Fish & Shellfish Immunology 42 (2015) 256e263
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Recombinant expression and characterization of a serine protease inhibitor (Lvserpin7) from the Pacific white shrimp, Litopenaeus vannamei Yongjie Liu, Fujun Hou, Xianzong Wang, Xiaolin Liu* College of Animal Science and Technology, Northwest A&F University, Shaanxi Yangling 712100, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 5 September 2014 Received in revised form 2 November 2014 Accepted 6 November 2014 Available online 20 November 2014
Serine protease inhibitors (serpins) are widely known to its inhibitory role on proteases involved in the immune responses. Herein, a novel serine protease inhibitor (Lvserpin7), encoding for 411 amino acids with calculated molecular mass of 46.29 kDa and isoelectric point of 6.98 was characterized from the Pacific white shrimp Litopenaeus vannamei. Lvserpin7 shared 92.9% identities to Penaeus monodon serpin7. Among the tested tissues, Lvserpin7 was mainly expressed in hemocytes and gill. The expression profiles analysis indicated that Lvserpin7 was significantly up-regulated in the early stage upon Vibrio anguillarum, Micrococcus lysodeikticus or White Spot Syndrome Virus (WSSV) infection. Fusion protein expression was induced by IPTG, and the purified recombinant Lvserpin7 protein (rLvserpin7) binds to both the Gram-positive and Gram-negative bacteria. Also rLvserpin7 exhibited inhibitory activity against the proteases secreted by Bacillus subtilis. Moreover, rLvserpin7 showed inhibition role on prophenoloxidase activation. To recap, we proposed that Lvserpin7 was implicated in the shrimp immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Litopenaeus vannamei Serpin7 Prophenoloxidase Proteases Immunity
1. Introduction Shrimps, like other invertebrates, lack an adaptive immune system and defend against foreign invaders through a non-specific innate immunity [1]. There are two different responses in innate immunity, the cellular and humoral responses [2e4]. Among the immune processes, for instance, blood coagulation, complement activation, encapsulation, phagocytosis, melanization and antimicrobial peptide synthesis are activated by proteases cascade [5e7]. Note that excessive proteases will disturb the balance and cause damage to the body, and necessarily, the extent of proteolysis needs to be subject to control [8]. Serine protease inhibitors (SPIs) are group of proteins that are used to assume such a role [9e11]. To date, varieties of SPIs families, namely, Kazal, Kunitz, BowmaneBirk, serpin and a-macroglobulin have been characterized [8,11,12]. Serpins among them are a superfamily of proteins folding into a conserved tertiary structure with a reactive center loop (RCL) near the C-terminus, which acts as a bait for target proteases [13].
* Corresponding author. Tel.: þ86 029 87054333; fax: þ86 029 87092164. E-mail address: [email protected] (X. Liu). http://dx.doi.org/10.1016/j.fsi.2014.11.001 1050-4648/© 2014 Elsevier Ltd. All rights reserved.
The exposed RCL protein motif contains a scissile bond between two amino acid residues, called P1 and P10 [14,15]. Once the bond is cleaved by a target protease, the serpin rapidly undergoes a conformational change and traps the proteases in an inactive state, and further results in irreversible inhibition of the proteases [16,17]. Serpins act as suicide-like substrates, irreversibly inhibit the target proteases and are found to be involved in the regulation of proPO system [8]. In Drosophila melanogaster, serpin-27A functions as a negative inhibitor of proPO activation by inhibiting the proPO activating enzyme (PPAE) [18]. In Manduca sexta, serpin-3, -6 and -7 have been characterized and shown to block proPO activation by inhibiting prophenoloxidase activating proteinases (PAPs) in the hemolymph [19e22]. Invariably, varieties of serpins have been identified in crustaceans and show regulatory role on proPO activation. EsSerpin identified from hemocyte of Eriocheir sinensis was reported have the ability on inhibition of bacterial growth and regulation of prophenoloxidase-activating system [23]. Pmserpin3 and Pmserpin8 from Penaeus monodon showed inhibition on prophenoloxidase system [24,25]. What's more, our previous study showed that Lvserpin blocks the proPO activation by inhibiting trypsin activity in Litopenaeus vannamei [26].
Y. Liu et al. / Fish & Shellfish Immunology 42 (2015) 256e263
As one of the important aquatic animals in China, the Pacific white shrimp L. vannamei suffers various diseases caused by microorganisms during culture [27,28]. The shrimp farming has encountered serious production decline and large economic losses. Study of the potential immune-related genes may be constructive to the better understanding of its immune defense mechanisms and the development of better disease management strategies. In the present study, a novel serpin, namely Lvserpin7, was identified from L. vannamei. The tissue distribution and immune responsive to Vibrio anguillarum, Micrococcus lysodeikticus and WSSV were investigated. Moreover, Lvserpin7 was expressed in Escherichia coli, and the purified rLvserpin7 was used for the investigation on inhibition of proteases activity and prophenoloxidase activation. 2. Materials and methods 2.1. Data mining and cloning of Lvserpin7 cDNA sequence The marine genomics EST database (http://www. marinegenomics.org/) was searched by homology for nucleotide sequence clusters corresponding to the serpin genes. Based on the EST clone, sequence specific primers (Spn7-F; Spn7-R) were designed to amplify the Open Reading Frame (ORF) (Table 1). The PCR products were cloned into the pUC-18T vector (CWBIO, China), then, transformed into the competent cells of E. coli DH5a. The potentially positive recombinant clones were identified by colony PCR. Then the positive recombinants were picked for sequencing.
To determine tissue expression of Lvserpin7 gene, hemocytes, gill, hepatopancreas, eyestalk, stomach, muscle, intestine, nerve, heart and testis were collected from normal shrimp. For the expression analysis of Lvserpin7 gene in response to pathogen infection, V. anguillarum, M. lysodeikticus and WSSV were selected. Twenty microliter of live V. anguillarum (4 108 CFU/ml), M. lysodeikticus (4 1010 CFU/ml) and tissue suspension prepared from WSSV-infected shrimp suspended in Phosphate Buffered Saline (PBS) were injected respectively into the last abdominal segment. And the shrimps which received an injection of 20 ml PBS were employed as control. Then three shrimps were randomly sampled from each group at 0, 2, 6, 12, 24 and 48 h post injection (hpi). The hemolymph was collected into a sterilized syringe with an equal volume of anticoagulant modified Alsever solution (27 mM sodium citrate, 336 mM NaCl, 115 mM glucose, 9 mM EDTA, pH 7.0), and centrifuged (800 g at 4 C for 10 min) immediately to collect hemocytes [29]. All the samples were preserved in liquid nitrogen immediately for further processing. 2.4. Total RNA extraction and cDNA synthesis The collected tissues were homogenized in 1 ml Trizol (Invitrogen, USA) and then were used for total RNA extraction following the manufacturer's instructions. After verifying the RNA quality and measuring the RNA concentration, 500 ng of the obtained RNA was used as a template for first stand cDNA synthesis using the PrimeScript® RT Reagent Kit with gDNA Eraser (TaKaRa, Japan). 2.5. Semi-quantitative RT-PCR and quantitative real-time PCR analysis of Lvserpin7 expression
2.2. Bioinformatics analysis Nucleotide and protein sequence similarities were conducted with BLAST program (http://blast.ncbi.nlm.nih.gov/Blast) and Matrix Global Alignment Tool (MatGAT) (http://bitincka.com/ledion/ matgat/). Multiple sequence alignment was created using the ClustalW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/). The protein motif features were predicted by Simple Modular Architecture Research Tool (http://smart.emblheidelberg.de/). Signal peptide was predicted with SignalP3.0 program (http://www.cbs.dtu.dk/ services/SignalP/). The phylogenetic tree was constructed based on the amino sequences alignment by the neighbor-joining (NJ) algorithm embedded in MEGA5.0 program with bootstrap trial 1000 replicates. 2.3. Sample preparation Healthy L. vannamei averaging 15e18 g in weight were collected from a local shrimp farm in Zhanjiang, Guangdong province, China, and acclimatized in tanks for a week before processing.
