.n) 1992 Oxford University Press

Nucleic Acids Research, 1992, Vol. 20, No. 24 6465-6472

Recognition of the high affinity binding site in rev-response element RNA by the Human Immunodeficiency Virus type-1 rev protein Shigenori lwai, Clare Pritchard, Derek A.Mann, Jonathan Karn and Michael J.Gait* MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, UK Received October 26, 1992; Revised and Accepted November 22, 1992

ABSTRACT The Human Immunodeficiency Virus type-1 rev protein binds with high affinity to a bubble structure located within the rev-response element (RRE) RNA in stemloop I. After this initial interaction, additional rev molecules bind to the RRE RNA in an ordered assembly process which requires a functional bubble structure, since mutations in the bubble sequence that reduce rev affinity block multiple complex formation. We have used synthetic chemistry to characterize the interaction between rev protein and its high affinity binding site. A minimal synthetic duplex RNA (RBC6) carrying the bubble and 12 flanking base pairs is able to bind rev with 1 to 1 stoichiometry and with high affinity. When the bubble structure is inserted into synthetic RNA molecules carrying longer stretches of flanking doublestranded RNA, rev forms additional complexes resembling the multimers observed with the RRE RNA. The ability of rev to bind to RBC6 analogues containing functional group modifications on base and sugar moieties of nucleoside residues was also examined. The results provide strong evidence that the bubble structure contains specific configurations of nonWatson - Crick G: G and G: A base pairs and suggest that high affinity recognition of RRE RNA by rev requires hydrogen bonding to functional groups in the major groove of a distorted RNA structure. INTRODUCTION The Human Immunodeficency Virus (HIV) trans-activator protein rev is expressed early during infection and is required for the production of the late HIV mRNAs (for reviews see refs. 1 and 2). In the absence of rev, mRNAs which are produced by single splicing events, such as the env and vifmRNAs, and the unspliced virion mRNA, which is also the mRNA for the gag-pol gene, are not expressed in a translatable form (3-5). Although it has been suggested that rev activity is coupled to splicing (6- 8), it now seems most likely that rev either stimulates the export of partially spliced viral mRNAs from the nucleus (9,10) or stabilizes these mRNAs in the cytoplasm of infected cells (3-5,11). *

To whom correspondence should be addressed

Rev operates through an RNA target sequence located in the env gene called the rev-response element (RRE). Mutagenesis experiments have shown that the RRE RNA is at least 234-residues long and has an elaborate secondary structure (9, 12, 13). RNA transcripts containing the RRE are specifically bound by rev in vitro (14-17). The binding reaction is complex and involves an initial interaction with a high affinity site (15) followed by the addition of further rev molecules to lower affinity sites on the flanking RNA sequences. Rev initially forms oligomers on the RRE RNA (7, 14, 15, 18-21), but at high protein concentrations rev is able to package the RRE RNA into rod-like ribonucleoprotein filaments (19, 22). We have recently used site-directed mutagenesis to map the high affinity rev binding site to a purine-rich 'bubble' containing bulged GG and GUA residues on either side of a double-helical RNA stem-loop structure (19). The precise location and sequence requirements of the high affinity binding site have recently been confirmed by chemical footprinting data (18, 21) as well as by the sequencing of high affinity binding sites for rev selected from pools of large numbers of randomly-generated mutants (23). In this paper we describe the preparation of a series of synthetic RNA duplexes containing the bubble structure. Rev is able to bind to a minimal RNA bubble structure, carrying only 12 flanking base pairs, with a 1 to 1 stoichiometry and nearly wildtype affinity. The bubble structure is believed to be stabilized by non-Watson-Crick G: A (19, 23) and G: G (23) base-pairs formed between the bulged residues. Using synthetic RNAs carrying functional group modifications on either the base or sugar moieties of nucleoside residues, we provide evidence for the formation of specific configurations of the G: G and G: A base pairs in the bubble and suggest that, as in the case of tat binding to TAR RNA (24, 25), specific recognition of the RRE RNA by rev may involve the formation of hydrogen-bonds in the major groove of a distorted RNA duplex.

RESULTS Oligomerization of rev requires the high affinity binding site The genetically defined rev-response element contains six stemloops arranged as a cruciform structure (7, 9, 12, 15, 18, 19). Figure I shows a predicted folding pattern for the RRE sequence

6466 Nucleic Acids Research, 1992, Vol. 20, No. 24 which is consistent with nuclease-protection and chemical-probing data (7, 18). The RRE sequence has been drawn to emphasize the symmetry of the structure. The high affinity rev binding site, defined by the bubble structure, is located towards the base of a stem-loop near a 3-way junction (18, 19, 21, 23). Packaging of RRE RNA into ribonucleoprotein filaments is an ordered assembly process (7, 15, 19, 20). Figure 2a shows a gel-retardation assay performed with a transcript carrying the RRE (R540. 1) RNA sequence (Figure 1). In agreement with previous results (7, 15, 20), a series of 6 to 8 complexes of increasing size is formed as the rev protein concentration is increased. The gel retardation patterns are consistent with a model whereby at low rev concentrations binding to the RRE takes place specifically at the high affinity site. As the rev concentration is increased, additional rev molecules can bind to neighbouring regions of double-stranded RNA with lower affinity as long as the length of neighbouring double strand is sufficient to allow adjacent packing. Similarly, a Scatchard analysis showed that rev binding to the RRE is non-linear and involves both high and low affinity binding reactions (19). It seems likely that each of the bands seen in Figure 2a arises from the additon of a single rev monomer, since quantitative analysis of the stoichiometry of the reaction shows that 6 to 8 rev monomers can bind to the 234-residue RRE RNA (7, 14, 19). The assembly model predicts that mutations in the high affinity binding site should block both monomer and oligomer formation on the RRE RNA. To test this hypothesis, gel mobility shift assays were performed using an RRE transcript carrying the AG35-36 mutation, a 2-base deletion of adjacent G residues within the bubble (RRE R10. 1). The AG35 36 mutation was

CA UC

A

AU CG 130- AU -140 AU

Rev .onc.

