3'- and 5'-ends with Origen-label were used in these assays . In Fig . 4,
we can
see that
the CFD2 probe does not hybridize with any of the
Rapid assays for PCR analysis
120,000
501
40,000
∎ X-I ® CFN2 O CFD2
100,000 30,000'
N C
80,000
N
J
-S J
60,000
20,000
W
U W
10,000
40,000
20,000
f1 12 3 4 5 6 7 8 9 1011 121314 15 DNA sample (UNC no .)
0 I
2 3 4 5 6 7 8 9 10 DNA sample
ECL assay for CF genes in DNA samples isolated from human chorionic membranes of 10 different individuals . The PCR was run with CFD2 and CFN2 probes modified with Origen-label at 3' and 5' ends of the oligonucleotides . The PCR was run for 30 cycles and samples were analysed on an Origen-analyser after bead capture. Fig . 4 .
product generated by PCR of individual samples . Therefore, all the samples analysed may have come from normal individuals . The variation seen in the ECL generated by the samples may be a reflection of variations in the PCR. To evaluate the sensitivity and the reproducibility of the assay format, a blind study was conducted on the patients samples . PCR products were analysed by using CF specific probes CFN2, CFD2 modified with Origen-label at 3'-end, and a non specific A-1 probe . The reaction conditions for the PCR amplification protocol remains the same as described earlier . Figure 5 shows the results obtained from the study . The variation seen in the ECL signal may be due to the differences in the samples used in the PCR . Out of 15 samples used in the analysis, the PCR products of five samples with sample numbers 1, 5, 9, 10 and 13 hybridized with only CFN2 probe, indicating that the samples came from normal individuals . The PCR products of five other patients with sample numbers 2, 3, 6, 8 and 14 hybridized with both CFD2 and CFN2 probes, indicating that the patients are heterozygous for the CF AF-508 deletion mutation . In Fig . 5, we noticed variations in the ECL intensity seen between different samples, and also between the two probes on the same sample. This intra-sample variation is most likely due to variability with the PCR from run to run . The analysis also showed that the samples (numbers 4, 7, 11, 12 and 15) came from individuals who are homozygous for the CF AF-508 deletion mutation . In Fig. 5, even though the ECL intensity
ECL assay for CF genes in clinical samples from University of North Carolina. The samples of DNA were isolated from patients tested previously for CF . The PCR was run for 30 cycles using CF specific primers and CFN2, CFD2 probes and a non-specific A-1 probe modified at 3' end with Origen-label. Samples of DNA 0 . 5 lag to 2 . 5 µg were used in 25 µl PCR . Aliquots of 2 p1 from the PCIZ were added to 240 µl of Origen assay buffer containing 15 µg of streptavidin coated Dynal M-280 beads . The ECL analysis was performed on an Origen-analyser after 15 min incubation with shaking on the analyser . Fig. 5.
obtained for sample number 15 was low, it was well above the background intensity recorded for the control . The results of the analysis showed without any ambiguity that five samples were from normal individuals, five were heterozygous for the AF-508 deletion mutation and five were homozygous for the OF-508 deletion mutation . The assay was repeated and the results obtained were the same as in the case of the first experiment . The results obtained in the blind study were compared to the test results obtained at the University of North Carolina and found to be identical . The experiments performed to evaluate the assay format and the results obtained demonstrate that : this one-step, non-separation hybridization assay works very well for the rapid analysis of PCR products . The primers and the labelled probes selected for the assay development exhibit required specificity and sensitivity . The results from the CF study on patients' samples were identical to the results obtained at the University of North Carolina . This study on the CF patients' samples clearly supports the fact that the assay format has the required sensitivity and specificity to analyse the clinical samples . Also, we can detect less than 10 copies of the HIV-1 gag gene . The pivotal aspect of this assay format is that we add oligonucleotide probes modified with Origen-label either at 3'-end, or at 3'- and 5'-ends at the beginning of the PCR reaction . The labelled probe remains
502
S. R . Gudibande et al.
intact and available for hybridization with the amplified product at the end of the PCR cycle . The important properties of Origen-label, such as, its stability to the reaction conditions that exists during the PCR, and its lack of interferences in the DNA hybridization process has made it possible to develop this versatile one-step assay method . Recent improvements in the detection limit of Origen-analysers have facilitated the speed and simplicity of the assays being developed using the ECL detection system .
CONCLUSIONS We have developed a novel DNA hybridization assay using oligonucleotide probes modified with Origenlabel at either 3'-end or at 3' and 5'-ends . The assay is a one-step, non-separation type and does not involve additional post-PCR washing steps. The assay format has been put to test in the analysis of HIV-1 gag gene and the CF AF-508 deletion mutation . The results obtained here suggests that the format performs extremely well and has the required specificity, sensitivity and precision to analyse clinical samples . The method is simple and does not require post-PCR addition of reagents, and hence, lends itself towards automation .
REFERENCES 1 . Newman, A. R . (1990) . The clinical chemistry laboratory of the future. Analytical Chemistry 62, 1063A-5A . 2 . Diamandis, E . P . (1990). Analytical methodology for immunoassays and DNA hybridization assays-Current status and selected systems-Critical Review . Clinica Chemica Acta 194,19-50. 3 . Landegren, U ., Kaiser, R ., Caskey, T . & Hood, L. (1988). DNA diagnostics-molecular techiques and automation . Science 242, 229-37 . 4 . Urdea, M. S ., Kolberg, J ., Clyne, J . et al . (1989) . Application of a rapid non-radiosotopic nucleic acid analysis system to the detection of sexually transmitted disease-causing organisms and their associated antimicrobial resistance, Clinical Chemistry 35, 1571-5 . 5 . Jablonski, E ., Moomaw, E . W., Tullis, R. H . & Ruth, J . L . (1986) . Preparation of oligonucleotide-alkaline phosphatase conjugates and their use as hybridization probes. Nucleic Acids Research 14, 6115-28 . 6. Li, P ., Medon, P. P ., Skingle, D . C ., Lancer, J . A . & Symons, R . H . (1987) . Enzyme linked synthetic oligonucleotide probes : non-radioactive detection of enterotoxigenic E . Coli in faecal specimens . Nucleic Acids Research 15, 5257-87. 7. Parkkinen, S ., Mantyjarvi, R ., Syrjanen, K ., Syvanen, A . & Ranki, M . (1989) . Sandwich hybridization in solution : a rapid method to screen HPV 16 DNA in cervical scrapes . Molecular and Cellular Probes 3, 1-11 . 8. Bates, D . L . (1987) . Enzyme amplification in diagnostics . TIBTECH 5, 204-9 .