Table 1 Sequences of primers used in this research. Primer
Objective
Tm ( C)
Sequence (50 e30 )
Spn7-F Spn7-R rSer7-F
ORF amplification
55
Protein expression
66
CAGAACGAAAGAGGTGTCAG AATATATGTATATATCATAAC CGGGGTACCCAGTGTTTCACCG ACAACGACGA (KpnI, italic) CCGGAATTCCTAACTTCCTGCC GTGTCGGGAT (EcoRI, italic) TCGGCGTTCATCATCGCTTAC GGCGTTGTTGCTGGTTTGG CACGAGACCACCTACAACTCCATC TCCTGCTTGCTGATCCACATCTG
rSer7-R S7t-F S7t-R Actin-F Actin-R
257
Real-time RT-PCR
60
Real-time RT- PCR
60
The tissue distribution of Lvserpin7 expression was analyzed via RT-PCR using the RT primers (Table 1). The PCR procedure was set as follows: 1 cycle at 94 C for 5 min; followed by 35 cycles of 94 C for 30 s, 58 C for 1 min, and 72 C for 30 s; and a final cycle at 72 C for 10 min b-actin gene was used as an internal control with primers Actin-F and Actin-R (Table 1). Quantitative real-time PCR (qRT-PCR) was carried out in a CFX Manager system (Bio-Rad, USA). Sequence specific primers, S7t-F and S7t-R (Table 1) were designed to amplify a product of 141 bp, which was used to determine the expression of Lvserpin7. The bactin from L. vannamei, amplified with primers Actin-F and Actin-R (Table 1), was chosen as reference gene for internal standardization. The qRT-PCR was carried out in a total volume of 20 ml, containing 10 ml SYBR Green Super mix (CWBIO, China), 2 ml of diluted cDNA, 0.4 ml of each primer (10 pmol/ml) and 7.2 ml nuclease-free water. The PCR program was 95 C for 10 min, followed by 40 cycles of 95 C for 15 s, 60 C for 1 min. To verify the amplification of a single product, dissociation curve analysis was performed at the end of each PCR reaction. The relative expression to controls was determined by the 2DDCT method [30]. All data represented means ± standard deviation and were subjected to a one-way analysis of variance (ANOVA) followed by Duncan's multiple range test using the SPSS 18.0 program. Differences were considered statistically significant at P < 0.05. 2.6. Construction, inducible expression and purification of Lvserpin7 The recombinant Lvserpin7 protein was produced in an E. coli expression system. The mature peptide of Lvserpin7 was amplified using forward primer rSer7-F and reverse primer rSer7-R (Table 1) with restriction sites of KpnI and EcoRI added to the 50 end respectively. Both the purified PCR product and the pET32a vector plasmid were digested with KpnI and EcoRI and then ligated to
258
Y. Liu et al. / Fish & Shellfish Immunology 42 (2015) 256e263
produce the recombinant clone. Being confirmed by restriction enzyme and sequencing, the recombinant plasmid was transformed into the E. coli BL21 pLysS (DE3) strain. Then a colony containing the recombinant plasmid was incubated in LB broth at 37 C with shaking at 220 rpm. When the OD600 reached 0.6e0.8, the cells were incubated for additional 18 h at 16 C with the induction of isopropyl-b-D-thiogalactoside (IPTG) at a final concentration of 0.1 mM. The harvested cells were resuspended in ice cooled PBS (pH 7.4) and sonicated for 30 min on ice. After sonication, the cell lysate and inclusion bodies were separated by centrifugation at 10,000 g for 30 min at 4 C. The soluble rLvserpin7 was purified using a ProteinIso™ Ni-NTA Resin (TransGen, China). The supernatant was loaded onto a Ni2þchelating column chromatography which had been previously equilibrated with the binding buffer (300 mM NaCl, 50 mM NaH2O4, 10 mM imidazole and 10 mM Tris base, pH 8.0). Then, the rLvserpin7 protein was eluted with 150 mM imidozol in 10 mM Tris base, pH 8.0 containing 300 mM NaCl and 50 mM NaH2O4. The purity of rLvserpin7 was analyzed by 12% sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) and the protein content was determined by the Bradford assay [31].
2.9. Prophenoloxidase inhibitory assay Hemolymph was withdrawn from L. vannamei using 200 ml of sodium citrate per 1 ml of hemolymph. Hemocytes was collected by centrifugation and lysed in CAC buffer (10 mM sodium cacodylate pH 7 and 10 mM CaCl2). The lysate was centrifuged at 10,000 g for 10 min at 4 C to separate the hemocyte lysate supernatant (HLS). The protein content of HLS was determined using Bradford method [31]. The PO activity assay was modified from that described by Wang et al. [36]. Appropriate amount of HLS protein was mixed with rLvserpin7 to the final concentration of 3.8 mM with the adjustment of CAC buffer in the volume of 165 ml in a 96-well microtiter plate. The reaction was activated by adding 10 ml of lipopolysaccharides (1 mg/ml), and incubated at room temperature for 5 min. Twentyfive microliters of 3 mg/ml L-3, 4-dihydroxy phenylalanine (L-Dopa) (Sigma) was added to start the reaction. After incubated at room temperature for 25 min, then the absorbance at 490 nm was measured with a microplate reader. Likewise, 5 mM of His-tagged pET32a protein and CAC buffer only were added as controls. 3. Results
2.7. Binding of rLvserpin7 to microorganisms 3.1. Identification and structural features of Lvserpin7 Binding activities of rLvserpin7 to microorganisms were assayed based on the procedure by Zhang et al. [32]. Bacteria, Bacillus subtilis, M. lysodeikticus and V. anguillarum were selected to perform this assay. Five milliliter of overnight cultured bacteria was centrifuged at 10,000 g for 5 min then the resulting pellets were washed twice with 1 ml of 1 PBS, and finally resuspended in 200 ml 1 PBS. Then an equal volume of purified rLvserpin7 protein (1.65 ng/ml) was incubated with these microorganisms (2 107 CFU) with gentle rotation at 37 C for 1 h. After washing the microorganisms four times with 200 ml of 1PBS, 100 ml of 7% SDS was used to elute the bacteria. Then the fourth-time PBS wash fraction, the 7% SDS elution and the final pelleted bacteria were analyzed using 12% SDS-PAGE. The result was demonstrated through western blot analysis. His-tagged pET32a protein was used as the negative control. 2.8. Proteases activity inhibitory assay The proteases inhibitory assay was performed from the disc diffusion technique [33]. Briefly, a single B. subtilis colony was picked up and placed on a skim milk plate (1% skim milk, 1% agar). Then a piece of paper disc with 10 ml of rLvserpin7 (1.8 mg/ ml) was located upon the microbial colony. After over-night incubation at 37 C, the skim milk plate was observed for the transparent zone. 1 PBS, His-tagged pET32a protein (2.5 mg/ml), and heat-inactivated rLvserpin7 (1.8 mg/ml) were used as negative controls. In another method [34], 5 ml of B. subtilis, M. lysodeikticus or V. anguillarum were cultured overnight at 37 C, and centrifuged at 10,000 g for 2 min. Then the resulting pellets were washed twice in reaction buffer (10 mM NaCl, 100 mM TriseHCl, pH 8.0) and centrifuged at 10,000 g for 5 min. The supernatant was collected and used as the secreted protease. Fifteen microliter of the washed supernatant was incubated with rLvserpin7 (1.8 mg/ml) at 37 C for 5 min. Then, 30 ml of 1% casein was added into the mixture and incubated for 1 h at 37 C in a final volume of 75 ml. Finally, 75 ml of 5% trichloroacetic acid (TCA) was added to stop the reaction and the enzymatic activity was determined via the Folin phenol method [35]. His-tagged pET32a protein (2.5 mg/ml) was used as the negative control. Each reaction was carried out in triplicate.
In this study, a novel Lvserpin cDNA sequence (GenBank Number: KF442979.1) with length 1496 bp was obtained, in which containing a 1236 bp open reading frame (ORF) flanked by a 100 bp 50 UTR and a 160 bp 30 UTR (Fig. S). The cDNA encodes a polypeptide (GenBank Number: AGZ91893.1) of 411 amino acids (aa) with a theoretical molecular weight of 46.29 kDa and an isoelectronic point of 6.98. A putative signal peptide of 19 amino acids (Fig. 1A) and a characteristic serpin domain (E-value ¼ 5.25e101) was found. In addition, the PROSITE database indicated that a highly conserved hinge region (353EEGTEAAAAT362) and a serpin signature sequence (379FHCNRPFLFLI389) were located at the C-terminus of the deduced amino acid sequence (Fig. 1B). 3.2. Sequence homology analysis Blastx analysis suggested that Lvserpin7 shared the significant homology to the P. monodon serpin7. To further study the sequence homology, serpin sequences from shrimp, crab, insect, cow, Xenopus laevis and Homo sapiens were selected for similarity analysis (Table 2). Data showed that Lvserpin7 exhibited 73.1e92.9% identities to other shrimp serpins with the highest identity to P. monodon serpin7 (92.9%) and 52.0e58.0% identities to other invertebrate serpins. Phylogenetic analysis by MEGA 5.0 software further supported the sequence similarity (Fig. A). The distance tree showed that Lvserpin7 with Pmserpin7 and Marsupenaeus japonicus serpin were all clustered in the same group as the Fenneropenaeus chinensis serpin. 3.3. Distribution of Lvserpin7 in shrimp tissues RT-PCR analysis was performed to determine the Lvserpin7 expression in 10 shrimp tissues. As shown in Fig. 2, Lvserpin7 was highly expressed in hemocytes and gill, weakly expressed in testis, heart, muscle and intestine. While no expression was observed in hepatopancreas, eyestalk, stomach and nerve. 3.4. Expression profiles of Lvserpin7 post pathogenic stimulation Quantitative real-time PCR was performed to analyze the expression profiles of Lvserpin7 post pathogenic stimulation. The
Y. Liu et al. / Fish & Shellfish Immunology 42 (2015) 256e263
259
Fig. 1. Multiple alignments of Lvserpin7 (AGZ91893.1) with other known serpins. GenBank accession numbers for these amino acid sequences are as follows: Fc-serpin (ABC33916.1); Pm-serpin7 (ADC42878.1); Mj-serpin (BAI50776.1); Pm-serpin6 (ADC42876.1); Lv-serpin (AGL39540.1); Pm-serpin8 (ADC42879.1) and Ms-serpin7 (ADM86478.1). Residues highlighted in black were identical and those in dark gray were similar. The characteristic domains of Lvserpin7 are boxed and named on the domain.
amplification efficiency for both b-actin and Lvserpin7 gene were over 95%, which was determined by a standard curve. After challenged with V. anguillarum, the expression of Lvserpin7 reached the first peak at 2 hpi (P < 0.05), then its transcripts began to decrease and at 24 hpi the expression returned back to the second peak (P < 0.05) (Fig. 3A). For the M. lysodeikticus challenge group, Lvserpin7 transcripts were significantly increased to the PBS group at 2 and 6 hpi (P < 0.05), then the expression returned to normal level, while an observed increase to the control group was detected at 48 hpi (P < 0.05) (Fig. 3B). In the WSSV challenged group, Lvserpin7 transcripts began to increase at 6 hpi (P < 0.05) and reached the peak of the whole experimental stage of WSSV challenge at 12 hpi (P < 0.05). After that, the expression of Lvserpin7 then recovered to control level at 48 hpi (Fig. 3C).
3.6. rLvserpin7 could bind to the tested bacteria Draw the following result, rLvserpin7 could solidly bind to the selected microorganisms, such as B. subtilis, M. lysodeikticus, and V. anguillarum (Fig. 5). Rather, the His-tagged protein is not available to bind to these microorganisms (Data not shown).
3.5. Recombinant expression and purification of Lvserpin7 The recombinant Lvserpin7 protein was induced by 0.1 mM IPTG at low temperatures and expressed as soluble protein, then purified by a His Bind resin chromatography. The purified protein was analyzed on 12% SDSePAGE, and an apparent 66 kDa target protein band was visualized (Fig. 4), which is about the expected size of calculated molecular mass of rLvserpin7 protein. Moreover, Histagged pET32a protein was also purified to serve as a control.
