Leukemia & Lymphoma, September 2014; 55(9): 2209–2210 © 2014 Informa UK, Ltd. ISSN: 1042-8194 print / 1029-2403 online DOI: 10.3109/10428194.2013.873536
LETTER TO THE EDITOR
Rare occurrence of SET binding protein 1 mutation in patients with acute lymphoblastic leukemia, mixed phenotype acute leukemia and chronic myeloid leukemia in blast crisis Meiyu Chen∗, Hong Yao∗, Suning Chen, Qinrong Wang, Qian Wang, Lijun Wen, Jundan Xie, Lili Qin, Lili Wu, Huiying Qiu & Jiannong Cen Jiangsu Institute of Hematology, Key Laboratory of Thrombosis and Hemostasis of Ministry of Health, the First Affiliated Hospital of Soochow University, Suzhou, P. R. China
SET binding protein 1 (SETBP1), consisting of 1596 amino acids with a molecular weight of 175 kDa, localizes predominantly in the nucleus, and is encoded by SETBP1 in chromosome 18q21.1 [1]. The protein contains a SETbinding region and a SKI homology region, which is highly conserved with unknown biological function [2]. SETBP1 is a binding partner for the SET nuclear oncoprotein, and is involved in apoptosis, transcription and nucleosome assembly [3]. Whole exome sequencing has identified germline SETBP1 alterations affecting amino-acid residues between 858 and 871 in patients with Schinzel–Giedion syndrome (SGS), characterized by skeletal malformations, mental retardation and developmental delay [4]. SETBP1 mutations have been identified in various myeloid malignancies with variable frequencies: 2.2% in myelodysplastic syndromes (MDS), 2.5% in primary myelofibrosis (PMF), 9% in MDS/myeloproliferative neoplasm overlap (MDS/MPN), 4% in MPN, 24% in atypical chronic myeloid leukemia (aCML), 17% in secondary acute myeloid leukemia (sAML) and 15% in chronic myelomonocytic leukemia (CMML) [3,5,6]. Somatic mutation of SETBP1 in aCML was associated with a worse prognosis and a higher white blood cell count [1], while mutations in sAML and CMML were significantly correlated with advanced age and monosomy 7/deletion 7q [⫺7/del(7q)], constituting poor prognostic factors. In addition, two out of 27 patients with CML in blast crisis (CML-BC) carried SETBP1 mutations [7]. This evidence indicates that somatic mutations of SETBP1 might be involved in leukemic evolution, and might be a novel marker in myeloid malignancies [1,7]. However, the prevalence of SETBP1 mutations in lymphoid malignancies remains unknown. In the present study, we aimed to investigate the frequency of SETBP1 mutations in acute lymphoblastic leukemia (ALL) and mixed phenotype
acute leukemia (MPAL) and assess the occurrence of SETBP1 mutations in Chinese patients with CML in BC. A total of 253 adult patients diagnosed with hematologic malignancies at Jiangsu Institute of Hematology from January 2001 to December 2011 were retrospectively analyzed in the present study. This group consisted of 110 patients with B-ALL, 41 patients with T-ALL, 54 patients with CML-BC and 48 patients with MPAL. The median age was 43 years (19–63 years), and the cohort was all Chinese with a majority of males (54.2%). The main characteristics of patients in this study are summarized in Table I. The present study was approved by the Ethics Committee of the First Affiliated Hospital of Soochow University following the Declaration of Helsinki. Genomic DNA was prepared as previously described [8]. Briefly, DNA was extracted either from the purified fraction of mononuclear cells after Ficoll density centrifugation or methanol/acetic acid-fixed cells prepared for cytogenetic analysis using a Purelink™ Genomic DNA kit (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Polymerase chain reaction (PCR) amplification and Sanger sequencing were applied for mutation screening. Forward primer 5′CAAATCTCCAGCCCATCAG3′ and reverse primer 5′CGTGGTAGAAGGTGTAACTC3′ were used to generate sequences for amino-acid region 807–975. PCR products were sequenced on both strands using an ABI 3730 XL DNA Analyzer (Applied Biosystems, Foster City, CA). However, in this study, no somatic mutation was identified in 110 patients with B-ALL, 41 with T-ALL and 48 with MPAL based on Sanger sequencing analysis. In addition, although we investigated more patients with CML-BC than in a previous study, there was no SETBP1 mutation in 54 patients with CML-BC, which was not consistent with the previous report [7].