9 . Arnold Jr., L. J ., Hammond, P. W ., Weise, A . & Nelson, C . (1989) . Assay formats involving acridinium-ester labelled DNA probes . Clinical Chemistry 35, 1588-94. 10. Coutlee, F ., Bobo, L ., Mayur, K ., Yolken, R. H . & Viscidi . (1989) . Immunodetection of DNA with biotinylated RNA probes: a study of reactivity of a monoclonal antibody to DNA-RNA hybrids . Analytical Biochemistry 181, 96-105 . 11 . Saiki, R . K ., Schraf, S ., Faloona, F ., Mullis, K . B ., Horn, G . T., Erlich, H. A . & Arnheim, N. (1985) . Enzymatic amplification of (3-globin genomic sequence and restriction site analysis for diagnosis of sickle cell anemia . Science 230, 1350-4. 12 . Mazza, C ., Manter, C . & Primi, D . (1991) . DNA enzyme immunoassay : a rapid and convenient colorimetric method for diagnosis of cystic fibrosis . Molecular and Cellular Probes 5, 459-66 . 13 . Urdea, M . S ., Warner, B . D ., Running, J . A ., Stempien, M., Clyne, J . & Horn, T. (1988). A comparison of nonradioisotopic hybridization assay methods using fluorescent, chemiluminescent and enzyme labelled synthetic oligodeoxyribonucleotide probes . Nucleic Acids Research 16, 4937-56 . 14. Erlich, H ., Celfand, D . & Sninsky, J . J . (1991) . Recent advances in the polymerase chain reaction . Science 252,1643-51 . 15 . Willium, J . F . (1989) . Optimization strategies for the polymerase chain reaction . Biotechniques 7, 762 . 16. Blackburn, G. F ., Shah, H . P ., Kenten, J . H . et al . (1991) . Electrochemiluminescence detection for development of immunoassays and DNA probe assays for clinical diagnostics . Clinical Chemistry 37, 1534-9 . 17 . Kenten, J . H ., Casadei, J ., Link, J . et al . (1991) . Rapid electrochemiluminescence assays of PCR products . Clinical Chemistry 37, 1626-32. 18 . Kenten, J . H ., Gudibande, S ., Link, J . et al . (1992) . Improved electrochemiluminescent label for DNA probe assays for HIV-I PCR products . Clinical Chemistry 38, 873-9 . 19 . Leland, J. K . & Powell, M . J . (1990) . Electrogenerated chemiluminescence : An oxidative-reduction type ECL reaction sequence using tripropylamine . journal of the Electrochemical Society 137, 3127-31 . 20 . Beaucage, S . L. & Caruthers, M. H . (1982). Deoxynucleoside phosphoramidites, a new class of key intermediates for deoxyoligonucleotide synthesis . Tetrahedron Letters 22, 1859-62. 21 . Saiki, R . K ., Gelfand, D . H ., Stoffel, S . et al. (1988). Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase . Science 239, 487-91 . 22 . Prior, T . W., Highsmith, Jr ., E. W ., Friedman, K . J ., Perry, T . R ., Scheuerbrandt, G . & Silverman, L .M . (1990). A model for molecular screening of newborns: simultaneous detection of DMD/BMD and CF . Clinical Chemistry 36, 1756-59 . 23 . Barre-Sinoussi, F., Chermann, J . C., Rey, F. et al . (1983) . Isolation of T-lymphotrophic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). Science 220, 868-71 . 24 . Gallo, R . C ., Salahuddin, S . Z., Popovic, M . et al . (1984) . Frequent detection and isolation of cytopathic retroviruses (HTLV III) from patients with AIDS and at risk for AIDS . Science 224, 500-2 . 25 . Levy, J . A . (1989). Human immunodeficiency viruses and the pathogenesis of AIDS. journal of American Medical Association 261, 2997-3006 .
Rapid assays for PCR analysis 26 . Fauci, A . S . (1988) . The human immunodeficiency virus : infectivity and mechanism of pathogenesis . Science 239,617-22 . 27 . Gonda, M . A . (1988) . Molecular genetics and structure of the human immunodeficiency virus . Journal of Electron Microscopy Techniques 8, 17-40. 28 . Taylor, G . R . (1988) . HIV detection by amplification . Journal of Clinical Pathology 41, 142-3 . 29 . Coutlee, F., Yang, B ., Bobo, L . et al . (1990). Enzyme immunoassay for detection of hybrids between PCR amplified HIV-I DNA and an RNA probe: PCR-EIA . AIDS Research and Human Retroviruses 6, 775-84. 30 . Rommens, J. M., lannuzzi, M . C ., Kerem, B . et al . (1989) .
