I1BIBllllO-

bnmunogenetics 33: 163-170, 1991

genetics

© Springer-Verlag 1991

Rapid typing of HLA-DQB1 DNA polymorphism using nonradioactive oligonucleotide probes and amplified DNA Teodorica L. Bugawan and Henry A. Erlich Department of Human Genetics, Cetus Corporation, 1400 Fifty-Third Street, Emeryville, CA 94608, USA Received September 21, 1990; revised version received October 22, 1990

Abstract. The allelic sequence diversity at the HLADQB1 locus has been analyzed by polymerase chain reaction (PCR) amplification and sequencing. Fifteen amino acid sequence-defined alleles (one previously unreported) and several silent nucleotide polymorphisms which subdivide these alleles have been identified. Here, we describe the specific amplification of the DQB1 second exon by several different PCR primer pairs and a simple and rapid typing procedure using a panel of 16 horseradish peroxidase (HRP)-labeled oligonucleotide probes capable of distinguishing these DQB1 alleles.

Introduction The HLA class II genes (HLA-DR, -DQ, and -DP) on the short arm of chromosome 6 encode c~ and/3 glycopeptide chains which form a cell surface heterodimer on antigenpresenting cells. These molecules bind processed antigen peptide fragments; recognition of this complex by the Tcell receptor of CD4 + lymphocytes leads to T-cell activation (Babbitt et al. 1985; Buus et al. 1987; Guillet et al. 1987; Sette et al. 1987). These genes are highly polymorphic, with most of the sequence-defined polymorphism being localized to the second exon. Polymorphism at the HLA-DQB1 locus has been detected using serologic typing reagents that define the specificities DQwl, 2, 3, and 4 (Marsh and Bodmer 1989). The specificity DQwl has been subdivided recently into the serologic subtypes DQw5 and 6, and DQw3 has been subdivided into DQw7, 8, and 9 (WHO Nomenclature Committee 1990). In routine typing, however, only the DQwl, DQw2, and DQw3 specificities are distinguished. The analysis of class II DNA polymorphism has been facilitated by the introduction of the polymerase chain reaction (PCR) method for specific DNA amplification

Address correspondence and offprint requests to: H. Erlich.

(Saiki et al. 1985, 1988; Mullis and Faloona 1987); sequence analysis of human DQB1 alleles has identified 15 different amino acid sequences (including one previously unreported; Horn et al. 1988; Fronek et al. 1988; Scharf et al. 1989; H. Erlich, unpublished data). PCR amplification has also made possible the phylogenetic analysis of DQ/3 polymorphism in primates (Gyllensten et al. 1990), revealing four major allelic lineages or types: DQI31a (corresponding to DQw5), DQ/31b (corresponding to DQw6), DQ/32, DQt33, and DQ/34. These allelic types preceded speciation and were present in the ancestral species that gave rise to the hominoid lineages. The 15 human DQB1 alleles currently known appear to have undergone more recent diversification within these ancient lineages or allelic types (Gyllensten eta!. 1990). PCR has also facilitated methods for identifying the alleles determined by sequence analysis. In particular, it has allowed the rapid typing of allelic sequence diversity using oligonucleotide probes (Saiki et al. 1986; Bugawan et al. 1988). Oligonucleotide probes were used to analyze restriction enzyme digests of genomic DNA to identify specific/3-globin mutations (Conner et al. 1983) and some HLA class II polymorphisms (Angelini et al. 1986). It is the ability to amplify specific genomic segments, however, that has made the analysis of polymorphism with oligonucleotide probes a practical approach to HLA typing. Here, we describe a procedure (Levenson and Chang 1986) in which 16 nonradioactively labeled oligonucleotide probes are used to distinguish 15 alleles (one previously unreported) at the HLA-DQB1 locus.

Materials and methods

Optimization of the PCRamplification. GenomicDNA (0.5-1 ~tg)was PCR-amplified using the Perkin-ElmerCetus (Norwalk, Connecticut) DNA Thermocyclerwith primers GH28 and GH29 with DB130 and DB131, or with a combinationof the two sets of primers, using the basic PCR conditions described by Saiki and co-workers (1988), except that MgCI concentration was varied from 1.5 to 2.5 raM. Samples were

164 amplified in a 100-gl reaction volume with 2.5 units Taq polymerase; for each primer set and MgC1 concentration, three different temperature profiles were tried. The three-step profile involved denaturation of the DNA strands at 94 °C for 1 min, primer annealing at 55 °C for 30 s, and extension of the DNA by Taq polymerase (Perkin-Elmer Cetus Amplitaq) at 72 °C for 30 s. The two-step cycle used 94 °C denaturation for 1 rain and 40 s annealing and extension at either 60 °C or 65 °C. A negative control (no DNA) was always included to check for contamination (Higuchi and Kwok 1989). Three microliters of amplified product was loaded in a 3 % Nusieve, 1% agarose gel to monitor the amplification efficiency. The original DQB1 primers GH28 (5'CTCGGATCCGCATGTGCTACTTCACCAACG-3') and GH29 (5'GAGCTGCAGGTAGTTGTGTCTGCACAC-3')(Horn et al. 1988) coamplify the DQB2 (previously DXB) alleles. Primers DB130 (5'AGGGATCCCCGCAGAGGATTTCGTGTACC-3') and DB131 (5'TCCTGCAGGGCGACGACGCTCACCTCCCC-3') were designed in an attempt to minimize amplification of DQB2sequences. DB130 contains a 4 base pair (bp) mismatch with DQB2, while DB131 contains a single bp mismatch at the second position from the 3' end as well as another bp mismatch with both DQB2and DQB1which was introduced at the third position from the 3' end for the primer to efficiently exclude amplification of DQB2 alleles. Amplification with DB131 also allows the analysis of the polymorphic sequences encoding amino acids 78 to 90. This region lies outside the GH29 primer.