Fig. 2. Tissue distribution of Lvserpin7 in selected 10 tissues. The transcripts were detected by semi-quantitative RT-PCR using b-actin as an internal control.
Table 2 Sequence identities of the deduced amino acid sequences of Lvserpin7 with other known serpins. Serpin proteins
Protein IDs
1
2
3
4
5
6
7
8
9
10
11
12
1. L. vannamei serpin7 2. F. chinensis serpin 3. P. monodon serpin7 4. M. japonicus serpin 5. P. monodon serpin6 6. L. vannamei serpin 7. P. monodon serpin8 8. E. sinensis serpin 9. M. sexta serpin-6 10. A. aegypti serpin 11. B. taurus serpin B3 12. X. laevis serpin 13. H. sapiens serpin
AGZ91893.1 ABC33916.1 ADC42878.1 BAI50776.1 ADC42876.1 AGL39540.1 ADC42879.1 ADF87946.1 AAV91026.1 XP_001653219.1 XP_005196879.1 AAI70494.1 CAL47031.1
92.7 92.9 89.1 78.8 77.1 73.1 52.0 58.0 56.7 52.1 45.9 49.9
98.3 90.0 78.3 76.9 73.1 53.9 58.3 55.8 53.8 46.1 49.1
89.3 78.3 76.4 72.7 53.5 58.3 56.5 53.5 46.8 49.4
78.6 76.6 73.1 52.9 59.5 54.1 52.3 45.0 49.4
94.0 75.5 53.9 58.3 54.6 52.0 48.2 49.2
75.1 52.6 57.6 55.8 52.8 47.5 49.4
52.2 56.1 49.4 51.8 43.8 48.9
48.7 47.8 48.9 45.8 43.9
66.0 51.2 48.9 45.6
51.5 48.9 42.6
51.4 49.0
45.4
260
Y. Liu et al. / Fish & Shellfish Immunology 42 (2015) 256e263
Fig. 3. Temporal expression analysis of Lvserpin7 in hemocytes after V. anguillarum, M. lysodeikticus and WSSV challenge by quantitative real-time PCR. The change in foldexpression was calculated by the 2DDCT method using b-actin as a reference gene. Data are presented as the mean ± SD (N ¼ 3) and are derived from three different shrimps. Transcriptional regulation of Lvserpin7 challenged by V. anguillarum (A), M. lysodeikticus (B) and WSSV(C). Significant difference compared to the control group is marked with an asterisk at P < 0.05.
3.7. rLvserpin7 have inhibitory activity to some bacterial proteases We further analyzed the bacterial protease inhibitory activity of rLvserpin7, and as shown in Fig. 6A, 1 PBS, His-tagged protein or heat-inactivated rLvserpin7 had no inhibitory effect on the
hydrolysis activity of protease derived from B. subtilis. Of note is that, with the presence of rLvserpin7, no transparent zone was formed, which clearly indicated that rLvserpin7 could inhibit the protease produced by B. subtilis. Moreover, another method was employed to test its inhibitory role on protease activities. As the result showed (Fig. 6B), rLvserpin7 protein could inhibit the protease secreted by B. subtilis compared to the His-tagged protein which was used as a control. 3.8. rLvserpin7 could inhibit prophenoloxidase activation The prophenoloxidase inhibition assay of rLvserpin7 was performed using HLS as the source of zymogen (proPO), and LPS as the PPO activator. As shown in Fig. 7, adding of rLvserpin7 could inhibit the activation of prophenoloxidase cascade by about 22% at 25 min reaction time point as compared to the buffer control. 4. Discussion The Toll pathway and proPO activation system are essential pieces of the innate immune response and are known to contribute
Fig. 4. SDS-PAGE of recombinant. Lane 1, the induced Lvserpin7-pET32a; lane 2e4, the purified recombinant Lvserpin7 protein; lane 5, the induced His-tagged pET32a protein; lane 6, the purified tag protein; land M, protein marker.
Fig. 5. Binding activities of rLvserpin7 to B. subtilis, M. lysodeikticus and V. anguillarum. Lane1, the fourth-time PBS wash fraction; lane2, 7% SDS elution fraction; lane 3, the final pellet; and lane C, the purified rLvserpin7 protein.
Y. Liu et al. / Fish & Shellfish Immunology 42 (2015) 256e263
261
Fig. 6. Inhibitory activity against the secretory protease from B. subtilis. (A) 1, a single microbial clone with a paper disc upon it; 2, a single microbial clone with a paper disc containing 10 ml 1 PBS; 3, a single microbial clone with a paper disc containing 10 ml His-Tagged protein; 4, a single microbial clone with a paper disc containing 10 ml heatinactivated rLvserpin7 (1.8 mg/ml); and 5, a single microbial clone with a paper disc containing 10 ml rLvserpin7. (B) The remaining enzyme activity was measured at 680 nm using a Microplate Reader. The experiment was done in triplicate. Significant difference compared to the control group is marked with an asterisk at P < 0.05.
to host defense against pathogenic infections in shrimp [3,37e39]. These defense processes require proteases to activate the activation cascades and further lead to the synthesis of certain antimicrobial peptides and melanin, respectively [2,40,41]. However, excessive generation of activated proteases may also cause severe injury to host body. For the moment, at least in part, serpins play a valuable role in inhibiting the proteases and further to maintain the balance [42]. To date, many serpins have been identified and functional studied in shrimp. For example, in P. monodon, PmSERPIN8 and PmSERPIN3 exhibited inhibitory effect on proPO activation system [24,25]. Our previous study revealed that Lvserpin was likely to have capability in inhibiting bacterial proteases and the proteases involved in proPO activation [26]. Moreover, MjSerp1 from
Fig. 7. Inhibition of prophenoloxidase system by rLvserpin7. The hemocyte lysate supernatant (HLS) was added rLvserpin7 to the final concentration of 3.8 mM to test the inhibitory ability. His-tagged pET32a protein of 5 mM was added instead in the negative control. The positive control was added CAC buffer only. The experiment was done in triplicate. The results are means with standard deviation. Significant differences compared to the control group are marked with different letters at P < 0.05.
M. japonicus functioned as a microbial serine protease inhibitor [43]. In this study, a novel serpin (namely Lvserpin7) coding for 411amino acid residue protein was identified from L. vannamei. The highly conserved hinge region, SERPIN signature sequence and RCL located at the C-terminus of Lvserpin7 indicated the ownership of serpin family. Besides, Lvserpin7 is phylogenetically grouped in the orthologue of Fcserpin, and the high identities with Lvserpin (77.1%), PmSERPIN8 (73.1%), Msserpin6 (58.0%) and Esserpin (52.0%) might indicate a similar inhibitory role of Lvserpin7 on prophenoloxidase activation. Presence of a 19-residue signal peptide indicated that Lvserpin7 is extracellular protein and might have inhibitory role on extracellular proteases. Like most other crustacean serpins, Lvserpin7 was mainly expressed in hemocytes and gill. It is generally known that hemocytes and gill are important tissues involved in crustacean immunity [44,45]. High expression of Lvserpin7 in gill might suggest its vital role in defensing against the invaders. Hemocytes in the lymphoid organ, as far as we know, would further secrete some bioactive molecules to kill the invaders [44]. Here, the higher expression in hemocytes just goes to show that Lvserpin7 might play a key role in shrimp immunity. Upon immune stimulation by bacteria and WSSV, the Lvserpin7 transcript level increased significantly in hemocytes at 2 h post bacterial infection and significantly up-regulated at 12 h post WSSV infection. A similar up-regulation pattern occurs for E. sinensis Esserpin, L. vannamei Lvserpin and M. japonicus MjSerp1 [23,26,43]. These results suggest that Lvserpin7 expression rapidly responds to pathogenic challenge and plays a role in the early phase of pathogenic infections. Interestingly, a second increase was occurred at the later stage, it might be explained that the induction of Lvserpin7 to promptly clear the redundant serine proteinase. It is widely known that many serpins are involved in the proPO system. M. sexta serpin-6 and serpin-7 can block prophenoloxidase activation by inhibiting PAP3 activity in plasma [20,22]. D. melanogaster serpin-27A functions as a negative inhibitor of proPO activation by inhibiting the proPO activating enzyme (PPAE) [18]. In P. monodon, both PmSERPIN8 and PmSERPIN3 show the blocking effect on the extent of proPO cascade [24,25]. As we know, the P1 residue of RCL determines the primary selectivity of a serpin, as well as determines the target specificity [16]. Like serpin-6 and serpin-7 from M. sexta [20,22], SERPIN8 and SERPIN3 from P. monodon [24,25], Lvserpin7 shares the same P1 residue of arginine, which indicates that Lvserpin7 might have inhibitory activity against plasmin, subtilisin, thrombin, trypsin and kallikrein, and have similar function in the proPO system. In order to increase
262
Y. Liu et al. / Fish & Shellfish Immunology 42 (2015) 256e263
knowledge of Lvserpin7 in proPO activation, the rLvserpin7 protein was expressed and purified for further activities study. The impediment of the extent of proPO cascade might indicate the inhibition of Lvserpin7 on the specific proteases, which might be one of the prophenoloxidase-activating proteases. It's worth mentioning that some serpins exhibited inhibitory effect against bacterial proteases. Ranaserpin in Rana grahami could inhibit the growth of B. subtilis by inhibiting the activity of trypsin, elastase and subtilisin produced by the bacteria [46]. M. japonicus MjSerp1 effectively inhibited the secreted proteinase from S. aureus, B. subtilis, Bacillus megaterium, E. coli, K. pneumonia, and V. anguillarum [43]. Of note is that rLvserpin7 could restrain the growth of B. subtilis through inhibiting the produced protease activities. As the key components of invader, the secreted bacterial proteases are requisite for entry into the host and rapid activation of the cascade system [47]. More importantly, we have found that rLvserpin7 could strongly bind to different bacteria, such as B. subtilis, M. lysodeikticus and V. anguillarum. Most speculatively, it might imply that the binding of Lvserpin7 to B. subtilis offers a facility for inhibiting bacterial proteases. Nevertheless, the exact mechanism of bacterial inhibition of Lvserpin7 needs further study. In conclusion, a novel serine protease inhibitor, Lvserpin7 was identified from the Pacific white shrimp, L. vannamei. Lvserpin7 was
highly expressed in gill and hemocytes. The expression profile of Lvserpin7 after challenged with different pathogens suggested that it is inducible and may be involved in shrimp immune response. Moreover, the rLvserpin7 was purified and showed strongly binding activity and inhibition on bacterial proteases activity and prophenoloxidase activation. Acknowledgments We thank the professor Fuhua Li for kindly giving the three pathogens. This work was supported by the Agricultural Science and Technology Achievement Transformation Fund Project of Ministry of Science and Technology of the People's Republic of China (No. 2012GB2E200361), the Key laboratory of Marine Biology, Institute of Oceanology, Chinese Academy of Sciences and the Northwest A&F University experimental demonstration station (base) and innovation of science and technology achievement transformation project (No. XNY2013-4). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2014.11.001.
