Rapid recombinant protein production from piggyBac transposon-mediated stable CHO cell pools.

G Model

ARTICLE IN PRESS

BIOTEC 7040 1–9

Journal of Biotechnology xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec

Rapid recombinant protein production from piggyBac transposon-mediated stable CHO cell pools

1

2

Q1

3 4

Sowmya Balasubramanian a,1 , Mattia Matasci a,1,2 , Zuzana Kadlecova c,3 , Lucia Baldi a , David L. Hacker a,b , Florian M. Wurm a,∗ a

Laboratory for Cellular Biotechnology, CH-1015 Lausanne, Switzerland Protein Expression Core Facility, CH-1015 Lausanne, Switzerland c Polymers Laboratory, École Polytechnique Fédérale de Lausanne, CH-1015 Lausanne, Switzerland

5

b

6 7 8

9 24

a r t i c l e

i n f o

a b s t r a c t

10 11 12 13 14 15

Article history: Received 28 November 2014 Received in revised form 10 February 2015 Accepted 2 March 2015 Available online xxx

16

23

Keywords: Recombinant protein piggyBac Transposon Cell pool Transfection CHO cells

25

1. Introduction

17 18 19 20 21 22

Heterogeneous populations of stably transfected cells (cell pools) can serve for the rapid production of moderate amounts of recombinant proteins. Here, we propose the use of the piggyBac (PB) transposon system to improve the productivity and long-term stability of cell pools derived from Chinese hamster ovary (CHO) cells. PB is a naturally occurring genetic element that has been engineered to facilitate the integration of a transgene into the genome of the host cell. In this report PB-derived cell pools were generated after 10 days of selection with puromycin. The resulting cell pools had volumetric productivities that were 3–4 times higher than those achieved with cell pools generated by conventional plasmid transfection even though the number of integrated transgene copies per cell was similar in the two populations. In 14-day batch cultures, protein levels up to 600 and 800 mg/L were obtained for an Fc-fusion protein and a monoclonal antibody, respectively, at volumetric scales up to 1 L. In general, the volumetric protein yield from cell pools remained constant for up to 3 months in the absence of selection. In conclusion, transfection of CHO cells with the PB transposon system is a simple, efficient, and reproducible approach to the generation of cell pools for the rapid production of recombinant proteins. © 2015 Published by Elsevier B.V.

Q2 26 27 28 29 30 31 32 33 34 35 36 37

Chinese hamster ovary (CHO) cells are the major host for the manufacture of recombinant therapeutic proteins by stable gene expression (Wurm, 2004). However, stable cell line development is a time-consuming process taking several months to complete (Browne and Al-Rubeai, 2007; Matasci et al., 2008; Wurm, 2004). For rapid access to recombinant proteins, transient gene expression (TGE) with suspension-adapted mammalian cells is often employed (Geisse and Voedisch, 2012; Hacker et al., 2013; Pham et al., 2006). Recent improvements in TGE in CHO, through host cell engineering and bioprocess optimization, have resulted in recombinant protein yields up to 2 g/L (Cain et al., 2013; Daramola et al., 2014; Rajendra et al., 2011). However, the relatively large amount of plasmid DNA

∗ Corresponding author at: EPFL SV-IBI-LBTC, CH J2-506 (Building CH), Station 6, CH-1015 Lausanne, Switzerland. Tel.: +41 021 693 61 41; fax: +41 021 693 61 40. E-mail address: florian.wurm@epfl.ch (F.M. Wurm). 1 These authors contributed equally to this work. 2 Current address: Philochem AG, Libernstrasse 3, CH-8112 Otelfingen, Switzerland. 3 Current address: Department of Cell Biology, University of Texas Southwestern Medical Center, Dallas, TX 75390-9039, USA.

required for transfection and its cost, together with the difficulty of handling large liquid volumes are limitations for TGE at volumetric scales above a few liters. An alternative approach to the rapid production of moderate amounts of protein is through the generation of cell pools or bulk cultures. These are heterogeneous populations of recombinant cells obtained by gene transfer and genetic selection but without subsequent cell cloning steps (Fan et al., 2013; Li et al., 2013; Ye et al., 2010). The main reasons for using cell pools over TGE are the need for only a small amount of plasmid DNA and the ease of volumetric scale-up by dilution (Fan et al., 2013; Li et al., 2013; Ye et al., 2010). Cell pools also have an advantage over clonal cell lines because of shorter and less costly development times (Ye et al., 2010). A major drawback of cell pools is the heterogeneity resulting from a cell population having a range of growth rates and recombinant protein expression levels. Consequently, the volumetric productivity of cell pools is usually lower than that for clonal cell lines recovered from the same population and it may not remain constant over time in culture (Fan et al., 2013; Ye et al., 2010). Transposons are naturally occurring mobile genetic elements that can be used in a modified form to facilitate the integration of transgenes into the mammalian cell genome (Izsvak and Ivics, 2004; Meir et al., 2011; Wilson et al., 2007). Engineered

http://dx.doi.org/10.1016/j.jbiotec.2015.03.001 0168-1656/© 2015 Published by Elsevier B.V.

Please cite this article in press as: Balasubramanian, S., et al., Rapid recombinant protein production from piggyBac transposon-mediated stable CHO cell pools. J. Biotechnol. (2015), http://dx.doi.org/10.1016/j.jbiotec.2015.03.001

38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

G Model BIOTEC 7040 1–9 2 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93