503
Identification of CF gene : chromosome walking and jumping. Science 245, 1059-65 . 31 . Riordan, J . R., Rommens, J . M., Kerem, B. et al. (1989) . Identification of CF gene: cloning and characterization of complementary DNA. Science 245, 1066-73 . 32 . Kerem, B ., Rommens, J . M., Buchanan, J . A . et al. (1989) . Identification of CF gene : genetic analysis . Science 245, 1073-80. 33 . Skogerboe, K . J ., West, S . F ., Murillo, M. D. & Tait, J . F . (1990) . Development and evaluation of a simplified dot-blot method for detecting the AF-508 mutation in CF . Clinical Chemistry 36, 1984-6 .
Rapid, non-separation electrochemiluminescent DNA hybridization assays for PCR products, using 3'-labelled oligonucleotide probes Satyanarayana R. Gudibande, John H . Kenten,* John Link, Kenneth Friedman' and Richard J . Massey Department of Molecular Biology, IGEN Inc ., 1530 E. Jefferson St . Rockville, MD 20852, USA, and 'University of North Carolina at Chapel Hill, CB# 7600, 1071 Patients Support Tower, Chapel Hill, NC 27514, USA (Received 9 June 1992, Accepted 13 August 1992)
Described are rapid assays for the analysis of PCR products in a one step, non-separation assay based on the use of electrochemiluminescence generated from a tris-bipyridine ruthenium (II) label . The assay uses PCR incorporation of a biotinylated oligonucleotide as a primer, with the inclusion of a labelled oligonucleotide . Oligonucleotides were labelled with an N-hydroxy succinimide ester of trisbipyridine ruthenium (II) dihexafluorophosphate (Origen ®-label) by modifying the 3' and 3' 5' ends of the oligonucleotide probes . The assay makes use of the inherent thermal stability and absence of polymerase activity on such probes to allow the PCR and probe hybridization to be completed automatically on the thermocycler . The assay is concluded by the addition of PCR samples to streptavidin beads on an electrochemiluminescence analyser for binding and analysis . Target genes evaluated were the HIV-1 gag gene, and cystic fibrosis AF-508 deletion mutation . The results obtained from these assays demonstrated the detection of 10 copies of the HIV-1 gag gene, and cystic fibrosis AF-508 mutation in 1 ng of human DNA within 15 min . This assay format allows a rapid and simple determination of specific amplified DNA sequences, reducing the contamination risks due to washes and multiple pipetting .
KEYWORDS: Electrochemiluminescence, tris-bipyridine Ru(II) complex, HIV-1, DNA hybridization,
PCR, cystic fibrosis.
INTRODUCTION Early detection and diagnosis of genetic and infectious diseases are areas of importance in clinical diagnostics.' -' Although immuno-diagnostics has evolved in the last few decades to a key position in the clinical diagnostic laboratory the same can not be said of DNA diagnostics .' This failure of DNA probe diagnostics to become a significant method in the clinical laboratory is that a number of hurdles for DNA probe assay technology remain to be cleared . Limitations come from the complexity in sample
preparation and the use of radioisotopes for detection . In an effort to solve these problems, much of the recent research and development has been focused on methods and non-radioisotopic labels . As a result, several non-radioactive reporter groups have been identified having interesting chemiluminescent and fluorescent properties, and they have been used in the development of DNA probe assays both with and without enzyme amplification ."
* Author to whom correspondence should be addressed .
0890-8508/92/060495 + 09 $08 .00/0
495
© 1992 Academic Press Limited
496
S . R . Gudibande et al.
In an attempt to simplify the process and to improve the sensitivity and specificity, several assay formats have been suggested in the literature .' ,' ,"' The ultimate aim of the assay development process is to automate the system so that the assays can be performed by personnel with minimum knowledge of DNA probe assays .' DNA probe assays have been developed based on a number of approaches : hybridization protection assay developed based on the chemiluminescent detection system ; 9 the antibody recognition of DNA-RNA hybrids ;10 and assay methods have been developed with enzyme-labelled oligonucleotide probes for fluorescent and chemiluminescent detection systems 4 fi,13 On the other hand, DNA probe technology has been greatly facilitated by enzyme mediated DNA amplification systems such as PCR ." In a typical DNA probe assay the DNA sample is amplified by PCR, followed by hybridization with wild-type specific or mutation specific labelled oligonucleotide probes .', " The resultant hybrid is analysed by a suitable detection system depending on the type of label used in preparing the probe . Recent advances in many areas of PCR such as the improved thermostable polymerases, methods to control the carry-over contamination, and improvements in the thermocycler equipment have made this technique a simple, indispensable method for DNA amplification ."," in addition to the developments in the PCR technique, application of streptavidin-biotin affinity systems, and the bead based assay formats 13 have made the DNA probe assays less complex . These simplifications have made automation of such DNA probe tests possible . Earlier we have demonstrated the application of an electrochemiluminescent (ECL) detection system in immunoassays and DNA probe assays ."" The electrochemiluminescent label (Origen-label) has been used in its NHS-ester or phosphoramidite form to label oligonucleotides .", " The Origen-label has an interesting photophysical property of luminescing upon electrochemical excitation . The mechanism by which a photon is generated in an ECL reaction in the case of tris-bipyridine ruthenium(ll) complex has been demonstrated earlier ." The DNA melting experiments using oligonucleotides modified with Origen-label have indicated that the Origen-label does not interfere with the DNA hybridization ." We have also subjected the Origen-label labelled oligonucleotide samples to 40 cycles of 1 min at 95 ° C, and 1 min at 60° C in a thermocycler. The ECL intensity of the oligonucleotide samples were measured before and after the thermocycler treatment and found that there was no significant difference." This property of stability of the Origen-label to high temperatures has played an important role in developing a one step,
non-separation assay format that required the label to be stable to the PCR reaction conditions . Also, the development of an aqueous buffer chemistry to perform the ECL assays at physiological pH has greatly facilitated the development of immunoassays and DNA probe assays .' A combination of all the aforementioned developments and photophysical properties of Origen-label have enabled the development of successful rapid, sensitive and versatile immuno and DNA probe assays ."" The assay formats that we describe here make use oligonucleotide probes modified with Origen-label at either a 3', or 3' and 5' ends . The 3'-labelled probes do not get incorporated into the PCR products and, hence, remain available at the end of the amplification process for hybridization and detection . This addition of the labelled probe before the PCR speeds up the process of analysis as the probe is available to hybridize with the PCR product at the end of the amplification cycles . The hybridized products are captured by streptavidin coated beads in Origenassay buffer through a 15 min incubation at room temperature on an Origen-analyser (IGEN, Inc .), followed by automated ECL analysis of the samples . This avoidance of post-PCR addition of reagents prevents contamination problems, human interference and, hence, the method lends itself to automation . We have used the assay format to analyse the PCR products of HIV-1 gag gene and cystic fibrosis (CF) gene . In the case of cystic fibrosis the study included the samples from 15 patients who were already tested for the genetic disorder . The samples used were from five normal individuals, five heterozygous for AF-508 deletion mutation and five homozygous for A-508 deletion mutation . Also, the study involves the analysis of normal and AF-508 deletion mutation in CF synthetic genes .