Fig. A. Phylogenetic tree of various serpins was constructed using the NJ-method with 1000 trials by MEGA 5.0 software.
Y. Liu et al. / Fish & Shellfish Immunology 42 (2015) 256e263
References [1] Marmaras VJ, Lampropoulou M. Regulators and signalling in insect haemocyte immunity. Cell Signal 2009;21:186e95. [2] Lee SY, Soderhall K. Early events in crustacean innate immunity. Fish Shellfish Immunol 2002;12:421e37. [3] Li F, Xiang J. Recent advances in researches on the innate immunity of shrimp in China. Dev Comp Immunol 2013;39:11e26. [4] Tassanakajon A, Somboonwiwat K, Supungul P, Tang S. Discovery of immune molecules and their crucial functions in shrimp immunity. Fish Shellfish Immunol 2013;34:954e67. [5] Yu X-Q, Jiang H, Wang Y, Kanost MR. Nonproteolytic serine proteinase homologs are involved in prophenoloxidase activation in the tobacco hornworm, Manduca sexta. Insect Biochem Molec 2003;33:197e208. [6] Cerenius L, Soderhall K. The prophenoloxidase-activating system in invertebrates. Immunol Rev 2004;198:116e26. [7] Jiravanichpaisal P, Lee BL, Soderhall K. Cell-mediated immunity in arthropods: hematopoiesis, coagulation, melanization and opsonization. Immunobiology 2006;211:213e36. [8] Kanost MR. Serine proteinase inhibitors in arthropod immunity. Dev Comp Immunol 1999;23:291e301. [9] Otlewski J, Krowarsch D, Apostoluk W. Protein inhibitors of serine proteinases. Acta Biochim Pol 1999;46:531e65. [10] Gubb D, Sanz-Parra A, Barcena L, Troxler L, Fullaondo A. Protease inhibitors and proteolytic signalling cascades in insects. Biochimie 2010;92: 1749e59. [11] Silverman GA, Whisstock JC, Bottomley SP, Huntington JA, Kaiserman D, Luke CJ, et al. Serpins flex their muscle I. Putting the clamps on proteolysis in diverse biological systems. J Biol Chem 2010;285:24299e305. [12] Rimphanitchayakit V, Tassanakajon A. Structure and function of invertebrate Kazal-type serine proteinase inhibitors. Dev Comp Immunol 2010;34:377e86. [13] Gettins PGW. Serpin structure, mechanism, and function. Chem Rev 2002;102:4751e803. [14] Wilczynska M, Fa M, Ohlsson P, Ny T. The inhibition mechanism of serpins. Evidence that the mobile reactive center loop is cleaved in the native protease-inhibitor complex. J Biol Chem 1995;270:29652e5. [15] Wang S, Cui Z, Liu Y, Li Q, Song C. Identification and characterization of a serine protease inhibitor (PtSerpin) in the swimming crab Portunus trituberculatus. Fish Shellfish Immunol 2012;32:544e50. [16] Huntington JA. Serpin structure, function and dysfunction. J Thromb Haemost 2011;9:26e34. [17] Mangan MSJ, Kaiserman D, Bird PI. The role of serpins in vertebrate immunity. Tissue Antigens 2008;72:1e10. [18] Nappi AJ, Frey F, Carton Y. Drosophila serpin 27A is a likely target for immune suppression of the blood cell-mediated melanotic encapsulation response. J Insect Physiol 2005;51:197e205. [19] Zhu Y, Wang Y, Gorman MJ, Jiang H, Kanost MR. Manduca sexta serpin-3 regulates prophenoloxidase activation in response to infection by inhibiting prophenoloxidase-activating proteinases. J Biol Chem 2003;278:46556e64. [20] Wang Y, Jiang H. Purification and characterization of Manduca sexta serpin-6: a serine proteinase inhibitor that selectively inhibits prophenoloxidaseactivating proteinase-3. Insect Biochem Molec 2004;34:387e95. [21] Christen JM, Hiromasa Y, An CJ, Kanost MR. Identification of plasma proteinase complexes with serpin-3 in Manduca sexta. Insect Biochem Molec 2012;42: 946e55. [22] Suwanchaichinda C, Ochieng R, Zhuang S, Kanost MR. Manduca sexta serpin-7, a putative regulator of hemolymph prophenoloxidase activation. Insect Biochem Molec 2013;43:555e61. [23] Wang L, Ma Z, Yang J, Gai Y, Zhou Z, Wang L, et al. Identification and characterization of a serine protease inhibitor Esserpin from the Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol 2013;34:1576e86. [24] Wetsaphan N, Rimphanitchayakit V, Tassanakajon A, Somboonwiwat K. PmSERPIN3 from black tiger shrimp Penaeus monodon is capable of controlling the proPO system. Dev Comp Immunol 2013;41:110e9.
263
[25] Somnuk S, Tassanakajon A, Rimphanitchayakit V. Gene expression and characterization of a serine proteinase inhibitor PmSERPIN8 from the black tiger shrimp Penaeus monodon. Fish Shellfish Immunol 2012;33:332e41. [26] Liu Y, Hou F, He S, Qian Z, Wang X, Mao A, et al. Identification, characterization and functional analysis of a serine protease inhibitor (Lvserpin) from the Pacific white shrimp, Litopenaeus vannamei. Dev Comp Immunol 2014;43: 35e46. [27] Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell 2006;124:783e801. [28] Akira S. Pathogen recognition receptors and innate immunity. Xenotransplantation 2013;20:351. [29] Rodriguez J, Boulo V, Mialhe E, Bachere E. Characterisation of shrimp haemocytes and plasma components by monoclonal antibodies. J Cell Sci 1995;108:1043e50. [30] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001;25: 402e8. [31] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248e54. [32] Zhang XW, Xu WT, Wang XW, Mu Y, Zhao XF, Yu XQ, et al. A novel C-type lectin with two CRD domains from Chinese shrimp Fenneropenaeus chinensis functions as a pattern recognition protein. Mol Immunol 2009;46:1626e37. [33] Chen A, He NH, Xu X. Mj-DWD, a double WAP domain-containing protein with antiviral relevance in Marsupenaeus japonicus. Fish Shellfish Immunol 2008;25:775e81. [34] Wang ZH, Zhao XF, Wang JX. Characterization, kinetics, and possible function of Kazal-type proteinase inhibitors of Chinese white shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol 2009;26:885e97. [35] Winters AL, Minchin FR. Modification of the Lowry assay to measure proteins and phenols in covalently bound complexes. Anal Biochem 2005;346:43e8. [36] Wang XW, Zhang HW, Li XA, Zhao XF, Wang JX. Characterization of a C-type lectin (PcLec2) as an upstream detector in the prophenoloxidase activating system of red swamp crayfish. Fish Shellfish Immunol 2011;30:241e7. [37] Amparyup P, Charoensapsri W, Tassanakajon A. Prophenoloxidase system and its role in shrimp immune responses against major pathogens. Fish Shellfish Immunol 2013;34:990e1001. [38] Li F, Xiang J. Signaling pathways regulating innate immune responses in shrimp. Fish Shellfish Immunol 2013;34:973e80. [39] Liu Y, Qian Z, Qu R, Wang X, He S, Hou F, et al. Molecular characterization, immune responsive expression and functional analysis of QM, a putative tumor suppressor gene from the Pacific white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol 2014;37:1e10. [40] Ghosh J, Lun CM, Majeske AJ, Sacchi S, Schrankel CS, Smith LC. Invertebrate immune diversity. Dev Comp Immunol 2011;35:959e74. [41] Hou F, Wang X, Qian Z, Liu Q, Liu Y, He S, et al. Identification and functional studies of Akirin, a potential positive nuclear factor of NF-kappaB signaling pathways in the Pacific white shrimp, Litopenaeus vannamei. Dev Comp Immunol 2013;41:703e14. [42] Herrid M, Vignarajan S, Davey R. Successful transplantation of bovine testicular cells to heterologous recipients. Reproduction 2006;132:617e24. [43] Zhao YR, Xu YH, Jiang HS, Xu S, Zhao XF, Wang JX. Antibacterial activity of serine protease inhibitor 1 from kuruma shrimp Marsupenaeus japonicus. Dev Comp Immunol 2014;44:261e9. [44] Smith V, Chisholm J. Non-cellular immunity in crustaceans. Fish Shellfish Immunol 1992;2:1e31. [45] Zhao J, Song L, Li C, Zou H, Ni D, Wang W, et al. Molecular cloning of an invertebrate goose-type lysozyme gene from Chlamys farreri, and lytic activity of the recombinant protein. Mol Immunol 2007;44:1198e208. [46] Han YP, Yu HN, Yang XB, Rees HH, Liu JZ, Lai R. A serine proteinase inhibitor from frog eggs with bacteriostatic activity. Comp Biochem Physiol B 2008;149:58e62. [47] Christeller JT. Evolutionary mechanisms acting on proteinase inhibitor variability. Febs J 2005;272:5710e22.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Recombinant expression and characterization of a serine protease inhibitor (Lvserpin7) from the Pacific white shrimp, Litopenaeus vannamei Yongjie Liu, Fujun Hou, Xianzong Wang, Xiaolin Liu* College of Animal Science and Technology, Northwest A&F University, Shaanxi Yangling 712100, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 5 September 2014 Received in revised form 2 November 2014 Accepted 6 November 2014 Available online 20 November 2014
Serine protease inhibitors (serpins) are widely known to its inhibitory role on proteases involved in the immune responses. Herein, a novel serine protease inhibitor (Lvserpin7), encoding for 411 amino acids with calculated molecular mass of 46.29 kDa and isoelectric point of 6.98 was characterized from the Pacific white shrimp Litopenaeus vannamei. Lvserpin7 shared 92.9% identities to Penaeus monodon serpin7. Among the tested tissues, Lvserpin7 was mainly expressed in hemocytes and gill. The expression profiles analysis indicated that Lvserpin7 was significantly up-regulated in the early stage upon Vibrio anguillarum, Micrococcus lysodeikticus or White Spot Syndrome Virus (WSSV) infection. Fusion protein expression was induced by IPTG, and the purified recombinant Lvserpin7 protein (rLvserpin7) binds to both the Gram-positive and Gram-negative bacteria. Also rLvserpin7 exhibited inhibitory activity against the proteases secreted by Bacillus subtilis. Moreover, rLvserpin7 showed inhibition role on prophenoloxidase activation. To recap, we proposed that Lvserpin7 was implicated in the shrimp immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Litopenaeus vannamei Serpin7 Prophenoloxidase Proteases Immunity
1. Introduction Shrimps, like other invertebrates, lack an adaptive immune system and defend against foreign invaders through a non-specific innate immunity [1]. There are two different responses in innate immunity, the cellular and humoral responses [2e4]. Among the immune processes, for instance, blood coagulation, complement activation, encapsulation, phagocytosis, melanization and antimicrobial peptide synthesis are activated by proteases cascade [5e7]. Note that excessive proteases will disturb the balance and cause damage to the body, and necessarily, the extent of proteolysis needs to be subject to control [8]. Serine protease inhibitors (SPIs) are group of proteins that are used to assume such a role [9e11]. To date, varieties of SPIs families, namely, Kazal, Kunitz, BowmaneBirk, serpin and a-macroglobulin have been characterized [8,11,12]. Serpins among them are a superfamily of proteins folding into a conserved tertiary structure with a reactive center loop (RCL) near the C-terminus, which acts as a bait for target proteases [13].