ARTICLE IN PRESS S. Balasubramanian et al. / Journal of Biotechnology xxx (2015) xxx–xxx

transposable elements have been used to generate stably transfected CHO- and human embryonic kidney (HEK293)-derived cell lines for protein production (Alattia et al., 2013; Li et al., 2013; Matasci et al., 2011), and they have also served as gene transfer vectors for applications in gene therapy and gene discovery (Ding et al., 2005; Ivics et al., 1997; Mossine et al., 2013; Tsukiyama et al., 2011; Wu et al., 2006). piggyBac (PB), a class II transposable element originally derived from the cabbage looper moth, is one of the several transposons modified to function in mammalian cells (Fraser et al., 1996; Meir et al., 2011; Wilson et al., 2007). The PB transposase (PBase) is known to have a preference for targeting transcriptionally active regions of the host genome. The integration sites have been found to be well-distributed in the genome but no integration clusters were observed even though a few apparent hot-spots of integration have been identified in several human cell types including HEK-293 (Huang et al., 2010; Meir et al., 2011, 2013; Wilson et al., 2007). However, the pattern of PB-mediated integration in CHO cells is not known. The PB transposon system has been used to generate stable CHO cell lines at a significantly higher frequency and with higher volumetric recombinant protein productivity than by conventional plasmid transfection (Matasci et al., 2011). The system consists of one plasmid (helper vector) for the transient expression of the PBase gene and a second plasmid (donor vector) carrying the 5 and 3 inverted repeat elements (5 IR and 3 IR) delimiting the ends of the artificial transposon (Kahlig et al., 2009; Meir et al., 2011). One or more transgenes and the accompanying transcriptional regulatory elements can be introduced between the two IR elements. Following co-transfection of the dual vector system, transiently expressed PBase catalyzes the excision of the artificial transposon from the donor vector and mediates its integration into the host genome. PBase has been reported to be capable of mobilizing very large DNA molecules, such as bacterial artificial chromosomes

(Li et al., 2011; Rostovskaya et al., 2012). However, the optimal transposon size may be below 14 kbp, since the frequency of transposition decreases as the size of the artificial transposon increases beyond this size (Alattia et al., 2013; Ding et al., 2005; Lacoste et al., 2009; Li et al., 2013; Meir et al., 2011). Here, we take advantage of PB-based gene delivery to generate cell pools for recombinant protein production with CHO DG44 cells as the host. We succeeded in producing tumor necrosis factor receptor-Fc fusion protein (TNFR:Fc) and a monoclonal antibody at scales of up to 1 L, with volumetric yields up to 800 mg/L in 14day batch cultures. Most of the pools had a constant volumetric productivity for up to 3 months in the absence of selection. Thus, PB-mediated gene delivery offers a rapid and efficient method for the production of recombinant proteins from cell pools.

94 95 96 97 98 99 100 101 102 103 104 105 106 107

2. Materials and methods

108

2.1. Routine cell culture

109

Suspension-adapted CHO DG44 cells were grown in ProCHO5 medium (Lonza AG, Verviers, Belgium) supplemented with 13.6 mg/L hypoxanthine, 3.84 mg/L thymidine, and 4 mM glutamine (SAFC Biosciences, St. Louis, MO) by orbital shaking in glass bottles as previously described (Muller et al., 2005). The cells were routinely inoculated in ProCHO5 twice per week at a density of 3 × 105 cells/mL. Cell number and viability were assessed manually by the Trypan Blue exclusion method. 2.2. Plasmids The donor vector pMPIG-TNFR:Fc (Fig. 1A) and the helper vector pmPBase have been described previously (Matasci et al., 2011).

Fig. 1. Schematic diagrams of PB donor plasmids. (A) The diagrams of several donor vectors having the same plasmid backbone are shown. For each plasmid, the name, gene of interest, and the selection gene are indicated. (B) Diagram of donor vector pMP-PB-Ig(+) having three separate expression cassettes within the artificial transposon. Abbreviations: internal ribosome entry site (IRES), enhanced green fluorescent protein gene (EGFP), tumor necrosis factor receptor Fc fusion gene (TNFR:Fc), bovine growth hormone polyadenylation element (BGH-pA), SV40 polyadenylation element (SV40-pA), mouse cytomegalovirus promoter (P-mCMV), herpes simplex virus-1 thymidine kinase promoter (P-HSV-tk), inverted terminal repeat (ITR), beta-lactamase gene (bla), antibody light chain gene (IgG-LC), antibody heavy chain gene (IgG-HC), and puromycin N-acetyl-transferase gene (pac).


110 111 112 113 114 115 116 117

118

119 120

G Model BIOTEC 7040 1–9


3

Table 1 Oligonucleotide primers used in this study for PCR and RT-qPCR. Genea

Forward primer (5 –3 )

Reverse primer (5 –3 )

bsr hph Sh ble IgG-LC TNFR:Fc bla

CAATTGTTAGCCCTCCCACACATAAC CAATTGCTATTCCTTTGCCCTCGGAC CAATTGTCAGTCCTGCTCCTCGGCCA CGGCGCTAGCAGTTTAAACAACAGGAAAGTTCCATTGG GCCAGACCAGGAACTGAAAC ACGATCAAGGCGAGTTACATGA

CATATGATGGCCAAGCCTTTGTCTCA CATATGATGAAAAAGCCTGAACTCAC CATATGATGGCCAAGTTGACCAGTGC ATTACCTAGGTTCGCGACCATAGAGCCCACCGCATC GTGGATGAAGTCGTGTTGGA ACACTGCGGCCAACTTACTTCT

a Abbreviations: bsr, blasticidin S-resistance; hph, hygromycin B phosphotransferase; Sh ble, ble from Streptoalloteichus hindustanus; bla, beta-lactamase; IgG-LC, immunoglobulin G light chain; TNFR:Fc, tumor necrosis factor receptor:Fc fusion.

121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147

148

149 150 151 152 153 154 155 156 157 158 159 160 161

162

163 164 165 166 167 168

The donor vector has a bicistronic organization for the coexpression of a gene coding for the ectodomain of the human tumor necrosis factor ␣ receptor 2 (TNFR) fused to a human IgG1 Fc (TNFR:Fc) and a gene coding for the enhanced green fluorescent protein (EGFP). The two genes are separated by the encephalomyocarditis virus (EMCV) internal ribosome entry site (IRES). pmPBase carries an expression cassette for the transient production in mammalian cells of a codon-optimized PBase gene. The donor plasmids pSB-BPB-TNFR:Fc, pSB-HPB-TNFR:Fc, and pSB-ZPB-TNFR:Fc (Fig. 1A) were constructed by replacing the puromycin resistance gene (puromycin N-acetyl-transferase – pac) in pMP-PB-TNFR:Fc (Matasci et al., 2011) with the genes for resistance to blasticidin (blasticidin S-resistance gene – bsr), hygromycin B (hygromycin B phosphotransferase gene – hph), and zeocin (bleomycin resistance gene from Streptoalloteichus hindustanus – Sh ble), respectively, following amplification of the individual genes with the appropriate pair of oligonucleotide primers (Table 1). The PCR products and pMP-PB-TNFR:Fc were digested with MfeI and NdeI, and ligations were performed to generate the three different donor vectors. To construct the donor vector pMP-PB-IgG(+) (Fig. 1B) for the expression of an anti-human RhesusD monoclonal antibody, an existing expression cassette for the light chain (LC) gene was amplified by PCR from pMP-PB-LC (Matasci et al., 2012) using the forward and reverse primers shown in Table 1. The resulting PCR product and pMP-PB-HC (Matasci et al., 2012), carrying the gene of the IgG heavy chain (HC), were digested with NheI and AvrII prior to ligation.