MATERIALS AND METHODS Chemicals The nucleoside phosphoramidites for the oligonucleotide synthesis were purchased from BioGenex Labs (San Ramon, CA, USA); the 3'-amino modified controlled pore glass solid matrix, and the 5'-amino modifying reagents, biotin NHS-ester were purchased from Clontech Laboratories Inc . (Palo Alto, CA, USA); the Origen-NHS ester and Origen-assay buffers were obtained from IGEN, Inc . (Rockville, MD, USA); Microparticles, Dynal M-280 beads coated with streptavidin was purchased from P and S Biochemicals (Gaithersburg, MD, USA) ; and all other reagents were purchased in their purest grade from reputed chemical companies .
Rapid assays for PCR analysis
Instruments The automated DNA synthesizer Model 380B (Applied Biosystems Inc ., Foster City, CA, USA) was used in the synthesis of oligonucleotides . The ECL intensity was measured on the Origen-I analyser (IGEN, Inc . Rockville, MD, USA), and a DNA Thermal Cycler (Perkin-Elmer Cetus, Norwalk, CT, USA) was used for PCR amplification of DNA samples .
Oligonucleotide synthesis The oligonucleotide probes, primers and CF synthetic genes were synthesized on an automated DNA synthesizer Model 380B using 2-cyanoethyl phosphoramidite chemistry . 20 The 3'-amino modification on the oligonucleotide containing three carbon spacer arm was introduced by using 3'-amino modified solid matrix. The 5'-amino modification containing six carbon spacer arm was incorporated using a 5'-amino modifier at the end of the oligonucleotide synthesis . The oligonucleotides probes and primers synthesized were sequences of 20-30 bases in length with appropriate 5' and 3' modifications . The oligonucleotides synthesized for the study of HIV-1 gag gene were SK38 and SK39 as primers, and SK19 as the probe . In the case of cystic fibrosis the oligonucleotides CFF and CFR were used as primers . CFN2 and CFD2 were used as probes specific for normal and OF-508 deletion mutant gene, respectively. In addition to this, two fairly long sequences, a normal gene with 92 bases and a mutant gene with 89 bases were synthesized on an automated DNA synthesizer . The CF synthetic gene sequences were purified by HPLC on a
Table 1 .
Vydac-C4 reverse phase column using following mobile phases : (a) 0-1 M triethylammonium acetate pH 6 . 75 ; and (b) 50% of 0 . 1 M triethylammonium acetate pH 6 . 75 and 50% acetonitrile with a running gradient of 10-40% mobile phase B in 30 min . Prior to loading on the column, the samples were denatured by heating with 10% deionized formamide in loading buffer for 3 min in a water bath at boiling . The fractions containing the oligonucleotides were pooled and the solvent was removed by speed-vac . The residual pellet was quantitated after reconstituting in water . The nucleotide sequences of the primers, probes and the synthetic genes are listed in Table 1 . Labelling of oligonucleotides The biotin and Origen-label were introduced onto the amino modified oligonucleotides after complete deprotection and preliminary purification on BiogelP6 chromatography, by using corresponding N-hydroxy succinimide derivatives . In a typical OrigenNHS-ester labelling reaction 0-1 µmol of oligonucleotide was reacted with 0 . 5 µmol of Origen-NHS-ester using 80% dimethysulfoxide in phosphate buffered saline, pH 7 . 4 . The biotinylation was carried out essentially the same way using 50% dimethylst .ilfoxide in phosphate buffered saline pH 7 . 4 . The labelled oligonucleotides were precipitated with ethanol and washed with 70% ethanol to remove the unreacted label . The resulting pellet was quantitated after reconstituting the same in water for further use . The oligonucleotide primers SK39 and CFF were biotinylated, and probes SK19, CFN2 and CFD2 were rnodified with Origen-label .
Sequences of oligonucleotide primers and probes used in the study
HIV-1 gag gene primers : SK38 5' -ATAATCCACCTAT000AGTAGGAGAAAT SK39 5' - TTTGGTCCTTGTCTTATGTCCAGAATGC HIV-1 gag gene probes : SK19 5' -ATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTAC CF Primers : CFF 5'-GACTTCACTTATAATGATGA CFR 5' -CTCTTCTAGTTGGCATGCT CF Probes: CFN2 5' -GAAACACCAAAGATGATATT CFD2 5' -AACACCAATGATATTTTCTTT CF Synthetic genes: CF Normal 5' -GACTTCACTTCTAATGATGATAAAGAAAATATCATCTTTGGT CTTTCCTATGATGAATATAGATACAGAA000AGCATGCCAACTAGA AGAG
CF OF-508
5' -GACTTCACTTCTAATGATGATAAAGAAAATATCATTGGT -
Mutant
GTTTCCTATGATGAATATAGATACAGAAGCGAGCATGCCAACTAGA AGAG
497
498
S . R. Gudibande et al.
