Eur. J. Biochem. 204, 1141-1148 (1992)
6 FEBS 1992
Recombinant human retinoic acid receptor a Binding of DNA and synthetic retinoids to the protein expressed in Escherichiu coli Siegfried KEIDEL’, Eva RUPP’ and Michael SZARDENINGS
’ Department of Biochemistry, Medizinische Hochschule Hannover, Federal Republic of Germany Ludwig Institute for Cancer Research, Biomedical Center, Uppsala, Sweden Dcpartment of Molecular Biology, University of Uppsala, Sweden (Received October 8/November 26, 1991) - EJB 91 1342
The human retinoic acid receptor u was expressed in Escherichia coli. The recombinant protein was found to be very unstable in several E. coli strains, probably due to proteolysis. Conditions were established to obtain reasonable amounts of active protein for ligand and DNA binding studies. The recombinant receptor showed the expected DNA binding activities in gel-retardation assays. Ligand binding properties were measured in a charcoal absorption assay. The dissociation constant for highly specific bound retinoic acid was found to be 0.67 nM. The affinity of several synthetic retinoids to thc recombinant protein was determined and compared to their biological activity. Some of the values presented here differ significantly from those published earlier for the receptor or its isolated hormonebinding domain.
The nuclear receptors for retinoids play a major role in the regulation of genes involved in cell differentiation and growth. Their natural ligand, the vitamin A derivative alltrans-retinoic acid, has been reported to be a possible morphogen in the embryonic tissues of frogs and chicken. Synthetic analogues of vitamin A (retinoids) show significant effects in treatment of dermatological disorders, as immunomodulators and as anticancer agents (Crettaz et al., 1990). The understanding of DNA and ligand binding of retinoic acid receptors is therefore of major interest. Retinoids are defined as compounds with retinoic-acidlike chemical structures or, more recently, as compounds inducing virtually the same biological activity as retinoic-acid itself ‘by binding to or activating a specific receptor or a set of receptors’ (Kagechika et al., 1988). Chemically stable retinoids especially, like those used in this study, are of great pharmaceutical importance. The biological potence of such retinoids is usually studied in in vivo systems, mainly based on measuring the induction of differentiation (Jetten et al., 1987; Breitman et al., 1980; Strickland and Mahdavi, 1978). The cDNAs for three similiar retinoic acid receptors (RARE,RARP and RARy; Giguere et al., 1987; Petkovich et al., 1987; Benbrook et al., 1988; Brand et al., 1988; Krust et al., 1989; Zelent et al., 1989) in human and mice have been cloned. Another receptor (RXRa) for retinoic-acid (Mangelsdorf et al., 1990) from human and its chicken analogue (Rowe et al., 1991) have been identified, but these are not related to RAR a, fi or y. Diffcrent domains of the receptors could be defined from sequence data (Green and Chambon, 1988), but it is not
known whether they retain their entire natural properties. Therefore it seemed to be important for the investigation of retinoic acid receptors to carry out retinoic-acid and DNA binding studies on the entire protein. Attempts have been made to use recombinant retinoic acid receptors (rRAR) from transfected cell lines for retinoic-acid binding studies, but this may require the use of HPLC to remove other retinoic acid binding activity (Cavey et al., 1990), which can be problematic if the ligand exhibits weak binding. Crettaz et al. (1990) reported the use of RARE and RARP ligand-binding domains expressed in Escherichia coli,but they failed to express the fulllength proteins. They reported similar retinoic acid binding constants for RARE and RARB from nuclear extracts and the retinoic acid binding domains expressed as fusion proteins in E. coli. We report here the characterization and kinetic studies on the binding of DNA, retinoic acid and other retinoids to human rRARcl expressed in E. coli. The binding to rRARcl is compared to results obtained recently for rRARcl and the retinoic acid binding domain expressed by other means (Yang et al., 1991; Hashimoto et al., 1990; Crettaz et al., 1990) and further to that determined in our assay system for murine cellular retinoic-acid-binding protein, also obtained by expression in E. coli (Zhang et al., 1992). There are significant differences between some reported values and our results. This will have consequences for the understanding of the action of some retinoids in vivo.
____
Strains and plasmids
Correspondence to M. Szardenings, Department of Molecular Biology, University of Uppsala, Box 590, S-75 124 Uppsala, Sweden Abbreviufions. RARa, RARP, RARy and RXRa, retinoic acid receptors; rRAR, recombinant retinoic acid receptor; OC, hormoneresponsive element of the human osteocalcin gene promoter.
The methods used for cloning and sequencing (Maniatis et al., 1982) have been described. Strain DH5a was used for cloning experiments. Sequences were confirmed by doublestrand sequencing with T7 DNA polymerase (Pharmacia).
MATERIALS AND METHODS
1142 Plasmid pRShRARa (Giguere et al., 1987) containing the RARa cDNA was obtained from Vincent Giguere (Toronto, Canada). pGP1-2 (Tabor and Richardson, 1985) and pT7-7 were kindly provided by Stan Tabor (Harvard Medical School). pT7-7 is an expression vector containing the entire promoter region of gene $10 from bacteriophage T7 oriented counterclockwise. This provides a strong transcription system in combination with T7 RNA polymerase and a strong ribosome binding site followed by a polylinker. Genes can be cloned into NdeI site at the translation start codon. pRShRARcc was restricted with EcoRI/BamHI and the cDNA cloned into the polylinker of pT7-7. The NdeI linker d(CCATATGG) (Pharmacia) was ligated into the B d l site following the start codon of the RARa cDNA. The resulting plasmid was restricted with NdeI to remove the sequence between the 410 start codon and cDNA. Religation yielded pT7-RARa. In this plasmid the cDNA can be expressed unaltered under transcriptional control of the 410 promoter. Bacterial strains used in here were LC137 (Goff et al., 1984; Lee et al., 1988): htpR(Am,ts), lonR9(ts), lac(Am), trp(Am), pho(Am), rpsL, supC(ts), rnal(am), txs: :TnlO; SG4121 (source: S. Gottesman): F-, dlon100, d(gal-bln), r-, m', recA, strA (derived from SG 4044, Gottesman et al., 1981); DH5a (BRL), JM103 (Messing et al., 1981), JM105 (YanischPerron et al., 1985), SG20252 (Trisle and Gottesman, 1984) and WK6 (Zell and Fritz, 1987) whose genotypes have been described. Expression of recombinant RARa Bacteria transformed with pGP1-2 and pT7-RARa were grown in SR medium (20 g/1 Bactotryptone, 20 g/1 yeast extract, 10 g/l meat extract, 0.5%, by vol., glycerol, 72mM K2HP04,17 mM KH2P04,pH 7.0)in thepresence of 100 mg/ 1 ampicillin and 40 mg/l kanamycin. In precultures additionally 0.5 mM isopropyl thio-P-D-galactopyranoside and optionally (LCl37) 20 mg/l tetracycline were used. The culture was inoculated 1 :200 with an overnight culture and grown at 30°C to an absorbance at 555 nm of 0.8- 1.0 and then shifted to 36°C. Cells were harvested after different time intervals by centrifugation and resuspended in a fifth of the original culture volume of buffer R (20mM Hepes pH 7.0, 50mM KCI, lo%, by vol., glycerol); 5 mM 2-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride and 10 U/ml benzon nuclease (Benzonase, Merck, Darmstadt, FRG) were added. The cells were lysed by sonification, incubated for 30 min on ice and cell debris was removed by centrifugation. For large-scale preparations from LC137xpGPl -2xpT7-RARE the inoculation ratio was 1 : 500, induction was carried out at A 5 5 5= 1.5-2.0 and cell pellets obtained by centrifugation were resuspended in 1 - 2 pellet volumes of buffer R. Additionally to the reagents described above, 0.5 mg/ml lysozyme was added. The solution was stirred on ice until the viscosity decreased and then frozen in liquid nitrogen to complete lysis of the cells. The cell debris was removed after thawing by ultracentrifugation at 45 000 x g, 2 "C for 15 h. The bacterial extract could be stored for several months at - 30 'C in buffer R containing 20% (by vol.) glycerol and 20 mM p-mercaptoethanol without any loss of retinoic-acid-binding activity. Retinoid binding assay Assays were carried out with all-trans-retinoic acid purchased from Sigma [11,12-3H] retinoic acid (55.7 Ci/mmol)
from New England Nuclear (NEN, Du Pont de Nemours, Bad Homburg, FRG). Calcitriol (1,25-dihydroxyvitamin D3) and TTNPB (Ro 13-7410) were gifts from Hoffmann-La Roche (Basel, Switzerland). Other analogues were synthesized as described: TTNN (Dawson et al., 1983), TTAB (Dawson et al., 1989), Am80 and Am90 (Kagechika et al., 1988), Ch80 and Ch55 (Kagechika et al., 1989); their structures are shown in Table 2. 2 mM stock solutions were prepared immediately before use and diluted in dimethylsulfoxide if necessary. In routine assays aliquots of bacterial extracts or purified fractions containing 0.2 - 0.3 pmol receptors were added to binding buffer (50 mM Hepes pH 7.0, 50 mM KCl, 10 mM dithiothreitol, 0.30/0 (masslvol.), y-globulin, 10 pg/ml leupeptin, 10 pg/ml antipain, 10 pg/ml EG64, 1 mM phenylmethylsulfonyl fluoride) in glass tubes giving a final volume of 0.5 ml. The following reactions were carried out in the dark; 0.2-5 nM [3H] retinoic acid and various concentrations of unlabelled compounds in dimethylsulfoxide were added. The final concentration of dimethylsulfoxide was 2% (by vol.). After shaking 3 h at 2 0 T , an aliquot for measuring total radioactivity was taken; 0.25 ml cold charcoal/dextran suspension (6%, mass/vol.), Norit A, (0.6%, mass/vol., dextran T70 in binding buffer) was added. After mixing, the tubes were shaken at 4°C for 15 min and than centrifuged 10 min at 15000 x g (4°C). Radioactivity of the supernatants was determined. Nonspecific binding was determined from experiments in presence of 100-fold molar excess of unlabelled retinoic acid or with bacterial extracts free of receptor protein obtained from LC137xpGPl-2. Scatchard analysis was performed as described by Scatchard (1949). Column chromatography In order to label the receptor with [3H] retinoic acid, in a typical experiment 100 p1 cell extract was mixed with 100 p1 200 mM Na2HP04 (pH 7.4), 10 pCi (0.2 pmol) [3H] retinoic acid in ethanol was added and the solution was incubated for at least 1 h at 4°C. Excess [3H]retinoic acid was removed with charcoal/dextran as described above and the supernatant was filtered over a 0.22-pm filter. All chromatography was carried out at 4°C. Gel filtration on Superose columns was carried out with 20 mM Hepes pH 7.0, 400 mM KCI, 10% (by vol.) glycerol, 2 mM 2-mercaptoethanol (Nervi et al., 1989). For Superdex columns 200 mM KC1 was used instead. Sucrose gradient centrifugation After charcoal/dextran treatment and centrifugation as described for the binding assay, 0.2 ml of the supernatant was layered onto linear 5-2070 sucrose gradients (3.5 ml), prepared in 50 mM Hepes pH 7.0, 2% (massivol.) KCI. The gradients were centrifuged for 20h at 250000 x g (Beckman SW60 rotor) and 4°C. Fractions (0.15 ml) of the gradient solutions were collected by using a fraction recovery system and radioactivity was measured. Gel-retardation assay Gel-retardation assays (Fried and Crothers, 1981) were performed as described earlier (Rupp et al., 1990). The painvise complementary oligonucleotides of the hormoneresponsive element of the human osteocalcin gene promoter, OC (Schiile et al., 1990) (5'-CGGTGACTCACCGGGTGAACGGGT-3'; 3'-GTACGCCACTCAGTGGCCCACTTG-