Dot-blot of PCR product. Five microliters of amplified DNA sample for each condition was mixed with 95 Ixl denaturation solution [0.4 M NaOH, 25 mM ethylenediaminetetraacetate (EDTA)] and spotted to a pre-wetted [water or 2 x saline-sodium phosphate-EDTA (SSPE)] nylon membrane (Genatran 45; Plasco, Woburn, Massachusetts, or Biodyne; Pall, Glen Cove, New York) using a BioRad (Richmond, California) dot-blot apparatus and duplicate membranes were prepared. The DNA was immobilized on the membrane by ultraviolet light crosslinking in Stratagene's Stratalinker (La Jolla, California) at an influx of 50 mJoules/cm.

Hybridization and Detection. The membranes were hybridized with horseradish peroxidase (HRP)-labeled DQB1 "ALL" probe UG86 (5'TACTGGAACAGCCAGAAGGA-3') or DQB2 probe GH63 (5'CTCGATGCTCCGCCCCAG-3') at 50 °C in 3 x SSPE, 0.5% sodium dodecyl sulfate (SDS) for 30 min and washed with 0.1 x SSPE, 0.1% SDS for 10 min in a 42 °C water bath. The probe UG86 does not hybridize with DQB2 and DQB 1"0401 and probe GH63 (noncoding sequence) hybridizes only with DQB2. The presence of hybridized probe was detected by either a chemiluminescent substrate (ELC; Amersham, Arlington Heights, Illinois) or by the chromogenic dye substrate TMB (3,3',5,5"-tetramethylbenzidine; Fluka, Ronkonkoma, New York) which is converted to a blue precipitate by HRP in the presence of hydrogen peroxide. The detection procedure was as follows: all incubations were done at room temperature with moderate shaking. After a stringent wash, the membranes were incubated for 30 min in 1 x Dulbecco's phosphate-buffered sahne, placed in the ECL detection kit for 1 min, and exposed to X-ray film for 1-5 min. For detection with TMB, the membranes were rinsed in Buffer C (100 mM sodium citrate, pH 5) for 5 min and then incubated in Buffer C plus 0.1 mg/ml TMB (stock is 2 mg/ml in ethanol) plus 0.00015% H202 for 2-10 rain. The reaction was stopped by rinsmg the membranes in 0.01 x Buffer C; membranes were then photographed for permanent record.

DQB1typing. Genomic DNAs were amplified with primers DB130 and GH29 or with DB130 and DB131 for 35 cycles using a temperature profile of 94°C for 1 min and either 55 °C or 60°C for 40 s. Five mlcroliters of PCR-amplified product was spotted on the membrane following the procedure described above. Enough amplified DNA and denaturing solution were prepared to make 16 replicate membranes. If amplified DNA is limiting, membranes can be decolorized in 0.5%

T.L. Bugawan and H.A. Erlich: HLA-DQB1 PCR/oligo typing sodium sulfite at room temperature with shaking for 10-20 min, and the hybridized probes removed by incubating the strips at 70 °C in 0.1 x SSPE, 0.1% SDS for 1 h. The membranes can then be rehybridized (membranes have been successfully re-used more than six times). Sixteen HRP-labeled sequence-specific oligonucleotide (SSO) probes were designed to distinguish the 15 DQB1alleles. Membranes were hybridized to each of the 16 probes, for 30 min to 1 h with 1.5 pmol of probe per ml hybridization solution. Table 1 shows the sequence, hybridization, and wash conditions for each probe.