190

22

44

R540.t RNA 88

440 2210 220 880

(b) RRE R10.1 RNA 0

22

44

88

440 221 0 220 880

Non-SpecAfiOornopiexes

G 180

GC_

Structure of short synthetic RNAs carrying the bubble structure We have shown previously that high affinity rev binding is maintained when the bubble is placed in heterologous stem-loop structures such as R33 (19). In order to find a minimal RNA sequence capable of binding rev with high affinity, a series of RNA duplex structures was prepared by annealing one (RBC5L), two (RBC6) or three (TWJ6) chemically synthesized oligoribonucleotides (Figure 1). Nuclease digestion experiments were performed to confirm that each of these synthetic molecules carries a bubble structure. The bubble structure is unexpectedly resistant to ribonuclease digestion. Figure 3a shows the RNase digestion pattern obtained using RBC5L RNA, a single 29-mer oligoribonucleotide that folds to give a stable stem-loop structure. RBC5L showed only three primary cleavage sites for RNase TI, with only one of these sites located in the bubble sequence. Digestion of RBC5L with RNase T2 led to a primary cleavage in the apical loop, which is not part of the bubble structure. At high nuclease concentrations, some secondary cleavages were observed at sites adjacent to the primary cleavage sites. The bubble structure in la, RRE

AGUCUGGGGC

110

RRE, the AG35-36 mutation (RRE R10.1) blocks both high affinity binding and the subsequent and progressive assembly reaction. Rev is unable to form the characteristic ladder of RNAprotein complexes seen when rev associates with wild-type RRE R540.1 RNA (Figure 2). At high rev concentrations, high molecular weight aggregates between rev and RRE RNA are seen with both the wild-type and mutant transcripts. Since these complexes are formed in the absence of high affinity binding to the bubble sequence, we consider these to be due to non-specific binding.

RRE (R540.1) RNA

CG

C A G A GC AU GC 150 1 0A UC UACA / A 120-U A CGGACCUCG A A ACG GA 170

GU GC

chosen since it reduces rev affinity by more than 20-fold in the context of the R33 sequence (19). In the context of the 276-residue

200

210

220

(U) AAAGAJACCUAAGGGAUCAACAGCUCCUAGG GC6GUG UUCU -UGGG -UUCC CGACG A\ AGGU oo >N)55 G0 \A AAG AG35G6 RRE (R10.1) RNA GCG 90-UA U GC -30 /1 4 5G / 4 AU R33 RNA UA WGG G UG CAGUGUCA GWAGUCGUCAG AGACA GCAGUCGCAGU GCCAGUGUCA AGACCGGAAUUCUG UG U 50 3AC GGCCUUAAGACA

AAUUUGCUG AUU CAAGACGAC

l

u

G

80-

CG

UA

AU

3-

5

6

GCGUCGCAGU

GC((

Q ,2GCGUG,.C .'TW6RA CAGACA ---Au 3-

u

UG

-

CGCAGC3

0CAGACAGOCOGUCG5 CUCC

RBC6 RNA

CG CAGC 3

S CGUGUG6

3GCACACA G@C GUCG5

53 3'

U

Figure

1.

free RNlA--p-

RBC5L RNA

8A -70 UA

-Spec!fic -onmPlexes

Structure of RRE RNA and

synthetic

RNAs

carrying

the bubble

structure, the high affinity binding site for rev. Residues previously found essential to rev recognition (19) are shown in highlighted characters.

Figure 2. Gel mobility shift assays showing that multiple complex formation by rev on RRE RNA requires a functional bubble. Binding reactions (20 pi) contined 25 nM 32P-labelled RRE R7 RNA (approx. 5000 cpm) and up to 2.2 FeM rev protein in 10 mM Tris-HCl (pH 7.4), 50 mM NaCl, 1 mM DTT, 1% Triton

X-100, 13 units RNasin (Promega). After incubation for 2 h on ice, 5 ul of dye mix (0.25% bromophenol blue, 40% sucrose, 10 mM Tris-HCl (pH 7.4)) was added and aliquots (12 ,ll) applied to a 6% non-denaturing polyacrylamide gel (1.5 x 180 mm) which was electrophoresed in a recirculating buffer of 3.3 mM sodium acetate, 6.7 mM Tris-HCl (pH 7.9) at 40C at 8mA for 12h and the gel subjected to autoradiography. (a) Wildtype RRE R540.1 RNA. (b) &G35-36 mutation, RRE RIO.1 RNA.

Nucleic Acids Research, 1992, Vol. 20, No. 24 6467 the RBC6 duplex is also highly resistant to RNase T, and T2 digestion (data not shown). The RBC6 duplex (tn = 62°) is somewhat less stable than the RBC5L hairpin (tn = 77°). Figure 3b shows the RNase T1 and T2 digestion patterns for the 3-stranded RNA TWJ8, which is slightly larger and more stable than TWJ6 (Figure 1). The tm of TWJ8 is 58°C, approximately 20°C higher than the tm for TWJ6. The bubble structure in TWJ8, which is close to a 3-way junction, appears to be slightly more accessible to ribonucleases than in RBC5L RNA. Three sites of primary RNase T1 cleavage were observed for TWJ8 (Figure 3b). There were two cleavage sites on strand II, the first site at an unpaired G residue located at the 3-way junction and the second site between a G and U residue in the bubble structure. A T1 cleavage occurred on strand I between two G residues but this was weaker and probably only occurred after primary cleavage on strand II. Only one major site of RNase T2 cleavage was present in each of strands I and II. As in the case of T1 cleavage, the strongest T2 cleavage site was found on strand II in the region of the bubble structure. Two weak RNase T2 cleavages also occurred on strand Im, at sites located at the 3-way junction and near the 3' end of the strand. The nuclease data is consistent with the proposed structures for the RBC5L, RBC6 and TWJ8 RNAs and support our suggestion (19) that in the RRE the bubble structure is maintained close to a 3-way junction. It seems likely that base pairs are formed between the 4 residues located between the bubble and the 3-way junction, since no RNase cleavages were observed at these positions. Kjems et al. in their studies of the full length RRE (7) and a stable RNA hairpin loop structure carrying the bubble (18) also found that the bubble sequence is highly nuclease resistant.

