Basic and Translational Science RCCRT1 Is Correlated With Prognosis and Promotes Cell Migration and Invasion in Renal Cell Carcinoma Shangqing Song, Zhenjie Wu, Cheng Wang, Bing Liu, Xuerong Ye, Junming Chen, Qing Yang, Huamao Ye, Bin Xu, and Linhui Wang OBJECTIVE
MATERIALS AND METHODS
RESULTS
CONCLUSION
To investigate the expression pattern of a novel long noncoding ribonucleic acid (RNA), RCCRT1, in renal cell carcinoma (RCC) tissues among the patients with various clinicopathologic features and to detect the role of RCCRT1 in migration and invasion of RCC in vitro. We found out a novel long noncoding RNA, RCCRT1, that expressed differently between highgrade (Fuhrman grade III-IV) and low-grade RCC tissues (Fuhrman grade I-II) by gene chip analysis, then verified it with quantitative polymerase chain reaction. The expression of RCCRT1 was diminished by transfecting with small interfering RNA. RCCRT1 effects were assessed by cell proliferation, cell apoptosis, transwell assay, and wound-healing assay. Compared with adjacent noncancerous tissues, RCCRT1 is upregulated remarkably in RCC, particularly in high-grade RCC tissues. After analyzing the relative expression of RCCRT1 in various tissues by quantitative reverse transcription polymerase chain reaction and clinicopathologic characteristics of patients, we drew the conclusion that RCCRT1 is associated with clinicopathologic findings such as tumor size, pathologic T stage, tumor grade, lymph node metastasis, and distant metastasis. Furthermore, small interfering RNAeinduced depletion of RCCRT1 expression suppressed migration and invasion in RCC cell lines. The results of the present study suggest that RCCRT1 promoted migration and invasion of RCC and that RCCRT1 may offer a biomarker to verdict prognosis as well as an attractive new target for prognostic and therapeutic intervention for RCC patients in the future. UROLOGY 84: 730.e1e730.e7, 2014. 2014 Elsevier Inc.
R
enal cell carcinoma (RCC) accounts for approximately 3% of all adult malignancies and represents the most lethal urologic cancer1; the 5year survival rate is 69.4%.2 However, because of the lack of biomarkers in the early diagnosis of renal cancer, nearly 20%-30% of patients have found a distant metastasis at the time of diagnosis, and 20%-40% of the patients who undergo nephrectomy for clinically localized RCC are expected to develop relapse at distant sites.3 In patients found to have distant metastases, the survival rate drops to 5.0 cm) pT stage pT1 pT2 pT3-pT4 Grade 1 2 3-4 Lymph node metastasis Absence Presence Distant metastasis Absence Presence
Patients (n)
Fold Change (mean SD)
40
2.645 2.0653
28 12
2.277 1.4550 3.503 2.9631
23 17
2.545 1.9972 2.780 2.2089
23 17
2.088 1.7838 3.399 2.2299
28 6 6
2.308 1.7293 2.696 1.4298 4.809 2.8524
8 13 19
2.181 1.2158 1.580 0.8540 3.569 2.5230
34 6
2.199 1.7602 5.171 1.9535
31 9
2.140 1.4850 4.383 2.8530
P Value .085 .728 .046 .022
.017
.008 .003
SD, standard deviation.
leukemia, and hepatocellular carcinoma, and so forth.10 However, the expression and functional significance of lncRNAs in renal cancer progression remains vague. According to our study, RCCRT1 was one of the differentially expressed lncRNAs screened by gene chip from high-grade RCC tumor tissues compared with lowgrade RCC tissues; related research of RCCRT1 was not found in literatures. It locates at chr5:137801181137805004 and is upregulated in the tissue of high-grade RCC. We studied the expression of RCCRT1 and its correlation with different clinicopathologic data of RCC patients. Our research proved that the expression of RCCRT1 is closely related to some of the clinicopathologic data and prognosis of RCC patients, which means that RCCRT1 may be a prognostic factor of RCC. In addition, the ability of invasion and migration declines after transfecting siRNA to cell lines of RCC and reduce the expression of RCCRT1, this means that RCCRT1 plays an essential role in the progress of RCC cell lines in vitro.