1143 a
pRShRARalpha :
M e t A l a Ser Asn
iL
CACTGTGGCCGCTTGGCATGG 'CAGCAAC
Bal I
pT7-RARalpha
:
1 iftAJa
AAGAAGGAGATATACAT
T7:22949
GGCCAGCAAC SerAsn Nde I
T7:22965
BamH I
I
Eluted volume ( m l )
pT7-RARalpha
4455 bp
Ndc I Fig. 1. Expression system. (a) The S' end of the cDNA for RARa in pRShRARcc and the construct obtained after recloning in pT7-RARa. The Bull site is maintained in the latter, although not indicated for convenience. (b) The expression plasmid used in this study. The RARa cDNA is under transcriptional control of the 410 promotor, that is exclusively recognized by the T7 RNA polymerase. The origin is of ColEl type. The blu gene for ampicillin resistance is oriented counterclockwise to avoid unwanted transcription from the 410 pro-
motor.
Fig.2. Gel filtration. Gel filtration on a Superdex 200pg HR16/60 column (Phannacia, Uppsala, Sweden). 0.5 ml of crude bacterial extract were incubated with [3H]retinoicacid as described and run on the column with a buffer containing 20mM Hepes pH 7.2, 200mM KCI, 10% (by vol.) glycerol, 5 mM 2-mercaptoethanol;I-mlfractions were collected and radioactivity determined. The arrows indicate elution volumes corresponding to ferritin (horse spleen; a, 450 kDa), catalase (bovine liver; b, 240 kDa), aldolase (rabbit muscle; c, 160 kDa), bovine serum albumin (d, 66 kDa), egg albumin (e, 45 kDa), chymotrypsinogen A (f, 25 kDa), equine myoglobin (g, 17.8 kDa), cytochrome c (h, 12.3 kDa).
added and samples were loaded on a 5% polyacrylamide gel (30: 0.5). The run was performed with Tris/borate/EDTA (0.089 M Tris, 0.089 M borate, 0.4 mM EDTA). The gel was autoradiographed with Amersham Hybond film using an intensifier screen.
RESULTS Expression of recombinant RARE
To express RARE in E. coli, the cDNA obtained from pRShRARcl (Giguere et al., 1987) was cloned into pT7-7 ( S . Tabor, Harvard, unpublished results; Fig. 1a). Bacteria harbouring pGP1-2 (Tabor and Richardson, 1985) were transformed with the resulting plasmid pT7-RARa (Fig. 1b). ExCCCAGATC-5') and the CAMP-responsive element of the rat pression was induced by shifting the temperature to 35 - 4 2 T . somatostatin gene (Montminy et al., 1986) (5'- This induces expression of the T7-RNA polymerase under CTGGCTGACGTCAGAGAT - 3' ;3'- GTACGACCGACTG - control of the PI promoter on pGP1-2 and subsequent tranCAGTCTCTAGATC-5') were synthesized, annealed and scription from the T7 promoter. Growth curves of E. coli labelled with T7-DNA polymerase (Pharmacia). Reaction strains (JM103, JM105, DHScr, Wk6) that were tested initially mixtures for gel-retardation assays contained E. coli extract for the expression of RARa showed a short lack phase, but or fractions thereof as indicated, 2 pg poly [(dI) . (dC)] and, started to grow normally again without producing any or little if indicated, competing oligonucleotides in a final volume of retinoic acid or DNA binding activity. This suggested that 20 p1 in 10 mM Hepes/NaOH pH 7.9, 2.5 mM MgC12, 10% those strains either lost one of the plasmids or overcame the (by vol.) glycerol, 60 mM KCl, 0.1 mM EDTA, 2 m M expression by proteolysis. Gel-retardation assays with such dithiothreitol and 10 pM ZnC1,. Reactions were incubated at material were only successful in the presence of proteinase room temperature for 15 min, 60 fmol 32P-labelled inhibitor. This assay was used initially to monitor the exoligonucleotidc was added and incubation continued for 15 pression of intact rRARcr, as we expected that to be more min. Then 3 p1 of a stop solution [90 mM EDTA, 0.25% sensitive to partial degradation than retinoic-acid-binding as(mass/vol.) bromophenol blue, 10% (mass/vol.) sucrose] was says. Proteolytic degradation resulted usually in smeared
1144
D
:;[ . ..
ul
_ .. ... : :. - .. ..
-- .... "?-; 0
i
;
0
5
lb Eluted volume ( m l )
Fig. 3. D N A binding of rRARa. Each gel-retardation experiment contains 60 fmol "P-labeled OC oligonucleotide, 2 pg poly[(dI) . (dC)] as unspecific competitor was added to each of the reactions and protein . DNA complexes were resolved on a 5% polyacrylamide gel. (A) Lane A1 contains no protein; lanes A2-A6 contain proteins eluted from a MonoQ column in a run similar to D and correspond to 0.25-ml fractions from 10.5- 11.5 ml elution volume. (B) Retardation experiments on the same gel with crude extracts from E. coli. The extracts used for lanes B1 and B2 are derived from E. coli cells harbouring the same plasmids as used for expression experiments, but without the RARr cDNA. These cells wcre also grown and lysed as described in Materials and Methods. Lanes B3 and B4 show corresponding experiments using an extract from induced E. coli LC137xpGP1-2xpT7-RARcl. I n lanes B2 and B4 reaction mixtures contained additionally 6 pmol unlabelled OC oligonucleotide. Arrow A indicates the complex between RARE and OC; arrows b and c indicate complexes created by interaction of E. coli proteins with the oligonucleotide. (C) DNA binding of rRARct is sequence-specific. Gel-retardation experiments were performed under the same conditions as in B and as described in Materials and Methods. For each experiment 60 fmol of 32P-labelled OC was incubated with 7 p1 protein material, corresponding to lane A4. In lane C2, 6 pmol unlabelled OC was added and lane C4 contains 6 pmol of the CAMP-responsive element of the rat somastatin gene (CRE) oligonucleotide. Arrow A: rRARr-specific DNA binding; arrows b and c : complexcs most probably due to unspecific interaction of E. coli proteins. (D) Purification of recombinant rRARa by ion-exchange chromatography. 0.5 ml crude extract incubated as described with [3H]retinoic acid was applied to a MonoQ HR5/10 column (Pharmacia). The column was eluted with 25 mM Tris pH 7.2, 5 mM 2-mercaptoethanol and a gradient (dashed line) of 0 - 1 M NaCI. The solid line absorbance at 280 nm; (-----)radioactivity in the eluent, indicating [3H]retinoic acid ([3-H]RA). indicates the (-)
bands (data not shown). The Ion- strains (SG20252, SG4121) tested upon this finding were found to lyse within 30 min after induction (> 37°C) or produced very little activity (> 37°C) (data not shown). E. coli K12 LC137 (lon-) seemed to be optimal for the expression with regard to plasmid stability and protein production. Due to hfpR(Am,Ts), i. e. a temperaturesensitive, amber-mutated a3' factor, the expression of heatshock genes depending on this factor is additionally reduced to a minimum under expression conditions. This reduces the heat-shock response, whereas at 30 "C no mucoid phenotype could be observed, as is the case with many Ion- strains. The optimal temperature for induction was found to be 36°C in accordance with recent publications about expression under control of the P I promoter (Lowman and Bina, 1990). Characterization of the recombinant RARa The rRARa activity was best retained in crude extracts, where it withstood repeated thawing and freezing. Active fractions obtained from column chromatography lost their activity partially upon freezing under the same conditions. For using these in binding assays, it had to be confirmed that activity was due to a single homogenous and active protein. Several experiments were carried out in order to confirm this. Cellular extracts were preincubated with [3H]retinoicacid and
subjected to gel filtration on several prepacked FPLC columns (Pharmacia). On a smaller Superose 12 HR10/30 a single peak eluted with a similar elution volume (14.9 ml, data not shown) as described for RARa derived from human cell extracts (about 14.5 ml, Nervi et al., 1989). Also from a higher-resolving Superdex column (Fig. 2) and from a sucrose gradient the activity was obtained in a single peak corresponding to a 50kDa protein. DNA binding activity DNA-binding activity of rRARa was assayed by gel-retardation. For these studies a hormone-responsive element of the human osteocalcin gene promoter (OC) was chosen. This element has been shown previously to bind specifically E. coli-derived RARa and confers retinoic-acid-inducibility to a heterologous promoter (Schule et al., 1990). Incubation of OC with control extracts from E. coli cells without RARa lead to bands that cannot be competed by an excess of unlabelled OC (100-fold excess) and are therefore considered to be unspecific (Fig. 3 B). These bands are indicated by arrows b and c. Experiments with E. coli cells expressing RARa show an additional band, which is competed by excess of unlabelled OC. This band is indicated by arrow A in Fig. 3 B. rRARa binding to OC can hardly be competed by an oligonucleotide rep-
1145
a
Bound RA (cpm) 5500 5000
Table 1. Binding specifity. Bacterial extracts were incubated with 2 nM [3H] retinoic acid and 1 pM of the indicated compounds as described in Materials and Methods. Specific binding activity of 2 nM [3H] retinoic acid without retinoids was calculated as 100%
4500
Addition
4000
Binding
3500
Yo
3000
None Retinoic acid Retinol Retinal 3,3’,5-Triiodo-~-thyronine Calcitriol Dexamethasone 17p-Estradiol Progesterone
2500
2000 1500
1000
500 0 0
1
2
3
4
5
RA (nM)
Bound/ Free
___.---
I00 5 82 12 100
99 97 96 99
b 1
Bound RA (% of control)
a
--+I Bound (nM) Retinoid (nM)
Fig. 4. Saturation binding and Scatchard analysis. (a) Bacterial extracts were incubated with the indicated concentrations of [3H]retinoicacid in the presence or absence of a 100-fold molar excess of unlabelled retinoic acid (RA) as describcd in Materials and Methods. No specific binding was measured in LC137xpGPI-2 extracts. (0)Total binding activity; (0)specific binding activity; ( A ) nonspecific binding activity. (b) Scatchard plot of the binding data. Points are means for duplicate determinations. The calculated Kd was 0.67 f 0.08 nM (n = 4).