Results The amino acid and nucleotide sequences o f 15 HLA-

DQB1 alleles are shown in F i g u r e s 1 and 2. [Some o f these alleles, defined as amino acid sequences, h a v e subtypes based on silent p o l y m o r p h i s m s . F o r example, two different DQBI*0503 (previously DQB1.3) nucleotide sequences (Scharf et al. 1989) and two different DQBI*0301 nucleotide sequences h a v e been identified (see l e g e n d for Table 1). T h e s e subtypes are detected by the probes in our typing panel.] The sequences w e r e determ i n e d f r o m our p r e v i o u s analysis of P C R - a m p l i f i e d DQB1 segments (Horn et al. 1988; S c h a r f et al. 1989; N. Fildes, V. Suraj, T. B u g a w a n , unpublished data) with primers G H 2 8 and G H 2 9 or taken f r o m the recent literature ( F r o n e k et al. 1988). T h e nucleotide sequence o f the p r e v i o u s l y unreported allele DQB1.9, a provisional designation pending the assignment o f the H L A N o m e n c l a t u r e C o m m i t t e e , was found in three D R 1 / 2 sibs all o f w h o m w e r e insulin-dependent diabetes mellitus ( I D D M ) patients (Erlich et al. 1990). The sequences o f the oligonucleotide probes and the hybridization and wash conditions used in this study are shown in Table 1; the location o f the p o l y m o r p h i c sequences either c o m p l e m e n tary or identical to the probes is s h o w n in F i g u r e 2. The design o f P C R p r i m e r s that amplify all DQB1 alleles but fail to amplify the linked p s e u d o g e n e DQB2 represents a challenge. P r i m e r s G H 2 8 and G H 2 9 , p r e v i o u s l y used for all alleles ( H o r n et al. 1988), do not amplify the w h o l e exon; they also co-amplify DQB2 alleles. N e w p r i m e r s D B 1 3 0 and DB131 that amplify a larger DQB1 f r a g m e n t but not DQB2 w e r e designed; F i g u r e 3 shows the gel profile o f the amplification products f r o m D N A f r o m the cell lines L G 2 and L U Y with primers A (GH28, G H 2 9 ) , B (DB130, DB 131), C (GH28, DB131), and D (DB130, G H 2 9 ) using either 1.5 or 2.5 m M MgC1. The samples w e r e amplified for 35 cycles at an annealing t e m p e r a t u r e o f 55 ° C , 60 ° C , or 65 ° C . The samples amplified at 60 ° C annealing and extension g a v e m o r e specific product with little to no b a c k g r o u n d , and in all cases the reaction buffer containing 1.5 m M MgC1 g a v e a m o r e specific and efficient amplification. To determ i n e whether these p r i m e r pairs and reaction conditions co-amplified DQB2, dot-blots w e r e p r e p a r e d and hybridized with D Q B 2 and D Q B 1 " A L L " probes (Fig. 4).

T, L. Bugawan and H . A . Erlich: HLA-DQB1 PCR/oligo typing

165

allele Exon-2: 10 20 30 40 50 60 70 8e 90 DQB3.2: •FVYQFK•MCYFTNGTERVRLVTRYIYNREEYARFDSD•GVYRA•TPLGPPAAEYwNSQKEVLERTRAELDTVCRHNYQLELRT•LQRR DQBI*e3O2 DQB3.3: D DQBI*e3O3 DQB3.1: -Y" E D DQBI*e3el DQB4.1: - - F L--C RLD DI--ED~SV DQBI*e4el DQB4.2: C RLD DI--ED~SV DQBI*e4e2 DQB2: S-5 IV EF L--L, .DI.~K--AV-R DQBI*e2el DQBI.I: - - L C H V Q-R-V GA--SV-R EVAY--GI DQBI*eSel DQB1.2: - - L C H V Q-R-~ GA--SV-R EVAY--GI DQBl*0502 DQBI.9: --L C V Q-R-S DI--ED~SV-R EVAY-GI DQBI,e??? DQBI.3: C H V Q-R-D GA--SV-R DQBl*0503 DQB1.4: --L--A ~ DV Q--R-D DI -EVAF-GI DQBl,0601 DQBI.5: --F Q-R-D C EVAF-GI DQBl*0602 DQBI.6: H Q-R-D C DQBl*0603 DQB1.7: H Q-R-V .EVGY--GI-DQB1*0604 DQB1.8: Q-R-V DQB1,0??? DXB: - - L V G-A C EFQ.~E--RSI -D~NY-DF-~QE--AV.-K EA __DXB GH28 > < OH29 > DB130 < DB131 DB86 < UC71

PCR Primer GH28 GH29 DB139 DB131 DB86 UG71

DQw 8 9 7

4 4 2 5 5 5 6 6 6 6 ?

Sequence ( 5' to 3 ' ) CTCGGATCCGCATGTGCTACTTCACCAACG GAGCTGCAGGTAGTTGTGTCTGCACAC AGGGATCCCCGCAGAGGATTTCGTCTACC TCCTGCAGGGCGACGACGCTCACCTCCCC CTGCAC-;GGTCGTGCGGAGCTCCAACTG GCTGCAGTCTCCTCTGCAGGATCCCCC

Fig. 1. Alignment of the protein sequences of the HLA-DQB1 genes. The sequences were translated into the standard one-letter amino acid code and aligned to the DQBI*0302 allele. Arrows indicate the positions of the PCR amplification primers. DB86 is used for specific amplification of DQBI*02, 03, and 04 alleles. UG71 is used for specific amplification of all DQBI*O1 alleles. The allele designations to the left are our local nomenclature which have been used in previous publications (Horn et al. 1988; Scharf et al. 1989), while those on the right are the official WHO Nomenclature Committee designations. The allele designated here as DQB1.8 has been referred to by Fronek and co-workers (1988) as DQ~SLE.