Polymerase chain reaction The polymerase chain reactions were performed according to the published procedures 21 incorporating the following modifications . The volume of a typical PCR reaction was 25 pl containing 75 ng of primers, and 250 ng of target DNA . The PCR reaction for the HIV-1 gag gene was performed using 75 ng of biotinylated SK39, 75 ng of SK38 primers, and 1 . 25 ng of Origen-labelled SK19 probe . The thermocycler was programmed as follows : 95 ° C for 1 min, 60°C for 1 min, and the amplification was carried out for 40 cycles . The amplification was followed by a denaturing step of 95 ° C for 1 min and a hybridization step of 60° C for 30 min . The PCR for the CF patients' samples and CF synthetic genes were performed as described elsewhere 2 2 In a reaction volume of 25 pl, 75 ng of CFR, 75 ng of biotinylated CFF and 5 ng of either 3'labelled or 3'- and 5'-Origen-labelled CFN2 or CFD2 probes were used . The thermocycler was set for 30 cycles of 94° C for 1 min, 55 ° C for 2 min, 72 ° C for 2 min . At the end of 30 cycles a denaturing step of 98 ° C for 5 min, followed by a hybridization step of 30 min at 65 ° C was introduced . In the case of synthetic genes, the concentration of synthetic DNA was matched to that of the concentration of single copy genes in normal human DNA, i .e . 3 X 10 5 copies per pg of DNA . Hence, 12 fg of synthetic DNA along with 100 ng of salmon sperm DNA (as non-specific carrier DNA) was used in the PCR amplification reactions .
Assay format The schematic diagram of the assay format is as shown in the Fig. 1 . Symmetric type PCR was performed using equal amounts of unlabelled and biotinlabelled primers . The probes were added to the reaction mixture at the beginning of the PCR . The probes carried the Origen-label at either the 3'-end, or the 3'- and 5'-ends of the oligonucleotides . The samples used for the HIV-1 gag gene PCR were the dilutions of the positive HIV-1 control DNA provided in the Gene Amp® kit supplied by Perkin-Elmer Cetus. In the case of cystic fibrosis, human DNA isolated from individual chorionic membranes was supplied by Sigma Chemical Co . (St Louis, MO, USA); DNA isolated from individual CF patients was received from the University of North Carolina, and the synthetic genes made on the automated DNA synthesizer were used as samples for PCR reaction . The PCR amplifications of samples were carried out in duplicates . Following the PCR amplification, the probes modified with Origen-label present in the reaction
mixture hybridize with the target DNA during the hybridization step of 30 min incubation at 65 ° C . In the case of HIV-1 gag gene following the PCR amplification, the duplicate samples were combined, and 2 pl of the reaction mixture was added to the 240 pd of Origen-assay buffer containing 15 Rg of streptavidin coated Dynal M-280 beads . The PCR product of CF samples were analysed in an identical manner in 240 µ1 of Origen assay buffer containing 30% of deionized formamide and 15 pg of streptavidin coated Dynal M-280 beads . The ECL intensity of the samples were measured after 15 min incubation with shaking at room temperature on the Origen-analyser .
ECL analysis of samples on the Origen-analyser We have described earlier the principal components of an Origen-analyser and the methods used to generate light." Briefly, the Origen-analyser consists of an electrode, a photomultiplier tube, tubings and an associated pump all controlled through a computer interface . The electrochemiluminescence reaction occurs on the surface of the electrode and this property has been used with our earlier versions of the assay formats without sample separations ."" The light generated is detected and quantitated using the photomultiplier tube . In the present version of the Origen-analyser we added a magnet to apply a magnetic field at the surface of the electrode, which allows more effective collection of the magnetic beads from the entire sample . The samples for the ECL analysis are drawn through the electrode chamber with the magnetic field applied at the electrode surface . This facilitates in concentrating the magnetic beads on the surface of the electrode as the sample flows through the system followed by Origenassay buffer . With the capture of the beads onto the electrode surface the sample is subject to ECL analysis. Following the ECL analysis of the captured beads the sample is flushed from the electrode chamber in preparation for the next sample.
RESULTS AND DISCUSSIONS HIV-1 infection and the cystic fibrosis genetic disorder are two common serious diseases where detection of the disease state is valuable . In the case of HIV-1, the viral infection leads to a fatal disease state known as Acquired Immune Deficiency Syndrome (AIDS) . 23' 24 AIDS is the result of a complex interaction between the process of viral infection and the host's response .25 The virus has been known to infect cells with CD4 receptor including, T-helper lymphocytes,
49 9
Rapid assays for PCR analysis
PCR reaction
B
Polymerase extension Biotin oligo II1I1I
I
I
I 1111111 l label oligo
' IIIIII1
_0
Polymerase extension
Oligo
Denature to separate strands
I I I I I I I
B
Origen
i
1 V
label oligo
Hybridize
Origen label oligo
Binding to beads then assay BS
1111111
Origen
Streptavidin bead
label oligo Light generated
Schematic representation of the rapid non-separation type ECL assay format . Symmetric type PCR was run using a biotinylated primer and an unlabelled primer . The probes used were modified with Origen-label at either 3' or at 3' and 5' ends of the oligonucleotides . At the end of the PCR cycles a denaturing step and a hybridization step were added to the format . An aliquot of 2 lal of the PCR amplified product was added to 240 µl of Origen assay buffer containing 15 .tg of streptavidin coated Dynal M-280 beads . The ECL analysis was performed on an Origen-analyser after 15 min incubation with shaking on the analyser . Fig . 1 .