Bound RA (cpm)
b
b
a
3500 3000 2500 -
2000
resenting the CAMP-responsive element of the rat somatostatin gene, CRE (Montminy et al., 1986; Fig. 3 C). Additionally Fig. 3 D shows the elution profile of intact RARa with bound [3H]retinoic acid and Fig. 3 A DNA-binding activity of fractions derived from the peak.
1500 1000 -
.,0 n
5
Ligand-binding characteristics of the cloned receptor The ligand-binding properties of the receptor were analysed by using the charcoal absorption hormone binding assay (Dokoh et a]., 1982). The use of y-globulin instead of gelatine as expander protein improved the reproducibility of measurements by efficiently reducing nonspecific binding. Analyses of [3H]retinoic-acid-labelledbacterial extracts by sucrose density gradient centrifugation indicated the presence of specific retinoic-acid-binding activity. The single, symmetrical peak sedimented between the positions of cytochrome c and bovine serum albumin. Retinoic acid competed with [3H]retinoicacid for these binding sites (Fig. 5b). Fig. 4a shows the binding of [3H]retinoic acid to bacterial extracts plotted against the retinoic acid concentration;
15
10
20
25
Fig. 5. Competition experiments with synthetic retinoids. (a) Competition of several retinoids with the binding of retinoic acid (RA). Bacterial extracts were incubated with 2 nM [3H]retinoic acid and the indicated concentrations of unlabelled retinoids as described in Materials and Methods. Specific binding activity of 2 nM [’H]retinoic acid without retinoids was calculated as 100%. Points are means for duplicate determinations. (0)Retinoic acid; ( V ) TTNPB; (0) TTAB; (0) AM80; (H) AM90; ( A ) Ch55; ( A ) Ch80 (see Table 2 for retinoid structures). (b) Sucrose gradient centrifugation. Bacterial extracts were incubated with 5 nM [3H]retinoic acid in the presence ( 0 1 or molar excess of unlabelled retinoic . - - -absence - - ~(0 ~ 1 of ~ 100-fold - ~ acid and other retinoids as under (a). The sedimentation positions of cytochrome c (a; 12.4 kDa) and bovine serum albumin (b; 66 kDa) are indicated bv arrows. \ - I
,
-
I
~~~
~
~~~
~
1146 Table 2. Biological activity and receptor binding of several retinoids. Relative receptor binding is defined as the ratio of IC50 value (i.e. concentration to achieve 50% inhibition of the total specific binding) for retinoic acid (RA) to that of the analogue. Biological activity was estimated from release of plasminogen activator during induced differentiation of F9 teratocarcinoma cells. At the EDSoconcentration the retinoid produces a half-maximal biological effect. Results were obtained from Dawson e l al. (1989) (a) or from Jetten et al. (1987) (b). Retinoid
Chemical structure
Plasminogen activator release, F9, EDso
Relative receptor binding
wcoon Yo
nM
0.10 70.37
100
TTNPB
0.08*/0.20
I1
TTAB
0.30"
RA
TTNN
170
wcoon 1.OO"
3
0.40b
17
/
Am80
0
> lOOb
Am90
0
0
Ch55
nonspecific binding determined in the presence of a 100-fold molar excess of unlabelled retinoic acid is linear to this concentration. Specific binding was obtained by subtracting nonspecific binding activity from total binding activity. LC137xpGPI-2 bacterial extracts showed no specific binding. Scatchard analysis of these data yielded a linear plot indicating a single class of binding sites (Fig. 4b). The concentration of rRARcl in the extracts was estimated to be 100nM in the average bacterial extract. The dissociation constant (Kd SD) was estimated to be 0.67 f0.08 nM (n = 4). The binding constant for recombinant murine cellular retinoic-acid-binding protein (Zhang et al., 1992) expressed and assayed in the same systems was determined to be 6.1 A 0.9 nM (n = 4), which is in good agreement with the value obtained by fluorometric studies (4.2 nM, Ong and Chytil, 1978) and another variant of the charcoal dextran assay (3.3 nM for rat cellular retinoicacid-binding protein, Madani et al., 1991). This shows that
0.60
1
0.26'
5
the modified assay system, although involving relatively harsh treatment of the protein, is quite comparable to a direct fluorometric measurement without further manipulations. The binding of retinoic acid to the bacterial extracts was specific. Two natural retinoids, retinal and retinol, had neglible effect in competing retinoic acid, whereas ligands for other nuclear receptors did not bind at all to rRARa (Table 1). Fig. 5 a compares the dose/response curves for inhibition of specific binding of [3H]retinoic acid to the receptor by the synthetic retinoids compared with those of retinoic acid. The order of potency of the compounds was TTAB > retinoic acid > TTNPB > Am80 > Ch55 > TTNN > Ch8O; Am90 did not compete with [3H]retinoic acid. The binding of these retinoids to rRARa was compared to the ability of the compounds to induce differentiation of F9 embryonal carcinoma cells (Table 2). The production of plasminogen activator dur-
1147 ing the differentiation serves as a differentiation marker in this assay (Jetten et al., 1987; Dawson et al., 1989).
DISCUSSION The human RARu cDN A was expressed in E. coli. Binding studies with DNA and retinoic acid showed that the recombinant protein has the expected properties. Competition experiments with synthetic retinoids suggest that RARu is a possible target for some of these, which might be important for clinical applications. The expression of rRARa in standard E. coli expression systems is mainly hampered by proteolytic degradation. This explains the low expression levels reported in a recent publication (Crettaz et al., 1990). Such problems can be overcome by expression under the control of T7 promotors (Studier et al., 1990). We found in contrast to Yang et al. (1991) that this was not sufficient to obtain reasonable amounts of active rRARa. Strains deficient in the protease gene lon have long been suggested for overcoming problems with proteolysis, but there are only a few published examples yet (see Gottesman, 1990, for references). No specific retinoic-acid binding activity could be found in E. coli extracts without rRARa, allowing measurement of binding data without any further purification. This was advantageous as the protein’s activity decreased when it was enriched by chromatography. The DNA binding might be affected by salts such as KCl (Yang et al., 1991), although we could not confirm this finding in our gel-retardation assay, when using 60 mM KC1 in the binding experiments. rRARa exhibited DNA binding to the responsive element of the human osteocalcin gene in a specific manner as expected. Additionally to the specific binding of rRARa to this element, two additional bands arose. These bands were nonspecific and were also observed when using a palindromic thyroid hormone responsive element (Umesono et al., 1988) as DNA probe (data not shown). They are probably caused by E. coli proteins. Whether they are due to the type of expression system used or to experimental procedures, is not known. The dissociation constant (0.67 nM) for rRARu is in accordance with recently published results (Kd = 0.21 nM, Yang et al. 1992). Crettaz et al. (1990) published a Kd value determined for the ligand binding domain of rRARa ( K d = 6.2 nM), i.e. a factor 10 lower than described here. This indicates that the binding properties of the isolated retinoic-acidbinding domain are not identical with those of the entire receptor as claimed by Crettaz et al. (1990). Thus the neighbouring regions in the RARa and the related receptors can be expected to influence retinoic-acid-binding properties or the protein stability. We determined the dissociation constant of recombinant murine cellular retinoic-acid-binding protein to be 6.1 nM, indicating that delivery of retinoic acid from its cytosolically located binding protein to human RARa might be possible. The cellular binding protein could serve as transport protein for retinoic acid in the cytoplasm, in the same way as retinolbinding protein has been suggested as an extracellular retinoicacid-transport protein due to the published binding constants (Goodman, 1984). Furthermore, it could serve as the intracellular storage protein for the otherwise easily degraded retinoic acid. On the other hand, recent publications suggest the cellular binding protein to be a down-regulator for the concentration of free retinoic acid (Dolle et al., 1990; Ruberte et al., 1991).