Samples 1 and 2, which were amplified with primers GH28 and GH29, hybridized with both probes equally, suggesting that both loci are amplified to about the same degree. Samples amplified with DB130 and DB131 at three different annealing temperatures did not hybridize with the DQB2 probe, while samples amplified with GH28 and DB131 or with DB130 and GH29 hybridized very faintly with DQB2 probe. These PCR amplifications and dot-blot results suggest that the DB 130 and DB 131 primers are specific for DQB1 and not DQB2 and might, in fact, be the preferred pair for general DQ typing. To determine if this is the case, representative DNA samples for each allele were amplified from homozygous-typing cell (HTC) lines. Interestingly, the DQB1.4 (DQBI*0601) allele failed to amplify with this primer pair at 65 °C; however, when the annealing temperature was lowered to 60 °C or 55 °C, it amplified, but inefficiently. This could pose a potential problem for DQB1.4 heterozygote samples in which the non-DQB1.4 allele might preferentially amplify. The primer pair DB130 and GH29, however, specifically and efficiently amplifies all DQB1 identified thus far, in spite of a silent polymorphism (GTG vs GTA) at codon 78 underneath the GH29 primer. DQBI*0402 alleles are mismatched (A-A) three nucleotides from the 3" end of GH29 as determined by amplification with DB130 and DB131. Nonetheless, DQBl*0402 alleles from the HTCs ARC, OLN, and RSH as well as heterozygous samples which have the same codon 78 (GTA) do amplify with

DB130 and GH29 (data not shown), suggesting that this mismatch is not sufficient to prevent amplification. Thus, the DB130 and GH29 primers have the requisite locus specificity and allelic range and this pair has been used for routine DQB1 typing. Eight of the 16 SSO probes used for typing are located in the most variable region around codons 53-57. The other eight probes are located at five other polymorphic regions of the second exon (see Fig. 2). In general, the DQB1 genotype of individual samples is inferred from the hybridization pattern of these 16 probes. Figure 5 shows the unique patterns corresponding to each of the DQB1 alleles. Figure 6 shows examples of nonradioactive DQB 1 typing, and Figure 7 shows the designation of alleles on previously sequenced homozygous and heterozygous cell lines. All of the 16 HRP-labeled probes are highly specific under the hybridization and wash conditions used here, except probe DB158, which is required to distinguish homozygous 3.1 samples from heterozygous 3.1,3.3 samples. This probe cross-hybridized slightly to the 3.2 allele (not shown in the example). This set of probes does not distinguish between the following three heterozygous genotypes: 1.5,1.7; 15,1.8; or 1.6,1.8. Additional probes are required in order to distinguish these genotypes. Figure 7 shows the assignments of the DQB1 genotypes based on probe reactivity for ten different samples, two of which are heterozygous. A computer algorithm (designed by J. Bolonick) gives the DQB1 genotype by entering the pattern of probe hybridization obtained for

166

T.L. Bugawan and H.A. Erlich: HLA-DQB1 PCR/oligo typing +55

+65

+75

A•a•a•ThrPr•LeuGlyPr•Pr•A•aA•aGluTyrTrpAsnSerG•nLysGlu•a•LeuG•uArgThrArgAlaG•uLeuAspThr DQB3.2:

GCGGTGACGCCGCTGGGGCCGCCTGCCGCCGAGTACTGGAACAGCCAGAAGGAAGTCCTGGAGAGGACCCGGGCGGAGTTGGACACG

DQBI*0302

DB80 DQB3.3:

.........................

A .............................................................

DQBI*0303

A .............................................................

DQBI*0301

DB54 DQB3.1:

.........................

DQB4.1

...................

G--T--A

...............

T ...........

CA ........

GA-GA

.......

TC-G

.......

C

DQBI*0401

...............

T ...........

CA ........

GA-GA

.......

TC-G

.......

C

DQBI*0402

DBI05 DQB4.2:

...................

DQB2:

..........

G--T--A

T ........

T .................................

CA ............

AA

.......

C-G

......

G-

DQBI*0201

DB53 DQBI.I:

--A

..........

A .....

G .....

TT ....................................

DBI07 DQBI.2:

.............

A .....

G ....

G--G

........

TC-G

......

G-

DQBI*0501

G--G

........

TC-G

......

GA

DQBI*0502

TC-G

......

G-

DQBI*0???

......

GA

DQBI*0503

DBIIO

AG .....................................

DB78* DQBI.9

.............

A .....

G ....

AG

...........................

CA ........

DQBI.3

.............

A .....

G .....

A .....................................

DQBI.4

.............

A .....

G .....

A ...........................

GA-GA

G--G

.......

.......

CA ................

CTC-G

A ...............

DQBI*0601

DBII4* DQBI.5:

.............

A .....

G .....

AT

....................................

G .......................

DQBI*0602

G .......................

DQBI*0603

DBII5* DQBI.6:

.............

A .....

G .....

AT

DQBI.7:

.............

A .....

G .....

TT ............................................................

DQBI*0604

DQBI.8:

.............

A .....

G .....

TT ............................................................

DQBI*0???

DXB:

........

CGA

........

G-AGCAT

....................................

. . . .

G .........

A-T-T

.....

CT--T

.....

CA-GAG

.....

C-C-G

......