(a) RBC5LRNA

5GUCUGG G CGCACUU 3,CAGACAU3GCGUGGC T2

T1

Nudease Units A

AC A

1'0

05

A

__

AL

"

G,_'MP'-. G- *

G-

'S

-

+C

_

U,

UC-

a, _

_

AC- _ G- _ GG-

u-

4v

c-

do

_m

_9 0

U-

(b) TWJ8RNA

5'

Strand I

Stan 1

Rev binds as a monomer to short synthetic RNAs carrying the bubble The ability of the synthetic RNAs described above to bind rev was examined using gel mobility shift assays. RBC5L RNA was found to form only a single ribonucleoprotein complex even in

AuAu G G GAG3' CA ACAUGGCGUCGCA5.

S.UGUAGC% ALabelled RNA Strand

II

I

T1

Nudease U

Units

T1

T2

m T2

o. AN 11

to LO

U)O

00

o-~Aco.

o_~A oo0

o_ Ao_.-

(a) RBC5L

_no _0. =1

_ eW

r

Rev Conc. (nM) 0 11 22 33 44

(b) R33 0 11 22 33 44 55 * Complex 2

43

4-

Complex-..

amamamam

-

_

__ I

I

,Complex 1 -

Free RNA

Free RNA_. in

0 0

a

0

a

U__

(c) TWJ8 Rev Conc. (nM) Non-specific Complex-

38 0

192 515 96 383 766

Complex 3_ Complex22i '-'. Complex 1

I Free RNA -_

Figure 3. Ribonuclease T1 and T2 digestion assays of synthetic RNA structures. RNA was labelled with [-y-32P]ATP at the 5' end, and digested as described in the Experimental Section. Open arrows show sites of primary ribonuclease T1 cleavage. Solid arrows show sites of primary ribonuclease T2 cleavage. (a) RBC5L RNA. (b) TWJ8 RNA.

Figure 4. Gel mobility shift assay of rev binding to chemically synthesized RNAs Reaction and electrophoresis conditions are as shown in Figure 2 except that electrophoresis was at 80V for 4h (a) RBC5L RNA (b) R33 RNA, or at 100V for 6h (c) TWJ8 RNA

6468 Nucleic Acids Research, 1992, Vol. 20, No. 24 the presence of a large excess of rev (Figure 4a). By contrast, when the bubble structure was incorporated into the 56 residue stem-loop R33 RNA, a second complex was seen at high rev concentrations (Figure 4b). Complex 1, which occurs from high affinity binding of rev to the bubble sequence, appears to be a precursor to complex 2. As rev concentration was increased, the amount of complex 1 decreased and there was a concomitant rise in the level of complex 2. TWJ8 RNA, which carries a 3-way junction structure, was able to form a third complex at high rev concentrations (Figure 4c). Thus it appears that short RNA structures such as RBC5L contain a single high affinity rev binding site, whereas significantly longer RNAs such as R33 and TWJ8 RNA carry sufficient flanking RNA sequences to allow the binding of more than one rev molecule. Filter binding assays were performed to measure the affinity of rev for the synthetic RNAs more precisely. Figure 5a shows a competition filter binding assay where a 32P-labelled 241-residue transcript containing the RRE RNA (R7) (19) is competed for rev binding against increasing amounts of unlabelled R7 transcript or against a synthetic RBC6 duplex RNA. The results show that the D112 (the concentration of competitor required to reduce binding to the filter by 50%) for RBC6 RNA is only about 2-fold increased compared to that of the R7 RNA (Figure Sa). TWJ6 RNA competes for rev binding with the same affinity as RBC6 (Figure Sa). By contrast, when strand III was omitted from the annealing reaction for TWJ6 RNA, a stable bubble structure could not be formed and this RNA failed to compete for rev binding (Figure 5a). Shorter 2-stranded duplex RNAs containing the bubble structure, but having only 4 or 5 flanking base pairs on each side, competed considerably more poorly than RBC6 (data not shown). Figure Sb shows a Scatchard analysis of data obtained from a self-competition binding assay of 32P-labelled RBC6 against

unlabelled RBC6. The plot is linear and the intercept gives a value for the stoichiometry, v, of approximately 1, while the slope of the line indicates a Kd of approximately 5 nM (Figure Sb). The filter binding results are consistent with the data of Cook et al. (26) who showed by a dual-labelling experiment that rev binds to its high affinity site as a monomer and the gel mobility shift assays shown in Figure 7 (see below), which show that only a single complex is formed between rev and the RBC5L or RBC6 RNAs.

Rev binding to chemically modified RNA duplexes Since RBC6 represents the minimum 2-stranded RNA that can bind a single molecule of rev with high affinity, it is a useful model for the more precise delineation of the requirements for specific recognition of the high affinity rev binding site. A series of functional group alterations or replacements at specific nucleoside residues were introduced into RBC6 by annealing an oligonucleotide strand containing one or more functional group modifications together with an unmodified oligoribonucleotide strand (Figure 6). Binding of rev to the modified duplex RNAs was then analysed by a competition filter binding assay, similar to that described in Figure 5a, where increasing concentrations of modified unlabelled duplex RNA were competed for rev binding against 32P-labelled 241-residue RRE R7 RNA. The affinity of the modified RBC6 RNAs for rev could be classified into 3 broad categories: those which exhibited wild-

35 36

RBC6RNA

CG UG U G GC GCAGC3 GCACAC GCGUCG 5 3' A UG 59 61 60

Wild-type affinity (D1/2 = 10 to 20 nM) (a)