2.3. DNA transfection Cells were transfected using linear 25 kDa polyethylenimine (PEI) (Polysciences, Eppenheim, Germany) according to a modified version of a published protocol (Matasci et al., 2011). The day before transfection, the cells were inoculated in ProCHO5 at a density of 1 × 106 cells/mL and grown overnight with agitation by orbital shaking as described (Muller et al., 2005). On the day of transfection, cells were centrifuged and resuspended in 0.5 mL of ProCHO5 in Tubespin Bioreactor 50 tubes (TS50) (TPP AG, Trasadingen, Switzerland) at a density of 20 × 106 cells/mL. To each tube, 15 ␮g of plasmid DNA and 30 ␮g of PEI (1 mg/mL in H2 O at pH 7.0) were sequentially added. The tubes were incubated with agitation at 180 rpm for 2–4 h, and each culture was diluted with ProCHO5 to a density of 1 × 106 cells/mL.

2.4. Flow cytometry Flow cytometry was performed using a guava easyCyte® microcapillary flow cytometer (Merck-Millipore, Schaffhausen, CH) with excitation and emission wavelengths of 488 and 532 nm, respectively. Cells were prepared for analysis by dilution in PBS to densities of 100–400 × 105 cells/mL. Each sample was measured in duplicate with a minimum of 5000 recorded events.

2.5. ELISA TNFR:Fc and IgG concentrations in cell culture medium were directly determined by sandwich ELISA using a modified version of a published protocol (Meissner et al., 2001). Briefly, a goat antihuman IgG or an Fc-specific goat anti-human IgG F(ab )2 fragment (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA) was used to coat 96-well plates for the analysis of IgG and TNFR:Fc, respectively. For both assays, captured protein was detected with alkaline phosphatase-conjugated goat anti-human gamma chain IgG (Life Technologies) using p-nitrophenyl phosphate (AppliChem GmbH, Darmstadt, Germany) as a substrate. Absorption was measured at 490 nm using a microplate reader (SPECTRAmax TM340; Molecular Devices, Palo Alto, CA, USA). Human TNFR:Fc (Enbrel® ) (Amgen, Zug, Switzerland) and human IgG (Jackson ImmunoResearch Laboratories, Inc.) were used to generate standard curves. 2.6. Plasmid copy number quantification For each analysis, 1 × 106 cells were collected by centrifugation, washed twice with cold PBS, flash frozen in liquid nitrogen, and stored at −80 ◦ C. Total DNA was extracted from cells using the DNeasy Blood & Tissue kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Real time quantitative PCR (RT-qPCR) was carried out in a LightCycler 480 Real-Time PCR System (Roche Applied Science, Basel, Switzerland) with the ABsolute QPCR SYBR Green ROX mix (Axon Lab AG, Baden-Dättwil, Switzerland) according to the manufacturer’s instructions. Oligonucleotide primers for amplification of the TNFR:Fc and ampicillin resistance (betalactamase gene – bla) genes are listed in Table 1. Standard curves to determine the copy number of each gene were created with known amounts of pMPIG-TNFR:Fc as the PCR template following its quantification by UV absorbance. 2.7. Generation of recombinant cell pools and cell lines Cell pools were generated by co-transfecting cells with donor and helper vectors at a 9:1 ratio (w:w) as described above. If necessary, sheared herring sperm DNA (Invitrogen AG, Basel, Switzerland) was used as a non-specific (filler) DNA to replace the helper vector. At day 2 post-transfection, the cells were seeded at a density of 3 × 105 cells/mL in a TS50 in 10 mL of ProCHO5 containing 10 ␮g/mL puromycin (Enzo Life Sciences, Switzerland) unless otherwise stated. Selective medium was replaced every 3–5 days during routine cell passage over 10 days with inoculation at 5 × 105 cells/mL. A similar protocol was adopted when generating cell pools in the presence of blasticidin, hygromycin B, or zeocin (Invitrogen AG). To analyze the stability of protein production over time, cell pools were maintained in ProCHO5 without selection and passaged every 3–4 days. The 14-day batch cultures of cell pools were performed in 500-mL cylindrical glass bottles following inoculation in 100 mL of ProCHO5 at an initial density of 3 × 105 cells/mL.


169

170 171 172 173 174 175 176 177 178 179 180 181 182 183

184

185 186 187 188 189 190 191 192 193 194 195 196 197 198

199

200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216


S. Balasubramanian et al. / Journal of Biotechnology xxx (2015) xxx–xxx

4 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244

ARTICLE IN PRESS

The cultures were maintained in an incubator shaker at 37 ◦ C until day 4, and then the temperature was changed to 31 ◦ C. For the stability studies at 1, 2 and 3 months post-transfection, 100-mL cultures in 500-mL cylindrical glass bottles were maintained for 14-days in an incubator shaker as just described. For the large-scale production of IgG from cell pools, cells were co-transfected with pMP-PB-IgG(+) and pmPBase at a 9:1 ratio (w:w). At day 2 post-transfection, the cells were seeded at a density of 3 × 105 cells/mL in TS50s in 10 mL of ProCHO5 with 10 ␮g/mL puromycin. Cells were diluted to a volume of 100 mL with ProCHO5 containing puromycin. After a total of 10 days under selection, batch cultures were started either in Tubespin Bioreactor 600 tubes (TS600s) at a volume of 500 mL or in 5-L cylindrical glass bottles at a volume of 1 L in the absence of selection. The cultures were maintained in an incubator shaker for 14 days with a temperature shift to 31 ◦ C from 37 ◦ C on day 4. Clonal cell lines expressing TNFR:Fc were recovered by limiting dilution from a cell pool after 10 days of selection in 10 ␮g/mL puromycin as described above. Cells were then seeded in 96-well plates at a density of 0.5 cells/well in 200 ␮l of ProCHO5 (1:1 mix of conditioned and fresh medium). After 15–20 days, individual colonies of cells were transferred to a 24-well plate and cultivated in suspension by agitation of the plate at 110 rpm by orbital shaking. After one passage in 24-well plates, cells were diluted 10-fold with ProCHO5 and seeded in 24-well plates. The cultures were analyzed at day 2 post-inoculation to determine the level of EGFP-specific fluorescence by flow cytometry and at day 8 post-inoculation to determine the volumetric TNFR:Fc productivity by ELISA.