A-

Fig. 2. Alignment of the nucleotide sequences of the HLA-DQBI genes. The local DQBI Nlele designations are shown to the left, and to the right are the official WHO Nomenclature Committee designations. Positions for DQBI*0302 are shown relative to the start of the mature peptide. For the other alleles, oNy the differences from DQB1*0302 are shown; a dash indicates sequence identity. The underlined nueleotides and the designations correspond to the SSO probes used for ~ping.

Table 1. Oligonucleotide probes for HLA-DQB1 allele typing. Probe name

Sequence variant

HRP-SSO probe sequence 5' to 3'

Specificity

Hybridization/wash conditions in SSPE

DB80 DB54 DB105 DB53 DB107 DB78* DBll4* DB115" DB162*

LGPPA LGPPD LGRLD LGLPA Q-R-V Q-R-S Q-R-D"DWl2" Q-R-D"DW2" TRYIY

CCGCCTGCCGCCGAG CGCTGGGGCCGCCTGAC CTGGGGCGGCTTGACGC TGCTGGGGCTGCCTGCC CCTGTTGCCGAGTAC CAGTACTCGGCGCTAGG TCGGCGTCAGGCCGCCC TCGGCATCAGGCCGC TATAGATGTATCTGGTCAC

3.2 3.1,3.3 4 2 1.1,1.7,1.8 1.2,1.9 1.3,1.4

0.5 ×55 °C/50 °C 1 x55 °C/55 °C 1 x 50 °C/50 °C 3 x 5 5 °C/50 °C 3 x50 °C/42 °C 3 x50 °C/42 °C 1 ×55 0C/55 °C

UG82 DB51 DB69 DB158 DB55 DBll0 DB79

TRHIY EEYAR EEDVR DVGVY DVEVY VLEGA ALL

ACCAGACACATCTATAACC AGGAGTACGCGCGCTTC AAGCGCACGTCCTCCT GCCCGATACACCCCCAC ACGTGGAGGTGTACCGG GAAGTCCTGGAGGGGGC CTTCGACAGCGACGTGG

1.5,1.6

3 x 50 o C/50 °C

3.1-3.3,4,1.5 1.4,1.8,1.9 1.1 1.3,1.6,1.7 4,1.5-1.8 1.4 1.3,1.4,3.3,4 3.1 1.1,1.2,1.3 ALL

3 × 50 °C/42 °C 3 x50 °C/42 i x 55 °C/50 1 x 50 °C/42 3 X 50 °C/42 3 X 50 °C/42 3 X 50 °C/50 3 × 50 °C/42

°C °C °C °C °C °C °C

* Denotes sequence from noncoding strand. The hybridization solution contains 0.5% SDS and SSPE at the concentration and temperature indicated above. The wash solution is 0.1 X SSPE plus 0.1% SDS for 10 min at temperature given above. The probes DB114 and DB115 distinguish the silent polymorphism (GAC vs GAT; Scharf et al. 1989) for the Asp codon at position 57. The probe DB51 also detects a silent polymorphism [GCG (3.1.2) vs GCA (3.1.1)] for the Ala codon at position 38, useful for distinguishing the homozygous 1.7 from heterozygotes 1.1,1.7.

T.L. Bugawan and H. A. Erlich: HLA-DQB1 PCR/oligo typing

167

+25

+35

+45

ThrGluArgVa•ArgLeuValThrArgTyrI•eTyrAsnArgGluGluTyrAlaArg•heAspSerAspValGlyValTyrArg DQB3.2:

GGACGGAGCGCGTGCGTCTTGTGACCAGATACATCTATAACCGAGAGGAGTACGCACGCTTCGACAGCGACGTGGGCGTGTATCGG

DQB3.3:

............................................................................

DQBI*0302

G .........

DBI62* DQB3.1:

.................

DQBI*0303

DBI58*

TA ........................................................

AG .....

C---

DQBI*0301

DB55 DQB4.1:

....

C ....

T ......

GGG

....................................

G ....................

G .........

DQBI*0401

G .........

DQBI*0402

G-A--TC---

DQBI*0201

TG ....................

G .....

C---

DQBI*0501

TG ....................

G .....

C---

DQBI*0502

TG ....................

G .....

C---

DQBI*0???

TG ....................

G .........

DQBI*0503

....................

G .........

DQBI*0601

DB51 DQB4.2:

....

C ...........

GGG

DQB2:

....

A ...................

DQBI.I:

................

GGG

....................................

G ....

..........

G ....................

AG ...............

A---AT--TG

C ........................

....................

UG82 DQBI.2:

................

GGG

..........

DQBI.9:

................

GGG

...........................

DQBI.3:

.......

GGG

..........

DQBI.4:

.................

A ........

C ........................

A .......

C ........................

TA ...............................

G---TG

DB69* DQBI.5:

.......................................................

G ....................

G .....

C--C

DQBI*0602

DQBI.6:

......................

A ......

C .........................

G ....................

G .....

C--C

DQBI*0603

DQBI.7:

......................

A ......

C .........................

G ....................

G .....

C---

DQBI*0604

G .....

C---

DQBI*0???

DB79 DQBI.8:

......................

DXB:

....

A ...........

A ................................

GGG

....

G ...................

G ....................

C ..........

a given sample. This program also indicates that only three of the 240 possible genotypes are not resolved by this panel of probes.

