Research Article J Mol Microbiol Biotechnol 2014;24:262–269 DOI: 10.1159/000365890
Published online: September 26, 2014
Rational Design of K173A Substitution Enhances Thermostability Coupled with Catalytic Activity of Enterobacter sp. Bn12 Lipase Parisa Farrokh a, b Bagher Yakhchali a Ali Asghar Karkhane a
a
Industrial and Environmental Biotechnology Department, National Institute of Genetic Engineering and Biotechnology (NIGEB) and b Department of Genetics, School of Biological Science, Tarbiat Modares University, Tehran, Iran
Key Words ELBn12 lipase · Thermostability · Rational design · Homology modeling
Abstract ELBn12 is a lipase isolated from Enterobacter sp. Bn12 with potential application in biotechnology. Homology modeling and rational design were applied to improve thermal stability of the lipase. K173A substitution introduced an AXXXA motif on the lipase model and it may have role in dimerization and thermostability of the protein. Site-directed mutagenesis was performed to construct the lipase variant. The mutated lipase was expressed in Escherichia coli pLysS and partially purified. Thermostability of the mutated lipase after 1 h of incubation at 70 ° C was twice that of wild-type lipase under the same conditions. Catalytic activity of the variant was about 1.5-fold towards tricaprylin at 60 ° C and pH 8.0; moreover, the lipase variant preserved its stability within the pH range of 7.0–11.0. Substitution of superficial hydrophilic Lys with hydrophobic Ala residue increased stability of the mutated lipase in the presence of nonionic surfactants, but this substitution caused lower stability towards polar solvents. Analysis of circular dichroism spectroscopy showed that the K173A mutation altered the secondary structure of the lipase into a more helical one. In conclusion, results of this study demonstrate the pos
© 2014 S. Karger AG, Basel 1464–1801/14/0244–0262$39.50/0 E-Mail [email protected] www.karger.com/mmb
itive role of generation of a stabilizing protein motif through rational protein engineering that improves the enzyme characteristics. © 2014 S. Karger AG, Basel
Introduction
Lipases are hydrolytic enzymes that have received special attention in recent years [Arpigny and Jaeger, 1999]. Lipases of microbial origin have widespread biotechnological applications due to their diversified catalytic properties [Hasan et al., 2006]. Among the various lipases identified from microorganisms, those that undergo catalytic reactions at high temperature are the most remarkable. Generally, the thermostable enzymes are more advantageous in industrial application than the mesophilic ones due to higher resistance to chemical denaturants and higher reaction temperature that result in increased substrate solubility, higher rate of reaction and less risk of microbial contamination [Liao et al., 1986; Vieille and Zeikus, 2001]. Thermostable lipases are also used in manufacturing detergent and leather and in organic synthesis [Hasan et al., 2006]. Recently, several approaches to protein engineering have been used to improve catalytic properties of various Ali Asghar Karkhane Department of Industrial and Environmental Biotechnology National Institute of Genetic Engineering and Biotechnology (NIGEB) P.O. Box 14965/161, Tehran (Iran) E-Mail karkhane @ nigeb.ac.ir
lipases [Hosseini et al., 2012; Khurana et al., 2011; Sharma et al., 2014]. In particular, considerable efforts have been devoted to the development of thermostable lipases [Khurana et al., 2011; Kolling et al., 2010; Shih and Pan, 2011; Wahab et al., 2012]. Previous research has determined that increasing hydrophobicity in the core of a protein [Wahab et al., 2012], enhancing hydrogen binding and salt bridge [Khurana et al., 2011; Sharma et al., 2014], reducing the number of thermolabile residues [Chakravorty et al., 2011] and the presence of some stabilizing protein motifs [Kleiger et al., 2002] have a meaningful outcome on the thermostability of the proteins. Wahab et al. [2012] showed that substitution of Glu114 by Leu in the core of Geobacillus zalihae lipase increased optimal temperature of the mutant. Furthermore, a variant of the Bacillus lipase harboring a mutation of I56T on the surface of the protein showed that it enhanced both activity and thermostability of the lipase [Khurana et al., 2011]. However, success of the protein-engineering approaches was not absolute in all studies. Shih and Pan [2011] indicated that some thermostable mutants of r03Lip from Geobacillus sp. NTU 03 had reduced specific activity. Similarly, a T103G mutation in Candida antarctica B lipase increased thermal stability of the lipase and reduced its specific activity [Patkar et al., 1998]. ELBn12 lipase, previously cloned and characterized from Enterobacter sp. Bn12, is an alkaline thermotolerant lipase [Farrokh et al., in press]. In spite of noticeable properties of the lipase, such as notable specific activity, high stability in the presence of organic solvents and nonionic detergents, it shows low thermostability that may limit its potential application [Farrokh et al., in press]. In this study, a three-dimensional structure of the wild-type (WT) ELBn12 lipase was predicted by homology modeling and used for rational protein engineering. To construct a variant with higher thermal stability, Lys173 was substituted with Ala in the predicted model to generate an AXXXA motif in a superficial helix of the lipase. Here, site-directed mutagenesis was applied to introduce a K173A mutation into the ELBn12 lipase, after which expression and purification of the recombinant mutant were performed and its characteristics compared with the WT lipase.
Results and Discussion
Homology Modeling and Structure Validation Rational protein-engineering approaches require a thorough understanding of protein structure and funcRational Design of ELBn12 Lipase
tion [Houde et al., 2004]. As the 3D structure of ELBn12 lipase is still unknown, homology modeling was used to generate a computational model. The 3D model of ELBn12 lipase was generated from PDB structures of 4GW3 [Koman and Bowie, 2012] and 1EX9 [Nardini et al., 2000] with 53 and 46% amino acid identity, respectively. Structural verification of the model was determined through various analytical servers. A Ramachandran plot was done for the model and revealed that 89.5% of the residues were in the favored region, 9.3% in the additionally allowed region and 0.8% in the generously allowed region, but only 0.4% (1 residue; Leu266) was in the disallowed region. The overall quality factor of the modeled structure predicted by ERRAT was 89.324. Additionally, ProSA and QMEAN scores for the model were –8.41 and 0.718 (Z-score = –0.58), respectively. All of the results presented here indicate that the model has appropriate quality for application in rational protein engineering. The quality of the mutated lipase model (K173A) was also determined as satisfactory and scores were not significantly different from those of the ELBn12 model (data not shown). The generated models represent the canonical α/β hydrolase fold observed in the lipases, and the position of the Lys173 selected for substitution with Ala was also demonstrated in the superimposed structures of both the WT and mutated lipase models (fig. 1). Effect of Substitution on Protein Function and 3D Structure Primary in silico studies have shown that K173A substitution might be an appropriate candidate to improve thermal stability of the ELBn12 lipase. The PROVEAN score (–1.757) indicated that the K173A mutation had a neutral effect on the lipase function. Superimposition of the WT and mutated lipases exhibited a root mean square deviation value of 0.12 Å, indicating high structural similarity between the models. Cloning, Expression and Purification Overlap extension PCR was applied to introduce K173A mutation into the ELBn12 lipase gene [Farrokh et al., in press]. The amplicons of expected size (532 and 380 bp) from the first and second PCRs were used to synthesize a full-length mutated gene (892 bp). Sequencing of the recombinant pET-26b(+) containing the variant lipase gene (pYKF-K173A) confirmed presence of the mutation. After gene expression in E. coli BL21 (DE3) pLysS, J Mol Microbiol Biotechnol 2014;24:262–269 DOI: 10.1159/000365890
263
1
Color version available online
Color version available online
M
2
35 kDa 25 kDa
15 kDa
the purified lipase showed the expected band on SDSPAGE with a molecular mass of approximately 30 kDa (fig. 2). Circular Dichroism Spectroscopy The protein secondary structure changes induced by mutation were analyzed by far-UV circular dichroism (CD) spectroscopy. Figure 3 shows the far-UV spectra of the WT and mutated lipases. The difference in the intensity of the CD spectra indicated that the K173A mutation changed the lipase’s secondary structure. The helical content of the lipase was increased from 9.0 to 17.5% through this mutation. Substitution of Lys with a more favorable helix-forming amino acid (Ala) [Malkov et al., 2008] via preferable helical interactions could be the reason for this structural conformation [Viguera et al., 1996].