* Corresponding author. Tel.: þ86 029 87054333; fax: þ86 029 87092164. E-mail address: [email protected] (X. Liu). http://dx.doi.org/10.1016/j.fsi.2014.11.001 1050-4648/© 2014 Elsevier Ltd. All rights reserved.
The exposed RCL protein motif contains a scissile bond between two amino acid residues, called P1 and P10 [14,15]. Once the bond is cleaved by a target protease, the serpin rapidly undergoes a conformational change and traps the proteases in an inactive state, and further results in irreversible inhibition of the proteases [16,17]. Serpins act as suicide-like substrates, irreversibly inhibit the target proteases and are found to be involved in the regulation of proPO system [8]. In Drosophila melanogaster, serpin-27A functions as a negative inhibitor of proPO activation by inhibiting the proPO activating enzyme (PPAE) [18]. In Manduca sexta, serpin-3, -6 and -7 have been characterized and shown to block proPO activation by inhibiting prophenoloxidase activating proteinases (PAPs) in the hemolymph [19e22]. Invariably, varieties of serpins have been identified in crustaceans and show regulatory role on proPO activation. EsSerpin identified from hemocyte of Eriocheir sinensis was reported have the ability on inhibition of bacterial growth and regulation of prophenoloxidase-activating system [23]. Pmserpin3 and Pmserpin8 from Penaeus monodon showed inhibition on prophenoloxidase system [24,25]. What's more, our previous study showed that Lvserpin blocks the proPO activation by inhibiting trypsin activity in Litopenaeus vannamei [26].
Y. Liu et al. / Fish & Shellfish Immunology 42 (2015) 256e263
As one of the important aquatic animals in China, the Pacific white shrimp L. vannamei suffers various diseases caused by microorganisms during culture [27,28]. The shrimp farming has encountered serious production decline and large economic losses. Study of the potential immune-related genes may be constructive to the better understanding of its immune defense mechanisms and the development of better disease management strategies. In the present study, a novel serpin, namely Lvserpin7, was identified from L. vannamei. The tissue distribution and immune responsive to Vibrio anguillarum, Micrococcus lysodeikticus and WSSV were investigated. Moreover, Lvserpin7 was expressed in Escherichia coli, and the purified rLvserpin7 was used for the investigation on inhibition of proteases activity and prophenoloxidase activation. 2. Materials and methods 2.1. Data mining and cloning of Lvserpin7 cDNA sequence The marine genomics EST database (http://www. marinegenomics.org/) was searched by homology for nucleotide sequence clusters corresponding to the serpin genes. Based on the EST clone, sequence specific primers (Spn7-F; Spn7-R) were designed to amplify the Open Reading Frame (ORF) (Table 1). The PCR products were cloned into the pUC-18T vector (CWBIO, China), then, transformed into the competent cells of E. coli DH5a. The potentially positive recombinant clones were identified by colony PCR. Then the positive recombinants were picked for sequencing.
To determine tissue expression of Lvserpin7 gene, hemocytes, gill, hepatopancreas, eyestalk, stomach, muscle, intestine, nerve, heart and testis were collected from normal shrimp. For the expression analysis of Lvserpin7 gene in response to pathogen infection, V. anguillarum, M. lysodeikticus and WSSV were selected. Twenty microliter of live V. anguillarum (4 108 CFU/ml), M. lysodeikticus (4 1010 CFU/ml) and tissue suspension prepared from WSSV-infected shrimp suspended in Phosphate Buffered Saline (PBS) were injected respectively into the last abdominal segment. And the shrimps which received an injection of 20 ml PBS were employed as control. Then three shrimps were randomly sampled from each group at 0, 2, 6, 12, 24 and 48 h post injection (hpi). The hemolymph was collected into a sterilized syringe with an equal volume of anticoagulant modified Alsever solution (27 mM sodium citrate, 336 mM NaCl, 115 mM glucose, 9 mM EDTA, pH 7.0), and centrifuged (800 g at 4 C for 10 min) immediately to collect hemocytes [29]. All the samples were preserved in liquid nitrogen immediately for further processing. 2.4. Total RNA extraction and cDNA synthesis The collected tissues were homogenized in 1 ml Trizol (Invitrogen, USA) and then were used for total RNA extraction following the manufacturer's instructions. After verifying the RNA quality and measuring the RNA concentration, 500 ng of the obtained RNA was used as a template for first stand cDNA synthesis using the PrimeScript® RT Reagent Kit with gDNA Eraser (TaKaRa, Japan). 2.5. Semi-quantitative RT-PCR and quantitative real-time PCR analysis of Lvserpin7 expression
2.2. Bioinformatics analysis Nucleotide and protein sequence similarities were conducted with BLAST program (http://blast.ncbi.nlm.nih.gov/Blast) and Matrix Global Alignment Tool (MatGAT) (http://bitincka.com/ledion/ matgat/). Multiple sequence alignment was created using the ClustalW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/). The protein motif features were predicted by Simple Modular Architecture Research Tool (http://smart.emblheidelberg.de/). Signal peptide was predicted with SignalP3.0 program (http://www.cbs.dtu.dk/ services/SignalP/). The phylogenetic tree was constructed based on the amino sequences alignment by the neighbor-joining (NJ) algorithm embedded in MEGA5.0 program with bootstrap trial 1000 replicates. 2.3. Sample preparation Healthy L. vannamei averaging 15e18 g in weight were collected from a local shrimp farm in Zhanjiang, Guangdong province, China, and acclimatized in tanks for a week before processing.
Table 1 Sequences of primers used in this research. Primer
Objective
Tm ( C)
Sequence (50 e30 )
Spn7-F Spn7-R rSer7-F
ORF amplification
55
Protein expression
66
CAGAACGAAAGAGGTGTCAG AATATATGTATATATCATAAC CGGGGTACCCAGTGTTTCACCG ACAACGACGA (KpnI, italic) CCGGAATTCCTAACTTCCTGCC GTGTCGGGAT (EcoRI, italic) TCGGCGTTCATCATCGCTTAC GGCGTTGTTGCTGGTTTGG CACGAGACCACCTACAACTCCATC TCCTGCTTGCTGATCCACATCTG
rSer7-R S7t-F S7t-R Actin-F Actin-R
257
Real-time RT-PCR
60
Real-time RT- PCR
60
The tissue distribution of Lvserpin7 expression was analyzed via RT-PCR using the RT primers (Table 1). The PCR procedure was set as follows: 1 cycle at 94 C for 5 min; followed by 35 cycles of 94 C for 30 s, 58 C for 1 min, and 72 C for 30 s; and a final cycle at 72 C for 10 min b-actin gene was used as an internal control with primers Actin-F and Actin-R (Table 1). Quantitative real-time PCR (qRT-PCR) was carried out in a CFX Manager system (Bio-Rad, USA). Sequence specific primers, S7t-F and S7t-R (Table 1) were designed to amplify a product of 141 bp, which was used to determine the expression of Lvserpin7. The bactin from L. vannamei, amplified with primers Actin-F and Actin-R (Table 1), was chosen as reference gene for internal standardization. The qRT-PCR was carried out in a total volume of 20 ml, containing 10 ml SYBR Green Super mix (CWBIO, China), 2 ml of diluted cDNA, 0.4 ml of each primer (10 pmol/ml) and 7.2 ml nuclease-free water. The PCR program was 95 C for 10 min, followed by 40 cycles of 95 C for 15 s, 60 C for 1 min. To verify the amplification of a single product, dissociation curve analysis was performed at the end of each PCR reaction. The relative expression to controls was determined by the 2DDCT method [30]. All data represented means ± standard deviation and were subjected to a one-way analysis of variance (ANOVA) followed by Duncan's multiple range test using the SPSS 18.0 program. Differences were considered statistically significant at P < 0.05. 2.6. Construction, inducible expression and purification of Lvserpin7 The recombinant Lvserpin7 protein was produced in an E. coli expression system. The mature peptide of Lvserpin7 was amplified using forward primer rSer7-F and reverse primer rSer7-R (Table 1) with restriction sites of KpnI and EcoRI added to the 50 end respectively. Both the purified PCR product and the pET32a vector plasmid were digested with KpnI and EcoRI and then ligated to
258
Y. Liu et al. / Fish & Shellfish Immunology 42 (2015) 256e263
produce the recombinant clone. Being confirmed by restriction enzyme and sequencing, the recombinant plasmid was transformed into the E. coli BL21 pLysS (DE3) strain. Then a colony containing the recombinant plasmid was incubated in LB broth at 37 C with shaking at 220 rpm. When the OD600 reached 0.6e0.8, the cells were incubated for additional 18 h at 16 C with the induction of isopropyl-b-D-thiogalactoside (IPTG) at a final concentration of 0.1 mM. The harvested cells were resuspended in ice cooled PBS (pH 7.4) and sonicated for 30 min on ice. After sonication, the cell lysate and inclusion bodies were separated by centrifugation at 10,000 g for 30 min at 4 C. The soluble rLvserpin7 was purified using a ProteinIso™ Ni-NTA Resin (TransGen, China). The supernatant was loaded onto a Ni2þchelating column chromatography which had been previously equilibrated with the binding buffer (300 mM NaCl, 50 mM NaH2O4, 10 mM imidazole and 10 mM Tris base, pH 8.0). Then, the rLvserpin7 protein was eluted with 150 mM imidozol in 10 mM Tris base, pH 8.0 containing 300 mM NaCl and 50 mM NaH2O4. The purity of rLvserpin7 was analyzed by 12% sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) and the protein content was determined by the Bradford assay [31].