Discussion

The allelic sequence diversity at the DQB1 locus is considerably greater (15 alleles) than the number of currently detectable serologic specificities (seven). In particular, there are nine different DQB1 alleles that type serologically as DQwl and as the subtypes DQw5 or Dw6. Polymorphism not detectable by serology can have profound biological significance. For example, DQBI*0503 (Asp-57), "0501 (Val-57), and *0502 (Ser-57) differ by only one residue and type as DQw5, but DQBl*0503 confers a high risk for Pemphigus vulgaris while the other alleles do not (Scharf et al. 1988). A simple, rapid, and precise method of typing DQB1 polymorphism would be valuable in the areas of disease susceptibility, tissue transplantation, individual identification, and anthropological genetics. The PCR-based dot-blot typing system described here uses 16 HRP-labeled oligonucleotide probes to identify 15 alleles and distinguish 237 of the possible 240 genotypes at the DQB1 locus. We have tried to develop

GG .................

T--G-A--TC-A-

primer pairs that amplify all DQB1 alleles but do not amplify DQB2 sequences. The use of primers that amplify specific groups of alleles epresents an alternative strategy (see Fig. 1); primers DB 130 and DB86 are used to amplify the DQBI*02, *03, and *04 alleles and primers DB130 and UG71 are used for the specific amplification of the DQB1*05 and *06 alleles. Since this approach requires multiple amplifications to type samples, our preference has been to amplify with locus-specific primers and analyze the PCR product with a panel of hybridization probes. The primer pairs GH28 and GH29 amplify all DQB1 alleles but co-amplify DQB2 sequences with equal efficiency. The primer pair DB130 and DB131 and the pair DB130 and GH29 are specific for DQB1 and do not amplify DQB2 sequences. The DB130 and DB131 primers amplify DQB1 specifically but fail to amplify the DQB1.4 (DQB1*0601) allele efficiently. The primers DB 130 and GH29, however, amplify all alleles efficiently in spite of a silent polymorphism at codon 78 underneath the GH29 primer. To ensure that this mismatch 3 nucleotides away from the 3' end of the primer does not prevent DQB1*04 alleles from being amplified efficiently, the annealing temperature has been set at 55 °C for routine typing. DB130 and DB131 are also useful, particularly for the analysis of the polymorphism from codon 84 to 90, not detectable with GH29. However, our current strategy for routine typing has been to use DB130 and

168

T . L . Bugawan and H . A . Erlich: H L A - D Q B 1 PCR/oligo typing

A 1

2

B 3

4

5

6

C

7

D

8 M 9 10 11 1 ' ) 1 3 1 4 1 5 1 6

55 °

60 °

GH29 to amplify and to type the sample with the panel of probes listed in Table 1. This panel of probes is capable not only of distinguishing the 15 DQB1 alleles currently known, but also of detecting new alMes, revealed as a novel pattern of probe reactivity. The new DQB1 allele, 1.9 (Erlich et al. 1990; Fig. 1), was initially identified by an unusual pattern of SSO probe hybridization in samples from an IDDM patient and his mother and then confirmed by cloning and sequencing the PCR product from these samples. This allele appears to be a "recombinant" allele, sharing most of the second exon sequence with DQBl*0502 and the third hypervariable region with DQBl*04. These HRP-labeled oligonucleotide probes are stable ( > 2 years when stored at 4 °C) and the typing system simple and robust. Over 500 samples from the CEPH

GH28, GH29

DB130, DB131

GH28, DB131

DB130, GH29

550 65 0

DQB2

600 650 550

Fig. 3 A-D. DQB1 PCR amplification. One m i c r o g r a m o f g e n o m i c D N A from cell lines LG2 and L U Y was amplified for 35 cycles (Perkin-Elmer Cetos D N A thermal cycler) using either 1.5 or 2.5 m M MgC1 as described in Materials and methods. The following p r i m e r sets were used: A, G H 2 8 , GH29; B, DB130, DB131; C, G H 2 8 , DB131; D, DB130, GH29. The annealing temperature was 55 ° C , 60 ° C , or 65 ° C . Lanes 1, 5, 9, and 13 are L G 2 D N A with 1.5 m M MgC1 in the PCR, while the reaction in lanes 3, 7, 11, and 15 contained 2.5 m M MgC1. Lanes 2, 6, 10, and 14 are L U Y D N A with 1.5 m M MgC1 in the PCR, while the reaction in lanes 4, 8, 12, and 16 contained 2.5 m M MgC1.

DQB1

600 65 °

Fig. 4. Analysis of DQB1 and DQB2 co-amplification, Five microliters of PCR-amplified products from D N A f r o m the L U Y cell line was spotted on duplicate m e m b r a n e . M e m b r a n e A was hybridized with DQB2 probe GH63 and m e m b r a n e B was hybridized with DQB1 " A L L " probe U G 8 6 .