MATERIALS AND METHODS Patients and Samples Tissue samples used in this study were 6 cases of RCC for gene chip screening, including 3 tumor samples of grade 3 or 4, and 3 samples of grade 1 or 2. Forty RCC tumor samples were used for quantitative reverse transcription polymerase chain reaction (qPCR) with their adjacent normal tissues as control. The entire tissue samples were obtained from patients who had undergone radical nephrectomy or nephron-sparing surgery at Changhai Hospital of Second Military Medical University (Shanghai, China). No further treatments were performed before operation; all specimens were removed immediately into liquid nitrogen for cryopreservation after resection. The diagnosis was confirmed by UROLOGY 84 (3), 2014
postoperative pathologic analysis; all of the tumor tissues were clear cell type renal carcinomas. No patient had detectable distant metastases at surgery. The clinical and pathologic features are summarized in Table 1. All cases were staged according to the Union for International Cancer Center’s Tumor Node Metastasis staging system, and nuclear grade was evaluated by Fuhrman criteria. For the use of these clinical materials for research purposes, prior patient’s consent and approval from the hospital ethics committee were obtained.
Gene Chip Screening Gene chip screening for the differential expression of lncRNAs was accomplished by Shanghai Gminix Biological Information Company (Shanghai, China), using Affymetrix glue grant human transcriptome array.
Real-time qPCR RCCRT1 was chosen to perform large-sample qPCR, which involved 40 pairs of RCC and adjacent tissues. Total RNA was extracted from tissues using the TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instruction. Complementary deoxyribonucleic acid (cDNA) was synthesized from total RNA using the PrimeScript II first strand cDNA synthesis kit (TaKaRa Biotechnology, Dalian, China) using a standard protocol. qPCR was then performed on cDNA in an SYBR green dye (TaKaRa Biotechnology, Dalian, China) with specific primers. U6 was used as an internal control. The median in each triplicate was used to calculate the relative content using the comparative DCt method (value of 2 DCt). Expression fold changes were calculated using 2 DDCt methods.11
Cell Lines and Culture ACHN and A498 human RCC cell lines were obtained from the Shanghai Institute of Cell Biology (Shanghai, China). Cell lines were cultured in Roswell Park Memorial Institute-1640 730.e2
medium supplemented with 10% fetal bovine serum (ShiYi Biotechnology Inc. Shanghai, China). All cell lines were cultured in a humidified incubator at 37 C with 5% carbon dioxide. The medium was replaced every 2 days.
RNA interference and Transfection Efficiency siRNA oligonucleotide sequences were designed by Invitrogen. The cells were transfected with either siRNA oligonucleotides or scrambled siRNA controls with Lipofectamine 2000 (Invitrogen) according to the protocol. After the cells were incubated for 48 hours, the relative expression of RCCRT1 was confirmed via qPCR. The primer sequences are as follows: siRNA1: forward GCUCCCCAGUUCCUCGGCGUU, reverse CGAGGGG UCAAGGAGCCGCUU; siRNA2: forward CUACCUGUUU CCACAGCAGCAUU, reverse GAUGGACAAAGGUGUC GUCGUUU; siRNA3: forward AGUGGAGUCCUGUGA UCGCCUU, reverse UCACCUCAGGACACUAGCGGUU.