monocytes, macrophages, and glial cells ." The virus was discovered in 1983 '23,24 and its genome has been cloned and sequenced . The viral genome encodes for several regulatory proteins in addition to reverse transcriptase, viral envelope and capsid proteins . 27 PCR has been used in the amplification of various regions of the viral genome for developing DNA probe assay formats that would facilitate an early detection of viral infection . 10-28,29 Unlike HIV-1 infection, cystic fibrosis is the most common autosomal recessive genetic disorder in the Caucasian population . The disease affects with a frequency of 1 in 2500 live births and a calculated carrier frequency of 5% . 30 The gene responsible for cystic fibrosis has been identified recently ." , " The locus of this gene spans 250 kb and has been assigned to the long arm of chromosome 7, band q31 . Although several mutations have been identified, the major mutation that accounts for about 70% of CF cases is a 3 by deletion resulting in the loss of a phenylalanine at the 508
position in the gene product . DNA probe assays have been developed based on PCR amplification of the region flanking the 508 deletion mutation .23,33 In a typical DNA probe assay using PCR amplification, the sample is first immobilized, then a labelled oligonucleotide probe is added at the end along with the other reagents necessary for the hybridization and analysis . Here, we have designed an assay format in order to eliminate this post-PCR immobilization, the addition of probe and other reagents that would delay the process of analysis . The probes that we have synthesized contain Origen-label at either the 3'-end, or at 3'- and 5'-ends of the oligonucleotides . As a result of 3'-end labelling, the oligonucleotides are unable to incorporate into the PCR product . Hence, the obvious advantage of using the 3'-labelled oligonucleotide probes is that the probe can be added at the beginning of the PCR reaction and it will remain as an independent entity at the end of the PCR cycles . The intrinsic thermal and chemical stabi-
500
S. R . Gudibande et aI.
lity of the Origen-label also allows this use of the probes without concern for the loss of signal . The PCR amplification was performed on the HIV-1 gag gene DNA samples used in the assay were dilutions of the positive HIV-1 DNA provided as a control in the GeneAmp® PCR kit supplied by PerkinElmer Cetus . The ECL intensities of the samples containing varying number of HIV-1 copies appear in Fig . 2 . The results of this assay demonstrate that we can detect less than 10 copies of HIV-1 gag gene after PCR amplification . This clearly illustrates the fact that the assay format can be used to detect and quantitate HIV-1 DNA rapidly and at low concentrations of target DNA . We have shown earlier with HPV-18 DNA from HeLa cells a similar result.' $ The assay format used in the study of HPV-18 was slightly different where the target DNA was amplified by asymmetric PCR, and the probe was added at the end of the PCR amplification . The PCR for cystic fibrosis assays were performed on the DNA isolated from human HeLa cell lines . In Fig . 3, we have the graph where the DNA concentration in ng has been plotted against the ECL intensity generated by an aliquot of 2lal PCR product . The results of the ECL analysis provided us with useful information that we can conveniently amplify and detect small quantities of target DNA as little as 15 ng or less . In this case the amplified product was analysed using CFN2 oligonucleotide probes modified with Origen-label at 3'- and 5'-ends . The labelled probes have been able to hybridize with the amplified
30,000
2000
0
I I I 5 10 15
20
DNA concentration (ng)
ECL assay for the CF gene in dilutions of DNA sample isolated from human cell line (HeLa) . The PCR was performed using biotinylated CFF, unlabelled CFR primers, and CFN2 probe modified with Origen-label at 3' and 5' ends . The PCR was run for 30 cycles and samples were Fig . 3 .
analysed on an Origen-analyser after bead capture .
PCR product with desired specificity. The results also show that the assay format is suitable for the rapid detection and quantitation of small amounts of target DNA in samples . The results from this titration also demonstrated that a good correlation between the ECL intensity and DNA amount is possible . We have used this assay format to test its specificity using two synthetic genes . The DNA sequences containing normal gene sequence and AF-508 deletion mutation were synthesized on an automated DNA synthesizer . The results of such an assay would permit us to draw conclusions on the results irrespective of the nature and source of DNA sample being screened for cystic fibrosis . The concentration
T C
20,000
N
J U w
with Origen-label at the 3'-end used in the
10,000
0
100
200
300
HIVI gag gene copies per reaction Fig . 2 .
of
synthetic DNA was matched to that of the concentration of single copy genes in normal human DNA (i.e. 3 x 10 5 copies p er .tg of DNA) . The result obtained from such an experiment clearly indicated (data not shown) that the CFN2 and CFD2 probes modified
ECL assay for the HIV-1 gag gene. The
HIV-1
gag
gene . DNA samples used in the assay were dilutions of the positive HIV-1 DNA provided as a control in the GeneAmp® PCR kit supplied by Perkin-Elmer Cetus . The PCR was run for 35 cycles using biotinylated SK39, unlabelled SK38 primers, and SK19 probe modified with Origen-label at 3' and 5' ends . The samples were
analysed on an Origen-analyser .
assay
show excellent specificity hybridizing with the appropriate amplified product . The assay format was also used in the analysis of the following DNA samples : (i) DNA isolated from human chorionic membranes of 10 different individuals (Sigma Chemical Co.), and (ii) DNA samples from patients previously tested for the AF-508 cystic fibrosis disorder . In Fig. 4, the results from the analysis of 10 human DNA samples isolated from the human chorionic membranes are presented . CFN2 and CFD2 probes modified at 3'- and 5'-ends with Origen-label were used in these assays . In Fig . 4,
we can
see that
the CFD2 probe does not hybridize with any of the
Rapid assays for PCR analysis
120,000
501
40,000
∎ X-I ® CFN2 O CFD2
100,000 30,000'
N C
80,000
N
J
-S J
60,000
20,000
W
U W
10,000
40,000
20,000
f1 12 3 4 5 6 7 8 9 1011 121314 15 DNA sample (UNC no .)