LGPPA LGPPD LGRLD LGLPA Q-R-V Q-R-S QRDI2 QRD 2 TRYIY TRHIY ~YAR EEDVR DVGVY DVEVY VLEGA DB69 DB158 DB55 DBll0 DBS0 DB54 DBI05 DB53 DB107 DB78 DBII4 DBII5 3B162 UGg2 DB51 4 1.4 1.3,1.4 3.1 1.1-1.3 Local 3.2 3.1,3.3 4 2 1.1,1.7 1.2,1.9 1.3,1 4 1.5,1 6 3.1-3.3 1.1-1.3 4,1.4, 1.6,1.7 1.5-1.8 3.3,4 Designation 1.8 1.5,1.8 1.9 + + + 1.1 + + 1.2 -I+ + + + 1.3 + + + + 1.4 + + + 1.5 + + + 1.6 + + + 1.7 + + + 1.8 + -t19 2 + + 3.1 + 3.2 + + + 3.3 + + + -I4 Fig. 5. Determination of the

HLA-DQB1 allele

ALL DB79 ALL

+ + + + + + + + + + + + + +

DQB Allele New Nomenclatur~ 0501 0502 0503 0601 0602 0603 O604 0?77 0?7? 0201 0301 0302 0303 0401

by oligonucleotide probe hybridization. The local designation is used to denote probe specificity.

The W H O Nomenclature Committee designations are shown on the

right.

T.L. Bugawan and H A. Erlich: HLA-DQB1 PCR/oligo typing PROBE LGPPA LGPPD LGRLD DB80 DB54 DB105

LGLPA DB53

Q-RIV DB107

Q-R-S DB78

QRD12 DBl14

ORD-2 DBl15

169 TRHIY UG82

EEYAR EEDVR DVGV¥ DB51 DB69 D8158

DVEVY VLEGA ALL D855 DB110 DB79

SAMPLES

BBQ1 type

LUY

3.1

OLN

4

AZH

1.2

TAB

1.4

FPF

1.S

LG2

1.1

JNP

2,3.2

QBL

2

PGF

1.5

FOR "186

3.3,1.8

Fig. 6. Dot-blots of DQB1 aIlele typing. The probe names as well as the amino acid sequences encoded in the probe region are indicated at the top; the sample names are written on the left, and the DQB1 type on the right. Assignments of the DQB1 allele for each sample are shown in Figure 7.

LGPPA DBS0 3.2 LUY

LGPPD DB54 3,1,3.3

LGRLD DBI05 4

LGLPA DB53 2

Q-R-V DBI07 1.1,1.7 1.8

QRD-2 DBll5 1.5,l.6

TRHIY UG82 1.1-1.3 1.6rl.7

+

EEYAR DB51 4 1.5-l.8

EEDVR ~DVGVY DVEVY VLEGA DB69 DB158 DB55 DBII0 14 1.3,1.4 3.1 1.1-1.3 3.314 +

+

AZH

+

TAB

+

+ +

LG2

+ +

+

+

+

+

+

+

QBL

+

+

+

FPF

+

+

PGF FOR 186

QRD12 DBll4 1,3,1.4

+

OLN

JNT

Q-R-S DB78 1.2,1.9

+ +

+

+ +

+

ALL DB79 ALL +

DQB Allele NOMENCLATLNE OLD NEW 3.1 0301

+

4

0401

+

1.2

0502

+

1.4

0601

+

1.6

0603

+

1.1

+

2,3.2

+

2

+

1.5

+

3.3,1.8

0501 0201,0302 0201 0602 0303, ?

Fig. 7. HLA-DQB1 typing using HRP-labeled oligonucleotide probes. The assignment of DQB1 genotypes based on probe reactivity is shown. The names of eight HTC lines and two heterozygous samples are written on the left, and the DQB1 types on the right.

pedigrees (A. Begovich, G. McClure, R. Helmuth, N. Fildes, V. Suraj, T. Bugawan, H. Erlich, W. Klitz, manuscript in preparation) and more than 200 unrelated samples have been typed by this procedure. To facilitate the analysis of PCR-amplified DNA with a large panel of probes, a reverse dot-blot procedure has been developed (Saiki et al. 1989) in which the probes are immobilized to a nylon membrane and the PCR product, labeled with biotin during amplification, is hybridized to a single membrane containing an array of all the typing probes. This reverse dot-blot typing system for HLADQA1 polymorphism is available commercially and has also been developed for typing DPB1 polymorphism (Bugawan et al. 1990). It is now being developed for DRB1 typing and for the DQB1 typing system described here.

Acknowledgments. We are grateful to Nicola Fildes and Vina Suraj for invaluable technical assistance, to Corey Levenson, Dragan Spasic, and Lori Goda for synthcsls of oligonucleotides, and to Kathy Levenson for preparation of this manuscript.