Table 2 compares the affinity of synthetic retinoids of rRARa found in vitro to their activity in vivo. Retinal and retinol exhibit biological activity (Sporn and Roberts, 1984) but did not bind significantly to rRARu (Table 1). These natural retinoids were most probably oxidized to retinoic acid in the responsive cells by known oxidation mechanisms (Frolik, 1984). For the compounds TTAB, TTNN, Am80 and Am90 a reasonable correlation was found. In accordance with the biological activity (Jetten et al., 1987; Dawson et al., 1989) Am80 showed significant binding activity, while TTNN showed lower binding activity. Interestingly, methylation of the amide-N in Am80, giving Am90, resulted in loss of biological activity and binding to rRARa. Only TTAB, a very active retinoid in many biological assays (Dawson et al., 1989), bound rRARa better than retinoic acid. The arotinoid TTNPB showed in most assays more biological activity than retinoic acid (Jetten et al., 1987). It still exhibits 71% of the binding activity for full-length rRARa, in contrast to 50% reported for the binding domain alone (Crettaz et al., 1990). A direct comparison of biological activity and in vitro binding to rRARu is hampered by the difference in chemical stability of retanoic acid and the synthetic retinoids. Furthermore retanoic acid can be degraded by known biological processes (Frolik, 1984), which will probably not modify the synthetic compounds used in this study. Ch8O exhibits significant and Ch55 very high biological activity, such as inducing differentiation of HL60 cells (Jetten et al., 1987), but low binding to rRARa. From knowledge of cellular metabolic pathways, it is unlikely that these Ch compounds will be metabolized in cells to derivates that are able to bind RARa. Ch55 was recently found to bind RARE isolated from trdnsfected human cell lines better than retinoic acid (Hashimoto et al., 1990). These measurements were carried out in competition experiments with [3H]Am80with relatively small amounts of receptor protein. An explanation might be the unknown association and rate constants for retinoic acid and Am80. Our results indicate that other nuclear receptors, like RARP, RARy and RXRa, can be expected to be targets of these retinoids. This work was suggested by and carried out in the laboratory of Prof. T. A. Jones as part of a project to understand the structural basis of retinoid function. This project is supported by the Swedish Natural Science Research Council. S. K. thanks Prof. W. Jungblut and Dr. W. Sierralta (Max Planck Institute for Experimental Endocrinology, Hannover, FRG) for the possibility to carry out the RA binding assays in their laboratories. E. R. is supported by the Boehringer lngelheim Fonds (Stuttgart, FRG). M. S. thanks the Nordisku Indusrri Fond (Copenhagen, Denmark) for funding.
REFERENCES Benbrook, D., Lernhardt, E. & Pfahl, M. (1988) Nature 333, 669672. Brand, N. J., Petkovich, M., Krust, A., Chambon, P., de The, H., Marchio, A., Fiollais, P. & Dejean, A. (1988) Nuture 332, 850853. Breitman, T. R., Selonick, S. I. & Collins, S. J. (1980) Proc. Nut1 Acad. Sci. USA 77,2136-22740. Cavey, M. T., Martin, B., Carlavan, I. & Shroot, B. (1990) Anal. Biochem. 186, 19-23. Crettaz, M., Baron, A., Siegenthaler, G. & Hunzikcr, W. (1990) Binchem. J . 272,391 - 397. Dawson, M. I., Chan, R. L.-S., Derdzinski, K. A., Hobbs, P. D., Chao, W. R. & Schiff, L. J. (1983) J . Med. Chem. 26, 1653 - 1656.
1148 Dawson, M. I., Hobbs, P. D., Derdzinski, K. A., Chao, W. R.. Frenking, G., Loew, G. H., Jetten, A. M., Napoli, J. L., Williams, J. B., Sani, B. P., Wille, J. J. Jr & Schiff, L. J. (1989) J. Med. Chem. 32,1504-1517.
Dokoh, S., Pike, J. W., Chandler, J. S., Mancini, J. M. & Haussler, M. R. (1981) Anal. Biochem. 116,221-222. Dollt, P., Ruberte, E., Leroy, P., Morriss-Kay, G. & Chambon, P. (1990) Development 110,1133-1151. Fried, M. &Crothers, D. M. (1981) Nucleic Acids Res. 9,6505-6525. Frolik, C. A. (1984) in The retinoids (Sporn, M. B., Roberts, A. B. & Goodman, D. S., eds) vol. 11, 177-208, Academic Press, New York. Giguere, V., Ong, E. S., Segui, P. & Evans, R. M. (1987) Nature 330, 624 -629. Goff, S. A., Casson, L. P. & Goldberg, A. L. (1984) Proc. Natl Acad. Sci. U S A 81,6647-6651. Goodman, D.-W. S. (1984) in The retinoids (Sporn, M. B., Roberts, A. B. & Goodman, D. S., eds) vol. 11, pp. 42 - 88, Academic Press, New York. Gottesman, S. (1990) Methods Enzymol. 185, 119-129. Gottesman, S.. Halpern, E. & Trisler, P. (1981) J. Bacteriol. 148, 265 - 273.
Green, S . & Chambon, P. (1988) Trends Genet. 4 , 309-314. Hashimoto, Y., Kagechika, H. & Shudo, K. (1990) Biochem. Biophys. Res. Commun. 166, 1300 - 1307. Jctten, A. M., Anderson, K., Deas, M. A., Kagechika, H., Lotan, R., Rearick, J. I. & Shudo, K. (1987) Cancer Res. 47,3523 -3527. Kagechika. H., Kawachi, E., Hashimoto, Y., Himi, T. & Shudo, K. (1988) J . Med. Chem. 31,2182-2192. Kagechika, H., Kawachi, E., Hashimoto, Y. & Shudo, K.(1989) J . Med. Chem. 32,834-840. Krust, A., Kastner, P., Petkovich, M., Zelent, A. & Chambon, P. (1989) Proc. Nut1 Acad. Sci. USA 85, 329-333. Lee, S. F.,Progulske-Fox, A. & Bleiweis, A. S. (1988) Infect. Immun. 56,2114-2119. Lowman, H. B. & Bina, M. (1990) Gene 96,133 - 136. Madani, K. A., Bazzdno, G. S. & Chou, A. C. (1991) Eur. J . Clin. Chem. Clin. Biochem. 29,317-320. Mangelsdorf, D. J., Ong, E. S., Dyck, J. A. & Evans, R. M. (1990) Nature 345,224 - 229. Maniatis, T., Fritsch, D. F. & Sambrook, J. (1982) Molecular cloning: a laboratory manual, Cold Spring Harbour Laboratory Press, Cold
Spring Harbour NY.
Messing, J., Grea, R. & Seeburg, P. H. (1981) Nucleic Acid5 Res. 9, 309 - 321. Montminy, M. R., Sevarino, K. A,, Wagner, J. A,, Mandel, G. & Goodman, R. H. (1986) Proc. Natl Acad. Sci. USA 83, 66826686.
Nervi, C., Grippo, J. F., Sherman, M. I., George, M. D. & Jetten, A. M. (1989) Proc. Natl Acud. Sci. USA 86, 5854-5858. Ong, D. E. & Chytil, F. (1978) J. Biol. Chem. 253,4551 -4554. Petkovich, M., Brand, N. J., Krust, A. & Chambon, P. (1987) Nature 330,444 - 450.
Rowe, A., Eager, N. S. C. & Brickell, P. M. (1991) Development 111, 771 -778.
Ruberte, E., Dolle, P., Chambon, P. & Morriss-Kay, G. (1991) Development I l l , 45-60, Rupp, E., Mayer, H. & Wingender, E. (1990) Nucleic Acids Res. 18, 5677 - 5683.
Scatchard, G. (1949) Ann. N Y Acad. Sci. 51,660-672. Schiile, R., Mangelsdorf, D. J., Umesono, K., Borado, J. & Evans, R. M. (1990) Cell 61,497-504. Sporn, M. B. & Roberts, A. B. (1984) in The retinoids (Sporn, M. B., Roberts, A. B. & Goodman, D. S., eds) vol. I, pp. 235-279, Academic Press, New York. Strickland, S. & Mahdavi, V. (1978) Cell 15, 393-403. Studier, F. W., Rosenberg, A. H., Dunn, J. J. & Dubendorff, J. W. (1990) Methods Enzymol. 185, 60-89. Tabor, S. & Richardson, C. C. (1985) Proc. Nutl Acud. Sci. USA 82, 1074-1078.
Trisler, P. & Gottesman, S. (1984) J . Bacteriol. 160, 184-191. Umesomo, K., Giguerc, V., Cuss, C. K., Rosenfeld, M. G. & Evans, R. M. (1988) Nature 336,262-265. Yang, N., Schiile, R., Mangelsdorf, D. J. & Evans, R. M. (1991) Proc. Nutl Acad. Sci. USA 88, 3559 - 3563. Yanisch-Perron, C., Vieira, J. & Messing, J. (1985) Gene 33, 103119.
Zelent, A., Krust, A., Petkovich, M., Kastncr, P. & Chambon, P. (1989) Nature 339, 714-717. Zell, R.&Fritz,H.-J.(1987) E M B O J . 6, 1809-1815. Zhang, J., Liu, Z.-P., Jones, T. A., Gierasch, L. M. & Sambrook, J. F. (1992) Proteins in the press.