0.6

RRE R7 (transcript) RBC6 (unmodified) dG35 dG36

0.4-

N7-deaza-dG36 dG35dG36

0.8

iq

z

IL'( a. Z

oZ CO cr

U-

dl35dl36 dU60

5-Br-U60 N3-Me-U60

0.2\

0

1.0'

5 15 12 15 10 20 15 20 10 15

Intermediate affinity (D1/2 =20 to 100 nM)

20

40 60 Competitor RNA (nM)

N7-deaza-dG35

(b)

o

D1/2 (nM)

d159 dG5g dA61 N6-Me-dA61

30 50

60 40 25

0.8 v

0.60.4

Non-specific binding (D1/2: ,100 nM)

N\a00

N7-deaza-dG34

A35 d161

0.2

00 0.0

0.1

0.2

dG5gdU60dA61

RNA (15-mer) + DNA (14-mer) DNA (I5-mer) + DNA (14-mer)

>>100 >>100 >>100 >>100 >>100

>>100

v

[RNA free (nM)]

Figure 5. (a) Nitrocellulose filter binding assay for rev. Binding reactions contained rev, 32P-labelled RRE R7 RNA, and unlabelled synthetic RNA competitors as described in the Experimental Section. (-) RRE R7, (0) RBC6, (A) TWJ, (A) TWJ6 lacking strand III (rUCUGGCAUAGUGC). (b) Scatchard analysis of rev binding to RBC6 RNA. The intercept shows a 1 to 1 stoichiometry (v).

Figure 6. Affinity of modified RBC6 RNAs for rev. Top, structure of RBC6 RNA. The bases in the bubble are highlighted and numbered according to Heaphy et al. (31). Bottom, summary of competition filter binding assays results. Unlabelled RBC6 RNA carrying functional group alterations was used as a competitor for rev binding to 32P-labelled RRE R7 RNA. The data is expressed as D1/2, the concentration of competitor RNA required to reduce the binding of 32P-labelled RRE RNA to the filter by 50%.

Nucleic Acids Research, 1992, Vol. 20, No. 24 6469 type affinity similar to that of unmodified RBC6 RNA, those of intermediate affinity, and those showing only non-specific binding (Figure 6). Similar results were obtained when the affinities of the modified duplexes were examined by gel mobility shift assay (data not shown). A representative gel mobility shift assay for some deoxyinosine-substituted duplexes is shown in Figure 7.

Configurations of non-Watson-Crick base pairs in the bubble The unusually high degree of ribonuclease protection of the bulged residues within these synthetic duplexes provides strong evidence for the presence of non-Watson -Crick base pairs that add additional stability to the bubble structure. Bartel et al. (23) showed recently that G36 and G59 could be simultaneously replaced by A residues and still maintain wild-type binding of rev. They therefore proposed that the two G-residues form a nonWatson-Crick base pair using each of their 06 and NH' positions respectively (Figure 8), since this type of G: G base pair is isosteric with an A: A pair. Similarly, we have proposed that G35 forms a non-Watson-Crick base pair with A61. We have used synthetic chemistry to distinguish between the various possible pairings in the bubble. We first examined the effect of deoxynucleoside substitution at each of the bulged nucleotides, since several important modified bases are currently only available as deoxynucleosides. Deoxynucleoside substitution at any of positions G35, G36 or U60 had no effect on rev binding. Even the double mutant dG35dG36 bound rev with wild-type affinity. However, deoxynucleoside substitutions at positions G59 and A61 were deleterious and produced a 2 to 4 fold reduction in afffinity for rev. The effects of deoxynucleoside substitutions either side of U60 were

(b)

(a) Rev Conc. (nM) Complex _.

0

RBC6 8.8 88 44

,{

(d)

(c)

dG59 dl35dl36 d159 dl35dl36 118.8 88 8.8 88

180 0

N

..:

44 -1.

180 0

4

so

44

G59 dl35dl36 II

180 0

Mtrn

8.8

88

44

180

sw or

Rev binding in the major groove

Free Duplex RNA _. 1,

Single Stranded RNA _h

additive; rev did not bind specifically to the triple mutant dG59dU60dA61. Rev also did not bind specifically to RBC6 derivatives where the 14 mer strand was replaced with an oligodeoxyribonucleotide or to a dU-substituted DNA duplex with the same sequence as RBC6. The effect of the dI (hypoxanthine deoxyriboside) substitution is to remove the exocyclic amino group of G. If rev is able to bind to deoxyinosine-substituted RNA duplex, then this must contain configurations of the G: G and G: A base pairs which do not require hydrogen bonding to the exocyclic amino group of G. As shown in Figures 6 and 7, deoxyinosines are welltolerated at each of the G positions in the bubble. Rev bound with wild-type affinity to the dI59 mutant and to the dI35dI36 double mutant. Similarly, replacement of G59 with either dG59 or d159 resulted in a comparable loss of binding. To test whether rev could bind to an RBC6 derivative carrying a dI: dI base pair, the binding of rev to the dI35dI36dI59 triple mutant was analysed by a gel mobility shift assay (Figure 7). Rev bound equally well to molecules carrying either the dI59: dI36 base pair, the dG59: d136 base pair or the G59: d136 base pair. Out of the four types of G: G pair that are theoretically possible, only the anti: syn pair shown in Figure 8 is consistent with this data, since this would allow isosteric I: I pairing whereas the other three possible G: G base pairs would require involvement of one or other of the exocyclic amino groups. A similar approach was used to study the configuration of the G35: A61 base pair. Rev affinity was greatly reduced when A61 was replaced by dI or when G35 was replaced by A. No further loss of affinity was seen for either the dI59 substitution or for the N6-methyl-dA61 substitution. There are three possible configurations for the proposed G35: A61 pair that are theoretically possible. Since inosine is tolerated at position 35, one of these structures, which requires bonding through the exocyclic amino group of the G residue, can now be eliminated. The two remaining structures (Figure 8) are consistent with the synthetic mutants so far studied and experiments to distinguish these two possibilities are in progress. Although deletion of the U60 residue causes a dramatic loss of rev affinity (19), binding is not affected by N3-methylation or by 5-bromination of U60 Similarly, substitution of U60 by dU or replacement by C (19), does not affect rev binding. Thus, it is probable that the U60 residue merely acts as a singlestranded spacer which helps to accommodate the distortions of the RNA helix introduced by the G: G and G: A pairs.