15,000
WT K173A
10,000 5,000 0 195
205
215
225
235
245
Color version available online
mutant lipases (dark). The positions of the Lys173 and Ala173 are indicated on a superficial α-helix structure.
Fig. 2. SDS-PAGE analysis of the mutant lipase (K173A). Lane 1: crude supernatant of induced E. coli harboring pYKF-K173A; lane 2: the purified mutant lipase; M: protein molecular weight markers (Fermentas).
Molar ellipticity (deg. cm2 dmol–1)
Fig. 1. Cartoon model of superimposed WT (bright) and K173A
255
–5,000 –10,000 –15,000
Wavelength (nm)
Fig. 3. CD spectra of the WT and variant lipases in the far-UV
spectral region (195–260 nm).
Biochemical Characteristics Substrate specificity of the lipases is demonstrated in figure 4. WT and variant lipases showed the highest activity (100%) against tricaprylin (C8) and tributyrin (C4), respectively. Neither the Ala-substituted variant nor the WT exhibit any specificity for long- or short-chain triglycerides. 264
J Mol Microbiol Biotechnol 2014;24:262–269 DOI: 10.1159/000365890
The optimum pH of the mutated lipase was 8.0 under test conditions and the value was the same in the WT, and most of the bacterial lipases catalyzing reactions took place in alkaline pH [Gupta et al., 2004]. Stability analysis of the lipases at various pH levels revealed that Farrokh/Yakhchali/Karkhane
WT K173A
100 Relative activity (%)
Color version available online
120
80 60 40 20 0
C4
Fig. 4. Relative activity of the lipases toward
C6
C8
Relative activity (%)
100 80 60 40 K173A WT
20 3
4
5
6
7
8
9
C12
C14
C16
C18
10
11
12
Color version available online
120
9,000 8,000 Specific activity (U/mg)
Color version available online
various triacylglycerols over 1 h. The experiments were carried out in triplicate.
0
C10
Chain length of triacylglycerol
7,000 6,000 5,000 4,000 3,000 2,000
K173A WT
1,000 0
13
pH
20
30
40
50
60
70
80
Temperature (ºC)
Fig. 5. Effect of pH on the WT and mutant lipases stability over 1 h.
Fig. 6. Effect of temperature on the specific activity of the WT
The results are the average of the triplicate experiments and the highest activity is taken as 100%.
and mutant lipases. The experiments were carried out in triplicate.
WT lipase maintained its stability within the pH range of 7.0–10.0. However, the mutant lipase exhibited more pH stability and its activity did not show significant change (p < 0.05) over the pH range of 7.0–11.0 (fig. 5). Furthermore, figure 5 illustrates more stability of the variant at acidic pH. The main challenge remains that of predicting the effect of a single amino acid substitution on pH stability of the protein [Kolling et al., 2010]. Here, the K173A mutation increased the range of stability of the lipase variant in alkaline conditions. This finding can be explained by the experience of Palmer et al. [2008], who reported that deprotonation of Tyr, Lys and Arg residues at alkaline pH
destabilized streptococcal protein G. Moreover, replacement of Ala, which has a high preference for an α-helix structure [Malkov et al., 2008], may have a stabilizing effect on the protein and increase its stability at acidic pH values [Liu et al., 2012]. The effect of temperature on lipase activity demonstrated that optimal temperature activity of the mutant was 50 ° C compared to that of the WT lipase (60 ° C; fig. 6). Activity of the WT lipase reduced significantly (p < 0.05) after incubation at different temperatures (fig. 7). Whereas ELBn12 lipase only had one cysteine residue, this low level of thermostability may be due to the lack of a disulfide bridge, which is common in the
Rational Design of ELBn12 Lipase
J Mol Microbiol Biotechnol 2014;24:262–269 DOI: 10.1159/000365890
265
60 40 20
K173A WT
0 0
20
a
40
100 Relative activity (%)
80
Relative activity (%)
Relative activity (%)
120
100
100
80 60 40 20 0 20
b
Time (min)
80 60 40 20 0
0
60
Color version available online
120
120
40
60
0
c
Time (min)
20
40
60
Time (min)
Fig. 7. Thermostability profile of the WT and variant lipases at 50 ° C (a), 60 ° C (b) and 70 ° C (c). The assays were performed in triplicate.
subfamily I.1 of bacterial lipases [Arpigny and Jaeger, 1999]. Thermostability of the variant (in all tested temperatures) was significantly higher than in the WT lipase (p < 0.05; fig. 7). After incubation for 1 h at 50 ° C, the K173A mutant retained 100% of its original activity (fig. 7a). Residual activity of the variant after 1 h of preincubation at 60 ° C and 70 ° C, showed slight decreases of 92.23 and 91.38% respectively, compared to the initial activity (100%; fig. 7b, c). The significant increment of thermostability in the mutant lipase can be conceivably explained by the role of the AXXXA motif in protein dimerization and the possibility of hydrogen bonds between superficial helices of homodimer lipase containing AXXXA motifs [Kleiger et al., 2002]. The K173A mutation significantly increased specific activity of the lipase (p < 0.05) to 7,911/0 ± 124.62 U/mg towards tricaprylin at 60 ° C and pH 8.0, while the WT lipase had specific activity of 5,106/7 ± 775.97 U/mg. Results of protein engineering on thermostability and catalytic activity were different for the various tested lipases. In some cases, simultaneous improvement of thermostability and enzyme activity were obtained [Khurana et al., 2011; Kolling et al., 2010], while findings to the contrary have been reported in other studies [Patkar et al., 1998; Sharma et al., 2014]. Here, substitution of structural Lys173 with Ala increased both activity and thermostability of the lipase variant. These results support the concept that activity and thermostability could be independent properties of enzymes [Khurana et al., 2011].
266
J Mol Microbiol Biotechnol 2014;24:262–269 DOI: 10.1159/000365890
Effect of Organic Solvents and Surfactants on Lipase Activity Figure 8a illustrates the effect of different organic solvents on lipase activity. The residual activity of the WT lipase increased significantly (p < 0.05) only in the presence of acetone and glycerol. Enhanced lipase activity by organic solvents can be due to disaggregation of the lipase or structural transformation induced by the process [Ahmed et al., 2010]. The K173A lipase variant also displayed great stability at 50% (v/v) concentration of the organic solvents. However, in comparison to WT lipase, it showed slightly lower stability with most of the polar solvents (ethanol, acetone, glycerol and 2-propanol). Here, substitution of hydrophilic residue (Lys173) with a hydrophobic one (Ala) is in the solvent-accessible surface of the lipase. Adverse interactions between hydrophobic residue and polar solvents could be responsible for the lower enzyme stability [Acharya et al., 2004; Khurana et al., 2011]. Evaluation of lipase activity in the presence of the various tested surfactants is demonstrated in figure 8b. The effect of surfactants on the activity of lipases is significantly related to their concentration in the reaction [Helistö and Korpela, 1998]. Various concentrations of surfactants were investigated on the activity of different lipases [Glogauer et al., 2011; Helistö and Korpela, 1998], but 1% (w/v) is a usual concentration applied in various studies [Chen et al., 2011; Meilleur et al., 2009]. The influence of the studied surfactants on lipase activity was similar to that of most of the other lipases [Khoo and Ibrahim, 2009; Wahab et al., 2012]. The stimulatory effect of the nonionic surfactants and inhibitory effect of the ionic Farrokh/Yakhchali/Karkhane
WT K173A
180 Relative activity (%)
160 140 120
Color version available online
200
100 80 60 40 20 0
Control
Ethanol
Methanol Acetone
a
Glycerol 2-propanol n-hexane Chloroform
Organic solvent 180 160
Relative activity (%)
140 120 100 80 60 40 20 0
Fig. 8. Effect of different organic solvents (a) and surfactants (b) on WT and mutant
lipase activity. All of the assays were performed in triplicate.