∗M.C. and H.Y. contributed equally to this manuscript. Correspondence: Dr. Jiannong Cen or Dr. Huiying Qiu, Jiangsu Institute of Hematology, Key Laboratory of Thrombosis and Hemostasis of Ministry of Health, the First Affiliated Hospital of Soochow University, 188 Shizi Street, Suzhou 215006, P. R. China. Tel: 086-0512-67780410. Fax: 0086-512-65113556. E-mail: [email protected] or Tel: 086-0512-67780322. E-mail: [email protected] Received 22 October 2013; revised 26 November 2013; accepted 30 November 2013
2209
2210
M. Chen et al.
Table I. Clinical characteristics of patients with ALL, MPAL and CML-BC. Characteristic Total Age, years, median (range) Sex Male Female B-ALL Age, years, median (range) Sex Male Female T-ALL Age, years, median (range) Sex Male Female CML-BC Age, years, median (range) Sex Male Female Blast cells in BM, % (range) Blast crisis Myeloid Lymphoid Myeloid/lymphoid MPAL Age, years, median (range) Sex Male Female
Number
Percentage
n ⫽ 253 43 (19–63) 137 116 n ⫽ 110 40 (19–57)
54.2% 45.8%
53 57 n ⫽ 41 39 (21–56)
48.2% 51.8%
19 22 n ⫽ 54 46 (27–58)
46.3% 53.7%
36 18 46.7 (27–86)
66.7% 33.3%
42 10 2 n ⫽ 48 43 (22–63)
77.8% 18.5% 3.7%
29 19
60.4% 39.6%
ALL, acute lymphoblastic leukemia; CML-BC, chronic myeloid leukemia in blast crisis; BM, bone marrow; MPAL, mixed phenotype acute leukemia.
In summary, we demonstrated that somatic mutation of SETBP1 might have only rare occurrence in ALL and MPAL, which suggested that SETBP1 mutation might not be involved in the leukemogenisis of ALL. Furthermore, the prevalence
of SETBP1 mutation in patients with CML-BC should be investigated in a large population or assessed using nextgeneration deep sequencing.
Potential conflict of interest: Disclosure forms provided by the authors are available with the full text of this article at www.informahealthcare.com/lal.
References [1] Piazza R, Valletta S, Winkelmann N, et al. Recurrent SETBP1 mutations in atypical chronic myeloid leukemia. Nat Genet 2013;45: 18–24. [2] Thol F, Suchanek KJ, Koenecke C, et al. SETBP1 mutation analysis in 944 patients with MDS and AML. Leukemia 2013;27: 2072–2075. [3] Laborde RR, Patnaik MM, Lasho TL, et al. SETBP1 mutations in 415 patients with primary myelofibrosis or chronic myelomonocytic leukemia: independent prognostic impact in CMML. Leukemia 2013;27:2100–2102. [4] Hoischen A , van Bon BW, Gilissen C, et al. De novo mutations of SETBP1 cause Schinzel-Giedion syndrome. Nat Genet 2010;42: 483–485. [5] Damm F, Itzykson R, Kosmider O, et al. SETBP1 mutations in 658 patients with myelodysplastic syndromes, chronic myelomonocytic leukemia and secondary acute myeloid leukemias. Leukemia 2013;27:1401–1403. [6] Meggendorfer M, Bacher U, Alpermann T, et al. SETBP1 mutations occur in 9% of MDS/MPN and in 4% of MPN cases and are strongly associated with atypical CML, monosomy 7, isochromosome i(17)(q10), ASXL1 and CBL mutations. Leukemia 2013;27: 1852–1860. [7] Makishima H, Yoshida K , Nguyen N, et al. Somatic SETBP1 mutations in myeloid malignancies. Nat Genet 2013;45: 942–946. [8] Wang Q, Qiu H, Jiang H, et al. Mutations of PHF6 are associated with mutations of NOTCH1, JAK1 and rearrangement of SET-NUP214 in T-cell acute lymphoblastic leukemia. Haematologica 2011;96: 1808–1814.