w

Figure 7. Complex formation between rev protein and deoxyinosine-substituted RBC6 RNA. Binding reactions (20 1d) contained 0.5% glycerol, 25 nM 32p_ labelled duplex RNA and 0, 8.8, 44, 88 or 180 nM rev protein. After incubation on ice for 15 min, 5 yl of dye was added and electrophoresis carried out at 12 W for 1 h at 4°C in a running buffer of 0.5 xTB (TB = 44.5 mM Tris base, 44.5 mM boric acid, adjusted to pH 8.3 with HCI), 0.1% Triton X-100, 1% glycerol. The gel was dried and the RNA-protein complexes were detected by autoradiography. (a) RBC6 RNA (b) dG59d135dI36 (c) dI59dI35dI36 and (d) G59dl35d136. Note that a dI5dI36 pair is tolerated without loss of rev binding ability.

Mutagenesis and chemical modification experiments have suggested that recognition of specific bases in the stem flanking the bubble sequence is critical for high affinity rev binding (18, 19, 21, 23). In a preliminary experiment, designed to determine whether the recognition of the critical G34 residue by rev involves hydrogen bond contacts in the major groove, G34 was replaced by N 7-deaza-dG (24). Substitution of G34 by N7-deazadG abolished specific rev binding (D1I2 > 100 nM, Figure 6), whereas substitution by dG had only a modest 3-fold effect (D112 =40-50 nM). In similar experiments, substitution of G35 by N7-deaza-dG had an intermediate effect on rev binding compared to the dG control substitution which showed wild-type binding. By contrast, substitution of G36 by N7-deaza-dG had no effect.

6470 Nucleic Acids Research, 1992, Vol. 20, No. 24

DISCUSSION Structure of the 'bubble' The high affinity binding site for rev appears to be a compact double-stranded RNA helix containing a distortion introduced by non-Watson-Crick base pairs and a bulged U residue. The nuclease protection results together with the functional group substitution studies described here provide strong evidence for the presence of both the G36: G59 and the G35: A6 base pairs. Whereas the G: G base pair must be in the anti: syn configuration (Figure 8), the G: A base pair may be in either the anti: syn or in the anti: anti configuration. Non-Watson -Crick base pairs have also been found in other RNA structures. A: A and G: A pairs are found in one stem of Xenopus laevis 5S RNA (27). Recent nmr data suggests that in the context of this quite different RNA duplex, the G : A and A : A pairs are both in an anti: anti configuration (28). Rev recognition of the high affinity binding site The minimal synthetic RNA duplex (RBC6) which can bind rev with high affinity consists of 12 Watson-Crick base pairs enclosing a bubble structure of 5 nucleotides. From our earlier data (19), specific base contacts with rev lie within the region covering the bubble and two base pairs on either side. However, since short RNA duplexes with less than 6 flanking base pairs are unable to bind rev with high affinity, further non-specific contacts must extend the region of duplex RNA covered by rev. The footprinting data of Kjems et al. (18) on a minimal stemloop carrying the bubble structure support the view that a total of 10 to 14 base pairs, including the non-Watson-Crick base pairs in the bubble, are covered by rev. The footprinting data suggests also that coverage of the high affinity site is asymmetric with respect to the number of pairs covered on each side of the bubble, with fewer pairs covered on the side of the 3-way junction. Our results to date are strongly reminiscent of the binding of tat to TAR RNA (24, 25, 29-31). Base-specific recognition of

TAR RNA by tat occurs at positions flanking a U-rich bulge. It is the bulged residues in TAR RNA that create a severely distorted major groove. Similarly in the rev-RRE RNA interaction, since N7-deaza-substitution at G34 or G35 leads to substantial loss of rev binding ability, it seems likely that recognition of the bubble by rev takes place in the major groove of the RNA duplex. Major groove binding was very recently proposed by Kjems et al. (18) based on the protection afforded by a rev-related short peptide to N7-modification by diethylpyrocarbonate (DEPC) of G-residues in the bubble region. One disadvantage of the DEPC reaction is that it introduces a bulky carboxyethyl group which may give rise to steric clash blocking rev binding. Our chemical approach rules out this possibility since functional groups, such as the nitrogen atom at N7, can be selectively removed. However, neither the chemical modification nor the chemical synthesis approach can fully discriminate between direct hydrogen-bonding contacts between rev and RNA and internal RNA-RNA hydrogen-bonding interactions, since the loss of either type of contact could potentially disrupt rev binding.

Progressive assembly of rev-RRE complexes Following high affinity binding of rev at the bubble structure, subsequent lower affinity binding requires a stretch of neighbouring duplex RNA, such as is presented in the linear R33 RNA and in the 3-way junction TWJ8 RNA. Multiple rev complex formation on the RRE requires the initial binding to the high affinity bubble site since mutations such as the AG35-36 mutation can block both processes. The regular nature of the proposed secondary structure for the RRE, consisting of two sets of 3-armed duplexes (each set containing a 3-way junction) symmetrically placed on either side of a long duplex stem (stem I) (Figure 1), suggests that after initial recognition of the bubble on one arm, there is an ordered recognition of the other 5 arms, but the precise details of rev assembly on the RRE are not yet understood. Syn

Syn

(a)

Anti

N

N

(b) Anti

HH sN

N0t

NN

H,s

SNN

0

,

.

H

Syn (c)

,N-H

Anti

R

(d)

Anti

f

H-N'H N

'.