Control
b
ones on the K173A mutant was similar to the WT. However, the relative activity of the mutant enhanced significantly (p < 0.05) in the 1% (w/v) nonionic surfactants (Tween 40, 60, 80 and Triton X-100). There are two possibilities that may account for the effect of nonionic surfactants on the mutated lipase: the outcome of amino acid substitution on the superficial characteristics of the lipase, or the different effect of surfactant on conformation of the mutant lipase. In summary, the results of the current study show that concurrent enhancement of protein stability and catalytic activity will be achievable if appropriate amino acids are selected for substitution in rational protein engineering methods. The K173A mutant could be an advantageous alternative for industrial applications and future in silico and experimental studies to improve other characteristics. Rational Design of ELBn12 Lipase
Tween 40
Tween 60
Tween 80 Triton X-100
SDS
CTAB
Surfactant
Experimental Procedures Bacterial Strains, Plasmids and Chemicals The recombinant plasmid pYKF, from previous work [Farrokh et al., in press], was used for site-directed mutagenesis of the ELBn12 gene. pTZ57R/T (Fermentas, Lithuania) and Escherichia coli Top10 (Invitrogen, USA) were also used for molecular cloning and pET-26b(+) (Novagen, USA) and E. coli BL21 (DE3) pLysS were utilized for gene expression. Various triacylglycerol substrates (C4–C18) were purchased from the Sigma Chemical Company (Sigma-Aldrich, Germany). Homology Modeling and Structural Evaluation Protein sequences with the closest identity to the ELBn12 lipase (Accession No. AFU92748) were selected by a BLASTP search (http://www.ncbi.nlm.nih.gov) against the PDB database. Multiple sequence alignment of the target and templates was made by ClustalW [Larkin et al., 2007] and used for homology modeling of the lipase using the MODELLER 9v12 program [Eswar et al., 2006]. Of the 100 models generated for the lipase by
J Mol Microbiol Biotechnol 2014;24:262–269 DOI: 10.1159/000365890
267
Table 1. Primer pairs used in site-directed mutagenesis Primer Name
Sequence (5′–3′)
Restriction site or mutated nucleotide
YKF-1 YKF-2 K173A-1 K173A-2
ATCATATGTCTACATCCCTGAAGTAC TAGAGCTCTTACAGTCCCTTCGCTTGC GGGTACTTCGCGTTAAAGGC GCCTTTAACGCGAAGTACCC
NdeI SacI – –
Bold indicates the position of the mutation.
MODELLER, the model with the lowest probability density function value was selected for further study. Three loop regions (Met1-Pro8, Gly23-Phe28 and Ile203-Gln210) in the model were further optimized using the loop refinement command in MODELLER 9v12. The quality of the final model was checked using PROCHECK [Laskowski et al., 1993], ERRAT [Colovos and Yeates, 1993], ProSA [Wiederstein and Sippl, 2007] and QMEAN [Benkert et al., 2008]. Structural modeling of the mutated lipase and a structural validation analysis were also made in the same way as that of the WT lipase. VMD version 1.8.7 was used for visualization of the protein structures [Humphrey et al., 1996].
Circular Dichroism To study the effect of K173A substitution on the secondary structure of the enzyme, analysis of far-UV CD spectra was made. CD spectra were taken over the range of 195–260 nm with a JASCO J-715 spectropolarimeter (Japan) using a step size of 1.0 nm and scan speed of 100 nm/min. The purified WT and mutated lipases with a final concentration of 0.16 and 0.20 mg/ml in 50 mM TrisBase buffer (pH 8.0) were used for the CD experiments with a 0.1cm path cell at 25 ° C. The percent of α-helix was calculated using the formula [θ]222 = –30,300 ƒH – 2,340 [Chen et al., 1972].
Lipase Activity Assay All enzyme activities were assayed with a titrimetric pH-stat system (Titrando 842; Metrohm, Switzerland) and substrate preparation was done as described in detail previously [Farrokh et al., in press]. One unit of lipase activity was defined as the quantity of enzyme releasing 1 μmol of fatty acid per minute under conditions of the experiment. Substrate Specificity of Lipase Substrate chain length preference of the lipases was studied by using tributyrin (C4), tricaproin (C6), tricaprylin (C8), tricaprin (C10), trilaurin (C12), trimyristin (C14), tripalmitin (C16) and olive oil (C18) at 60 ° C and pH 8.0 in the pH-stat assay system.
Site-Directed Mutagenesis and Cloning The plasmid pYKF containing the WT ELBn12 gene [Farrokh et al., in press] was used as a template for site-directed mutagenesis by overlap extension PCR [Ho et al., 1989]. The first and second PCRs were carried out with YKF-1/K173A-1 and YKF-2/K173A-2 primer pairs (table 1). After purification, the PCR products were used for full-length amplification of the mutated gene with YKF-1 and YKF-2 primers (table 1). The final PCR product was ligated into pTZ57R/T and subsequently cloned into pET-26b(+) via NdeI and SacI restriction sites. The presence of mutation in the lipase gene was confirmed by DNA sequencing. Expression and Partial Purification Expression of the mutated lipase in E. coli BL21 (DE3) pLysS was carried out with 0.5 mM IPTG at 20 ° C, and crude lysate was extracted with a lysis buffer and ultrasonication as explained previously [Farrokh et al., in press]. After overnight dialysis of the crude extract against 50 mM Tris-HCl buffer (pH 5.4), partial purification was performed by DEAE-cellulose chromatography as previously described [Farrokh et al., in press]. Unbonded protein fractions were collected, and the quality of the purified lipase was checked on SDS-PAGE [Laemmli, 1970].
268
J Mol Microbiol Biotechnol 2014;24:262–269 DOI: 10.1159/000365890
Effect of pH and Temperature on Enzyme Activity and Stability Optimum pH of the lipases was determined at various pH values from 6.0 to 10.0 at 60 ° C. The effect of pH on stability of the lipases was analyzed over a pH range of 5.0–11.0 after incubation for 1 h at 30 ° C. The following buffers were used: 50 mM sodium acetate (pH 5.0), 50 mM sodium phosphate (pH 6.0–8.0) and 50 mM glycine-NaOH (pH 9.0–11.0). The optimum temperature for both lipases was assayed at different temperatures ranging from 30 to 70 ° C at intervals of 10 ° C using pH-stat titration at pH 8.0. The thermal stability of the enzymes was studied by incubating them at 50, 60 and 70 ° C for 1 h and the residual activity measured every 20 min. Tricaprylin was used as a substrate for all of the triplicate assays.
In Silico Mutational Analysis The PROVEAN (Protein Variation Effect Analyzer) tool, a sequence alignment-based algorithm, was used to predict the functional effect of amino acid substitution [Choi et al., 2012]. Homogeneity between structures of the WT and mutated lipases was also analyzed by the root mean square deviation value over all Cα backbones using the alignment tool of the VMD software.
Effect of Organic Solvents and Surfactants on Lipase Activity Lipase activity was determined after incubation with 50% (v/v) of various organic solvents such as ethanol, methanol, 2-propanol, glycerol, acetone, n-hexane and chloroform at 30 ° C for 1 h. The effect of surfactants (Tween 40, Tween 60, Tween 80, Triton X-100, SDS and CTAB) with final concentration of 1 % (w/v) on lipase activity was studied after the mixtures were incubated at 30 ° C for 1 h. Residual activity of the lipases was assayed in triplicate experiments at 60 ° C and pH 8.0 using tricaprylin.
Statistical Evaluation Statistical analysis of data was performed by factorial design using the Statistical Analysis System (Version 8.1; SAS Institute Inc., Cary, N.C., USA). In addition, means comparison was made using Duncan’s test (p < 0.05).