Copyright of Leukemia & Lymphoma is the property of Taylor & Francis Ltd and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
LETTER TO THE EDITOR
Rare occurrence of SET binding protein 1 mutation in patients with acute lymphoblastic leukemia, mixed phenotype acute leukemia and chronic myeloid leukemia in blast crisis Meiyu Chen∗, Hong Yao∗, Suning Chen, Qinrong Wang, Qian Wang, Lijun Wen, Jundan Xie, Lili Qin, Lili Wu, Huiying Qiu & Jiannong Cen Jiangsu Institute of Hematology, Key Laboratory of Thrombosis and Hemostasis of Ministry of Health, the First Affiliated Hospital of Soochow University, Suzhou, P. R. China
SET binding protein 1 (SETBP1), consisting of 1596 amino acids with a molecular weight of 175 kDa, localizes predominantly in the nucleus, and is encoded by SETBP1 in chromosome 18q21.1 [1]. The protein contains a SETbinding region and a SKI homology region, which is highly conserved with unknown biological function [2]. SETBP1 is a binding partner for the SET nuclear oncoprotein, and is involved in apoptosis, transcription and nucleosome assembly [3]. Whole exome sequencing has identified germline SETBP1 alterations affecting amino-acid residues between 858 and 871 in patients with Schinzel–Giedion syndrome (SGS), characterized by skeletal malformations, mental retardation and developmental delay [4]. SETBP1 mutations have been identified in various myeloid malignancies with variable frequencies: 2.2% in myelodysplastic syndromes (MDS), 2.5% in primary myelofibrosis (PMF), 9% in MDS/myeloproliferative neoplasm overlap (MDS/MPN), 4% in MPN, 24% in atypical chronic myeloid leukemia (aCML), 17% in secondary acute myeloid leukemia (sAML) and 15% in chronic myelomonocytic leukemia (CMML) [3,5,6]. Somatic mutation of SETBP1 in aCML was associated with a worse prognosis and a higher white blood cell count [1], while mutations in sAML and CMML were significantly correlated with advanced age and monosomy 7/deletion 7q [⫺7/del(7q)], constituting poor prognostic factors. In addition, two out of 27 patients with CML in blast crisis (CML-BC) carried SETBP1 mutations [7]. This evidence indicates that somatic mutations of SETBP1 might be involved in leukemic evolution, and might be a novel marker in myeloid malignancies [1,7]. However, the prevalence of SETBP1 mutations in lymphoid malignancies remains unknown. In the present study, we aimed to investigate the frequency of SETBP1 mutations in acute lymphoblastic leukemia (ALL) and mixed phenotype
acute leukemia (MPAL) and assess the occurrence of SETBP1 mutations in Chinese patients with CML in BC. A total of 253 adult patients diagnosed with hematologic malignancies at Jiangsu Institute of Hematology from January 2001 to December 2011 were retrospectively analyzed in the present study. This group consisted of 110 patients with B-ALL, 41 patients with T-ALL, 54 patients with CML-BC and 48 patients with MPAL. The median age was 43 years (19–63 years), and the cohort was all Chinese with a majority of males (54.2%). The main characteristics of patients in this study are summarized in Table I. The present study was approved by the Ethics Committee of the First Affiliated Hospital of Soochow University following the Declaration of Helsinki. Genomic DNA was prepared as previously described [8]. Briefly, DNA was extracted either from the purified fraction of mononuclear cells after Ficoll density centrifugation or methanol/acetic acid-fixed cells prepared for cytogenetic analysis using a Purelink™ Genomic DNA kit (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Polymerase chain reaction (PCR) amplification and Sanger sequencing were applied for mutation screening. Forward primer 5′CAAATCTCCAGCCCATCAG3′ and reverse primer 5′CGTGGTAGAAGGTGTAACTC3′ were used to generate sequences for amino-acid region 807–975. PCR products were sequenced on both strands using an ABI 3730 XL DNA Analyzer (Applied Biosystems, Foster City, CA). However, in this study, no somatic mutation was identified in 110 patients with B-ALL, 41 with T-ALL and 48 with MPAL based on Sanger sequencing analysis. In addition, although we investigated more patients with CML-BC than in a previous study, there was no SETBP1 mutation in 54 patients with CML-BC, which was not consistent with the previous report [7].