2.9. Prophenoloxidase inhibitory assay Hemolymph was withdrawn from L. vannamei using 200 ml of sodium citrate per 1 ml of hemolymph. Hemocytes was collected by centrifugation and lysed in CAC buffer (10 mM sodium cacodylate pH 7 and 10 mM CaCl2). The lysate was centrifuged at 10,000 g for 10 min at 4 C to separate the hemocyte lysate supernatant (HLS). The protein content of HLS was determined using Bradford method [31]. The PO activity assay was modified from that described by Wang et al. [36]. Appropriate amount of HLS protein was mixed with rLvserpin7 to the final concentration of 3.8 mM with the adjustment of CAC buffer in the volume of 165 ml in a 96-well microtiter plate. The reaction was activated by adding 10 ml of lipopolysaccharides (1 mg/ml), and incubated at room temperature for 5 min. Twentyfive microliters of 3 mg/ml L-3, 4-dihydroxy phenylalanine (L-Dopa) (Sigma) was added to start the reaction. After incubated at room temperature for 25 min, then the absorbance at 490 nm was measured with a microplate reader. Likewise, 5 mM of His-tagged pET32a protein and CAC buffer only were added as controls. 3. Results
2.7. Binding of rLvserpin7 to microorganisms 3.1. Identification and structural features of Lvserpin7 Binding activities of rLvserpin7 to microorganisms were assayed based on the procedure by Zhang et al. [32]. Bacteria, Bacillus subtilis, M. lysodeikticus and V. anguillarum were selected to perform this assay. Five milliliter of overnight cultured bacteria was centrifuged at 10,000 g for 5 min then the resulting pellets were washed twice with 1 ml of 1 PBS, and finally resuspended in 200 ml 1 PBS. Then an equal volume of purified rLvserpin7 protein (1.65 ng/ml) was incubated with these microorganisms (2 107 CFU) with gentle rotation at 37 C for 1 h. After washing the microorganisms four times with 200 ml of 1PBS, 100 ml of 7% SDS was used to elute the bacteria. Then the fourth-time PBS wash fraction, the 7% SDS elution and the final pelleted bacteria were analyzed using 12% SDS-PAGE. The result was demonstrated through western blot analysis. His-tagged pET32a protein was used as the negative control. 2.8. Proteases activity inhibitory assay The proteases inhibitory assay was performed from the disc diffusion technique [33]. Briefly, a single B. subtilis colony was picked up and placed on a skim milk plate (1% skim milk, 1% agar). Then a piece of paper disc with 10 ml of rLvserpin7 (1.8 mg/ ml) was located upon the microbial colony. After over-night incubation at 37 C, the skim milk plate was observed for the transparent zone. 1 PBS, His-tagged pET32a protein (2.5 mg/ml), and heat-inactivated rLvserpin7 (1.8 mg/ml) were used as negative controls. In another method [34], 5 ml of B. subtilis, M. lysodeikticus or V. anguillarum were cultured overnight at 37 C, and centrifuged at 10,000 g for 2 min. Then the resulting pellets were washed twice in reaction buffer (10 mM NaCl, 100 mM TriseHCl, pH 8.0) and centrifuged at 10,000 g for 5 min. The supernatant was collected and used as the secreted protease. Fifteen microliter of the washed supernatant was incubated with rLvserpin7 (1.8 mg/ml) at 37 C for 5 min. Then, 30 ml of 1% casein was added into the mixture and incubated for 1 h at 37 C in a final volume of 75 ml. Finally, 75 ml of 5% trichloroacetic acid (TCA) was added to stop the reaction and the enzymatic activity was determined via the Folin phenol method [35]. His-tagged pET32a protein (2.5 mg/ml) was used as the negative control. Each reaction was carried out in triplicate.
In this study, a novel Lvserpin cDNA sequence (GenBank Number: KF442979.1) with length 1496 bp was obtained, in which containing a 1236 bp open reading frame (ORF) flanked by a 100 bp 50 UTR and a 160 bp 30 UTR (Fig. S). The cDNA encodes a polypeptide (GenBank Number: AGZ91893.1) of 411 amino acids (aa) with a theoretical molecular weight of 46.29 kDa and an isoelectronic point of 6.98. A putative signal peptide of 19 amino acids (Fig. 1A) and a characteristic serpin domain (E-value ¼ 5.25e101) was found. In addition, the PROSITE database indicated that a highly conserved hinge region (353EEGTEAAAAT362) and a serpin signature sequence (379FHCNRPFLFLI389) were located at the C-terminus of the deduced amino acid sequence (Fig. 1B). 3.2. Sequence homology analysis Blastx analysis suggested that Lvserpin7 shared the significant homology to the P. monodon serpin7. To further study the sequence homology, serpin sequences from shrimp, crab, insect, cow, Xenopus laevis and Homo sapiens were selected for similarity analysis (Table 2). Data showed that Lvserpin7 exhibited 73.1e92.9% identities to other shrimp serpins with the highest identity to P. monodon serpin7 (92.9%) and 52.0e58.0% identities to other invertebrate serpins. Phylogenetic analysis by MEGA 5.0 software further supported the sequence similarity (Fig. A). The distance tree showed that Lvserpin7 with Pmserpin7 and Marsupenaeus japonicus serpin were all clustered in the same group as the Fenneropenaeus chinensis serpin. 3.3. Distribution of Lvserpin7 in shrimp tissues RT-PCR analysis was performed to determine the Lvserpin7 expression in 10 shrimp tissues. As shown in Fig. 2, Lvserpin7 was highly expressed in hemocytes and gill, weakly expressed in testis, heart, muscle and intestine. While no expression was observed in hepatopancreas, eyestalk, stomach and nerve. 3.4. Expression profiles of Lvserpin7 post pathogenic stimulation Quantitative real-time PCR was performed to analyze the expression profiles of Lvserpin7 post pathogenic stimulation. The
Y. Liu et al. / Fish & Shellfish Immunology 42 (2015) 256e263
259
Fig. 1. Multiple alignments of Lvserpin7 (AGZ91893.1) with other known serpins. GenBank accession numbers for these amino acid sequences are as follows: Fc-serpin (ABC33916.1); Pm-serpin7 (ADC42878.1); Mj-serpin (BAI50776.1); Pm-serpin6 (ADC42876.1); Lv-serpin (AGL39540.1); Pm-serpin8 (ADC42879.1) and Ms-serpin7 (ADM86478.1). Residues highlighted in black were identical and those in dark gray were similar. The characteristic domains of Lvserpin7 are boxed and named on the domain.
amplification efficiency for both b-actin and Lvserpin7 gene were over 95%, which was determined by a standard curve. After challenged with V. anguillarum, the expression of Lvserpin7 reached the first peak at 2 hpi (P < 0.05), then its transcripts began to decrease and at 24 hpi the expression returned back to the second peak (P < 0.05) (Fig. 3A). For the M. lysodeikticus challenge group, Lvserpin7 transcripts were significantly increased to the PBS group at 2 and 6 hpi (P < 0.05), then the expression returned to normal level, while an observed increase to the control group was detected at 48 hpi (P < 0.05) (Fig. 3B). In the WSSV challenged group, Lvserpin7 transcripts began to increase at 6 hpi (P < 0.05) and reached the peak of the whole experimental stage of WSSV challenge at 12 hpi (P < 0.05). After that, the expression of Lvserpin7 then recovered to control level at 48 hpi (Fig. 3C).
3.6. rLvserpin7 could bind to the tested bacteria Draw the following result, rLvserpin7 could solidly bind to the selected microorganisms, such as B. subtilis, M. lysodeikticus, and V. anguillarum (Fig. 5). Rather, the His-tagged protein is not available to bind to these microorganisms (Data not shown).
3.5. Recombinant expression and purification of Lvserpin7 The recombinant Lvserpin7 protein was induced by 0.1 mM IPTG at low temperatures and expressed as soluble protein, then purified by a His Bind resin chromatography. The purified protein was analyzed on 12% SDSePAGE, and an apparent 66 kDa target protein band was visualized (Fig. 4), which is about the expected size of calculated molecular mass of rLvserpin7 protein. Moreover, Histagged pET32a protein was also purified to serve as a control.