Acknowledgements We thank Dr. Dina Morshedi for her help in the analysis of the CD spectra.
Farrokh/Yakhchali/Karkhane
References Acharya P, Rajakumara E, Sankaranarayanan R, Rao NM: Structural basis of selection and thermostability of laboratory evolved Bacillus subtilis lipase. J Mol Biol 2004;341:1271–1281. Ahmed EH, Raghavendra T, Madamwar D: A thermostable alkaline lipase from a local isolate Bacillus subtilis EH 37: characterization, partial purification, and application in organic synthesis. Appl Biochem Biotechnol 2010; 160:2102–2113. Arpigny JL, Jaeger K: Bacterial lipolytic enzymes: classification and properties. Biochem J 1999; 343:177–183. Benkert P, Tosatto SC, Schomburg D: QMEAN: A comprehensive scoring function for model quality assessment. Proteins 2008; 71: 261– 277. Chakravorty D, Parameswaran S, Dubey VK, Patra S: In silico characterization of thermostable lipases. Extremophiles 2011;15:89–103. Chen YH, Yang JT, Martinez HM: Determination of the secondary structures of proteins by circular dichroism and optical rotatory dispersion. Biochem 1972;11:4120–4131. Chen R, Guo L, Dang H: Gene cloning, expression and characterization of a cold-adapted lipase from a psychrophilic deep-sea bacterium Psychrobacter sp. C18. World J Microbiol Biotechnol 2011;27:431–441. Choi Y, Sims GE, Murphy S, Miller JR, Chan AP: Predicting the functional effect of amino acid substitutions and indels. PLoS One 2012; 7:e46688. Colovos C, Yeates TO: Verification of protein structures: patterns of nonbonded atomic interactions. Protein Sci 1993;2:1511–1519. Eswar N, Webb B, Marti-Renom MA, Madhusudhan MS, Eramian D, Shen MY, Pieper U, Sali A: Comparative protein structure modeling with MODELLER. Curr Protoc Bioinformatics 2006;Chapt 5:Unit 5.6. Farrokh P, Yakhchali B, Karkhane AA: Cloning and characterization of newly isolated lipase from Enterobacter sp. Bn12. Braz J Microbiol, in press. Glogauer A, Martini VP, Faoro H, Couto GH, Müller-Santos M, Monteiro RA, Mitchell DA, Souza EM, Pedrosa F, Krieger N: Identification and characterization of a new true lipase isolated through metagenomic approach. Microb Cell Fact 2011;10:54. Gupta R, Gupta N, Rathi P: Bacterial lipases: an overview of production, purification and biochemical properties. Appl Microbiol Biotechnol 2004;64:763–781. Hasan F, Shah AA, Hameed A: Industrial applications of microbial lipases. Enzyme Microb Technol 2006;39:235–251.
Rational Design of ELBn12 Lipase
Helistö P, Korpela T: Effects of detergents on activity of microbial lipases as measured by the nitrophenyl alkanoate esters method. Enzyme Microb Technol 1998;23:113–117. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR: Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 1989;77:51–59. Hosseini M, Karkhane AA, Yakhchali B, Shamsara M, Aminzadeh S, Morshedi D, Haghbeen K, Torktaz I, Karimi E, Safari Z: In silico and experimental characterization of chimeric Bacillus thermocatenulatus lipase with the complete conserved pentapeptide of Candida rugosa lipase. Appl Biochem Biotechnol 2012; 169:773–785. Houde A, Kademi A, Leblanc D: Lipases and their industrial applications: an overview. Appl Biochem Biotechnol 2004;118:155–170. Humphrey W, Dalke A, Schulten K: VMD: visual molecular dynamics. J Mol Graph 1996; 14: 33–38. Khoo ML, Ibrahim CO: Lipase from thermoalkalophilic Pseudomonas species as an additive in potential laundry detergent formulations. Malays J Microbiol 2009;5:1–5. Khurana J, Singh R, Kaur J: Engineering of Bacillus lipase by directed evolution for enhanced thermal stability: effect of isoleucine to threonine mutation at protein surface. Mol Biol Rep 2011;38:2919–2926. Kleiger G, Grothe R, Mallick P, Eisenberg D: GXXXG and AXXXA: common α-helical interaction motifs in proteins, particularly in extremophiles. Biochemistry 2002; 41: 5990– 5997. Kolling DJ, Bertoldo JB, Brod FCA, Vernal J: Biochemical and structural characterization of two site-directed mutants of Staphylococcus xylosus lipase. Mol Biotechnol 2010;46:168–175. Koman TP, Bowie JU: Crystal structure of Proteus mirabilis lipase, a novel lipase from the Proteus/psychrophilic subfamily of lipase family I.1. PLoS One 2012;7:e52890. Laemmli UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680–685. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG: ClustalW and ClustalX version 2. Bioinformatics 2007; 23: 2947– 2948. Laskowski RA, MacArthur MW, Moss DS, Thornton JM: PROCHECK: a program to check the stereochemical quality of protein structures. J Appl Crystallography 1993;26:283–291. Liao H, McKenzie T, Hageman R: Isolation of a thermostable enzyme variant by cloning and selection in a thermophile. Proc Natl Acad Sci USA 1986;83:576–580.
Liu YH, Hu B, Xu YJ, Bo JX, Fan S, Wang JL, Lu FP: Improvement of the acid stability of Bacillus licheniformis alpha amylase by errorprone PCR. J Appl Microbiol 2012; 113: 541– 549. Malkov SN, Živković MV, Beljanski MV, Hall MB, Zarić SD: A reexamination of the propensities of amino acids towards a particular secondary structure: classification of amino acids based on their chemical structure. J Mol Model 2008;14:769–775. Meilleur C, Hupé JF, Juteau P, Shareck F: Isolation and characterization of a new alkali-thermostable lipase cloned from a metagenomic library. J Ind Microbiol Biotechnol 2009; 36: 853–861. Nardini M, Lang DA, Liebeton K, Jaeger K, Dijkstra BW: Crystal structure of Pseudomonas aeruginosa lipase in the open conformation. J Biol Chem 2000;275:31219–31225. Palmer B, Angus K, Taylor L, Warwicker J, Derrick JP: Design of stability at extreme alkaline pH in streptococcal protein G. J Biotechnol 2008;134:222–230. Patkar S, Vind J, Kelstrup E, Christensen MW, Svendsen A, Borch K, Kirk O: Effect of mutations in Candida antarctica B lipase. Chem Phys Lipids 1998;93:95–101. Sharma PK, Kumar R, Garg P, Kaur J: Insights into controlling role of substitution mutation, E315G on thermostability of a lipase cloned from metagenome of hot spring soil. 3 Biotechnol 2014;4:189–196. Shih T, Pan T: Substitution of Asp189 residue alters the activity and thermostability of Geobacillus sp. NTU 03 lipase. Biotechnol Lett 2011; 33:1841–1846. Vieille C, Zeikus GJ: Hyperthermophilic enzymes: sources, uses, and molecular mechanisms for thermostability. Microbiol Mol Biol Rev 2001;65:1–43. Viguera AR, Villegas V, Avilés FX, Serrano L: Favourable native-like helical local interactions can accelerate protein folding. Fold Des 1996; 2:23–33. Wahab RA, Basri M, Abdul Rahman MB, Abdul Rahman RN, Salleh AB, Chor LT: Engineering catalytic efficiency of thermophilic lipase from Geobacillus zalihae by hydrophobic residue mutation near the catalytic pocket. Adv Biosci Biotechnol 2012; 3: 158– 167. Wiederstein M, Sippl MJ: ProSA-web: interactive web service for the recognition of errors in three-dimensional structures of proteins. Nucleic Acids Res 2007;35:W407–W410.
J Mol Microbiol Biotechnol 2014;24:262–269 DOI: 10.1159/000365890
269
Copyright: S. Karger AG, Basel 2014. Reproduced with the permission of S. Karger AG, Basel. Further reproduction or distribution (electronic or otherwise) is prohibited without permission from the copyright holder.