245

3. Results

246

3.1. Identification of selection conditions for cell pool generation

247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278

For the generation of cell pools, both the duration and the start of selection were investigated by co-transfecting cells with pMPIG-TNFR:Fc and pmPBase at a ratio of 9:1 (w/w). At 2 days post-transfection, the cells were grown in the presence of 10 ␮g/mL puromycin for up to 10 days. We had previously demonstrated the successful recovery of high-yielding CHO cell lines using these conditions (Matasci et al., 2011). Aliquots of cells were removed from the culture each day and grown in the absence of selection until the cell viability reached at least 90%. Then the volumetric productivity of each cell pool was evaluated in a 4-day batch culture that was inoculated at 3 × 105 cells/mL in the absence of selection. The volumetric TNFR:Fc productivity of the cell pools increased with the duration of selection up to day 5 and then reached a plateau, with the highest volumetric productivity being observed in the cell pool recovered after 8 days of selection (Fig. 2). We concluded from these results that a selection period of 5–10 days was sufficient to generate a cell pool with a high volumetric productivity. However, the cell viability in the transfected cell population reached 90% after 7 days of selection and continued to increase with time (Fig. 2). For this reason, we chose a duration of 10 days for the selection period. The starting date of the selection period was investigated next. Cells were co-transfected with pMPIG-TNFR:Fc and pmPBase as described above. At 1, 2 or 3 days post-transfection, a 10-day selection period was initiated in 10 ␮g/mL puromycin. The TNFR:Fc productivity of the resulting cell pools was measured in 4-day batch cultures. The three pools produced similar levels of TNFR:Fc (data not shown), indicating that selection could be initiated at 1–3 days post-transfection. For the generation of cell lines by conventional plasmid transfection, the selection agent is known to influence the selection stringency, which may affect volumetric productivity and the stability of transgene expression (Wurm, 2004). To determine if cell

Fig. 2. Effect on the duration of selection on the productivity of cell pools. Cells were co-transfected in duplicate with pMP-PB-TNFR:Fc and pmPBase at a ratio of 9:1 (w/w). The cells were selected in 10 ␮g/mL puromycin for 1–10 days as indicated. The cell viability of the populations under selection was measured daily (black line). Each day, cells were removed from the selected culture and grown in the absence of selection for up to 10 days. The volumetric TNFR:Fc productivity of a 4-day culture was measured by ELISA (bars).

pools could be generated with antibiotics other than puromycin, we constructed a family of TNFR:Fc expression vectors for selection in puromycin (pMP-PB-TNFR:Fc), blasticidin (pSB-BPB-TNFR:Fc), hygromycin B (pSB-HPB-TNFR:Fc), and zeocin (pSB-ZPB-TNFR:Fc) (Fig. 1A). Cells were co-transfected with one of the donor vectors and pmPBase at a ratio of 9:1 (w/w). As a control, cells were also generated by conventional plasmid transfection by replacing pmPBase with filler DNA. For each antibiotic, a range of concentrations was tested to identify the optimal conditions for cell pool generation. We maintained the cells under selection until the cell viability increased to more than 90%. This occurred after 7–14 days of selection for all four antibiotics tested (data not shown). The volumetric TNFR:Fc production of each pool was measured at the end of a 4day batch culture. For each antibiotic, the maximum TNFR:Fc level for the pools generated with the PB system was 3–4 times higher than the maximum level observed in control pools (Fig. 3). In the presence of puromycin, concentrations of 5–10 ␮g/mL were found to be optimal for protein production (Fig. 3A). The optimal concentrations of blasticidin (10 ␮g/mL), hygromycin B (200 ␮g/mL) and zeocin (50 ␮g/mL) resulted in cell pools with volumetric TNFR:Fc productivities of 80–90 mg/L (Fig. 3B–D). These findings demonstrated that cell pools could be generated in the presence of different selection agents. 3.2. Stability of cell pools generated with the PB system Cell pools co-expressing TNFR:Fc and EGFP were generated from five independent transfections in which cells were co-transfected with pMPIG-TNFR:Fc and pmPBase at a 9:1 ratio (w:w). Cell pools were recovered by selection with puromycin (10 ␮g/mL) for 10 days starting on day 2 post-transfection. The cell pools were then grown for 1 month in the absence of selection, and the volumetric TNFR:Fc productivity of each was evaluated in a 14-day batch culture of 100 mL. For each cell pool, the cell density and viability were measured daily, as was the volumetric TNFR:Fc productivity. All the pools had similar cell density and viability profiles, with the maximum cell density reaching 7–8 × 106 cells/mL at day 7 or 8 post-inoculation (Fig. 4A). The volumetric TNFR:Fc productivities reached 350–550 mg/L by day 14 post-inoculation (Fig. 4B). To assess the stability of TNFR:Fc production over time, the cell pools were maintained in the absence of selection for an


279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301

302

303 304 305 306 307 308 309 310 311 312 313 314 315 316 317



5

Fig. 3. Volumetric TNFR:Fc productivity of cell pools generated in the presence of different antibiotics. The cells were co-transfected with either (A) pMP-PB-TNFR:Fc, (B) pSB-BPB-TNFR:Fc, (C) pSB-HPB-TNFR:Fc, or (D) pSB-ZPB-TNFR:Fc and either pmPBase (+PBase) or filler DNA (−PBase) at a 9:1 ratio (w/w). Transfected cells were selected in different concentrations of (A) puromycin, (B) blasticidin, (C) hygromycin B, or (D) zeocin. Cells were maintained under selective pressure until the cell viability reached 90% or more. The cells were then grown in the absence of selection for 10–14 days and used to inoculate 4-day batch cultures for the analysis of TNFR:Fc production by ELISA. The cells (−PBase) selected in the presence of 50 ␮g/mL puromycin did not survive.