Fig. 2. Tissue distribution of Lvserpin7 in selected 10 tissues. The transcripts were detected by semi-quantitative RT-PCR using b-actin as an internal control.
Table 2 Sequence identities of the deduced amino acid sequences of Lvserpin7 with other known serpins. Serpin proteins
Protein IDs
1
2
3
4
5
6
7
8
9
10
11
12
1. L. vannamei serpin7 2. F. chinensis serpin 3. P. monodon serpin7 4. M. japonicus serpin 5. P. monodon serpin6 6. L. vannamei serpin 7. P. monodon serpin8 8. E. sinensis serpin 9. M. sexta serpin-6 10. A. aegypti serpin 11. B. taurus serpin B3 12. X. laevis serpin 13. H. sapiens serpin
AGZ91893.1 ABC33916.1 ADC42878.1 BAI50776.1 ADC42876.1 AGL39540.1 ADC42879.1 ADF87946.1 AAV91026.1 XP_001653219.1 XP_005196879.1 AAI70494.1 CAL47031.1
92.7 92.9 89.1 78.8 77.1 73.1 52.0 58.0 56.7 52.1 45.9 49.9
98.3 90.0 78.3 76.9 73.1 53.9 58.3 55.8 53.8 46.1 49.1
89.3 78.3 76.4 72.7 53.5 58.3 56.5 53.5 46.8 49.4
78.6 76.6 73.1 52.9 59.5 54.1 52.3 45.0 49.4
94.0 75.5 53.9 58.3 54.6 52.0 48.2 49.2
75.1 52.6 57.6 55.8 52.8 47.5 49.4
52.2 56.1 49.4 51.8 43.8 48.9
48.7 47.8 48.9 45.8 43.9
66.0 51.2 48.9 45.6
51.5 48.9 42.6
51.4 49.0
45.4
260
Y. Liu et al. / Fish & Shellfish Immunology 42 (2015) 256e263
Fig. 3. Temporal expression analysis of Lvserpin7 in hemocytes after V. anguillarum, M. lysodeikticus and WSSV challenge by quantitative real-time PCR. The change in foldexpression was calculated by the 2DDCT method using b-actin as a reference gene. Data are presented as the mean ± SD (N ¼ 3) and are derived from three different shrimps. Transcriptional regulation of Lvserpin7 challenged by V. anguillarum (A), M. lysodeikticus (B) and WSSV(C). Significant difference compared to the control group is marked with an asterisk at P < 0.05.
3.7. rLvserpin7 have inhibitory activity to some bacterial proteases We further analyzed the bacterial protease inhibitory activity of rLvserpin7, and as shown in Fig. 6A, 1 PBS, His-tagged protein or heat-inactivated rLvserpin7 had no inhibitory effect on the
hydrolysis activity of protease derived from B. subtilis. Of note is that, with the presence of rLvserpin7, no transparent zone was formed, which clearly indicated that rLvserpin7 could inhibit the protease produced by B. subtilis. Moreover, another method was employed to test its inhibitory role on protease activities. As the result showed (Fig. 6B), rLvserpin7 protein could inhibit the protease secreted by B. subtilis compared to the His-tagged protein which was used as a control. 3.8. rLvserpin7 could inhibit prophenoloxidase activation The prophenoloxidase inhibition assay of rLvserpin7 was performed using HLS as the source of zymogen (proPO), and LPS as the PPO activator. As shown in Fig. 7, adding of rLvserpin7 could inhibit the activation of prophenoloxidase cascade by about 22% at 25 min reaction time point as compared to the buffer control. 4. Discussion The Toll pathway and proPO activation system are essential pieces of the innate immune response and are known to contribute
Fig. 4. SDS-PAGE of recombinant. Lane 1, the induced Lvserpin7-pET32a; lane 2e4, the purified recombinant Lvserpin7 protein; lane 5, the induced His-tagged pET32a protein; lane 6, the purified tag protein; land M, protein marker.
Fig. 5. Binding activities of rLvserpin7 to B. subtilis, M. lysodeikticus and V. anguillarum. Lane1, the fourth-time PBS wash fraction; lane2, 7% SDS elution fraction; lane 3, the final pellet; and lane C, the purified rLvserpin7 protein.
Y. Liu et al. / Fish & Shellfish Immunology 42 (2015) 256e263
261
Fig. 6. Inhibitory activity against the secretory protease from B. subtilis. (A) 1, a single microbial clone with a paper disc upon it; 2, a single microbial clone with a paper disc containing 10 ml 1 PBS; 3, a single microbial clone with a paper disc containing 10 ml His-Tagged protein; 4, a single microbial clone with a paper disc containing 10 ml heatinactivated rLvserpin7 (1.8 mg/ml); and 5, a single microbial clone with a paper disc containing 10 ml rLvserpin7. (B) The remaining enzyme activity was measured at 680 nm using a Microplate Reader. The experiment was done in triplicate. Significant difference compared to the control group is marked with an asterisk at P < 0.05.
to host defense against pathogenic infections in shrimp [3,37e39]. These defense processes require proteases to activate the activation cascades and further lead to the synthesis of certain antimicrobial peptides and melanin, respectively [2,40,41]. However, excessive generation of activated proteases may also cause severe injury to host body. For the moment, at least in part, serpins play a valuable role in inhibiting the proteases and further to maintain the balance [42]. To date, many serpins have been identified and functional studied in shrimp. For example, in P. monodon, PmSERPIN8 and PmSERPIN3 exhibited inhibitory effect on proPO activation system [24,25]. Our previous study revealed that Lvserpin was likely to have capability in inhibiting bacterial proteases and the proteases involved in proPO activation [26]. Moreover, MjSerp1 from
Fig. 7. Inhibition of prophenoloxidase system by rLvserpin7. The hemocyte lysate supernatant (HLS) was added rLvserpin7 to the final concentration of 3.8 mM to test the inhibitory ability. His-tagged pET32a protein of 5 mM was added instead in the negative control. The positive control was added CAC buffer only. The experiment was done in triplicate. The results are means with standard deviation. Significant differences compared to the control group are marked with different letters at P < 0.05.
M. japonicus functioned as a microbial serine protease inhibitor [43]. In this study, a novel serpin (namely Lvserpin7) coding for 411amino acid residue protein was identified from L. vannamei. The highly conserved hinge region, SERPIN signature sequence and RCL located at the C-terminus of Lvserpin7 indicated the ownership of serpin family. Besides, Lvserpin7 is phylogenetically grouped in the orthologue of Fcserpin, and the high identities with Lvserpin (77.1%), PmSERPIN8 (73.1%), Msserpin6 (58.0%) and Esserpin (52.0%) might indicate a similar inhibitory role of Lvserpin7 on prophenoloxidase activation. Presence of a 19-residue signal peptide indicated that Lvserpin7 is extracellular protein and might have inhibitory role on extracellular proteases. Like most other crustacean serpins, Lvserpin7 was mainly expressed in hemocytes and gill. It is generally known that hemocytes and gill are important tissues involved in crustacean immunity [44,45]. High expression of Lvserpin7 in gill might suggest its vital role in defensing against the invaders. Hemocytes in the lymphoid organ, as far as we know, would further secrete some bioactive molecules to kill the invaders [44]. Here, the higher expression in hemocytes just goes to show that Lvserpin7 might play a key role in shrimp immunity. Upon immune stimulation by bacteria and WSSV, the Lvserpin7 transcript level increased significantly in hemocytes at 2 h post bacterial infection and significantly up-regulated at 12 h post WSSV infection. A similar up-regulation pattern occurs for E. sinensis Esserpin, L. vannamei Lvserpin and M. japonicus MjSerp1 [23,26,43]. These results suggest that Lvserpin7 expression rapidly responds to pathogenic challenge and plays a role in the early phase of pathogenic infections. Interestingly, a second increase was occurred at the later stage, it might be explained that the induction of Lvserpin7 to promptly clear the redundant serine proteinase. It is widely known that many serpins are involved in the proPO system. M. sexta serpin-6 and serpin-7 can block prophenoloxidase activation by inhibiting PAP3 activity in plasma [20,22]. D. melanogaster serpin-27A functions as a negative inhibitor of proPO activation by inhibiting the proPO activating enzyme (PPAE) [18]. In P. monodon, both PmSERPIN8 and PmSERPIN3 show the blocking effect on the extent of proPO cascade [24,25]. As we know, the P1 residue of RCL determines the primary selectivity of a serpin, as well as determines the target specificity [16]. Like serpin-6 and serpin-7 from M. sexta [20,22], SERPIN8 and SERPIN3 from P. monodon [24,25], Lvserpin7 shares the same P1 residue of arginine, which indicates that Lvserpin7 might have inhibitory activity against plasmin, subtilisin, thrombin, trypsin and kallikrein, and have similar function in the proPO system. In order to increase
262
Y. Liu et al. / Fish & Shellfish Immunology 42 (2015) 256e263
knowledge of Lvserpin7 in proPO activation, the rLvserpin7 protein was expressed and purified for further activities study. The impediment of the extent of proPO cascade might indicate the inhibition of Lvserpin7 on the specific proteases, which might be one of the prophenoloxidase-activating proteases. It's worth mentioning that some serpins exhibited inhibitory effect against bacterial proteases. Ranaserpin in Rana grahami could inhibit the growth of B. subtilis by inhibiting the activity of trypsin, elastase and subtilisin produced by the bacteria [46]. M. japonicus MjSerp1 effectively inhibited the secreted proteinase from S. aureus, B. subtilis, Bacillus megaterium, E. coli, K. pneumonia, and V. anguillarum [43]. Of note is that rLvserpin7 could restrain the growth of B. subtilis through inhibiting the produced protease activities. As the key components of invader, the secreted bacterial proteases are requisite for entry into the host and rapid activation of the cascade system [47]. More importantly, we have found that rLvserpin7 could strongly bind to different bacteria, such as B. subtilis, M. lysodeikticus and V. anguillarum. Most speculatively, it might imply that the binding of Lvserpin7 to B. subtilis offers a facility for inhibiting bacterial proteases. Nevertheless, the exact mechanism of bacterial inhibition of Lvserpin7 needs further study. In conclusion, a novel serine protease inhibitor, Lvserpin7 was identified from the Pacific white shrimp, L. vannamei. Lvserpin7 was
highly expressed in gill and hemocytes. The expression profile of Lvserpin7 after challenged with different pathogens suggested that it is inducible and may be involved in shrimp immune response. Moreover, the rLvserpin7 was purified and showed strongly binding activity and inhibition on bacterial proteases activity and prophenoloxidase activation. Acknowledgments We thank the professor Fuhua Li for kindly giving the three pathogens. This work was supported by the Agricultural Science and Technology Achievement Transformation Fund Project of Ministry of Science and Technology of the People's Republic of China (No. 2012GB2E200361), the Key laboratory of Marine Biology, Institute of Oceanology, Chinese Academy of Sciences and the Northwest A&F University experimental demonstration station (base) and innovation of science and technology achievement transformation project (No. XNY2013-4). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2014.11.001.