Published online: September 26, 2014
Rational Design of K173A Substitution Enhances Thermostability Coupled with Catalytic Activity of Enterobacter sp. Bn12 Lipase Parisa Farrokh a, b Bagher Yakhchali a Ali Asghar Karkhane a
a
Industrial and Environmental Biotechnology Department, National Institute of Genetic Engineering and Biotechnology (NIGEB) and b Department of Genetics, School of Biological Science, Tarbiat Modares University, Tehran, Iran
Key Words ELBn12 lipase · Thermostability · Rational design · Homology modeling
Abstract ELBn12 is a lipase isolated from Enterobacter sp. Bn12 with potential application in biotechnology. Homology modeling and rational design were applied to improve thermal stability of the lipase. K173A substitution introduced an AXXXA motif on the lipase model and it may have role in dimerization and thermostability of the protein. Site-directed mutagenesis was performed to construct the lipase variant. The mutated lipase was expressed in Escherichia coli pLysS and partially purified. Thermostability of the mutated lipase after 1 h of incubation at 70 ° C was twice that of wild-type lipase under the same conditions. Catalytic activity of the variant was about 1.5-fold towards tricaprylin at 60 ° C and pH 8.0; moreover, the lipase variant preserved its stability within the pH range of 7.0–11.0. Substitution of superficial hydrophilic Lys with hydrophobic Ala residue increased stability of the mutated lipase in the presence of nonionic surfactants, but this substitution caused lower stability towards polar solvents. Analysis of circular dichroism spectroscopy showed that the K173A mutation altered the secondary structure of the lipase into a more helical one. In conclusion, results of this study demonstrate the pos
© 2014 S. Karger AG, Basel 1464–1801/14/0244–0262$39.50/0 E-Mail [email protected] www.karger.com/mmb
itive role of generation of a stabilizing protein motif through rational protein engineering that improves the enzyme characteristics. © 2014 S. Karger AG, Basel
Introduction
Lipases are hydrolytic enzymes that have received special attention in recent years [Arpigny and Jaeger, 1999]. Lipases of microbial origin have widespread biotechnological applications due to their diversified catalytic properties [Hasan et al., 2006]. Among the various lipases identified from microorganisms, those that undergo catalytic reactions at high temperature are the most remarkable. Generally, the thermostable enzymes are more advantageous in industrial application than the mesophilic ones due to higher resistance to chemical denaturants and higher reaction temperature that result in increased substrate solubility, higher rate of reaction and less risk of microbial contamination [Liao et al., 1986; Vieille and Zeikus, 2001]. Thermostable lipases are also used in manufacturing detergent and leather and in organic synthesis [Hasan et al., 2006]. Recently, several approaches to protein engineering have been used to improve catalytic properties of various Ali Asghar Karkhane Department of Industrial and Environmental Biotechnology National Institute of Genetic Engineering and Biotechnology (NIGEB) P.O. Box 14965/161, Tehran (Iran) E-Mail karkhane @ nigeb.ac.ir
lipases [Hosseini et al., 2012; Khurana et al., 2011; Sharma et al., 2014]. In particular, considerable efforts have been devoted to the development of thermostable lipases [Khurana et al., 2011; Kolling et al., 2010; Shih and Pan, 2011; Wahab et al., 2012]. Previous research has determined that increasing hydrophobicity in the core of a protein [Wahab et al., 2012], enhancing hydrogen binding and salt bridge [Khurana et al., 2011; Sharma et al., 2014], reducing the number of thermolabile residues [Chakravorty et al., 2011] and the presence of some stabilizing protein motifs [Kleiger et al., 2002] have a meaningful outcome on the thermostability of the proteins. Wahab et al. [2012] showed that substitution of Glu114 by Leu in the core of Geobacillus zalihae lipase increased optimal temperature of the mutant. Furthermore, a variant of the Bacillus lipase harboring a mutation of I56T on the surface of the protein showed that it enhanced both activity and thermostability of the lipase [Khurana et al., 2011]. However, success of the protein-engineering approaches was not absolute in all studies. Shih and Pan [2011] indicated that some thermostable mutants of r03Lip from Geobacillus sp. NTU 03 had reduced specific activity. Similarly, a T103G mutation in Candida antarctica B lipase increased thermal stability of the lipase and reduced its specific activity [Patkar et al., 1998]. ELBn12 lipase, previously cloned and characterized from Enterobacter sp. Bn12, is an alkaline thermotolerant lipase [Farrokh et al., in press]. In spite of noticeable properties of the lipase, such as notable specific activity, high stability in the presence of organic solvents and nonionic detergents, it shows low thermostability that may limit its potential application [Farrokh et al., in press]. In this study, a three-dimensional structure of the wild-type (WT) ELBn12 lipase was predicted by homology modeling and used for rational protein engineering. To construct a variant with higher thermal stability, Lys173 was substituted with Ala in the predicted model to generate an AXXXA motif in a superficial helix of the lipase. Here, site-directed mutagenesis was applied to introduce a K173A mutation into the ELBn12 lipase, after which expression and purification of the recombinant mutant were performed and its characteristics compared with the WT lipase.
Results and Discussion
Homology Modeling and Structure Validation Rational protein-engineering approaches require a thorough understanding of protein structure and funcRational Design of ELBn12 Lipase
tion [Houde et al., 2004]. As the 3D structure of ELBn12 lipase is still unknown, homology modeling was used to generate a computational model. The 3D model of ELBn12 lipase was generated from PDB structures of 4GW3 [Koman and Bowie, 2012] and 1EX9 [Nardini et al., 2000] with 53 and 46% amino acid identity, respectively. Structural verification of the model was determined through various analytical servers. A Ramachandran plot was done for the model and revealed that 89.5% of the residues were in the favored region, 9.3% in the additionally allowed region and 0.8% in the generously allowed region, but only 0.4% (1 residue; Leu266) was in the disallowed region. The overall quality factor of the modeled structure predicted by ERRAT was 89.324. Additionally, ProSA and QMEAN scores for the model were –8.41 and 0.718 (Z-score = –0.58), respectively. All of the results presented here indicate that the model has appropriate quality for application in rational protein engineering. The quality of the mutated lipase model (K173A) was also determined as satisfactory and scores were not significantly different from those of the ELBn12 model (data not shown). The generated models represent the canonical α/β hydrolase fold observed in the lipases, and the position of the Lys173 selected for substitution with Ala was also demonstrated in the superimposed structures of both the WT and mutated lipase models (fig. 1). Effect of Substitution on Protein Function and 3D Structure Primary in silico studies have shown that K173A substitution might be an appropriate candidate to improve thermal stability of the ELBn12 lipase. The PROVEAN score (–1.757) indicated that the K173A mutation had a neutral effect on the lipase function. Superimposition of the WT and mutated lipases exhibited a root mean square deviation value of 0.12 Å, indicating high structural similarity between the models. Cloning, Expression and Purification Overlap extension PCR was applied to introduce K173A mutation into the ELBn12 lipase gene [Farrokh et al., in press]. The amplicons of expected size (532 and 380 bp) from the first and second PCRs were used to synthesize a full-length mutated gene (892 bp). Sequencing of the recombinant pET-26b(+) containing the variant lipase gene (pYKF-K173A) confirmed presence of the mutation. After gene expression in E. coli BL21 (DE3) pLysS, J Mol Microbiol Biotechnol 2014;24:262–269 DOI: 10.1159/000365890
263
1
Color version available online
Color version available online
M
2
35 kDa 25 kDa
15 kDa
the purified lipase showed the expected band on SDSPAGE with a molecular mass of approximately 30 kDa (fig. 2). Circular Dichroism Spectroscopy The protein secondary structure changes induced by mutation were analyzed by far-UV circular dichroism (CD) spectroscopy. Figure 3 shows the far-UV spectra of the WT and mutated lipases. The difference in the intensity of the CD spectra indicated that the K173A mutation changed the lipase’s secondary structure. The helical content of the lipase was increased from 9.0 to 17.5% through this mutation. Substitution of Lys with a more favorable helix-forming amino acid (Ala) [Malkov et al., 2008] via preferable helical interactions could be the reason for this structural conformation [Viguera et al., 1996].