∗M.C. and H.Y. contributed equally to this manuscript. Correspondence: Dr. Jiannong Cen or Dr. Huiying Qiu, Jiangsu Institute of Hematology, Key Laboratory of Thrombosis and Hemostasis of Ministry of Health, the First Affiliated Hospital of Soochow University, 188 Shizi Street, Suzhou 215006, P. R. China. Tel: 086-0512-67780410. Fax: 0086-512-65113556. E-mail: [email protected] or Tel: 086-0512-67780322. E-mail: [email protected] Received 22 October 2013; revised 26 November 2013; accepted 30 November 2013
2209
2210
M. Chen et al.
Table I. Clinical characteristics of patients with ALL, MPAL and CML-BC. Characteristic Total Age, years, median (range) Sex Male Female B-ALL Age, years, median (range) Sex Male Female T-ALL Age, years, median (range) Sex Male Female CML-BC Age, years, median (range) Sex Male Female Blast cells in BM, % (range) Blast crisis Myeloid Lymphoid Myeloid/lymphoid MPAL Age, years, median (range) Sex Male Female
Number
Percentage
n ⫽ 253 43 (19–63) 137 116 n ⫽ 110 40 (19–57)
54.2% 45.8%
53 57 n ⫽ 41 39 (21–56)
48.2% 51.8%
19 22 n ⫽ 54 46 (27–58)
46.3% 53.7%
36 18 46.7 (27–86)
66.7% 33.3%
42 10 2 n ⫽ 48 43 (22–63)
77.8% 18.5% 3.7%
29 19
60.4% 39.6%
ALL, acute lymphoblastic leukemia; CML-BC, chronic myeloid leukemia in blast crisis; BM, bone marrow; MPAL, mixed phenotype acute leukemia.
In summary, we demonstrated that somatic mutation of SETBP1 might have only rare occurrence in ALL and MPAL, which suggested that SETBP1 mutation might not be involved in the leukemogenisis of ALL. Furthermore, the prevalence
of SETBP1 mutation in patients with CML-BC should be investigated in a large population or assessed using nextgeneration deep sequencing.
Potential conflict of interest: Disclosure forms provided by the authors are available with the full text of this article at www.informahealthcare.com/lal.
References [1] Piazza R, Valletta S, Winkelmann N, et al. Recurrent SETBP1 mutations in atypical chronic myeloid leukemia. Nat Genet 2013;45: 18–24. [2] Thol F, Suchanek KJ, Koenecke C, et al. SETBP1 mutation analysis in 944 patients with MDS and AML. Leukemia 2013;27: 2072–2075. [3] Laborde RR, Patnaik MM, Lasho TL, et al. SETBP1 mutations in 415 patients with primary myelofibrosis or chronic myelomonocytic leukemia: independent prognostic impact in CMML. Leukemia 2013;27:2100–2102. [4] Hoischen A , van Bon BW, Gilissen C, et al. De novo mutations of SETBP1 cause Schinzel-Giedion syndrome. Nat Genet 2010;42: 483–485. [5] Damm F, Itzykson R, Kosmider O, et al. SETBP1 mutations in 658 patients with myelodysplastic syndromes, chronic myelomonocytic leukemia and secondary acute myeloid leukemias. Leukemia 2013;27:1401–1403. [6] Meggendorfer M, Bacher U, Alpermann T, et al. SETBP1 mutations occur in 9% of MDS/MPN and in 4% of MPN cases and are strongly associated with atypical CML, monosomy 7, isochromosome i(17)(q10), ASXL1 and CBL mutations. Leukemia 2013;27: 1852–1860. [7] Makishima H, Yoshida K , Nguyen N, et al. Somatic SETBP1 mutations in myeloid malignancies. Nat Genet 2013;45: 942–946. [8] Wang Q, Qiu H, Jiang H, et al. Mutations of PHF6 are associated with mutations of NOTCH1, JAK1 and rearrangement of SET-NUP214 in T-cell acute lymphoblastic leukemia. Haematologica 2011;96: 1808–1814.
Copyright of Leukemia & Lymphoma is the property of Taylor & Francis Ltd and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