Fig. A. Phylogenetic tree of various serpins was constructed using the NJ-method with 1000 trials by MEGA 5.0 software.
Y. Liu et al. / Fish & Shellfish Immunology 42 (2015) 256e263
References [1] Marmaras VJ, Lampropoulou M. Regulators and signalling in insect haemocyte immunity. Cell Signal 2009;21:186e95. [2] Lee SY, Soderhall K. Early events in crustacean innate immunity. Fish Shellfish Immunol 2002;12:421e37. [3] Li F, Xiang J. Recent advances in researches on the innate immunity of shrimp in China. Dev Comp Immunol 2013;39:11e26. [4] Tassanakajon A, Somboonwiwat K, Supungul P, Tang S. Discovery of immune molecules and their crucial functions in shrimp immunity. Fish Shellfish Immunol 2013;34:954e67. [5] Yu X-Q, Jiang H, Wang Y, Kanost MR. Nonproteolytic serine proteinase homologs are involved in prophenoloxidase activation in the tobacco hornworm, Manduca sexta. Insect Biochem Molec 2003;33:197e208. [6] Cerenius L, Soderhall K. The prophenoloxidase-activating system in invertebrates. Immunol Rev 2004;198:116e26. [7] Jiravanichpaisal P, Lee BL, Soderhall K. Cell-mediated immunity in arthropods: hematopoiesis, coagulation, melanization and opsonization. Immunobiology 2006;211:213e36. [8] Kanost MR. Serine proteinase inhibitors in arthropod immunity. Dev Comp Immunol 1999;23:291e301. [9] Otlewski J, Krowarsch D, Apostoluk W. Protein inhibitors of serine proteinases. Acta Biochim Pol 1999;46:531e65. [10] Gubb D, Sanz-Parra A, Barcena L, Troxler L, Fullaondo A. Protease inhibitors and proteolytic signalling cascades in insects. Biochimie 2010;92: 1749e59. [11] Silverman GA, Whisstock JC, Bottomley SP, Huntington JA, Kaiserman D, Luke CJ, et al. Serpins flex their muscle I. Putting the clamps on proteolysis in diverse biological systems. J Biol Chem 2010;285:24299e305. [12] Rimphanitchayakit V, Tassanakajon A. Structure and function of invertebrate Kazal-type serine proteinase inhibitors. Dev Comp Immunol 2010;34:377e86. [13] Gettins PGW. Serpin structure, mechanism, and function. Chem Rev 2002;102:4751e803. [14] Wilczynska M, Fa M, Ohlsson P, Ny T. The inhibition mechanism of serpins. Evidence that the mobile reactive center loop is cleaved in the native protease-inhibitor complex. J Biol Chem 1995;270:29652e5. [15] Wang S, Cui Z, Liu Y, Li Q, Song C. Identification and characterization of a serine protease inhibitor (PtSerpin) in the swimming crab Portunus trituberculatus. Fish Shellfish Immunol 2012;32:544e50. [16] Huntington JA. Serpin structure, function and dysfunction. J Thromb Haemost 2011;9:26e34. [17] Mangan MSJ, Kaiserman D, Bird PI. The role of serpins in vertebrate immunity. Tissue Antigens 2008;72:1e10. [18] Nappi AJ, Frey F, Carton Y. Drosophila serpin 27A is a likely target for immune suppression of the blood cell-mediated melanotic encapsulation response. J Insect Physiol 2005;51:197e205. [19] Zhu Y, Wang Y, Gorman MJ, Jiang H, Kanost MR. Manduca sexta serpin-3 regulates prophenoloxidase activation in response to infection by inhibiting prophenoloxidase-activating proteinases. J Biol Chem 2003;278:46556e64. [20] Wang Y, Jiang H. Purification and characterization of Manduca sexta serpin-6: a serine proteinase inhibitor that selectively inhibits prophenoloxidaseactivating proteinase-3. Insect Biochem Molec 2004;34:387e95. [21] Christen JM, Hiromasa Y, An CJ, Kanost MR. Identification of plasma proteinase complexes with serpin-3 in Manduca sexta. Insect Biochem Molec 2012;42: 946e55. [22] Suwanchaichinda C, Ochieng R, Zhuang S, Kanost MR. Manduca sexta serpin-7, a putative regulator of hemolymph prophenoloxidase activation. Insect Biochem Molec 2013;43:555e61. [23] Wang L, Ma Z, Yang J, Gai Y, Zhou Z, Wang L, et al. Identification and characterization of a serine protease inhibitor Esserpin from the Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol 2013;34:1576e86. [24] Wetsaphan N, Rimphanitchayakit V, Tassanakajon A, Somboonwiwat K. PmSERPIN3 from black tiger shrimp Penaeus monodon is capable of controlling the proPO system. Dev Comp Immunol 2013;41:110e9.
263
[25] Somnuk S, Tassanakajon A, Rimphanitchayakit V. Gene expression and characterization of a serine proteinase inhibitor PmSERPIN8 from the black tiger shrimp Penaeus monodon. Fish Shellfish Immunol 2012;33:332e41. [26] Liu Y, Hou F, He S, Qian Z, Wang X, Mao A, et al. Identification, characterization and functional analysis of a serine protease inhibitor (Lvserpin) from the Pacific white shrimp, Litopenaeus vannamei. Dev Comp Immunol 2014;43: 35e46. [27] Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell 2006;124:783e801. [28] Akira S. Pathogen recognition receptors and innate immunity. Xenotransplantation 2013;20:351. [29] Rodriguez J, Boulo V, Mialhe E, Bachere E. Characterisation of shrimp haemocytes and plasma components by monoclonal antibodies. J Cell Sci 1995;108:1043e50. [30] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001;25: 402e8. [31] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248e54. [32] Zhang XW, Xu WT, Wang XW, Mu Y, Zhao XF, Yu XQ, et al. A novel C-type lectin with two CRD domains from Chinese shrimp Fenneropenaeus chinensis functions as a pattern recognition protein. Mol Immunol 2009;46:1626e37. [33] Chen A, He NH, Xu X. Mj-DWD, a double WAP domain-containing protein with antiviral relevance in Marsupenaeus japonicus. Fish Shellfish Immunol 2008;25:775e81. [34] Wang ZH, Zhao XF, Wang JX. Characterization, kinetics, and possible function of Kazal-type proteinase inhibitors of Chinese white shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol 2009;26:885e97. [35] Winters AL, Minchin FR. Modification of the Lowry assay to measure proteins and phenols in covalently bound complexes. Anal Biochem 2005;346:43e8. [36] Wang XW, Zhang HW, Li XA, Zhao XF, Wang JX. Characterization of a C-type lectin (PcLec2) as an upstream detector in the prophenoloxidase activating system of red swamp crayfish. Fish Shellfish Immunol 2011;30:241e7. [37] Amparyup P, Charoensapsri W, Tassanakajon A. Prophenoloxidase system and its role in shrimp immune responses against major pathogens. Fish Shellfish Immunol 2013;34:990e1001. [38] Li F, Xiang J. Signaling pathways regulating innate immune responses in shrimp. Fish Shellfish Immunol 2013;34:973e80. [39] Liu Y, Qian Z, Qu R, Wang X, He S, Hou F, et al. Molecular characterization, immune responsive expression and functional analysis of QM, a putative tumor suppressor gene from the Pacific white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol 2014;37:1e10. [40] Ghosh J, Lun CM, Majeske AJ, Sacchi S, Schrankel CS, Smith LC. Invertebrate immune diversity. Dev Comp Immunol 2011;35:959e74. [41] Hou F, Wang X, Qian Z, Liu Q, Liu Y, He S, et al. Identification and functional studies of Akirin, a potential positive nuclear factor of NF-kappaB signaling pathways in the Pacific white shrimp, Litopenaeus vannamei. Dev Comp Immunol 2013;41:703e14. [42] Herrid M, Vignarajan S, Davey R. Successful transplantation of bovine testicular cells to heterologous recipients. Reproduction 2006;132:617e24. [43] Zhao YR, Xu YH, Jiang HS, Xu S, Zhao XF, Wang JX. Antibacterial activity of serine protease inhibitor 1 from kuruma shrimp Marsupenaeus japonicus. Dev Comp Immunol 2014;44:261e9. [44] Smith V, Chisholm J. Non-cellular immunity in crustaceans. Fish Shellfish Immunol 1992;2:1e31. [45] Zhao J, Song L, Li C, Zou H, Ni D, Wang W, et al. Molecular cloning of an invertebrate goose-type lysozyme gene from Chlamys farreri, and lytic activity of the recombinant protein. Mol Immunol 2007;44:1198e208. [46] Han YP, Yu HN, Yang XB, Rees HH, Liu JZ, Lai R. A serine proteinase inhibitor from frog eggs with bacteriostatic activity. Comp Biochem Physiol B 2008;149:58e62. [47] Christeller JT. Evolutionary mechanisms acting on proteinase inhibitor variability. Febs J 2005;272:5710e22.