6 FEBS 1992
Recombinant human retinoic acid receptor a Binding of DNA and synthetic retinoids to the protein expressed in Escherichiu coli Siegfried KEIDEL’, Eva RUPP’ and Michael SZARDENINGS
’ Department of Biochemistry, Medizinische Hochschule Hannover, Federal Republic of Germany Ludwig Institute for Cancer Research, Biomedical Center, Uppsala, Sweden Dcpartment of Molecular Biology, University of Uppsala, Sweden (Received October 8/November 26, 1991) - EJB 91 1342
The human retinoic acid receptor u was expressed in Escherichia coli. The recombinant protein was found to be very unstable in several E. coli strains, probably due to proteolysis. Conditions were established to obtain reasonable amounts of active protein for ligand and DNA binding studies. The recombinant receptor showed the expected DNA binding activities in gel-retardation assays. Ligand binding properties were measured in a charcoal absorption assay. The dissociation constant for highly specific bound retinoic acid was found to be 0.67 nM. The affinity of several synthetic retinoids to thc recombinant protein was determined and compared to their biological activity. Some of the values presented here differ significantly from those published earlier for the receptor or its isolated hormonebinding domain.
The nuclear receptors for retinoids play a major role in the regulation of genes involved in cell differentiation and growth. Their natural ligand, the vitamin A derivative alltrans-retinoic acid, has been reported to be a possible morphogen in the embryonic tissues of frogs and chicken. Synthetic analogues of vitamin A (retinoids) show significant effects in treatment of dermatological disorders, as immunomodulators and as anticancer agents (Crettaz et al., 1990). The understanding of DNA and ligand binding of retinoic acid receptors is therefore of major interest. Retinoids are defined as compounds with retinoic-acidlike chemical structures or, more recently, as compounds inducing virtually the same biological activity as retinoic-acid itself ‘by binding to or activating a specific receptor or a set of receptors’ (Kagechika et al., 1988). Chemically stable retinoids especially, like those used in this study, are of great pharmaceutical importance. The biological potence of such retinoids is usually studied in in vivo systems, mainly based on measuring the induction of differentiation (Jetten et al., 1987; Breitman et al., 1980; Strickland and Mahdavi, 1978). The cDNAs for three similiar retinoic acid receptors (RARE,RARP and RARy; Giguere et al., 1987; Petkovich et al., 1987; Benbrook et al., 1988; Brand et al., 1988; Krust et al., 1989; Zelent et al., 1989) in human and mice have been cloned. Another receptor (RXRa) for retinoic-acid (Mangelsdorf et al., 1990) from human and its chicken analogue (Rowe et al., 1991) have been identified, but these are not related to RAR a, fi or y. Diffcrent domains of the receptors could be defined from sequence data (Green and Chambon, 1988), but it is not
known whether they retain their entire natural properties. Therefore it seemed to be important for the investigation of retinoic acid receptors to carry out retinoic-acid and DNA binding studies on the entire protein. Attempts have been made to use recombinant retinoic acid receptors (rRAR) from transfected cell lines for retinoic-acid binding studies, but this may require the use of HPLC to remove other retinoic acid binding activity (Cavey et al., 1990), which can be problematic if the ligand exhibits weak binding. Crettaz et al. (1990) reported the use of RARE and RARP ligand-binding domains expressed in Escherichia coli,but they failed to express the fulllength proteins. They reported similar retinoic acid binding constants for RARE and RARB from nuclear extracts and the retinoic acid binding domains expressed as fusion proteins in E. coli. We report here the characterization and kinetic studies on the binding of DNA, retinoic acid and other retinoids to human rRARcl expressed in E. coli. The binding to rRARcl is compared to results obtained recently for rRARcl and the retinoic acid binding domain expressed by other means (Yang et al., 1991; Hashimoto et al., 1990; Crettaz et al., 1990) and further to that determined in our assay system for murine cellular retinoic-acid-binding protein, also obtained by expression in E. coli (Zhang et al., 1992). There are significant differences between some reported values and our results. This will have consequences for the understanding of the action of some retinoids in vivo.
____
Strains and plasmids
Correspondence to M. Szardenings, Department of Molecular Biology, University of Uppsala, Box 590, S-75 124 Uppsala, Sweden Abbreviufions. RARa, RARP, RARy and RXRa, retinoic acid receptors; rRAR, recombinant retinoic acid receptor; OC, hormoneresponsive element of the human osteocalcin gene promoter.
The methods used for cloning and sequencing (Maniatis et al., 1982) have been described. Strain DH5a was used for cloning experiments. Sequences were confirmed by doublestrand sequencing with T7 DNA polymerase (Pharmacia).
MATERIALS AND METHODS
1142 Plasmid pRShRARa (Giguere et al., 1987) containing the RARa cDNA was obtained from Vincent Giguere (Toronto, Canada). pGP1-2 (Tabor and Richardson, 1985) and pT7-7 were kindly provided by Stan Tabor (Harvard Medical School). pT7-7 is an expression vector containing the entire promoter region of gene $10 from bacteriophage T7 oriented counterclockwise. This provides a strong transcription system in combination with T7 RNA polymerase and a strong ribosome binding site followed by a polylinker. Genes can be cloned into NdeI site at the translation start codon. pRShRARcc was restricted with EcoRI/BamHI and the cDNA cloned into the polylinker of pT7-7. The NdeI linker d(CCATATGG) (Pharmacia) was ligated into the B d l site following the start codon of the RARa cDNA. The resulting plasmid was restricted with NdeI to remove the sequence between the 410 start codon and cDNA. Religation yielded pT7-RARa. In this plasmid the cDNA can be expressed unaltered under transcriptional control of the 410 promoter. Bacterial strains used in here were LC137 (Goff et al., 1984; Lee et al., 1988): htpR(Am,ts), lonR9(ts), lac(Am), trp(Am), pho(Am), rpsL, supC(ts), rnal(am), txs: :TnlO; SG4121 (source: S. Gottesman): F-, dlon100, d(gal-bln), r-, m', recA, strA (derived from SG 4044, Gottesman et al., 1981); DH5a (BRL), JM103 (Messing et al., 1981), JM105 (YanischPerron et al., 1985), SG20252 (Trisle and Gottesman, 1984) and WK6 (Zell and Fritz, 1987) whose genotypes have been described. Expression of recombinant RARa Bacteria transformed with pGP1-2 and pT7-RARa were grown in SR medium (20 g/1 Bactotryptone, 20 g/1 yeast extract, 10 g/l meat extract, 0.5%, by vol., glycerol, 72mM K2HP04,17 mM KH2P04,pH 7.0)in thepresence of 100 mg/ 1 ampicillin and 40 mg/l kanamycin. In precultures additionally 0.5 mM isopropyl thio-P-D-galactopyranoside and optionally (LCl37) 20 mg/l tetracycline were used. The culture was inoculated 1 :200 with an overnight culture and grown at 30°C to an absorbance at 555 nm of 0.8- 1.0 and then shifted to 36°C. Cells were harvested after different time intervals by centrifugation and resuspended in a fifth of the original culture volume of buffer R (20mM Hepes pH 7.0, 50mM KCI, lo%, by vol., glycerol); 5 mM 2-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride and 10 U/ml benzon nuclease (Benzonase, Merck, Darmstadt, FRG) were added. The cells were lysed by sonification, incubated for 30 min on ice and cell debris was removed by centrifugation. For large-scale preparations from LC137xpGPl -2xpT7-RARE the inoculation ratio was 1 : 500, induction was carried out at A 5 5 5= 1.5-2.0 and cell pellets obtained by centrifugation were resuspended in 1 - 2 pellet volumes of buffer R. Additionally to the reagents described above, 0.5 mg/ml lysozyme was added. The solution was stirred on ice until the viscosity decreased and then frozen in liquid nitrogen to complete lysis of the cells. The cell debris was removed after thawing by ultracentrifugation at 45 000 x g, 2 "C for 15 h. The bacterial extract could be stored for several months at - 30 'C in buffer R containing 20% (by vol.) glycerol and 20 mM p-mercaptoethanol without any loss of retinoic-acid-binding activity. Retinoid binding assay Assays were carried out with all-trans-retinoic acid purchased from Sigma [11,12-3H] retinoic acid (55.7 Ci/mmol)
from New England Nuclear (NEN, Du Pont de Nemours, Bad Homburg, FRG). Calcitriol (1,25-dihydroxyvitamin D3) and TTNPB (Ro 13-7410) were gifts from Hoffmann-La Roche (Basel, Switzerland). Other analogues were synthesized as described: TTNN (Dawson et al., 1983), TTAB (Dawson et al., 1989), Am80 and Am90 (Kagechika et al., 1988), Ch80 and Ch55 (Kagechika et al., 1989); their structures are shown in Table 2. 2 mM stock solutions were prepared immediately before use and diluted in dimethylsulfoxide if necessary. In routine assays aliquots of bacterial extracts or purified fractions containing 0.2 - 0.3 pmol receptors were added to binding buffer (50 mM Hepes pH 7.0, 50 mM KCl, 10 mM dithiothreitol, 0.30/0 (masslvol.), y-globulin, 10 pg/ml leupeptin, 10 pg/ml antipain, 10 pg/ml EG64, 1 mM phenylmethylsulfonyl fluoride) in glass tubes giving a final volume of 0.5 ml. The following reactions were carried out in the dark; 0.2-5 nM [3H] retinoic acid and various concentrations of unlabelled compounds in dimethylsulfoxide were added. The final concentration of dimethylsulfoxide was 2% (by vol.). After shaking 3 h at 2 0 T , an aliquot for measuring total radioactivity was taken; 0.25 ml cold charcoal/dextran suspension (6%, mass/vol.), Norit A, (0.6%, mass/vol., dextran T70 in binding buffer) was added. After mixing, the tubes were shaken at 4°C for 15 min and than centrifuged 10 min at 15000 x g (4°C). Radioactivity of the supernatants was determined. Nonspecific binding was determined from experiments in presence of 100-fold molar excess of unlabelled retinoic acid or with bacterial extracts free of receptor protein obtained from LC137xpGPl-2. Scatchard analysis was performed as described by Scatchard (1949). Column chromatography In order to label the receptor with [3H] retinoic acid, in a typical experiment 100 p1 cell extract was mixed with 100 p1 200 mM Na2HP04 (pH 7.4), 10 pCi (0.2 pmol) [3H] retinoic acid in ethanol was added and the solution was incubated for at least 1 h at 4°C. Excess [3H]retinoic acid was removed with charcoal/dextran as described above and the supernatant was filtered over a 0.22-pm filter. All chromatography was carried out at 4°C. Gel filtration on Superose columns was carried out with 20 mM Hepes pH 7.0, 400 mM KCI, 10% (by vol.) glycerol, 2 mM 2-mercaptoethanol (Nervi et al., 1989). For Superdex columns 200 mM KC1 was used instead. Sucrose gradient centrifugation After charcoal/dextran treatment and centrifugation as described for the binding assay, 0.2 ml of the supernatant was layered onto linear 5-2070 sucrose gradients (3.5 ml), prepared in 50 mM Hepes pH 7.0, 2% (massivol.) KCI. The gradients were centrifuged for 20h at 250000 x g (Beckman SW60 rotor) and 4°C. Fractions (0.15 ml) of the gradient solutions were collected by using a fraction recovery system and radioactivity was measured. Gel-retardation assay Gel-retardation assays (Fried and Crothers, 1981) were performed as described earlier (Rupp et al., 1990). The painvise complementary oligonucleotides of the hormoneresponsive element of the human osteocalcin gene promoter, OC (Schiile et al., 1990) (5'-CGGTGACTCACCGGGTGAACGGGT-3'; 3'-GTACGCCACTCAGTGGCCCACTTG-