0 I
2 3 4 5 6 7 8 9 10 DNA sample
ECL assay for CF genes in DNA samples isolated from human chorionic membranes of 10 different individuals . The PCR was run with CFD2 and CFN2 probes modified with Origen-label at 3' and 5' ends of the oligonucleotides . The PCR was run for 30 cycles and samples were analysed on an Origen-analyser after bead capture. Fig . 4 .
product generated by PCR of individual samples . Therefore, all the samples analysed may have come from normal individuals . The variation seen in the ECL generated by the samples may be a reflection of variations in the PCR. To evaluate the sensitivity and the reproducibility of the assay format, a blind study was conducted on the patients samples . PCR products were analysed by using CF specific probes CFN2, CFD2 modified with Origen-label at 3'-end, and a non specific A-1 probe . The reaction conditions for the PCR amplification protocol remains the same as described earlier . Figure 5 shows the results obtained from the study . The variation seen in the ECL signal may be due to the differences in the samples used in the PCR . Out of 15 samples used in the analysis, the PCR products of five samples with sample numbers 1, 5, 9, 10 and 13 hybridized with only CFN2 probe, indicating that the samples came from normal individuals . The PCR products of five other patients with sample numbers 2, 3, 6, 8 and 14 hybridized with both CFD2 and CFN2 probes, indicating that the patients are heterozygous for the CF AF-508 deletion mutation . In Fig . 5, we noticed variations in the ECL intensity seen between different samples, and also between the two probes on the same sample. This intra-sample variation is most likely due to variability with the PCR from run to run . The analysis also showed that the samples (numbers 4, 7, 11, 12 and 15) came from individuals who are homozygous for the CF AF-508 deletion mutation . In Fig. 5, even though the ECL intensity
ECL assay for CF genes in clinical samples from University of North Carolina. The samples of DNA were isolated from patients tested previously for CF . The PCR was run for 30 cycles using CF specific primers and CFN2, CFD2 probes and a non-specific A-1 probe modified at 3' end with Origen-label. Samples of DNA 0 . 5 lag to 2 . 5 µg were used in 25 µl PCR . Aliquots of 2 p1 from the PCIZ were added to 240 µl of Origen assay buffer containing 15 µg of streptavidin coated Dynal M-280 beads . The ECL analysis was performed on an Origen-analyser after 15 min incubation with shaking on the analyser . Fig. 5.
obtained for sample number 15 was low, it was well above the background intensity recorded for the control . The results of the analysis showed without any ambiguity that five samples were from normal individuals, five were heterozygous for the AF-508 deletion mutation and five were homozygous for the OF-508 deletion mutation . The assay was repeated and the results obtained were the same as in the case of the first experiment . The results obtained in the blind study were compared to the test results obtained at the University of North Carolina and found to be identical . The experiments performed to evaluate the assay format and the results obtained demonstrate that : this one-step, non-separation hybridization assay works very well for the rapid analysis of PCR products . The primers and the labelled probes selected for the assay development exhibit required specificity and sensitivity . The results from the CF study on patients' samples were identical to the results obtained at the University of North Carolina . This study on the CF patients' samples clearly supports the fact that the assay format has the required sensitivity and specificity to analyse the clinical samples . Also, we can detect less than 10 copies of the HIV-1 gag gene . The pivotal aspect of this assay format is that we add oligonucleotide probes modified with Origen-label either at 3'-end, or at 3'- and 5'-ends at the beginning of the PCR reaction . The labelled probe remains
502
S. R . Gudibande et al.
intact and available for hybridization with the amplified product at the end of the PCR cycle . The important properties of Origen-label, such as, its stability to the reaction conditions that exists during the PCR, and its lack of interferences in the DNA hybridization process has made it possible to develop this versatile one-step assay method . Recent improvements in the detection limit of Origen-analysers have facilitated the speed and simplicity of the assays being developed using the ECL detection system .
CONCLUSIONS We have developed a novel DNA hybridization assay using oligonucleotide probes modified with Origenlabel at either 3'-end or at 3' and 5'-ends . The assay is a one-step, non-separation type and does not involve additional post-PCR washing steps. The assay format has been put to test in the analysis of HIV-1 gag gene and the CF AF-508 deletion mutation . The results obtained here suggests that the format performs extremely well and has the required specificity, sensitivity and precision to analyse clinical samples . The method is simple and does not require post-PCR addition of reagents, and hence, lends itself towards automation .
REFERENCES 1 . Newman, A. R . (1990) . The clinical chemistry laboratory of the future. Analytical Chemistry 62, 1063A-5A . 2 . Diamandis, E . P . (1990). Analytical methodology for immunoassays and DNA hybridization assays-Current status and selected systems-Critical Review . Clinica Chemica Acta 194,19-50. 3 . Landegren, U ., Kaiser, R ., Caskey, T . & Hood, L. (1988). DNA diagnostics-molecular techiques and automation . Science 242, 229-37 . 4 . Urdea, M. S ., Kolberg, J ., Clyne, J . et al . (1989) . Application of a rapid non-radiosotopic nucleic acid analysis system to the detection of sexually transmitted disease-causing organisms and their associated antimicrobial resistance, Clinical Chemistry 35, 1571-5 . 5 . Jablonski, E ., Moomaw, E . W., Tullis, R. H . & Ruth, J . L . (1986) . Preparation of oligonucleotide-alkaline phosphatase conjugates and their use as hybridization probes. Nucleic Acids Research 14, 6115-28 . 6. Li, P ., Medon, P. P ., Skingle, D . C ., Lancer, J . A . & Symons, R . H . (1987) . Enzyme linked synthetic oligonucleotide probes : non-radioactive detection of enterotoxigenic E . Coli in faecal specimens . Nucleic Acids Research 15, 5257-87. 7. Parkkinen, S ., Mantyjarvi, R ., Syrjanen, K ., Syvanen, A . & Ranki, M . (1989) . Sandwich hybridization in solution : a rapid method to screen HPV 16 DNA in cervical scrapes . Molecular and Cellular Probes 3, 1-11 . 8. Bates, D . L . (1987) . Enzyme amplification in diagnostics . TIBTECH 5, 204-9 .