-N G

R,_O N\40"N Figure 8. Structures of non-Watson-Crick base pairs found in the bubble. (a) The configuration of the G36: G59 pair in the bubble, (b) the stucture of the isosteric I36: 159 pair, (c and d) the two possible configurations for the G35: A61 pair.

Nucleic Acids Research, 1992, Vol. 20, No. 24 6471 Mutagenesis studies strongly suggest that nucleation at the high affinity rev binding site and oligomerization at flanking sites also takes place in vivo. Rev activity is abolished by deletion or disruption of the high affinity binding site as well as by mutations that disrupt flanking double-stranded regions in the RRE (12, 13, 16, 32 -34). Preliminary results suggest that complexes between rev and HIV mRNAs carrying RRE sequences can be immunoprecipitated from infected cells (35). Thus, the assembly of rev protein on viral mRNAs carrying RRE sequences represents an essential step in the HIV life-cycle. A detailed biochemical understanding of the assembly process should prove helpful in the development of screens for small molecules that interfere with either high affinity RNA recognition or the subsequent oligomerization of rev and thereby act as specific antiHIV therapeutic agents.

EXPERIMENTAL SECTION Chemical synthesis of modified oligoribonucleotides Oligoribonucleotides were synthesised by the phosphoramidite method on a 1 Amol scale using an ABI 380B DNA/RNA Synthesizer programmed for 10 minute coupling times essentially as previously described (36). N,N-diisopropyl-2-cyanoethylphosphoramidites were obtained from Millipore (uridine, N4-benzoylcytidine, N2-isobutyrylguanosine and N6-benzoyladenosine) or from ABN (uridine, N4-benzoylcytidine, N2-phenoxyacetylguanosine and N6-phenoxyacetyladenosine). Oligoribonucleotides containing single residue modifications were synthesized using ABN ribo amidites and phosphoramidite derivatives of the following modified nucleosides: N2-isobutyryl-7-deaza-2'-deoxyguanosine, N6-methyl-2'-deoxyadenosine, 2'-deoxyinosine (Glen Research via Cambio), N6-benzoyl-2'-deoxyadenosine, N2-isobutyryl-2'-deoxyguanosine, 2'-deoxyuridine (Cruachem). 5-bromouridine phosphoramidite was prepared by the route of Talbot et al (37) except that silylation was carried out as described by Green et al. (38). N3-methyluridine phosphoramidite was prepared by 5'-dimethoxytritylation, 2 '-silylation and 3'-phosphitylation of N3-methyluridine (39) similarly to the reactions used by Green et al. for synthesis of an inosine phosphoramidite (38). Oligonucleotides were cleaved from the support and base-deprotected by one of the following methods: (1) for oligoribonucleotides containing dA, dl, N3-methyl-U, or 5-bromo-U; saturated methanolic ammonia at room temperature for 24 h. (2) for oligoribonucleotides containing dG or N7-deaza-dG; ethanol/30% aqueous ammonia solution (1/3) at 550 for 16 h. (3) for oligoribonucleotides containing N6-Me-dA; ethanol/ethanolamine (1 : 1) at room temperature for 48 h. followed by 55° for 12 h. (40) (4) for oligoribonucleotides prepared using Millipore unmodified ribo-amidites: ethanol/30% aqueous ammonia solution (1 : 3) at room temperature for 2 h followed by 550 for 16 h. The support was removed by centrifugation or by filtration and the solution was evaporated to dryness (Savant Speed Vac for aqueous ammonia samples, rotary evaporator for methanolic samples). 2'-O-t-butyldimethylsilyl groups were removed by resuspension and treatment with 1 M tetrabutylammonium fluoride (TBAF) dissoved in tetrahydrofuran (1 ml, Aldrich) at room temperature for 24 h. Aliquots (0.2 ml) were quenched with 0.8 ml of 0.1 M triethylammonium acetate solution (pH 7) and desalted on a Sephadex G25 NAPlO column (Pharmacia). Alternatively after TBAF treatment, most of the tetrahydrofuran was removed by brief rotary evaporation, the residue dissolved

in water (1 ml) and desalted on a Sephadex G25 NAPlO column. Yields of crude oligonucleotides ranged between 50 and 100 A260 units. Oligonucleotides were purified by strong anion exchange HPLC using a Partisil 10 SAX (Whatman) semipreparative column (Hichrom) or by reversed phase HPLC (,u-Bondapak C18, Waters) as previously described (36). The base composition of the oligonucleotides was assayed by digestion of an aliquot of oligonucleotide (500 pmol) in 0.3 M Tris-HCl buffer (pH 8.9) with snake-venom phosphodiesterase (0.25 ug) and calf alkaline phosphatase (0.25 ug) for 18h at 37°C. The resulting nucleosides were separated by reversed phase HPLC separation using a buffer of 0.1 M triethylammonium acetate (pH 6.3) and a gradient of 0 to 15% acetonitrile run for 20 minutes. Elution times (minutes) were: C (6.1), U (7.9), G (15.7), A (20.0). Modified nucleosides were eluted at the following times with respect to the elution time of A: dU (-8.9), dl (-4.0), 5-Br-U (-3.4), dG (-3.0), N3-Me-U (-2.9), dT (-2.1), dA (+1.6), N6-Me-dA (+5.8). N7-deaza-dG coeluted with A. Oligonucleotides were labelled at their 5' ends by treatment with [Ly-32P]ATP and T4 polynucleotide kinase as previously described (41). Thermal denaturation analysis was carried out using a Perkin-Elmer X-15 uv melting apparatus. Oligonucleotides were dissolved in 0.1 M sodium phosphate (pH 7.2) buffer and melting points were recorded at 260 nm (42) at a heating rate of I ° per minute over a temperature range of 20 to 90°C. Duplexes and 3-stranded complexes were formed by heating equimolar quantitities of two oligonucleotides together to 900 and allowing the mixture to cool slowly to 4°.