1143 a
pRShRARalpha :
M e t A l a Ser Asn
iL
CACTGTGGCCGCTTGGCATGG 'CAGCAAC
Bal I
pT7-RARalpha
:
1 iftAJa
AAGAAGGAGATATACAT
T7:22949
GGCCAGCAAC SerAsn Nde I
T7:22965
BamH I
I
Eluted volume ( m l )
pT7-RARalpha
4455 bp
Ndc I Fig. 1. Expression system. (a) The S' end of the cDNA for RARa in pRShRARcc and the construct obtained after recloning in pT7-RARa. The Bull site is maintained in the latter, although not indicated for convenience. (b) The expression plasmid used in this study. The RARa cDNA is under transcriptional control of the 410 promotor, that is exclusively recognized by the T7 RNA polymerase. The origin is of ColEl type. The blu gene for ampicillin resistance is oriented counterclockwise to avoid unwanted transcription from the 410 pro-
motor.
Fig.2. Gel filtration. Gel filtration on a Superdex 200pg HR16/60 column (Phannacia, Uppsala, Sweden). 0.5 ml of crude bacterial extract were incubated with [3H]retinoicacid as described and run on the column with a buffer containing 20mM Hepes pH 7.2, 200mM KCI, 10% (by vol.) glycerol, 5 mM 2-mercaptoethanol;I-mlfractions were collected and radioactivity determined. The arrows indicate elution volumes corresponding to ferritin (horse spleen; a, 450 kDa), catalase (bovine liver; b, 240 kDa), aldolase (rabbit muscle; c, 160 kDa), bovine serum albumin (d, 66 kDa), egg albumin (e, 45 kDa), chymotrypsinogen A (f, 25 kDa), equine myoglobin (g, 17.8 kDa), cytochrome c (h, 12.3 kDa).
added and samples were loaded on a 5% polyacrylamide gel (30: 0.5). The run was performed with Tris/borate/EDTA (0.089 M Tris, 0.089 M borate, 0.4 mM EDTA). The gel was autoradiographed with Amersham Hybond film using an intensifier screen.
RESULTS Expression of recombinant RARE
To express RARE in E. coli, the cDNA obtained from pRShRARcl (Giguere et al., 1987) was cloned into pT7-7 ( S . Tabor, Harvard, unpublished results; Fig. 1a). Bacteria harbouring pGP1-2 (Tabor and Richardson, 1985) were transformed with the resulting plasmid pT7-RARa (Fig. 1b). ExCCCAGATC-5') and the CAMP-responsive element of the rat pression was induced by shifting the temperature to 35 - 4 2 T . somatostatin gene (Montminy et al., 1986) (5'- This induces expression of the T7-RNA polymerase under CTGGCTGACGTCAGAGAT - 3' ;3'- GTACGACCGACTG - control of the PI promoter on pGP1-2 and subsequent tranCAGTCTCTAGATC-5') were synthesized, annealed and scription from the T7 promoter. Growth curves of E. coli labelled with T7-DNA polymerase (Pharmacia). Reaction strains (JM103, JM105, DHScr, Wk6) that were tested initially mixtures for gel-retardation assays contained E. coli extract for the expression of RARa showed a short lack phase, but or fractions thereof as indicated, 2 pg poly [(dI) . (dC)] and, started to grow normally again without producing any or little if indicated, competing oligonucleotides in a final volume of retinoic acid or DNA binding activity. This suggested that 20 p1 in 10 mM Hepes/NaOH pH 7.9, 2.5 mM MgC12, 10% those strains either lost one of the plasmids or overcame the (by vol.) glycerol, 60 mM KCl, 0.1 mM EDTA, 2 m M expression by proteolysis. Gel-retardation assays with such dithiothreitol and 10 pM ZnC1,. Reactions were incubated at material were only successful in the presence of proteinase room temperature for 15 min, 60 fmol 32P-labelled inhibitor. This assay was used initially to monitor the exoligonucleotidc was added and incubation continued for 15 pression of intact rRARcr, as we expected that to be more min. Then 3 p1 of a stop solution [90 mM EDTA, 0.25% sensitive to partial degradation than retinoic-acid-binding as(mass/vol.) bromophenol blue, 10% (mass/vol.) sucrose] was says. Proteolytic degradation resulted usually in smeared
1144
D
:;[ . ..
ul
_ .. ... : :. - .. ..
-- .... "?-; 0
i
;
0
5
lb Eluted volume ( m l )
Fig. 3. D N A binding of rRARa. Each gel-retardation experiment contains 60 fmol "P-labeled OC oligonucleotide, 2 pg poly[(dI) . (dC)] as unspecific competitor was added to each of the reactions and protein . DNA complexes were resolved on a 5% polyacrylamide gel. (A) Lane A1 contains no protein; lanes A2-A6 contain proteins eluted from a MonoQ column in a run similar to D and correspond to 0.25-ml fractions from 10.5- 11.5 ml elution volume. (B) Retardation experiments on the same gel with crude extracts from E. coli. The extracts used for lanes B1 and B2 are derived from E. coli cells harbouring the same plasmids as used for expression experiments, but without the RARr cDNA. These cells wcre also grown and lysed as described in Materials and Methods. Lanes B3 and B4 show corresponding experiments using an extract from induced E. coli LC137xpGP1-2xpT7-RARcl. I n lanes B2 and B4 reaction mixtures contained additionally 6 pmol unlabelled OC oligonucleotide. Arrow A indicates the complex between RARE and OC; arrows b and c indicate complexes created by interaction of E. coli proteins with the oligonucleotide. (C) DNA binding of rRARct is sequence-specific. Gel-retardation experiments were performed under the same conditions as in B and as described in Materials and Methods. For each experiment 60 fmol of 32P-labelled OC was incubated with 7 p1 protein material, corresponding to lane A4. In lane C2, 6 pmol unlabelled OC was added and lane C4 contains 6 pmol of the CAMP-responsive element of the rat somastatin gene (CRE) oligonucleotide. Arrow A: rRARr-specific DNA binding; arrows b and c : complexcs most probably due to unspecific interaction of E. coli proteins. (D) Purification of recombinant rRARa by ion-exchange chromatography. 0.5 ml crude extract incubated as described with [3H]retinoic acid was applied to a MonoQ HR5/10 column (Pharmacia). The column was eluted with 25 mM Tris pH 7.2, 5 mM 2-mercaptoethanol and a gradient (dashed line) of 0 - 1 M NaCI. The solid line absorbance at 280 nm; (-----)radioactivity in the eluent, indicating [3H]retinoic acid ([3-H]RA). indicates the (-)
bands (data not shown). The Ion- strains (SG20252, SG4121) tested upon this finding were found to lyse within 30 min after induction (> 37°C) or produced very little activity (> 37°C) (data not shown). E. coli K12 LC137 (lon-) seemed to be optimal for the expression with regard to plasmid stability and protein production. Due to hfpR(Am,Ts), i. e. a temperaturesensitive, amber-mutated a3' factor, the expression of heatshock genes depending on this factor is additionally reduced to a minimum under expression conditions. This reduces the heat-shock response, whereas at 30 "C no mucoid phenotype could be observed, as is the case with many Ion- strains. The optimal temperature for induction was found to be 36°C in accordance with recent publications about expression under control of the P I promoter (Lowman and Bina, 1990). Characterization of the recombinant RARa The rRARa activity was best retained in crude extracts, where it withstood repeated thawing and freezing. Active fractions obtained from column chromatography lost their activity partially upon freezing under the same conditions. For using these in binding assays, it had to be confirmed that activity was due to a single homogenous and active protein. Several experiments were carried out in order to confirm this. Cellular extracts were preincubated with [3H]retinoicacid and
subjected to gel filtration on several prepacked FPLC columns (Pharmacia). On a smaller Superose 12 HR10/30 a single peak eluted with a similar elution volume (14.9 ml, data not shown) as described for RARa derived from human cell extracts (about 14.5 ml, Nervi et al., 1989). Also from a higher-resolving Superdex column (Fig. 2) and from a sucrose gradient the activity was obtained in a single peak corresponding to a 50kDa protein. DNA binding activity DNA-binding activity of rRARa was assayed by gel-retardation. For these studies a hormone-responsive element of the human osteocalcin gene promoter (OC) was chosen. This element has been shown previously to bind specifically E. coli-derived RARa and confers retinoic-acid-inducibility to a heterologous promoter (Schule et al., 1990). Incubation of OC with control extracts from E. coli cells without RARa lead to bands that cannot be competed by an excess of unlabelled OC (100-fold excess) and are therefore considered to be unspecific (Fig. 3 B). These bands are indicated by arrows b and c. Experiments with E. coli cells expressing RARa show an additional band, which is competed by excess of unlabelled OC. This band is indicated by arrow A in Fig. 3 B. rRARa binding to OC can hardly be competed by an oligonucleotide rep-
1145
a
Bound RA (cpm) 5500 5000
Table 1. Binding specifity. Bacterial extracts were incubated with 2 nM [3H] retinoic acid and 1 pM of the indicated compounds as described in Materials and Methods. Specific binding activity of 2 nM [3H] retinoic acid without retinoids was calculated as 100%
4500
Addition
4000
Binding
3500
Yo
3000
None Retinoic acid Retinol Retinal 3,3’,5-Triiodo-~-thyronine Calcitriol Dexamethasone 17p-Estradiol Progesterone
2500
2000 1500
1000
500 0 0
1
2
3
4
5
RA (nM)
Bound/ Free
___.---
I00 5 82 12 100
99 97 96 99
b 1
Bound RA (% of control)
a
--+I Bound (nM) Retinoid (nM)
Fig. 4. Saturation binding and Scatchard analysis. (a) Bacterial extracts were incubated with the indicated concentrations of [3H]retinoicacid in the presence or absence of a 100-fold molar excess of unlabelled retinoic acid (RA) as describcd in Materials and Methods. No specific binding was measured in LC137xpGPI-2 extracts. (0)Total binding activity; (0)specific binding activity; ( A ) nonspecific binding activity. (b) Scatchard plot of the binding data. Points are means for duplicate determinations. The calculated Kd was 0.67 f 0.08 nM (n = 4).