Cell Proliferation Assay ACHN and A498 cell suspension was seeded into 96-well plates at a concentration of 100 mL (5000 cells) per well and then cultured in the incubator for 24 hours (37 C, 5% CO2). The cells were then transfected with either siRNA oligonucleotides or scrambled siRNA controls with Lipofectamine 2000 according to the protocol. Ten microliters of Cell Counting Kit-8 reagent (Beyotime Institute of Biotechnology, Shanghai, China) was added to each well. Cultivating the cells in the incubator was continued. Subsequently, viable proliferating cells at various points (from day 1 to day 4) were found out. Cell viability was expressed as the optical density, detected using an enzyme-linked immunosorbent assay reader (Therma, San Jose, CA) at a 450-nm wavelength according to the instruction. The growth curve was drawn according to the data. All points were measured in triplicates.
Cell Apoptosis Assay Cells undergoing early and late apoptosis were quantified using flow cytometry analysis (BD Biosciences, San Jose, CA) after transfecting with siRNA or scramble sequence for 48 hours, after the staining with Annexin V-fluorescein isothiocyanate and propidium iodide (Beyotime Institute of Biotechnology). The experiments were triplicated.
Wound-healing Assay Cell migration assay was performed using wound-healing assay. At 48 hours after RNA interference, the cells were seeded into 6-well plates and cultured until the plates were filled. Then, horizontal lines were scratched at the bottom of the plates using tips and the cells were cultivated in the incubator after washing with phosphate-buffered saline for 3 times. Photographs at diverse points of time (0, 24, and 72 hours) in the same view were taken.
Transwell Invasion Assay Cell invasion assay was performed using a Transwell (Corning Incorporated)-based standard method. At 48 hours after RNA interference, the filters coated with Matrigel (BD Bioscience) in the upper compartment were seeded with 1 104 cells, and the lower compartment was filled with cell culture medium supplemented with 30% fetal bovine serum. Twenty-four hours later, invaded cells on the bottom surface were fixed with 95% 730.e3
methanol for 30 minutes and stained with 0.1% crystal violet. Three fields were counted per filter in each group. Each test was repeated in triplicate.
Statistical Analysis All the data are presented as mean standard deviation. The differences between groups were assessed by 2-tailed nonpaired Student t test or analysis of variance. Multiple regression was used for multivariate analysis. The survival analysis was calculated using the Kaplan-Meier method and log-rank test. Significance was defined as P .05), but there is significant statistical difference in different pT stages, grades, lymph node metastasis, and distant metastasis (P
MATERIALS AND METHODS
RESULTS
CONCLUSION
To investigate the expression pattern of a novel long noncoding ribonucleic acid (RNA), RCCRT1, in renal cell carcinoma (RCC) tissues among the patients with various clinicopathologic features and to detect the role of RCCRT1 in migration and invasion of RCC in vitro. We found out a novel long noncoding RNA, RCCRT1, that expressed differently between highgrade (Fuhrman grade III-IV) and low-grade RCC tissues (Fuhrman grade I-II) by gene chip analysis, then verified it with quantitative polymerase chain reaction. The expression of RCCRT1 was diminished by transfecting with small interfering RNA. RCCRT1 effects were assessed by cell proliferation, cell apoptosis, transwell assay, and wound-healing assay. Compared with adjacent noncancerous tissues, RCCRT1 is upregulated remarkably in RCC, particularly in high-grade RCC tissues. After analyzing the relative expression of RCCRT1 in various tissues by quantitative reverse transcription polymerase chain reaction and clinicopathologic characteristics of patients, we drew the conclusion that RCCRT1 is associated with clinicopathologic findings such as tumor size, pathologic T stage, tumor grade, lymph node metastasis, and distant metastasis. Furthermore, small interfering RNAeinduced depletion of RCCRT1 expression suppressed migration and invasion in RCC cell lines. The results of the present study suggest that RCCRT1 promoted migration and invasion of RCC and that RCCRT1 may offer a biomarker to verdict prognosis as well as an attractive new target for prognostic and therapeutic intervention for RCC patients in the future. UROLOGY 84: 730.e1e730.e7, 2014. 2014 Elsevier Inc.