Ribonuclease digestion of synthetic RNAs A solution (1 Al) of annealed oligonucleotides forming RBCSL or TWJ8 where only one strand was 32P-labelled (10 AM, 4 x 105 cpm/,4l) was mixed with a solution (2.5,ul) containing 60 mM Tris-HCl (pH 7.8), 40 mM MgCl2 and 600 mM KCl, and a solution (1.5 dl) of RNase T1 (0.067 to 0.67 units/4l) or RNase T2 (0.017 to 0.67 units/il) was added. After 30 minutes on ice, 0.5 M EDTA (15 1l) and formamide containing xylene cyanol and bromophenol blue (60 itl) were added and the mixtures were denatured at 750 for 2 minutes and cooled rapidly in ice/water. Aliquots (2 Al) of each sample were applied to a 20 % polyacrylamide gel containing 7 M urea (O.5 x 360 mm) and electrophoresis carried out at 20 W for 2.5 h.

Preparation of transcript RNAs 32P-labelled RRE R7 RNA was prepared by T7 RNA polymerase transcription of HindlIl cut pGEM plasmids as previously described (15, 19). RRE (R7) RNA is a 241-mer containing 225 residues (7786-8010) of HIV-lARv and contains 15 extra residues at the 5' end and a single A residue at the 3' end derived from the pGEM vector. RRE (R540. 1) RNA and RRE (RIO. 1) RNA were prepared from RRE sequences cloned into pBluescript vectors (Stratagene). RRE R540.1 (Figure 1) is a 276-mer containing 225 residues (7786-8010 of HIV-lARV together with an extra 50 residues at the 5 '-end and a single U residue at the 3 '-end derived from the pBluescript vector. RRE RIO. 1 is identical to RRE R540.1 except that it carries the AG35_36 mutation (a deletion of the G residues 7826 and 7827). To prepare these plasmids, PCR reactions were carried out on RRE7 plasmid DNA (1 jg) using 0.5 zM oligonucleotide primers, 80 AAM dNTPs, 0.1 mg/mi BSA and 2 units Vent DNA polymerase in 200 tl of Vent buffer (New

6472 Nucleic Acids Research, 1992, Vol. 20, No. 24 England Biolabs). The PCR reactions were performed using a maximum of 30 cycles of incubation at 94°C for 1 minute, 55°C for 1 minute and 72°C for 2 minutes. Oligonucleotide primers, fully matched for R540.1 or containing the AG35 36 mutation for RIO. 1, also contained Clal or XbaI linker ends to permit subsequent cloning. PCR products were digested with Clal and XbaI and purified by electrophoresis on 2% agarose gels. The purified fragments were cloned into pBluescript which had been predigested with ClaI and XbaI. The resultant plasmid DNAs (DM540. 1 and DM10. 1) were digested with XbaI and transcribed using T3 RNA polymerase as previously described (43).

Rev binding assays Rev protein was obtained essentially as previously described (19) except that it was chromatographed on Heparin-Sepharose and Superose 12 after refolding. The rev protein binds tightly to Heparin and was eluted in 2 M NaCl. Rev protein stocks were stored in aliquots in liquid nitrogen in a buffer containing 50 mM Tris-HCl (pH8.0), 200 mM NaCl, 0.1% Triton X-100, 1 mM DTT, 0.1 mM EDTA. Filter binding reactions (0.5 ml) contained TK buffer (50 mM Tris-HCl buffer (pH 7.9), 20 mM KCI), 10 nM rev protein, 1.5 nM 32P-labelled RRE R7 RNA, 12 units RNasin (Promega), 0.375 Ag tRNA, 0.75 ,ug DNA, and 0 to 100 nM unlabelled competitor duplex RNA and incubated on ice for 15 minutes. The binding reactions were filtered through 25 mm GS filters (0.22 1l pore size, Millipore), washed with ice cold TK buffer, dried and counted by liquid scintillation, as previously described

(19).

Scatchard analysis of rev binding to RBC6 RNA was performed in 0.5 ml reactions in TK buffer which included 1.5 nM 32plabelled RBC6 RNA duplex (approximately 20,000 cpm), 25 nM rev protein, 40 units RNasin (Promega), 0.1% Triton X-100 and varying concentrations of unlabelled RBC6 RNA duplex. After binding for 15 minutes on ice, the solutions were filtered through GS filters and counted as described above. Gel mobility shift assays were performed essentially as described (15, 29). Binding and electrophoresis conditions are given in the Figure legends.

ACKNOWLEDGEMENTS We thank M.J.Churcher for advice on gel mobility shift assays, A.D.Lowe, S.M.Green, and M.Singh for technical assistance, and our colleagues at LMB for advice and helpful discussions. S.Iwai is very grateful to the Japan Society for the Promotion of Science and to the Ministry of Education, Science and Culture, Japan, for fellowship awards.

REFERENCES 1. Cullen, B.R. and Malim, M.H. (1991) Trends in Biochemical Sciences, 16,

346-350. 2. Karn, J., Dingwall, C., Gait, M.J., Heaphy, S. and Skinner, M.A. (1991) in Eckstein, F. and Lilley, D.M.J. (eds.) Nucleic Acids and Molecular Biology, Springer-Verlag, Berlin, Vol 5, 194-218. 3. Arrigo, S.J. and Chen, I.S.Y. (1991) Genes & Devel., 5, 808-819. 4. D'Agostino, D.M., Felber, B.K., Harrison, J.E. and Pavlakis, G.N. (1992) Mol. Cell Biol., 12, 1375-1386. 5. Lawrence, J.B., Cochrane, A.W., Johnson, C.V., Perkins, A. and Rosen, C.A. (1991) New Biol., 3, 1220-1232. 6. Malim, M.H., Hauber, J., Fenrich, R. and Cullen, B.R. (1988) Nature, 335, 181-183.