Bound RA (cpm)
b
b
a
3500 3000 2500 -
2000
resenting the CAMP-responsive element of the rat somatostatin gene, CRE (Montminy et al., 1986; Fig. 3 C). Additionally Fig. 3 D shows the elution profile of intact RARa with bound [3H]retinoic acid and Fig. 3 A DNA-binding activity of fractions derived from the peak.
1500 1000 -
.,0 n
5
Ligand-binding characteristics of the cloned receptor The ligand-binding properties of the receptor were analysed by using the charcoal absorption hormone binding assay (Dokoh et a]., 1982). The use of y-globulin instead of gelatine as expander protein improved the reproducibility of measurements by efficiently reducing nonspecific binding. Analyses of [3H]retinoic-acid-labelledbacterial extracts by sucrose density gradient centrifugation indicated the presence of specific retinoic-acid-binding activity. The single, symmetrical peak sedimented between the positions of cytochrome c and bovine serum albumin. Retinoic acid competed with [3H]retinoicacid for these binding sites (Fig. 5b). Fig. 4a shows the binding of [3H]retinoic acid to bacterial extracts plotted against the retinoic acid concentration;
15
10
20
25
Fig. 5. Competition experiments with synthetic retinoids. (a) Competition of several retinoids with the binding of retinoic acid (RA). Bacterial extracts were incubated with 2 nM [3H]retinoic acid and the indicated concentrations of unlabelled retinoids as described in Materials and Methods. Specific binding activity of 2 nM [’H]retinoic acid without retinoids was calculated as 100%. Points are means for duplicate determinations. (0)Retinoic acid; ( V ) TTNPB; (0) TTAB; (0) AM80; (H) AM90; ( A ) Ch55; ( A ) Ch80 (see Table 2 for retinoid structures). (b) Sucrose gradient centrifugation. Bacterial extracts were incubated with 5 nM [3H]retinoic acid in the presence ( 0 1 or molar excess of unlabelled retinoic . - - -absence - - ~(0 ~ 1 of ~ 100-fold - ~ acid and other retinoids as under (a). The sedimentation positions of cytochrome c (a; 12.4 kDa) and bovine serum albumin (b; 66 kDa) are indicated bv arrows. \ - I
,
-
I
~~~
~
~~~
~
1146 Table 2. Biological activity and receptor binding of several retinoids. Relative receptor binding is defined as the ratio of IC50 value (i.e. concentration to achieve 50% inhibition of the total specific binding) for retinoic acid (RA) to that of the analogue. Biological activity was estimated from release of plasminogen activator during induced differentiation of F9 teratocarcinoma cells. At the EDSoconcentration the retinoid produces a half-maximal biological effect. Results were obtained from Dawson e l al. (1989) (a) or from Jetten et al. (1987) (b). Retinoid
Chemical structure
Plasminogen activator release, F9, EDso
Relative receptor binding
wcoon Yo
nM
0.10 70.37
100
TTNPB
0.08*/0.20
I1
TTAB
0.30"
RA
TTNN
170
wcoon 1.OO"
3
0.40b
17
/
Am80
0
> lOOb
Am90
0
0
Ch55
nonspecific binding determined in the presence of a 100-fold molar excess of unlabelled retinoic acid is linear to this concentration. Specific binding was obtained by subtracting nonspecific binding activity from total binding activity. LC137xpGPI-2 bacterial extracts showed no specific binding. Scatchard analysis of these data yielded a linear plot indicating a single class of binding sites (Fig. 4b). The concentration of rRARcl in the extracts was estimated to be 100nM in the average bacterial extract. The dissociation constant (Kd SD) was estimated to be 0.67 f0.08 nM (n = 4). The binding constant for recombinant murine cellular retinoic-acid-binding protein (Zhang et al., 1992) expressed and assayed in the same systems was determined to be 6.1 A 0.9 nM (n = 4), which is in good agreement with the value obtained by fluorometric studies (4.2 nM, Ong and Chytil, 1978) and another variant of the charcoal dextran assay (3.3 nM for rat cellular retinoicacid-binding protein, Madani et al., 1991). This shows that
0.60
1
0.26'
5
the modified assay system, although involving relatively harsh treatment of the protein, is quite comparable to a direct fluorometric measurement without further manipulations. The binding of retinoic acid to the bacterial extracts was specific. Two natural retinoids, retinal and retinol, had neglible effect in competing retinoic acid, whereas ligands for other nuclear receptors did not bind at all to rRARa (Table 1). Fig. 5 a compares the dose/response curves for inhibition of specific binding of [3H]retinoic acid to the receptor by the synthetic retinoids compared with those of retinoic acid. The order of potency of the compounds was TTAB > retinoic acid > TTNPB > Am80 > Ch55 > TTNN > Ch8O; Am90 did not compete with [3H]retinoic acid. The binding of these retinoids to rRARa was compared to the ability of the compounds to induce differentiation of F9 embryonal carcinoma cells (Table 2). The production of plasminogen activator dur-
1147 ing the differentiation serves as a differentiation marker in this assay (Jetten et al., 1987; Dawson et al., 1989).
DISCUSSION The human RARu cDN A was expressed in E. coli. Binding studies with DNA and retinoic acid showed that the recombinant protein has the expected properties. Competition experiments with synthetic retinoids suggest that RARu is a possible target for some of these, which might be important for clinical applications. The expression of rRARa in standard E. coli expression systems is mainly hampered by proteolytic degradation. This explains the low expression levels reported in a recent publication (Crettaz et al., 1990). Such problems can be overcome by expression under the control of T7 promotors (Studier et al., 1990). We found in contrast to Yang et al. (1991) that this was not sufficient to obtain reasonable amounts of active rRARa. Strains deficient in the protease gene lon have long been suggested for overcoming problems with proteolysis, but there are only a few published examples yet (see Gottesman, 1990, for references). No specific retinoic-acid binding activity could be found in E. coli extracts without rRARa, allowing measurement of binding data without any further purification. This was advantageous as the protein’s activity decreased when it was enriched by chromatography. The DNA binding might be affected by salts such as KCl (Yang et al., 1991), although we could not confirm this finding in our gel-retardation assay, when using 60 mM KC1 in the binding experiments. rRARa exhibited DNA binding to the responsive element of the human osteocalcin gene in a specific manner as expected. Additionally to the specific binding of rRARa to this element, two additional bands arose. These bands were nonspecific and were also observed when using a palindromic thyroid hormone responsive element (Umesono et al., 1988) as DNA probe (data not shown). They are probably caused by E. coli proteins. Whether they are due to the type of expression system used or to experimental procedures, is not known. The dissociation constant (0.67 nM) for rRARu is in accordance with recently published results (Kd = 0.21 nM, Yang et al. 1992). Crettaz et al. (1990) published a Kd value determined for the ligand binding domain of rRARa ( K d = 6.2 nM), i.e. a factor 10 lower than described here. This indicates that the binding properties of the isolated retinoic-acidbinding domain are not identical with those of the entire receptor as claimed by Crettaz et al. (1990). Thus the neighbouring regions in the RARa and the related receptors can be expected to influence retinoic-acid-binding properties or the protein stability. We determined the dissociation constant of recombinant murine cellular retinoic-acid-binding protein to be 6.1 nM, indicating that delivery of retinoic acid from its cytosolically located binding protein to human RARa might be possible. The cellular binding protein could serve as transport protein for retinoic acid in the cytoplasm, in the same way as retinolbinding protein has been suggested as an extracellular retinoicacid-transport protein due to the published binding constants (Goodman, 1984). Furthermore, it could serve as the intracellular storage protein for the otherwise easily degraded retinoic acid. On the other hand, recent publications suggest the cellular binding protein to be a down-regulator for the concentration of free retinoic acid (Dolle et al., 1990; Ruberte et al., 1991).