15,000
WT K173A
10,000 5,000 0 195
205
215
225
235
245
Color version available online
mutant lipases (dark). The positions of the Lys173 and Ala173 are indicated on a superficial α-helix structure.
Fig. 2. SDS-PAGE analysis of the mutant lipase (K173A). Lane 1: crude supernatant of induced E. coli harboring pYKF-K173A; lane 2: the purified mutant lipase; M: protein molecular weight markers (Fermentas).
Molar ellipticity (deg. cm2 dmol–1)
Fig. 1. Cartoon model of superimposed WT (bright) and K173A
255
–5,000 –10,000 –15,000
Wavelength (nm)
Fig. 3. CD spectra of the WT and variant lipases in the far-UV
spectral region (195–260 nm).
Biochemical Characteristics Substrate specificity of the lipases is demonstrated in figure 4. WT and variant lipases showed the highest activity (100%) against tricaprylin (C8) and tributyrin (C4), respectively. Neither the Ala-substituted variant nor the WT exhibit any specificity for long- or short-chain triglycerides. 264
J Mol Microbiol Biotechnol 2014;24:262–269 DOI: 10.1159/000365890
The optimum pH of the mutated lipase was 8.0 under test conditions and the value was the same in the WT, and most of the bacterial lipases catalyzing reactions took place in alkaline pH [Gupta et al., 2004]. Stability analysis of the lipases at various pH levels revealed that Farrokh/Yakhchali/Karkhane
WT K173A
100 Relative activity (%)
Color version available online
120
80 60 40 20 0
C4
Fig. 4. Relative activity of the lipases toward
C6
C8
Relative activity (%)
100 80 60 40 K173A WT
20 3
4
5
6
7
8
9
C12
C14
C16
C18
10
11
12
Color version available online
120
9,000 8,000 Specific activity (U/mg)
Color version available online
various triacylglycerols over 1 h. The experiments were carried out in triplicate.
0
C10
Chain length of triacylglycerol
7,000 6,000 5,000 4,000 3,000 2,000
K173A WT
1,000 0
13
pH
20
30
40
50
60
70
80
Temperature (ºC)
Fig. 5. Effect of pH on the WT and mutant lipases stability over 1 h.
Fig. 6. Effect of temperature on the specific activity of the WT
The results are the average of the triplicate experiments and the highest activity is taken as 100%.
and mutant lipases. The experiments were carried out in triplicate.
WT lipase maintained its stability within the pH range of 7.0–10.0. However, the mutant lipase exhibited more pH stability and its activity did not show significant change (p < 0.05) over the pH range of 7.0–11.0 (fig. 5). Furthermore, figure 5 illustrates more stability of the variant at acidic pH. The main challenge remains that of predicting the effect of a single amino acid substitution on pH stability of the protein [Kolling et al., 2010]. Here, the K173A mutation increased the range of stability of the lipase variant in alkaline conditions. This finding can be explained by the experience of Palmer et al. [2008], who reported that deprotonation of Tyr, Lys and Arg residues at alkaline pH
destabilized streptococcal protein G. Moreover, replacement of Ala, which has a high preference for an α-helix structure [Malkov et al., 2008], may have a stabilizing effect on the protein and increase its stability at acidic pH values [Liu et al., 2012]. The effect of temperature on lipase activity demonstrated that optimal temperature activity of the mutant was 50 ° C compared to that of the WT lipase (60 ° C; fig. 6). Activity of the WT lipase reduced significantly (p < 0.05) after incubation at different temperatures (fig. 7). Whereas ELBn12 lipase only had one cysteine residue, this low level of thermostability may be due to the lack of a disulfide bridge, which is common in the
Rational Design of ELBn12 Lipase
J Mol Microbiol Biotechnol 2014;24:262–269 DOI: 10.1159/000365890
265
60 40 20
K173A WT
0 0
20
a
40
100 Relative activity (%)
80
Relative activity (%)
Relative activity (%)
120
100
100
80 60 40 20 0 20
b
Time (min)
80 60 40 20 0
0
60
Color version available online
120
120
40
60
0
c
Time (min)
20
40
60
Time (min)
Fig. 7. Thermostability profile of the WT and variant lipases at 50 ° C (a), 60 ° C (b) and 70 ° C (c). The assays were performed in triplicate.
subfamily I.1 of bacterial lipases [Arpigny and Jaeger, 1999]. Thermostability of the variant (in all tested temperatures) was significantly higher than in the WT lipase (p < 0.05; fig. 7). After incubation for 1 h at 50 ° C, the K173A mutant retained 100% of its original activity (fig. 7a). Residual activity of the variant after 1 h of preincubation at 60 ° C and 70 ° C, showed slight decreases of 92.23 and 91.38% respectively, compared to the initial activity (100%; fig. 7b, c). The significant increment of thermostability in the mutant lipase can be conceivably explained by the role of the AXXXA motif in protein dimerization and the possibility of hydrogen bonds between superficial helices of homodimer lipase containing AXXXA motifs [Kleiger et al., 2002]. The K173A mutation significantly increased specific activity of the lipase (p < 0.05) to 7,911/0 ± 124.62 U/mg towards tricaprylin at 60 ° C and pH 8.0, while the WT lipase had specific activity of 5,106/7 ± 775.97 U/mg. Results of protein engineering on thermostability and catalytic activity were different for the various tested lipases. In some cases, simultaneous improvement of thermostability and enzyme activity were obtained [Khurana et al., 2011; Kolling et al., 2010], while findings to the contrary have been reported in other studies [Patkar et al., 1998; Sharma et al., 2014]. Here, substitution of structural Lys173 with Ala increased both activity and thermostability of the lipase variant. These results support the concept that activity and thermostability could be independent properties of enzymes [Khurana et al., 2011].
266
J Mol Microbiol Biotechnol 2014;24:262–269 DOI: 10.1159/000365890
Effect of Organic Solvents and Surfactants on Lipase Activity Figure 8a illustrates the effect of different organic solvents on lipase activity. The residual activity of the WT lipase increased significantly (p < 0.05) only in the presence of acetone and glycerol. Enhanced lipase activity by organic solvents can be due to disaggregation of the lipase or structural transformation induced by the process [Ahmed et al., 2010]. The K173A lipase variant also displayed great stability at 50% (v/v) concentration of the organic solvents. However, in comparison to WT lipase, it showed slightly lower stability with most of the polar solvents (ethanol, acetone, glycerol and 2-propanol). Here, substitution of hydrophilic residue (Lys173) with a hydrophobic one (Ala) is in the solvent-accessible surface of the lipase. Adverse interactions between hydrophobic residue and polar solvents could be responsible for the lower enzyme stability [Acharya et al., 2004; Khurana et al., 2011]. Evaluation of lipase activity in the presence of the various tested surfactants is demonstrated in figure 8b. The effect of surfactants on the activity of lipases is significantly related to their concentration in the reaction [Helistö and Korpela, 1998]. Various concentrations of surfactants were investigated on the activity of different lipases [Glogauer et al., 2011; Helistö and Korpela, 1998], but 1% (w/v) is a usual concentration applied in various studies [Chen et al., 2011; Meilleur et al., 2009]. The influence of the studied surfactants on lipase activity was similar to that of most of the other lipases [Khoo and Ibrahim, 2009; Wahab et al., 2012]. The stimulatory effect of the nonionic surfactants and inhibitory effect of the ionic Farrokh/Yakhchali/Karkhane
WT K173A
180 Relative activity (%)
160 140 120
Color version available online
200
100 80 60 40 20 0
Control
Ethanol
Methanol Acetone
a
Glycerol 2-propanol n-hexane Chloroform
Organic solvent 180 160
Relative activity (%)
140 120 100 80 60 40 20 0
Fig. 8. Effect of different organic solvents (a) and surfactants (b) on WT and mutant
lipase activity. All of the assays were performed in triplicate.