7. Kjems, J., Brown, M., Chang, D.D. and Sharp, P.A. (1991) Proc. Natl. Acad. Sci. USA, 88, 683-687. 8. Chang, D.A. and Sharp, P.A. (1989) Cell, 59, 789-795. 9. Malim, M.H., Hauber, J., Le, S.-Y., Maizel, J.V. and Cullen, B.R. (1989) Nature, 338, 254-257. 10. Emerman, M., Vazeaux, R. and Peden, K. (1989) Cell, 57, 1155-1165. 11. Felber, B.K., Hadzopoulou-Cladaras, M., Cladaras, C., Copeland, T. and Pavlakis, G.N. (1989) Proc. Natl. Acad. Sci. USA, 86, 1495-1499. 12. Dayton, E.T., Konings, D.A.M., Powell, D.M., Shapiro, B.A., Butini, L., Maizel, J.V. and Dayton, A.I. (1992) J. Virol., 66, 1139-1151. 13. Holland, S.M., Chavez, M., Gerstberger, S. and Venkatesan, S. (1992) J. Virol., 66, 3699-3706. 14. Daly, T.J., Cook, K.S., Gary, G.S., Maione, T.E. and Rusche, J.R. (1989) Nature, 342, 816-819. 15. Heaphy, S., Dingwall, C., Emberg, I., Gait, M.J., Green, S.M., Karn, J., Lowe, A.D., Singh, M. and Skinner, M.A. (1990) Cell, 60, 685-693. 16. Malim, M.H., Tiley, L.S., McCam, D.F., Rusche, J.R., Hauber, J. and Cullen, B.R. (1990) Cell, 60, 675-683. 17. Zapp, M.L. and Green, M.R. (1989) Nature, 342, 714-716. 18. Kjems, J., Calnan, B.J., Frankel, A.D. and Sharp, P.A. (1992) EMBO J., 11, 1119-1129. 19. Heaphy, S., Finch, J.T., Gait, M.J., Karn, J. and Singh, M. (1991) Proc. Natl. Acad. Sci. USA, 88, 7366-7370. 20. Malim, M.H. and Cullen, B.R. (1991) Cell, 65, 241-248. 21. Tiley, L.S., Malim, M.H., Tewary, H.K., Stockley, P.G. and Cullen, B.R. (1992) Proc. Natl. Acad. Sci. USA, 89, 758-762. 21. Wingfield, P.T., Stahl, S.J., Payton, M.A., Venkatesan, S., Misra, M. and Steven, A.J. (1991) Biochemistry, 30, 7527-7534. 23. Bartel, D.P., Zapp, M.L., Green, M.R. and Szostak, J.W. (1991) Cell, 67, 529-536. 24. Hamy, F., Asseline, U., Grasby, J., Iwai, S., Pritchard, C., Slim, G., Butler, P.J.G., Karn, J. and Gait, M.J. (1992) J. Mol. Biol., in press. 25. Weeks, K.M. and Crothers, D.M. (1991) Cell, 66, 577-588. 26. Cook, K.S., Fisk, G.J., Hauber, J., Usman, N., Daly, T.J. and Rusche, J.R. (1991) Nucl. Acid Res., 19, 1577-1583. 27. Westhof, E., Romby, P., Romaniuk, P., J.-P., E., Ehresmann, C. and Ehresmann, B. (1989) J. Mol. Biol., 207, 417-431. 28. Wimberly, B., Varani, G. and Tinoco, I. (1992) Biochemistry, in press. 29. Churcher, M., Lamont, C., Dingwall, C., Green, S.M., Lowe, A.D., Butler, P.J.G., Gait, M.J. and Karn, J. (1992) J. Mo. Biol., in press. 30. Puglisi, J.D., Tan, R., Calnan, B.J., Frankel, A.D. and Williamson, J.R. (1992) Science, 257, 76-80. 31. Delling, U., Reid, L.S., Bamett, R.W., Ma, M.Y.-X., Climie, S., SumnerSmith, M. and Sonenberg, N. (1992) J. Virol., 66, 3018-3025. 32. Olsen, H.S., Nelbrock, P., Cohrane, A.W. and Rosen, C.A. (1990) Science, 247, 845-848. 33. Holland, S.M., Ahmad, N., Maitra, R.K., Wingfield, P. and Venkatesan, S. (1990) J. Virol., 64, 5966-5975. 34. Cochrane, A.W., Chen, C.-H. and Rosen, C.A. (1990) Proc. Natl. Acad. Sci. USA, 87, 1198-1202. 35. Arrigo, S.J., Heaphy, S. and Haines, J.K. (1992) J. Virol., 66, 5569-5575. 36. Gait, M.J., Pritchard, C. and Slim, G. (1991) in Eckstein, F. (ed.),Oligonucleotides and analogues: a practical approach, IRL Press: Oxford, UK. pp 25-48. 37. Talbot, S.J., Goodiman, S., Bates, S.R.E., Fishwick, C.W.G. and Stockley, P.G. (1990) Nucleic Acids Res., 18, 3521-3528. 38. Green, R., Szostak, J.W., Benner, S.A., Rich, A. and Usman, N. (1991) Nucd. Acids Res., 19, 4161-4166. 39. Zemlicka, J. (1970) Collect. Czech. Chem. Commun., 35, 3572-3583. 40. Polushin, N.N., Pashkova, I.N. and Efimov, V.A. (1991) Nucl. Acids Res. Symp. Series, 24, 49-50. 41. Slim, G. and Gait, M.J. (1991) Nucd. Acids Res. 19, 1183-1188. 42. Brown, T., Leonard, G.A., Booth, E.D. and Kneale, G. (1990) J. Mol. Biol., 212, 437-440. 43. Dingwall, C., Ernberg, I., Gait, M.J., Heaphy, S., Karn, J. and Skinner, M.A. (1991) in Kumar, A. (ed.), Adwznces in Molecular Biology and Targeted Treatment for AIDS, Plenum: New York. pp 133-143.