Table 2 compares the affinity of synthetic retinoids of rRARa found in vitro to their activity in vivo. Retinal and retinol exhibit biological activity (Sporn and Roberts, 1984) but did not bind significantly to rRARu (Table 1). These natural retinoids were most probably oxidized to retinoic acid in the responsive cells by known oxidation mechanisms (Frolik, 1984). For the compounds TTAB, TTNN, Am80 and Am90 a reasonable correlation was found. In accordance with the biological activity (Jetten et al., 1987; Dawson et al., 1989) Am80 showed significant binding activity, while TTNN showed lower binding activity. Interestingly, methylation of the amide-N in Am80, giving Am90, resulted in loss of biological activity and binding to rRARa. Only TTAB, a very active retinoid in many biological assays (Dawson et al., 1989), bound rRARa better than retinoic acid. The arotinoid TTNPB showed in most assays more biological activity than retinoic acid (Jetten et al., 1987). It still exhibits 71% of the binding activity for full-length rRARa, in contrast to 50% reported for the binding domain alone (Crettaz et al., 1990). A direct comparison of biological activity and in vitro binding to rRARu is hampered by the difference in chemical stability of retanoic acid and the synthetic retinoids. Furthermore retanoic acid can be degraded by known biological processes (Frolik, 1984), which will probably not modify the synthetic compounds used in this study. Ch8O exhibits significant and Ch55 very high biological activity, such as inducing differentiation of HL60 cells (Jetten et al., 1987), but low binding to rRARa. From knowledge of cellular metabolic pathways, it is unlikely that these Ch compounds will be metabolized in cells to derivates that are able to bind RARa. Ch55 was recently found to bind RARE isolated from trdnsfected human cell lines better than retinoic acid (Hashimoto et al., 1990). These measurements were carried out in competition experiments with [3H]Am80with relatively small amounts of receptor protein. An explanation might be the unknown association and rate constants for retinoic acid and Am80. Our results indicate that other nuclear receptors, like RARP, RARy and RXRa, can be expected to be targets of these retinoids. This work was suggested by and carried out in the laboratory of Prof. T. A. Jones as part of a project to understand the structural basis of retinoid function. This project is supported by the Swedish Natural Science Research Council. S. K. thanks Prof. W. Jungblut and Dr. W. Sierralta (Max Planck Institute for Experimental Endocrinology, Hannover, FRG) for the possibility to carry out the RA binding assays in their laboratories. E. R. is supported by the Boehringer lngelheim Fonds (Stuttgart, FRG). M. S. thanks the Nordisku Indusrri Fond (Copenhagen, Denmark) for funding.
REFERENCES Benbrook, D., Lernhardt, E. & Pfahl, M. (1988) Nature 333, 669672. Brand, N. J., Petkovich, M., Krust, A., Chambon, P., de The, H., Marchio, A., Fiollais, P. & Dejean, A. (1988) Nuture 332, 850853. Breitman, T. R., Selonick, S. I. & Collins, S. J. (1980) Proc. Nut1 Acad. Sci. USA 77,2136-22740. Cavey, M. T., Martin, B., Carlavan, I. & Shroot, B. (1990) Anal. Biochem. 186, 19-23. Crettaz, M., Baron, A., Siegenthaler, G. & Hunzikcr, W. (1990) Binchem. J . 272,391 - 397. Dawson, M. I., Chan, R. L.-S., Derdzinski, K. A., Hobbs, P. D., Chao, W. R. & Schiff, L. J. (1983) J . Med. Chem. 26, 1653 - 1656.
1148 Dawson, M. I., Hobbs, P. D., Derdzinski, K. A., Chao, W. R.. Frenking, G., Loew, G. H., Jetten, A. M., Napoli, J. L., Williams, J. B., Sani, B. P., Wille, J. J. Jr & Schiff, L. J. (1989) J. Med. Chem. 32,1504-1517.
Dokoh, S., Pike, J. W., Chandler, J. S., Mancini, J. M. & Haussler, M. R. (1981) Anal. Biochem. 116,221-222. Dollt, P., Ruberte, E., Leroy, P., Morriss-Kay, G. & Chambon, P. (1990) Development 110,1133-1151. Fried, M. &Crothers, D. M. (1981) Nucleic Acids Res. 9,6505-6525. Frolik, C. A. (1984) in The retinoids (Sporn, M. B., Roberts, A. B. & Goodman, D. S., eds) vol. 11, 177-208, Academic Press, New York. Giguere, V., Ong, E. S., Segui, P. & Evans, R. M. (1987) Nature 330, 624 -629. Goff, S. A., Casson, L. P. & Goldberg, A. L. (1984) Proc. Natl Acad. Sci. U S A 81,6647-6651. Goodman, D.-W. S. (1984) in The retinoids (Sporn, M. B., Roberts, A. B. & Goodman, D. S., eds) vol. 11, pp. 42 - 88, Academic Press, New York. Gottesman, S. (1990) Methods Enzymol. 185, 119-129. Gottesman, S.. Halpern, E. & Trisler, P. (1981) J. Bacteriol. 148, 265 - 273.
Green, S . & Chambon, P. (1988) Trends Genet. 4 , 309-314. Hashimoto, Y., Kagechika, H. & Shudo, K. (1990) Biochem. Biophys. Res. Commun. 166, 1300 - 1307. Jctten, A. M., Anderson, K., Deas, M. A., Kagechika, H., Lotan, R., Rearick, J. I. & Shudo, K. (1987) Cancer Res. 47,3523 -3527. Kagechika. H., Kawachi, E., Hashimoto, Y., Himi, T. & Shudo, K. (1988) J . Med. Chem. 31,2182-2192. Kagechika, H., Kawachi, E., Hashimoto, Y. & Shudo, K.(1989) J . Med. Chem. 32,834-840. Krust, A., Kastner, P., Petkovich, M., Zelent, A. & Chambon, P. (1989) Proc. Nut1 Acad. Sci. USA 85, 329-333. Lee, S. F.,Progulske-Fox, A. & Bleiweis, A. S. (1988) Infect. Immun. 56,2114-2119. Lowman, H. B. & Bina, M. (1990) Gene 96,133 - 136. Madani, K. A., Bazzdno, G. S. & Chou, A. C. (1991) Eur. J . Clin. Chem. Clin. Biochem. 29,317-320. Mangelsdorf, D. J., Ong, E. S., Dyck, J. A. & Evans, R. M. (1990) Nature 345,224 - 229. Maniatis, T., Fritsch, D. F. & Sambrook, J. (1982) Molecular cloning: a laboratory manual, Cold Spring Harbour Laboratory Press, Cold
Spring Harbour NY.
Messing, J., Grea, R. & Seeburg, P. H. (1981) Nucleic Acid5 Res. 9, 309 - 321. Montminy, M. R., Sevarino, K. A,, Wagner, J. A,, Mandel, G. & Goodman, R. H. (1986) Proc. Natl Acad. Sci. USA 83, 66826686.
Nervi, C., Grippo, J. F., Sherman, M. I., George, M. D. & Jetten, A. M. (1989) Proc. Natl Acud. Sci. USA 86, 5854-5858. Ong, D. E. & Chytil, F. (1978) J. Biol. Chem. 253,4551 -4554. Petkovich, M., Brand, N. J., Krust, A. & Chambon, P. (1987) Nature 330,444 - 450.
Rowe, A., Eager, N. S. C. & Brickell, P. M. (1991) Development 111, 771 -778.
Ruberte, E., Dolle, P., Chambon, P. & Morriss-Kay, G. (1991) Development I l l , 45-60, Rupp, E., Mayer, H. & Wingender, E. (1990) Nucleic Acids Res. 18, 5677 - 5683.
Scatchard, G. (1949) Ann. N Y Acad. Sci. 51,660-672. Schiile, R., Mangelsdorf, D. J., Umesono, K., Borado, J. & Evans, R. M. (1990) Cell 61,497-504. Sporn, M. B. & Roberts, A. B. (1984) in The retinoids (Sporn, M. B., Roberts, A. B. & Goodman, D. S., eds) vol. I, pp. 235-279, Academic Press, New York. Strickland, S. & Mahdavi, V. (1978) Cell 15, 393-403. Studier, F. W., Rosenberg, A. H., Dunn, J. J. & Dubendorff, J. W. (1990) Methods Enzymol. 185, 60-89. Tabor, S. & Richardson, C. C. (1985) Proc. Nutl Acud. Sci. USA 82, 1074-1078.
Trisler, P. & Gottesman, S. (1984) J . Bacteriol. 160, 184-191. Umesomo, K., Giguerc, V., Cuss, C. K., Rosenfeld, M. G. & Evans, R. M. (1988) Nature 336,262-265. Yang, N., Schiile, R., Mangelsdorf, D. J. & Evans, R. M. (1991) Proc. Nutl Acad. Sci. USA 88, 3559 - 3563. Yanisch-Perron, C., Vieira, J. & Messing, J. (1985) Gene 33, 103119.
Zelent, A., Krust, A., Petkovich, M., Kastncr, P. & Chambon, P. (1989) Nature 339, 714-717. Zell, R.&Fritz,H.-J.(1987) E M B O J . 6, 1809-1815. Zhang, J., Liu, Z.-P., Jones, T. A., Gierasch, L. M. & Sambrook, J. F. (1992) Proteins in the press.