Control
b
ones on the K173A mutant was similar to the WT. However, the relative activity of the mutant enhanced significantly (p < 0.05) in the 1% (w/v) nonionic surfactants (Tween 40, 60, 80 and Triton X-100). There are two possibilities that may account for the effect of nonionic surfactants on the mutated lipase: the outcome of amino acid substitution on the superficial characteristics of the lipase, or the different effect of surfactant on conformation of the mutant lipase. In summary, the results of the current study show that concurrent enhancement of protein stability and catalytic activity will be achievable if appropriate amino acids are selected for substitution in rational protein engineering methods. The K173A mutant could be an advantageous alternative for industrial applications and future in silico and experimental studies to improve other characteristics. Rational Design of ELBn12 Lipase
Tween 40
Tween 60
Tween 80 Triton X-100
SDS
CTAB
Surfactant
Experimental Procedures Bacterial Strains, Plasmids and Chemicals The recombinant plasmid pYKF, from previous work [Farrokh et al., in press], was used for site-directed mutagenesis of the ELBn12 gene. pTZ57R/T (Fermentas, Lithuania) and Escherichia coli Top10 (Invitrogen, USA) were also used for molecular cloning and pET-26b(+) (Novagen, USA) and E. coli BL21 (DE3) pLysS were utilized for gene expression. Various triacylglycerol substrates (C4–C18) were purchased from the Sigma Chemical Company (Sigma-Aldrich, Germany). Homology Modeling and Structural Evaluation Protein sequences with the closest identity to the ELBn12 lipase (Accession No. AFU92748) were selected by a BLASTP search (http://www.ncbi.nlm.nih.gov) against the PDB database. Multiple sequence alignment of the target and templates was made by ClustalW [Larkin et al., 2007] and used for homology modeling of the lipase using the MODELLER 9v12 program [Eswar et al., 2006]. Of the 100 models generated for the lipase by
J Mol Microbiol Biotechnol 2014;24:262–269 DOI: 10.1159/000365890
267
Table 1. Primer pairs used in site-directed mutagenesis Primer Name
Sequence (5′–3′)
Restriction site or mutated nucleotide
YKF-1 YKF-2 K173A-1 K173A-2
ATCATATGTCTACATCCCTGAAGTAC TAGAGCTCTTACAGTCCCTTCGCTTGC GGGTACTTCGCGTTAAAGGC GCCTTTAACGCGAAGTACCC
NdeI SacI – –
Bold indicates the position of the mutation.
MODELLER, the model with the lowest probability density function value was selected for further study. Three loop regions (Met1-Pro8, Gly23-Phe28 and Ile203-Gln210) in the model were further optimized using the loop refinement command in MODELLER 9v12. The quality of the final model was checked using PROCHECK [Laskowski et al., 1993], ERRAT [Colovos and Yeates, 1993], ProSA [Wiederstein and Sippl, 2007] and QMEAN [Benkert et al., 2008]. Structural modeling of the mutated lipase and a structural validation analysis were also made in the same way as that of the WT lipase. VMD version 1.8.7 was used for visualization of the protein structures [Humphrey et al., 1996].
Circular Dichroism To study the effect of K173A substitution on the secondary structure of the enzyme, analysis of far-UV CD spectra was made. CD spectra were taken over the range of 195–260 nm with a JASCO J-715 spectropolarimeter (Japan) using a step size of 1.0 nm and scan speed of 100 nm/min. The purified WT and mutated lipases with a final concentration of 0.16 and 0.20 mg/ml in 50 mM TrisBase buffer (pH 8.0) were used for the CD experiments with a 0.1cm path cell at 25 ° C. The percent of α-helix was calculated using the formula [θ]222 = –30,300 ƒH – 2,340 [Chen et al., 1972].
Lipase Activity Assay All enzyme activities were assayed with a titrimetric pH-stat system (Titrando 842; Metrohm, Switzerland) and substrate preparation was done as described in detail previously [Farrokh et al., in press]. One unit of lipase activity was defined as the quantity of enzyme releasing 1 μmol of fatty acid per minute under conditions of the experiment. Substrate Specificity of Lipase Substrate chain length preference of the lipases was studied by using tributyrin (C4), tricaproin (C6), tricaprylin (C8), tricaprin (C10), trilaurin (C12), trimyristin (C14), tripalmitin (C16) and olive oil (C18) at 60 ° C and pH 8.0 in the pH-stat assay system.
Site-Directed Mutagenesis and Cloning The plasmid pYKF containing the WT ELBn12 gene [Farrokh et al., in press] was used as a template for site-directed mutagenesis by overlap extension PCR [Ho et al., 1989]. The first and second PCRs were carried out with YKF-1/K173A-1 and YKF-2/K173A-2 primer pairs (table 1). After purification, the PCR products were used for full-length amplification of the mutated gene with YKF-1 and YKF-2 primers (table 1). The final PCR product was ligated into pTZ57R/T and subsequently cloned into pET-26b(+) via NdeI and SacI restriction sites. The presence of mutation in the lipase gene was confirmed by DNA sequencing. Expression and Partial Purification Expression of the mutated lipase in E. coli BL21 (DE3) pLysS was carried out with 0.5 mM IPTG at 20 ° C, and crude lysate was extracted with a lysis buffer and ultrasonication as explained previously [Farrokh et al., in press]. After overnight dialysis of the crude extract against 50 mM Tris-HCl buffer (pH 5.4), partial purification was performed by DEAE-cellulose chromatography as previously described [Farrokh et al., in press]. Unbonded protein fractions were collected, and the quality of the purified lipase was checked on SDS-PAGE [Laemmli, 1970].
268
J Mol Microbiol Biotechnol 2014;24:262–269 DOI: 10.1159/000365890
Effect of pH and Temperature on Enzyme Activity and Stability Optimum pH of the lipases was determined at various pH values from 6.0 to 10.0 at 60 ° C. The effect of pH on stability of the lipases was analyzed over a pH range of 5.0–11.0 after incubation for 1 h at 30 ° C. The following buffers were used: 50 mM sodium acetate (pH 5.0), 50 mM sodium phosphate (pH 6.0–8.0) and 50 mM glycine-NaOH (pH 9.0–11.0). The optimum temperature for both lipases was assayed at different temperatures ranging from 30 to 70 ° C at intervals of 10 ° C using pH-stat titration at pH 8.0. The thermal stability of the enzymes was studied by incubating them at 50, 60 and 70 ° C for 1 h and the residual activity measured every 20 min. Tricaprylin was used as a substrate for all of the triplicate assays.
In Silico Mutational Analysis The PROVEAN (Protein Variation Effect Analyzer) tool, a sequence alignment-based algorithm, was used to predict the functional effect of amino acid substitution [Choi et al., 2012]. Homogeneity between structures of the WT and mutated lipases was also analyzed by the root mean square deviation value over all Cα backbones using the alignment tool of the VMD software.
Effect of Organic Solvents and Surfactants on Lipase Activity Lipase activity was determined after incubation with 50% (v/v) of various organic solvents such as ethanol, methanol, 2-propanol, glycerol, acetone, n-hexane and chloroform at 30 ° C for 1 h. The effect of surfactants (Tween 40, Tween 60, Tween 80, Triton X-100, SDS and CTAB) with final concentration of 1 % (w/v) on lipase activity was studied after the mixtures were incubated at 30 ° C for 1 h. Residual activity of the lipases was assayed in triplicate experiments at 60 ° C and pH 8.0 using tricaprylin.
Statistical Evaluation Statistical analysis of data was performed by factorial design using the Statistical Analysis System (Version 8.1; SAS Institute Inc., Cary, N.C., USA). In addition, means comparison was made using Duncan’s test (p < 0.05).
Acknowledgements We thank Dr. Dina Morshedi for her help in the analysis of the CD spectra.