R
enal cell carcinoma (RCC) accounts for approximately 3% of all adult malignancies and represents the most lethal urologic cancer1; the 5year survival rate is 69.4%.2 However, because of the lack of biomarkers in the early diagnosis of renal cancer, nearly 20%-30% of patients have found a distant metastasis at the time of diagnosis, and 20%-40% of the patients who undergo nephrectomy for clinically localized RCC are expected to develop relapse at distant sites.3 In patients found to have distant metastases, the survival rate drops to 5.0 cm) pT stage pT1 pT2 pT3-pT4 Grade 1 2 3-4 Lymph node metastasis Absence Presence Distant metastasis Absence Presence
Patients (n)
Fold Change (mean SD)
40
2.645 2.0653
28 12
2.277 1.4550 3.503 2.9631
23 17
2.545 1.9972 2.780 2.2089
23 17
2.088 1.7838 3.399 2.2299
28 6 6
2.308 1.7293 2.696 1.4298 4.809 2.8524
8 13 19
2.181 1.2158 1.580 0.8540 3.569 2.5230
34 6
2.199 1.7602 5.171 1.9535
31 9
2.140 1.4850 4.383 2.8530
P Value .085 .728 .046 .022
.017
.008 .003
SD, standard deviation.
leukemia, and hepatocellular carcinoma, and so forth.10 However, the expression and functional significance of lncRNAs in renal cancer progression remains vague. According to our study, RCCRT1 was one of the differentially expressed lncRNAs screened by gene chip from high-grade RCC tumor tissues compared with lowgrade RCC tissues; related research of RCCRT1 was not found in literatures. It locates at chr5:137801181137805004 and is upregulated in the tissue of high-grade RCC. We studied the expression of RCCRT1 and its correlation with different clinicopathologic data of RCC patients. Our research proved that the expression of RCCRT1 is closely related to some of the clinicopathologic data and prognosis of RCC patients, which means that RCCRT1 may be a prognostic factor of RCC. In addition, the ability of invasion and migration declines after transfecting siRNA to cell lines of RCC and reduce the expression of RCCRT1, this means that RCCRT1 plays an essential role in the progress of RCC cell lines in vitro.
MATERIALS AND METHODS Patients and Samples Tissue samples used in this study were 6 cases of RCC for gene chip screening, including 3 tumor samples of grade 3 or 4, and 3 samples of grade 1 or 2. Forty RCC tumor samples were used for quantitative reverse transcription polymerase chain reaction (qPCR) with their adjacent normal tissues as control. The entire tissue samples were obtained from patients who had undergone radical nephrectomy or nephron-sparing surgery at Changhai Hospital of Second Military Medical University (Shanghai, China). No further treatments were performed before operation; all specimens were removed immediately into liquid nitrogen for cryopreservation after resection. The diagnosis was confirmed by UROLOGY 84 (3), 2014
postoperative pathologic analysis; all of the tumor tissues were clear cell type renal carcinomas. No patient had detectable distant metastases at surgery. The clinical and pathologic features are summarized in Table 1. All cases were staged according to the Union for International Cancer Center’s Tumor Node Metastasis staging system, and nuclear grade was evaluated by Fuhrman criteria. For the use of these clinical materials for research purposes, prior patient’s consent and approval from the hospital ethics committee were obtained.
Gene Chip Screening Gene chip screening for the differential expression of lncRNAs was accomplished by Shanghai Gminix Biological Information Company (Shanghai, China), using Affymetrix glue grant human transcriptome array.