330

additional 2 months. At the end of each month, 14-day batch cultures of 100 mL were inoculated with each cell pool. The cell density and viability trends of the cell pools were similar to those observed at the 1-month time point (data not shown). Over the 3-month cultivation period, the volumetric TNFR:Fc yield declined only in pool 2 (Fig. 4C). For the other four cell pools, the productivity was found to be stable for 3 months in the absence of selection (Fig. 4C). The stability of the pools was also measured by determining the percentage of EGFP-positive cells over time. For all five pools, the percentage of EGFP-positive cells remained between 85% and 95% for over two months in culture (Fig. 4D). These results demonstrated the stability of recombinant protein production in cell pools cultivated in the absence of selection.

331

3.3. Transgene copy number in cell pools

318 319 320 321 322 323 324 325 326 327 328 329

332 333 334 335

Cells were co-transfected with pMPIG-TNFR:Fc and either pmPBase or filler DNA at a ratio of 9:1 (w/w) and then selected for 10 days in the presence of 10 ␮g/mL puromycin. The resulting cell pools were grown in the absence of selection for 3 days, and

the volumetric TNFR:Fc productivity of each pool was then measured in a 4-day batch culture. The cell pools generated in the presence (+PBase) and absence of pmPBase (−PBase) had yields of 55.8 mg/L ± 0.4 mg/L and 9.6 mg/L ± 1.3 mg/L, respectively. For each cell pool, the average number of integrated copies per cell of the TNFR:Fc gene and the ampicillin resistance (bla) gene was determined by RT-qPCR. The bla gene was not expected to be detected for DNA integration events resulting from transposition since it was not present within the boundaries of the artificial transposon carried by pMPIG-TNFR:Fc (Fig. 1A). Its detection, however, would be indicative of a DNA integration event resulting from DNA recombination. Therefore, the difference between the average copies per cell of the TNFR:Fc gene and the bla gene represented the average number of transgene integrations per cell resulting from transposition. The +PBase cell pool had 20% fewer copies per cell of the TNFR:Fc gene than the −PBase cell pool, even though the volumetric TNFR:Fc productivity was 5 times higher in the former (Fig. 5). For the +PBase pool we detected on average 3 times more copies per cell of the TNFR:Fc gene than of the bla gene (Fig. 5). In contrast, there were about the same number of copies per cell of the


336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355

G Model BIOTEC 7040 1–9 6


Fig. 4. The long-term stability of cell pools expressing TNFR:Fc and EGFP. Cell pools were generated from five independent co-transfections with pMPIG-TNFR:Fc and pmPBase at a ratio of 9:1 (w/w) performed on different days. Selection was performed for 10 days in 10 ␮g/mL puromycin to generate cell pools numbered 1–5. The cells were then maintained in culture for up to 3 months in the absence of selection. After one month in the absence of selection, 14-day batch cultures at a volume of 100 mL in 500-mL cylindrical glass bottles were inoculated. (A) The live cell density and cell viability were measured daily by the Trypan Blue exclusion method using a hemocytometer. (B) Volumetric TNFR:Fc productivities were measured daily by ELISA. (C) The volumetric TNFR:Fc productivities of each pool were compiled from 14-day cultures after 1, 2, and 3 months of growth in the absence of selection. (D) The percentage of EGFP-positive cells in cell pools grown in the absence of selection for 2 months. EGFP-specific fluorescence was measured by flow cytometry.

356 357 358 359 360

361 362

two genes in the −PBase cell pool (Fig. 5). It can be concluded that in the presence of PBase, about two-thirds of the transgene integration events resulted from transposition, while in the absence of PBase, all of the transgene integration events occurred through DNA recombination, as expected. 3.4. Generation of clonal cell lines from stable pools expressing TNFR:Fc

367

Using limiting dilution, a set of 361 clonal cell lines was recovered from one of the cell pools expressing TNFR:Fc and EGFP following selection for 10 days in puromycin. Over 95% of the cell lines expressed TNFR:Fc, with the highest yield being 350 mg/L in an 8-day batch culture (Fig. 6).

368

3.5. Scalability of cell pools expressing a monoclonal antibody

363 364 365 366

369 370 371

For this experiment, a human recombinant monoclonal IgG antibody was chosen as the model protein in order to demonstrate the versatility of the expression system. Cells were co-transfected

with pMP-PB-Ig(+), carrying the IgG light and heavy chain genes in separate expression cassettes, and pmPBase at a ratio of 9:1 (w/w). The cells from three independent transfections performed on different days were subjected to selection for 10 days with 10 ␮g/mL puromycin. During selection, the culture volume was increased from 10 to 100 mL by dilution. After removal of selective pressure, batch cultures were inoculated at 3 × 105 cells/mL in 1 L of medium in 5-L cylindrical glass bottles (pools 1–3) or in 500 mL of medium in a TS600 (pool 3 only). The cell density, viability, and volumetric IgG productivity of each culture were analyzed daily during the 14-day production phase. The cell density profiles were similar for all four cultures with the maximum cell density being about 8 × 106 cells/mL on day 7 (Fig. 7A). The cell viability of each culture began to decline at day 5 or 6 postinoculation (Fig. 7A). Volumetric IgG yields of 600–800 mg/L were obtained for all four cultures with the highest productivity being observed in the TS600 (Fig. 7B). The entire process from transfection to production was performed in less than 4 weeks. Similar results were achieved with cell pools expressing TNFR:Fc (data not shown).