Farrokh/Yakhchali/Karkhane
References Acharya P, Rajakumara E, Sankaranarayanan R, Rao NM: Structural basis of selection and thermostability of laboratory evolved Bacillus subtilis lipase. J Mol Biol 2004;341:1271–1281. Ahmed EH, Raghavendra T, Madamwar D: A thermostable alkaline lipase from a local isolate Bacillus subtilis EH 37: characterization, partial purification, and application in organic synthesis. Appl Biochem Biotechnol 2010; 160:2102–2113. Arpigny JL, Jaeger K: Bacterial lipolytic enzymes: classification and properties. Biochem J 1999; 343:177–183. Benkert P, Tosatto SC, Schomburg D: QMEAN: A comprehensive scoring function for model quality assessment. Proteins 2008; 71: 261– 277. Chakravorty D, Parameswaran S, Dubey VK, Patra S: In silico characterization of thermostable lipases. Extremophiles 2011;15:89–103. Chen YH, Yang JT, Martinez HM: Determination of the secondary structures of proteins by circular dichroism and optical rotatory dispersion. Biochem 1972;11:4120–4131. Chen R, Guo L, Dang H: Gene cloning, expression and characterization of a cold-adapted lipase from a psychrophilic deep-sea bacterium Psychrobacter sp. C18. World J Microbiol Biotechnol 2011;27:431–441. Choi Y, Sims GE, Murphy S, Miller JR, Chan AP: Predicting the functional effect of amino acid substitutions and indels. PLoS One 2012; 7:e46688. Colovos C, Yeates TO: Verification of protein structures: patterns of nonbonded atomic interactions. Protein Sci 1993;2:1511–1519. Eswar N, Webb B, Marti-Renom MA, Madhusudhan MS, Eramian D, Shen MY, Pieper U, Sali A: Comparative protein structure modeling with MODELLER. Curr Protoc Bioinformatics 2006;Chapt 5:Unit 5.6. Farrokh P, Yakhchali B, Karkhane AA: Cloning and characterization of newly isolated lipase from Enterobacter sp. Bn12. Braz J Microbiol, in press. Glogauer A, Martini VP, Faoro H, Couto GH, Müller-Santos M, Monteiro RA, Mitchell DA, Souza EM, Pedrosa F, Krieger N: Identification and characterization of a new true lipase isolated through metagenomic approach. Microb Cell Fact 2011;10:54. Gupta R, Gupta N, Rathi P: Bacterial lipases: an overview of production, purification and biochemical properties. Appl Microbiol Biotechnol 2004;64:763–781. Hasan F, Shah AA, Hameed A: Industrial applications of microbial lipases. Enzyme Microb Technol 2006;39:235–251.
Rational Design of ELBn12 Lipase
Helistö P, Korpela T: Effects of detergents on activity of microbial lipases as measured by the nitrophenyl alkanoate esters method. Enzyme Microb Technol 1998;23:113–117. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR: Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 1989;77:51–59. Hosseini M, Karkhane AA, Yakhchali B, Shamsara M, Aminzadeh S, Morshedi D, Haghbeen K, Torktaz I, Karimi E, Safari Z: In silico and experimental characterization of chimeric Bacillus thermocatenulatus lipase with the complete conserved pentapeptide of Candida rugosa lipase. Appl Biochem Biotechnol 2012; 169:773–785. Houde A, Kademi A, Leblanc D: Lipases and their industrial applications: an overview. Appl Biochem Biotechnol 2004;118:155–170. Humphrey W, Dalke A, Schulten K: VMD: visual molecular dynamics. J Mol Graph 1996; 14: 33–38. Khoo ML, Ibrahim CO: Lipase from thermoalkalophilic Pseudomonas species as an additive in potential laundry detergent formulations. Malays J Microbiol 2009;5:1–5. Khurana J, Singh R, Kaur J: Engineering of Bacillus lipase by directed evolution for enhanced thermal stability: effect of isoleucine to threonine mutation at protein surface. Mol Biol Rep 2011;38:2919–2926. Kleiger G, Grothe R, Mallick P, Eisenberg D: GXXXG and AXXXA: common α-helical interaction motifs in proteins, particularly in extremophiles. Biochemistry 2002; 41: 5990– 5997. Kolling DJ, Bertoldo JB, Brod FCA, Vernal J: Biochemical and structural characterization of two site-directed mutants of Staphylococcus xylosus lipase. Mol Biotechnol 2010;46:168–175. Koman TP, Bowie JU: Crystal structure of Proteus mirabilis lipase, a novel lipase from the Proteus/psychrophilic subfamily of lipase family I.1. PLoS One 2012;7:e52890. Laemmli UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680–685. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG: ClustalW and ClustalX version 2. Bioinformatics 2007; 23: 2947– 2948. Laskowski RA, MacArthur MW, Moss DS, Thornton JM: PROCHECK: a program to check the stereochemical quality of protein structures. J Appl Crystallography 1993;26:283–291. Liao H, McKenzie T, Hageman R: Isolation of a thermostable enzyme variant by cloning and selection in a thermophile. Proc Natl Acad Sci USA 1986;83:576–580.
Liu YH, Hu B, Xu YJ, Bo JX, Fan S, Wang JL, Lu FP: Improvement of the acid stability of Bacillus licheniformis alpha amylase by errorprone PCR. J Appl Microbiol 2012; 113: 541– 549. Malkov SN, Živković MV, Beljanski MV, Hall MB, Zarić SD: A reexamination of the propensities of amino acids towards a particular secondary structure: classification of amino acids based on their chemical structure. J Mol Model 2008;14:769–775. Meilleur C, Hupé JF, Juteau P, Shareck F: Isolation and characterization of a new alkali-thermostable lipase cloned from a metagenomic library. J Ind Microbiol Biotechnol 2009; 36: 853–861. Nardini M, Lang DA, Liebeton K, Jaeger K, Dijkstra BW: Crystal structure of Pseudomonas aeruginosa lipase in the open conformation. J Biol Chem 2000;275:31219–31225. Palmer B, Angus K, Taylor L, Warwicker J, Derrick JP: Design of stability at extreme alkaline pH in streptococcal protein G. J Biotechnol 2008;134:222–230. Patkar S, Vind J, Kelstrup E, Christensen MW, Svendsen A, Borch K, Kirk O: Effect of mutations in Candida antarctica B lipase. Chem Phys Lipids 1998;93:95–101. Sharma PK, Kumar R, Garg P, Kaur J: Insights into controlling role of substitution mutation, E315G on thermostability of a lipase cloned from metagenome of hot spring soil. 3 Biotechnol 2014;4:189–196. Shih T, Pan T: Substitution of Asp189 residue alters the activity and thermostability of Geobacillus sp. NTU 03 lipase. Biotechnol Lett 2011; 33:1841–1846. Vieille C, Zeikus GJ: Hyperthermophilic enzymes: sources, uses, and molecular mechanisms for thermostability. Microbiol Mol Biol Rev 2001;65:1–43. Viguera AR, Villegas V, Avilés FX, Serrano L: Favourable native-like helical local interactions can accelerate protein folding. Fold Des 1996; 2:23–33. Wahab RA, Basri M, Abdul Rahman MB, Abdul Rahman RN, Salleh AB, Chor LT: Engineering catalytic efficiency of thermophilic lipase from Geobacillus zalihae by hydrophobic residue mutation near the catalytic pocket. Adv Biosci Biotechnol 2012; 3: 158– 167. Wiederstein M, Sippl MJ: ProSA-web: interactive web service for the recognition of errors in three-dimensional structures of proteins. Nucleic Acids Res 2007;35:W407–W410.
J Mol Microbiol Biotechnol 2014;24:262–269 DOI: 10.1159/000365890
269
Copyright: S. Karger AG, Basel 2014. Reproduced with the permission of S. Karger AG, Basel. Further reproduction or distribution (electronic or otherwise) is prohibited without permission from the copyright holder.