Real-time qPCR RCCRT1 was chosen to perform large-sample qPCR, which involved 40 pairs of RCC and adjacent tissues. Total RNA was extracted from tissues using the TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instruction. Complementary deoxyribonucleic acid (cDNA) was synthesized from total RNA using the PrimeScript II first strand cDNA synthesis kit (TaKaRa Biotechnology, Dalian, China) using a standard protocol. qPCR was then performed on cDNA in an SYBR green dye (TaKaRa Biotechnology, Dalian, China) with specific primers. U6 was used as an internal control. The median in each triplicate was used to calculate the relative content using the comparative DCt method (value of 2 DCt). Expression fold changes were calculated using 2 DDCt methods.11
Cell Lines and Culture ACHN and A498 human RCC cell lines were obtained from the Shanghai Institute of Cell Biology (Shanghai, China). Cell lines were cultured in Roswell Park Memorial Institute-1640 730.e2
medium supplemented with 10% fetal bovine serum (ShiYi Biotechnology Inc. Shanghai, China). All cell lines were cultured in a humidified incubator at 37 C with 5% carbon dioxide. The medium was replaced every 2 days.
RNA interference and Transfection Efficiency siRNA oligonucleotide sequences were designed by Invitrogen. The cells were transfected with either siRNA oligonucleotides or scrambled siRNA controls with Lipofectamine 2000 (Invitrogen) according to the protocol. After the cells were incubated for 48 hours, the relative expression of RCCRT1 was confirmed via qPCR. The primer sequences are as follows: siRNA1: forward GCUCCCCAGUUCCUCGGCGUU, reverse CGAGGGG UCAAGGAGCCGCUU; siRNA2: forward CUACCUGUUU CCACAGCAGCAUU, reverse GAUGGACAAAGGUGUC GUCGUUU; siRNA3: forward AGUGGAGUCCUGUGA UCGCCUU, reverse UCACCUCAGGACACUAGCGGUU.
Cell Proliferation Assay ACHN and A498 cell suspension was seeded into 96-well plates at a concentration of 100 mL (5000 cells) per well and then cultured in the incubator for 24 hours (37 C, 5% CO2). The cells were then transfected with either siRNA oligonucleotides or scrambled siRNA controls with Lipofectamine 2000 according to the protocol. Ten microliters of Cell Counting Kit-8 reagent (Beyotime Institute of Biotechnology, Shanghai, China) was added to each well. Cultivating the cells in the incubator was continued. Subsequently, viable proliferating cells at various points (from day 1 to day 4) were found out. Cell viability was expressed as the optical density, detected using an enzyme-linked immunosorbent assay reader (Therma, San Jose, CA) at a 450-nm wavelength according to the instruction. The growth curve was drawn according to the data. All points were measured in triplicates.
Cell Apoptosis Assay Cells undergoing early and late apoptosis were quantified using flow cytometry analysis (BD Biosciences, San Jose, CA) after transfecting with siRNA or scramble sequence for 48 hours, after the staining with Annexin V-fluorescein isothiocyanate and propidium iodide (Beyotime Institute of Biotechnology). The experiments were triplicated.
Wound-healing Assay Cell migration assay was performed using wound-healing assay. At 48 hours after RNA interference, the cells were seeded into 6-well plates and cultured until the plates were filled. Then, horizontal lines were scratched at the bottom of the plates using tips and the cells were cultivated in the incubator after washing with phosphate-buffered saline for 3 times. Photographs at diverse points of time (0, 24, and 72 hours) in the same view were taken.
Transwell Invasion Assay Cell invasion assay was performed using a Transwell (Corning Incorporated)-based standard method. At 48 hours after RNA interference, the filters coated with Matrigel (BD Bioscience) in the upper compartment were seeded with 1 104 cells, and the lower compartment was filled with cell culture medium supplemented with 30% fetal bovine serum. Twenty-four hours later, invaded cells on the bottom surface were fixed with 95% 730.e3
methanol for 30 minutes and stained with 0.1% crystal violet. Three fields were counted per filter in each group. Each test was repeated in triplicate.
Statistical Analysis All the data are presented as mean standard deviation. The differences between groups were assessed by 2-tailed nonpaired Student t test or analysis of variance. Multiple regression was used for multivariate analysis. The survival analysis was calculated using the Kaplan-Meier method and log-rank test. Significance was defined as P .05), but there is significant statistical difference in different pT stages, grades, lymph node metastasis, and distant metastasis (P