9 . Arnold Jr., L. J ., Hammond, P. W ., Weise, A . & Nelson, C . (1989) . Assay formats involving acridinium-ester labelled DNA probes . Clinical Chemistry 35, 1588-94. 10. Coutlee, F ., Bobo, L ., Mayur, K ., Yolken, R. H . & Viscidi . (1989) . Immunodetection of DNA with biotinylated RNA probes: a study of reactivity of a monoclonal antibody to DNA-RNA hybrids . Analytical Biochemistry 181, 96-105 . 11 . Saiki, R . K ., Schraf, S ., Faloona, F ., Mullis, K . B ., Horn, G . T., Erlich, H. A . & Arnheim, N. (1985) . Enzymatic amplification of (3-globin genomic sequence and restriction site analysis for diagnosis of sickle cell anemia . Science 230, 1350-4. 12 . Mazza, C ., Manter, C . & Primi, D . (1991) . DNA enzyme immunoassay : a rapid and convenient colorimetric method for diagnosis of cystic fibrosis . Molecular and Cellular Probes 5, 459-66 . 13 . Urdea, M . S ., Warner, B . D ., Running, J . A ., Stempien, M., Clyne, J . & Horn, T. (1988). A comparison of nonradioisotopic hybridization assay methods using fluorescent, chemiluminescent and enzyme labelled synthetic oligodeoxyribonucleotide probes . Nucleic Acids Research 16, 4937-56 . 14. Erlich, H ., Celfand, D . & Sninsky, J . J . (1991) . Recent advances in the polymerase chain reaction . Science 252,1643-51 . 15 . Willium, J . F . (1989) . Optimization strategies for the polymerase chain reaction . Biotechniques 7, 762 . 16. Blackburn, G. F ., Shah, H . P ., Kenten, J . H . et al . (1991) . Electrochemiluminescence detection for development of immunoassays and DNA probe assays for clinical diagnostics . Clinical Chemistry 37, 1534-9 . 17 . Kenten, J . H ., Casadei, J ., Link, J . et al . (1991) . Rapid electrochemiluminescence assays of PCR products . Clinical Chemistry 37, 1626-32. 18 . Kenten, J . H ., Gudibande, S ., Link, J . et al . (1992) . Improved electrochemiluminescent label for DNA probe assays for HIV-I PCR products . Clinical Chemistry 38, 873-9 . 19 . Leland, J. K . & Powell, M . J . (1990) . Electrogenerated chemiluminescence : An oxidative-reduction type ECL reaction sequence using tripropylamine . journal of the Electrochemical Society 137, 3127-31 . 20 . Beaucage, S . L. & Caruthers, M. H . (1982). Deoxynucleoside phosphoramidites, a new class of key intermediates for deoxyoligonucleotide synthesis . Tetrahedron Letters 22, 1859-62. 21 . Saiki, R . K ., Gelfand, D . H ., Stoffel, S . et al. (1988). Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase . Science 239, 487-91 . 22 . Prior, T . W., Highsmith, Jr ., E. W ., Friedman, K . J ., Perry, T . R ., Scheuerbrandt, G . & Silverman, L .M . (1990). A model for molecular screening of newborns: simultaneous detection of DMD/BMD and CF . Clinical Chemistry 36, 1756-59 . 23 . Barre-Sinoussi, F., Chermann, J . C., Rey, F. et al . (1983) . Isolation of T-lymphotrophic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). Science 220, 868-71 . 24 . Gallo, R . C ., Salahuddin, S . Z., Popovic, M . et al . (1984) . Frequent detection and isolation of cytopathic retroviruses (HTLV III) from patients with AIDS and at risk for AIDS . Science 224, 500-2 . 25 . Levy, J . A . (1989). Human immunodeficiency viruses and the pathogenesis of AIDS. journal of American Medical Association 261, 2997-3006 .
Rapid assays for PCR analysis 26 . Fauci, A . S . (1988) . The human immunodeficiency virus : infectivity and mechanism of pathogenesis . Science 239,617-22 . 27 . Gonda, M . A . (1988) . Molecular genetics and structure of the human immunodeficiency virus . Journal of Electron Microscopy Techniques 8, 17-40. 28 . Taylor, G . R . (1988) . HIV detection by amplification . Journal of Clinical Pathology 41, 142-3 . 29 . Coutlee, F., Yang, B ., Bobo, L . et al . (1990). Enzyme immunoassay for detection of hybrids between PCR amplified HIV-I DNA and an RNA probe: PCR-EIA . AIDS Research and Human Retroviruses 6, 775-84. 30 . Rommens, J. M., lannuzzi, M . C ., Kerem, B . et al . (1989) .
503
Identification of CF gene : chromosome walking and jumping. Science 245, 1059-65 . 31 . Riordan, J . R., Rommens, J . M., Kerem, B. et al. (1989) . Identification of CF gene: cloning and characterization of complementary DNA. Science 245, 1066-73 . 32 . Kerem, B ., Rommens, J . M., Buchanan, J . A . et al. (1989) . Identification of CF gene : genetic analysis . Science 245, 1073-80. 33 . Skogerboe, K . J ., West, S . F ., Murillo, M. D. & Tait, J . F . (1990) . Development and evaluation of a simplified dot-blot method for detecting the AF-508 mutation in CF . Clinical Chemistry 36, 1984-6 .