372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391



Fig. 5. Analysis of transgene copy number in cell pools. Cells were co-transfected with pMPIG-TNFR:Fc and either pmPBase (+PBase) or filler DNA (−PBase) at a ratio of 9:1 (w/w). The cells were cultivated in the presence of 10 ␮g/mL puromycin for 10 days. For each cell pool the integrated copy number per cell for the TNFR:Fc and the bla genes was determined by RT-qPCR. The error bars represent the standard deviation of two experimental (parallel transfections) and two analytical duplicates (PCR assay duplicates) for a total of 4 measurements.

392

393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409

4. Discussion The goal of this work was to evaluate the PB transposon system as a DNA delivery vector to generate CHO cell pools for the rapid production of recombinant proteins. Using two model proteins we were able to demonstrate the feasibility of generating cell pools with volumetric yields of up to 800 mg/L in 14-day batch cultures. Furthermore, when the selection phase was combined with culture scale-up, the entire process from transfection to a 1-L production culture was completed within 4 weeks. Therefore, this method can be considered as an alternative to large-scale TGE for the rapid production of recombinant proteins. Clearly, the time frame for protein production with cell pools is longer than for TGE, as there is a selection phase for the former. However, cell pools present other advantages when compared to TGE: (i) the ease of volumetric scaleup of the culture by dilution, (ii) the small amount of plasmid DNA required for transfection, and (iii) the maintenance of a frozen cell bank to launch multiple production campaigns from the same cell population. If necessary, cell pools can eventually serve as a source

7

of clonal cell lines. These features of cell pools may be of interest in the early stages of drug development. The PB transposon system has several characteristics that make it an attractive tool for gene delivery in mammalian cells. Previously, we demonstrated that co-transfection of CHO cells with PB donor and helper vectors results in 15–20 times more recombinant cells in the population than observed for a standard transfection with the donor vector alone (Matasci et al., 2011). Furthermore, the clonal cell lines recovered from the transfection with the PB transposon system had, on average, higher volumetric productivities and greater production stability than did cell lines generated with the donor vector alone (Matasci et al., 2011). In this report, cell pools with and without co-transfection with the helper vector had the same number of transgene integrations per cell, but the volumetric productivity of the pools generated with the PB system was 5 times higher than the yields from cell pools generated with the donor vector alone. These characteristics of PB-mediated gene delivery may be due to the biased nature of PBase in targeting transcriptionally active regions of the host genome, as suggested in previous studies (Galvan et al., 2009; Meir et al., 2011; Wilson et al., 2007). It was surprising to discover that approximately 3 copies of the bla gene were integrated per cell in the pools generated with the PB system. This gene was integrated by DNA recombination rather than transposition since it was not present within the artificial transposon of the donor plasmid. The bla gene is also present on the helper vector, and so it is possible that this plasmid also contributes to the total number of integrations involving the bla gene. However, the co-transfections with the PB system were performed with a 9:1 ratio (w/w) of the donor and helper vectors, reducing the probability of integration of the helper vector as compared to the donor vector. In addition, the gene conferring resistance to puromycin was not present on the helper vector. Therefore, it is not expected to be integrated at a high level in the cell pools. Overall, we were not expecting such a high level of plasmid integration by DNA recombination following co-transfection of the PB system since previous experiments demonstrated that transposition with the PB system occurs in a much higher percentage of transfected cells than does DNA recombination (Matasci et al., 2011). We suggest that due to the high amount of donor vector being delivered to the cells by transfection, some transgene integrations by DNA recombination are inevitable. Without further analysis of the cell pools at the DNA sequence level it is difficult to make conclusions about the integration of the bla gene. For cell pools, the presence of the bla gene is not expected to have a negative effect on the volumetric productivity. However, this makes PB-mediated cell pools less ideal for

Fig. 6. Analysis of recombinant cell lines recovered from a cell pool. Cells were co-transfected with pMPIG-TNFR:Fc and pmPBase at a ratio of 9:1 (w/w) and then subjected to selection for 10 days in the presence of 10 ␮g/mL puromycin. Clonal cell lines were then recovered by limiting dilution. The cell lines (N = 361) were grown one month in the absence of selection and then analyzed for TNFR:Fc production by ELISA from a 8-day batch culture. The clonal cell lines were ranked according to the volumetric TNFR:Fc productivity.


410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455



8

Fig. 7. Analysis of cell pools expressing a recombinant monoclonal antibody. Three independent co-transfections with pMP-PB-Ig(+) and pmPBase were performed on different days. The cells were selected for 10 days in the presence of 10 ␮g/mL puromycin. On day 12 post-transfection, the three resulting cell pools (pools 1–3) were inoculated to 14-day batch cultures at a final volume of either 0.5 L in a TS600 (pool 3) or 1 L in a 5-L cylindrical glass bottle (pools 1–3). (A) The live cell density and the cell viability were determined at the times indicated by the Trypan Blue exclusion method. (B) The antibody yield was measured by ELISA at the times indicated.

456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484

Q3 485 486

487

commercial use. When generating cell lines from these cell pools, it is possible to screen for those containing only transgenes integrated by transposition. It may also be possible to reduce the level of integration events resulting from DNA recombination by using a modified PBase (Meir et al., 2013). While TGE is a well-established method of rapid protein production with volumetric yields up to 2 g/L, it is not easily scalable and it requires a large amount of plasmid DNA (1–3 g/L of transfection) (Cain et al., 2013; Daramola et al., 2014; Rajendra et al., 2011). In contrast, cell pools are readily scalable by dilution and their generation only requires a few ␮g of DNA if the transfection is performed at a small volumetric scale. Nonetheless, for the production of biopharmaceuticals, clonal cell lines will remain the method of choice both for regulatory reasons and for the ease of cell line characterization. However, we are now aware of the genetic heterogeneity in clonal populations of recombinant cells in culture (Pilbrough et al., 2009; Wurm, 2013). This genomic instability results in the formation of a quasi-species which, in many ways, is like the cell population found in pools. In conclusion, we recommend the use of cell pools for the production of recombinant proteins for research applications. This method may also be taken into consideration as part of a rapid response strategy for the production of low-dose therapeutic proteins. We have shown it to be a rapid and simple technology that can reproducibly yield cell pools with a high level of protein productivity which can be stably maintained in culture for at least 3 months in the absence of selection. Furthermore, we have shown the versatility of the method by expressing two different recombinant proteins and by selecting cells with four different antibiotics.