References Angelini, G., de Preval, C., Gorski, J . , and Mach, B.: High resolution analysis of the human HLA-DR polymorphism by hybridization with sequence-specific oligonucleotide probes. Proc Natl Acad Sci USA 83: 4489-4493, 1986 Babbitt, B.P., Allen, P.M., Matsueda, G., Haher, E., and Unanue, E.R.: Binding of immunogenic peptides to Ia histocompatibility molecules. Nature 317." 359-361, 1985 Bugawan, T.L., Saiki, R.K., Levenson, C.H., Watson, R. M., and Erlich, H. A. : The use of non-radioactive oligonucleotide probes to analyze enzymatically amplified DNA for prenatal diagnosis and forensic HLA typing. Bio/Technology 6: 943-947, 1988 Bugawan, T. L., Begovich, A. B., and Erlich, H. A. : Rapid HLA-DPB typing using enzymatically amplified DNA and nonradioactive sequence-specific oligonucleotide probes. Immunogenetics 32: 231-241, 1990 Buus, S., Settc, A., Colon, S., Miles, C., and Grey, H. M. : The relation between major histocompatibility complex (MHC) restriction and the capacity of Ia to bind immunogenic peptides. Science 235: 1353-1358, 1987 Conner, B.J., Reyes, A . A . , Morin, C., Itakura, K., Teplitz, R.L., and Wallace, R. B. : Detection of sickle cell ~-S globin allele by hybridization with synthetic oligo nucleotides. Proc Natl Acad Sci USA 80: 278-282, 1983

170 Erlich, H.A., Griffith, R., Bugawan, T.L., Ziegler, R., Alper, C., and Eisenbarth, G.: The identification of type 1 diabetic siblings with a novel HLA-DQB1 allele in genetic susceptibility and resistance. Diabetes, in press, 1990 Fronek, Z., Timmerman, L. A., Alper, C. A., Hahn, B. H., Kalunian, K., Peterlin, P. M., and McDevitt, H. O.: Major histocompatibility complex associations with systemic lupus erythematosus. Am J Med 85 (Suppl 6A): 42-44, 1988 Guillet, J.G., Lai, M.Z., Briner, T.J., Buns, S., Sette, A., Grey, H.M., Smith, J.A., and Gefter, M.L.: Immunological self, nonself discrimination. Science 235: 865-870, 1987 Gyllensten, U. B., Lashkari, D., and Erlich, H. A.: Allelic diversification at the HLA-DQ/3 locus of the mammalian major histocompatibility complex. Proc Natl Acad Sci USA 87: 1835-1839, 1990 Higuchi, R. and Kwok, S.: Avoiding false positive with PCR. Nature 339: 237-238, 1989 Horn, G. T., Bugawan, T. L., Long, C., and Erlich, H. A.: Allelic sequence variation of the HLA-DQ loci: relationship to serology and insulin-dependent diabetes susceptibility. Proc Natl Acad Sci USA 85: 6012-6016, 1988 Levenson, C.H. and Chang, C.A.: Non isotopically labelled probes and primers. In M. Innis, J. Sninsky, D. Gelfand, and T. White (eds.): PCR Protocols and Application-A Laboratory Manual, p. 99-112, Academic, New York, 1986 Marsh, S.G.E. and Bodmer, J.G.: HLA-DR and DQ epitopes and monoclonal antibody specificity. Immunol Today 10: 305-312, 1989 Mullis, K.B. and Faloona, F. : Specific synthesis of DNA in vitro via polymerase catalyzed chain reaction. Methods Enzymol 155: 335-350, 1987

T.L. Bugawan and H.A. Eriich: HLA-DQB1 PCR/oligo typing Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A., and Arnheim, N. : Enzymatic amplification of/3globin genomic sequence and restriction site analysis for diagnosis of sickle cell anemia. Science 230: 1350-1354, 1985 Saiki, R. K., Bugawan, T. L., Horn, G. T., Mullis, K. B., and Erlich, H. A. : Analysis of enzymatically amplified /3-globin and HLADQe~ DNA with allele specific probes. Nature 324: 163-166, 1986 Saikl, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. : Primer-directed enzymatic amplification of DNA with thermostable DNA polymerase. Science 239: 487-491, 1988 Saiki, R., Walsh, P.S., Levenson, C.H., and Erlich, H. A.: Genetic analysis of amplified DNA with immobilized sequence-specific oligonucleotide probes. Proc Natl Acad Sci USA 86: 6230-6234, 1989 Scharf, S.J., Friedmann, A., Brautbar, C., Szafer, F., Steinman, L., Horn, G., Gyllensten, U., and Erlich, H. A.: HLA class II allelic variation and susceptibility to Pemphigus vulgaris. Proc Natl Acad Sci USA 85: 3504-3508, 1988 Scharf, S., Friedmann, A., Stemman, L., Brautbar, C., and Erlich, H.A.: Specific HLA-DQ~ and DR~I alleles confer susceptibility to Pemphigus vulgaris. Proc Natl Acad Sci USA 86: 6215-6219, 1989 Sette, A., Buus, S., Colon, S., Smith, J.A., Miles, C., and Grey, H. M.: Structural characteristics of an antigen required for its interaction with Ia and recognition by T cells. Nature 328: 395-399, 1987 WHO Nomenclature Committee: Nomenclature for factors of the HLA system, 1989. lmmunogenetics 31: 131-140, 1990

Rapid typing of HLA-DQB1 DNA polymorphism using nonradioactive oligonucleotide probes and amplified DNA.

The allelic sequence diversity at the HLA-DQB1 locus has been analyzed by polymerase chain reaction (PCR) amplification and sequencing. Fifteen amino ...
646KB Sizes 0 Downloads 0 Views