Uncited references Balciunas et al. (2006) and Wang et al. (2014).

Acknowledgments

The authors thank Virginie Bachmann and Sarah Thurnheer for Q4 their technical support. This work was supported by the Ecole 489 Polytechnique Fédérale de Lausanne and the Swiss Innovation Pro490 motion Agency KTI/CTI (10203.1PFLS-LS). 491 488

References Alattia, J.R., Matasci, M., Dimitrov, M., Aeschbach, L., Balasubramanian, S., Hacker, D.L., Wurm, F.M., Fraering, P.C., 2013. Highly efficient production of the Alzheimer’s gamma-secretase integral membrane protease complex by a multigene stable integration approach. Biotechnol. Bioeng. 110, 1995–2005. Balciunas, D., Wangensteen, K.J., Wilber, A., Bell, J., Geurts, A., Sivasubbu, S., Wang, X., Hackett, P.B., Largaespada, D.A., McIvor, R.S., Ekker, S.C., 2006. Harnessing a high cargo-capacity transposon for genetic applications in vertebrates. PLoS Genet. 2, e169. Browne, S.M., Al-Rubeai, M., 2007. Selection methods for high-producing mammalian cell lines. Trends Biotechnol. 25, 425–432. Cain, K., Peters, S., Hailu, H., Sweeney, B., Stephens, P., Heads, J., Sarkar, K., Ventom, A., Page, C., Dickson, A., 2013. A CHO cell line engineered to express XBP1 and ERO1-Lalpha has increased levels of transient protein expression. Biotechnol. Prog. 29, 697–706. Daramola, O., Stevenson, J., Dean, G., Hatton, D., Pettman, G., Holmes, W., Field, R., 2014. A high-yielding CHO transient system: coexpression of genes encoding EBNA-1 and GS enhances transient protein expression. Biotechnol. Prog. 30, 132–141. Ding, S., Wu, X., Li, G., Han, M., Zhuang, Y., Xu, T., 2005. Efficient transposition of the piggyBac (PB) transposon in mammalian cells and mice. Cell 122, 473–483. Fan, L., Kadura, I., Krebs, L.E., Larson, J.L., Bowden, D.M., Frye, C.C., 2013. Development of a highly-efficient CHO cell line generation system with engineered SV40E promoter. J. Biotechnol. 168, 652–658. Fraser, M.J., Ciszczon, T., Elick, T., Bauser, C., 1996. Precise excision of TTAA-specific lepidopteran transposons piggyBac (IFP2) and tagalong (TFP3) from the baculovirus genome in cell lines from two species of Lepidoptera. Insect Mol. Biol. 5, 141–151. Galvan, D.L., Nakazawa, Y., Kaja, A., Kettlun, C., Cooper, L.J., Rooney, C.M., Wilson, M.H., 2009. Genome-wide mapping of PiggyBac transposon integrations in primary human T cells. J. Immunother. 32, 837–844. Geisse, S., Voedisch, B., 2012. Transient expression technologies: past, present, and future. Methods Mol. Biol. 899, 203–219. Hacker, D.L., Kiseljak, D., Rajendra, Y., Thurnheer, S., Baldi, L., Wurm, F.M., 2013. Polyethyleneimine-based transient gene expression processes for suspensionadapted HEK-293E and CHO-DG44 cells. Protein Expr. Purif. 92, 67–76. Huang, X., Guo, H., Tammana, S., Jung, Y.C., Mellgren, E., Bassi, P., Cao, Q., Tu, Z.J., Kim, Y.C., Ekker, S.C., Wu, X., Wang, S.M., Zhou, X., 2010. Gene transfer efficiency and genome-wide integration profiling of Sleeping Beauty, Tol2, and piggyBac transposons in human primary T cells. Mol. Ther. 18, 1803–1813. Ivics, Z., Hackett, P.B., Plasterk, R.H., Izsvak, Z., 1997. Molecular reconstruction of sleeping beauty, a Tc1-like transposon from fish, and its transposition in human cells. Cell 91, 501–510. Izsvak, Z., Ivics, Z., 2004. Sleeping beauty transposition: biology and applications for molecular therapy. Mol. Ther. 9, 147–156. Kahlig, K.M., Saridey, S.K., Kaja, A., Daniels, M.A., George Jr., A.L., Wilson, M.H., 2009. Multiplexed transposon-mediated stable gene transfer in human cells. Proc. Natl. Acad. Sci. U. S. A. 107, 1343–1348. Lacoste, A., Berenshteyn, F., Brivanlou, A.H., 2009. An efficient and reversible transposable system for gene delivery and lineage-specific differentiation in human embryonic stem cells. Cell Stem Cell 5, 332–342. Li, M.A., Turner, D.J., Ning, Z., Yusa, K., Liang, Q., Eckert, S., Rad, L., Fitzgerald, T.W., Craig, N.L., Bradley, A., 2011. Mobilization of giant piggyBac transposons in the mouse genome. Nucleic Acids Res. 39, e148.


492

493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545



546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575

Li, Z., Michael, I.P., Zhou, D., Nagy, A., Rini, J.M., 2013. Simple piggyBac transposonbased mammalian cell expression system for inducible protein production. Proc. Natl. Acad. Sci. U. S. A. 110, 5004–5009. Matasci, M., Bachmann, V., Delegrange, F., Chenuet, S., Hacker, D., Wurm, F., 2012. Generation of high-producing CHO cell lines by Piggybac transposition. In: Jenkins, N., Barron, N., Alves, P. (Eds.), Proceedings of the 21st Annual Meeting of the European Society for Animal Cell Technology (ESACT). Dublin, Ireland, June 7–10, 2009. Springer, Netherlands, pp. 129–133. Matasci, M., Baldi, L., Hacker, D.L., Wurm, F.M., 2011. The PiggyBac transposon enhances the frequency of CHO stable cell line generation and yields recombinant lines with superior productivity and stability. Biotechnol. Bioeng. 108, 2141–2150. Matasci, M., Hacker, D.L., Baldi, L., Wurm, F.M., 2008. Recombinant therapeutic protein production in cultivated mammalian cells: current status and future prospects. Drug Discov. Today: Technol. 5, e37–e42. Meir, Y.J., Lin, A., Huang, M.F., Lin, J.R., Weirauch, M.T., Chou, H.C., Lin, S.J., Wu, S.C., 2013. A versatile, highly efficient, and potentially safer piggyBac transposon system for mammalian genome manipulations. FASEB J. 27, 4429–4443. Meir, Y.J., Weirauch, M.T., Yang, H.S., Chung, P.C., Yu, R.K., Wu, S.C., 2011. Genomewide target profiling of piggyBac and Tol2 in HEK 293: pros and cons for gene discovery and gene therapy. BMC Biotechnol. 11, 28. Meissner, P., Pick, H., Kulangara, A., Chatellard, P., Friedrich, K., Wurm, F.M., 2001. Transient gene expression: recombinant protein production with suspensionadapted HEK293-EBNA cells. Biotechnol. Bioeng. 75, 197–203. Mossine, V.V., Waters, J.K., Hannink, M., Mawhinney, T.P., 2013. PiggyBac transposon plus insulators overcome epigenetic silencing to provide for stable signaling pathway reporter cell lines. PLoS ONE 8, e85494. Muller, N., Girard, P., Hacker, D.L., Jordan, M., Wurm, F.M., 2005. Orbital shaker technology for the cultivation of mammalian cells in suspension. Biotechnol. Bioeng. 89, 400–406.

9

Pham, P.L., Kamen, A., Durocher, Y., 2006. Large-scale transfection of mammalian cells for the fast production of recombinant protein. Mol. Biotechnol. 34, 225–237. Pilbrough, W., Munro, T.P., Gray, P., 2009. Intraclonal protein expression heterogeneity in recombinant CHO cells. PLoS ONE 4, e8432. Rajendra, Y., Kiseljak, D., Baldi, L., Hacker, D.L., Wurm, F.M., 2011. A simple highyielding process for transient gene expression in CHO cells. J. Biotechnol. 153, 22–26. Rostovskaya, M., Fu, J., Obst, M., Baer, I., Weidlich, S., Wang, H., Smith, A.J., Anastassiadis, K., Stewart, A.F., 2012. Transposon-mediated BAC transgenesis in human ES cells. Nucleic Acids Res. 40, e150. Tsukiyama, T., Asano, R., Kawaguchi, T., Kim, N., Yamada, M., Minami, N., Ohinata, Y., Imai, H., 2011. Simple and efficient method for generation of induced pluripotent stem cells using piggyBac transposition of doxycycline-inducible factors and an EOS reporter system. Genes Cells 16, 815–825. Wang, Y., Wang, J., Devaraj, A., Singh, M., Jimenez Orgaz, A., Chen, J.X., Selbach, M., Ivics, Z., Izsvak, Z., 2014. Suicidal autointegration of sleeping beauty and piggyBac transposons in eukaryotic cells. PLoS Genet. 10, e1004103. Wilson, M.H., Coates, C.J., George Jr., A.L., 2007. PiggyBac transposon-mediated gene transfer in human cells. Mol. Ther. 15, 139–145. Wu, S.C., Meir, Y.J., Coates, C.J., Handler, A.M., Pelczar, P., Moisyadi, S., Kaminski, J.M., 2006. piggyBac is a flexible and highly active transposon as compared to sleeping beauty, Tol2, and Mos1 in mammalian cells. Proc. Natl. Acad. Sci. U. S. A. 103, 15008–15013. Wurm, F.M., 2004. Production of recombinant protein therapeutics in cultivated mammalian cells. Nat. Biotechnol. 22, 1393–1398. Wurm, F.M., 2013. CHO-quasispecies-implications for manufacturing processes. Processes 1, 296–311. Ye, J., Alvin, K., Latif, H., Hsu, A., Parikh, V., Whitmer, T., Tellers, M., de la Cruz Edmonds, M.C., Ly, J., Salmon, P., Markusen, J.F., 2010. Rapid protein production using CHO stable transfection pools. Biotechnol. Prog. 26, 1431–1437.


576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606

Effects of glutamine and asparagine on recombinant antibody production using CHO-GS cell lines.

More similar than different: Host cell protein production using three null CHO cell lines.

minimal piggyBac hybrid vectors for stable production of self-inactivating gamma-retroviruses.

Robust production of recombinant phosphoproteins using cell-free protein synthesis.

Bacterial cell factories for recombinant protein production; expanding the catalogue.

Recombinant human prorenin from CHO cells: expression and purification.

Bioprocess development to improve foreign protein production from recombinant Streptomyces.

A functional high-content miRNA screen identifies miR-30 family to boost recombinant protein production in CHO cells.

Enhanced transient recombinant protein production in CHO cells through the co-transfection of the product gene with Bcl-xL.

CHOPPI: a web tool for the analysis of immunogenicity risk from host cell proteins in CHO-based protein production.

Toward stable gene expression in CHO cells.

Spin filter perfusion system for high density cell culture: production of recombinant urinary type plasminogen activator in CHO cells.

Engineering of CHO Cells for the Production of Recombinant Glycoprotein Vaccines with Xylosylated N-glycans.

Production of recombinant Von Willebrand factor by CHO cells cultured in macroporous microcarriers.

piggyBac transposon plus insulators overcome epigenetic silencing to provide for stable signaling pathway reporter cell lines.

Growth and production of microencapsulated recombinant CHO in a stirred tank bioreactor.

Recombinant protein production in bacterial hosts.

Rapid and facile recombinant expression of bovine rhodopsin in HEK293S GnTI(-) cells using a PiggyBac inducible system.

Carbohydrate metabolism in insect cell cultures during cell growth and recombinant protein production.

Monoclonal antibodies expression improvement in CHO cells by PiggyBac transposition regarding vectors ratios and design.

matrix attachment regions from CHO cell chromosome enhanced the stable transfection efficiency and the expression of transgene in CHO cells.

Stable 293 T and CHO cell lines expressing cleaved, stable HIV-1 envelope glycoprotein trimers for structural and vaccine studies.

Transcriptome study and identification of potential marker genes related to the stable expression of recombinant proteins in CHO clones.

Impact of different promoters, promoter mutation, and an enhancer on recombinant protein expression in CHO cells.