Appl Microbiol Biotechnol DOI 10.1007/s00253-015-6477-5
APPLIED MICROBIAL AND CELL PHYSIOLOGY
Recombinant Nogo-66 via soluble expression with SUMO fusion in Escherichia coli inhibits neurite outgrowth in vitro Xiaoyong Dai & Zhongqing Sun & Rui Liang & Yu Li & Huanmin Luo & Yadong Huang & Meiwan Chen & Zhijian Su & Fei Xiao
Received: 18 December 2014 / Revised: 10 February 2015 / Accepted: 12 February 2015 # Springer-Verlag Berlin Heidelberg 2015
Abstract Nogo-66, a hydrophilic loop of 66 amino acids flank two hydrophobic domains of the Nogo-A C terminus, interacts with the Nogo-66 receptor (NgR) to exert numerous functions in the central nervous system (CNS). Nogo-66 has important roles in aspects of neuronal development, including cell migration, axon guidance, fasciculation, and dendritic branching, and in aspects of CNS plasticity, including oligodendrocyte differentiation and myelination. Here, the small ubiquitin-related modifier (SUMO) was fused to the target gene, Nogo-66, and the construct was expressed in Escherichia coli (E. coli). Under the optimal fermentation conditions, the soluble expression level of the fusion protein was 33 % of the total supernatant protein. After cleaving the fusion proteins with SUMO protease and purifying them by NiNTA affinity chromatography, the yield and purity of recombinant Nogo-66 obtained by 10-L scale fermentation were 23±1.5 mg/L and greater than 93 %, respectively. The authenticity of the recombinant Nogo-66 was Xiaoyong Dai and Zhongqing Sun contributed equally to this work. Electronic supplementary material The online version of this article (doi:10.1007/s00253-015-6477-5) contains supplementary material, which is available to authorized users. X. Dai : R. Liang : Y. Huang : Z. Su (*) Guangdong Provincial Key Laboratory of Bioengineering Medicine, Jinan University, Guangzhou 510632, People’s Republic of China e-mail: [email protected] Z. Sun : Y. Li : H. Luo : F. Xiao (*) Department of Pharmacology, School of Medicine, Jinan University, Guangzhou 510632, People’s Republic of China e-mail: [email protected] M. Chen State Key Laboratory of Quality Research in Chinese Medicine, Institute of Chinese Medical Sciences, University of Macau, Macau 999078, People’s Republic of China
confirmed by an electrospray ionization-mass spectrometry analysis. The functional analyses indicated that the recombinant Nogo-66 was capable of binding the NgR specifically. The immunofluorescence results showed that the recombinant Nogo-66 could significantly inhibit neurite outgrowth of rat pheochromocytoma (PC12) cells stimulated by nerve growth factor and cerebellar granule cells (CGCs). Furthermore, Nogo-66 inhibited neurite outgrowth by increasing the level of phosphorylated Rhoassociated coiled-coil-containing protein kinase 2 (ROCK2), collapsin response mediator protein 2 (CRMP2), and myosin light chain (MLC). This study provided a feasible and convenient production method for generating sufficient recombinant Nogo-66 for experimental and clinical applications. Keywords Nogo-66 . Small ubiquitin-related modifier . Expression . Purification . Bioassay
Introduction It is well established that the neuronal regeneration ability of patients with injuries to the central nervous system (CNS) or diseases of the CNS, including spinal cord injuries and strokes, is limited (Fitch and Silver 2008; Hellal et al. 2011). Injuries and diseases of the CNS often lead to dysfunction of the lesion area, causing permanent paralysis, insensitivity, and a lack of vegetative functions (Schwab et al. 2006). Research indicates that the major inhibitory proteins of myelin in the CNS are Nogo-A, myelin-associated glycoprotein (MAG), and oligodendrocyte myelin glycoprotein (OMgp) (Akbik et al. 2012; Schwab 2010). Nogo-66, the major inhibitory region of Nogo-A, is responsible for inhibiting neurite growth and inducing the
Appl Microbiol Biotechnol
collapse of the growth cone (Fournier and Strittmatter 2001). It can exert these biological effects by acting on the Nogo-66 receptor (NgR), which is a 473 amino acid glycosylphosphatidylionsitol (GPI)-linked protein (Fournier et al. 2001). Nogo-66 binds to the NgR and, subsequently, activates the RhoA/ROCK signaling pathway as follows: activated RhoA is able to bind to the Rho-binding domain (RBD) of the Rho-associated coiled-coil-containing protein kinase (ROCK), resulting in the activation of downstream effectors, including ROCK2, collapsin response mediator protein 2 (CRMP2), and myosin light chain (MLC). These results in rearrangement of the cytoskeleton (Schmandke et al. 2007; Nash et al. 2009). In general, Nogo-66 plays a pivotal role in the prevention of axonal regeneration after CNS injury in mammals (Petrinovic et al. 2013; Chong et al. 2012; Wang et al. 2008). However, recent studies have suggested a novel role of Nogo-A signaling in the regulation of synaptic plasticity in the CNS: the maintenance of stable memory engrams (Zagrebelsky and Korte 2014; Delekate et al. 2011). In addition, Nogo-66 is implicated in neurological traumas, such as spinal cord injury and stroke (Zorner and Schwab 2010; Lindau et al. 2014), neurodegenerative diseases, such as Alzheimer’s disease (Zhou et al. 2011), amyotrophic lateral sclerosis, and multiple sclerosis (Theotokis et al. 2012; Yang et al. 2009), and schizophrenia (Tews et al. 2013). Furthermore, Nogo-A has been shown to mediate apoptosis in hepatocellular carcinoma SMMC-7721 cells and, thus, is a potential therapeutic agent for the treatment of liver cancer (Hao et al. 2014). Several studies have generated recombinant Nogo-66 by prokaryotic expression, but large amounts of soluble Nogo-66 have not been obtained (GrandPre et al. 2000; Vasudevan et al. 2010). Neither a glutathione Stransferase (GST) tag nor a hexahistidine (His) tag is able to improve the solubility of Nogo-66 in E. coli. Small ubiquitin-like modifier (SUMO) proteins are covalently linked to a variety of proteins that regulate diverse cellular processes, including transcription, replication, chromosome segregation, and DNA repair (Johnson 2004; Geiss-Friedlander and Melchior 2007). It has been well documented that the use of SUMO as a chaperone can significantly increase recombinant protein expression levels, correctly facilitate target protein folding, and increase protein solubility (Butt et al. 2005). Therefore, in order to obtain a sufficient amount of soluble, bioactive Nogo-66, we tagged Nogo-66 with SUMO by fusing their DNA sequences and we induced the expression of the recombinant protein in the E. coli strain Origami B (DE3). This study provides a novel expression strategy that could significantly increase the yield of recombinant Nogo-66 to meet the demand of experimental and clinical applications of the protein.
Materials and methods Reagents Pyrobest DNA polymerase, restriction endonucleases, a polymerase chain reaction purification kit, a gel extraction kit, and a MiniBest plasmid purification kit were purchased from Takara Company (Dalian, China). The expression vector pET-3c, the E. coli strain Origami B (DE3), and SUMO protease were maintained by the Biopharmaceutical Research and Development Center of Jinan University. Isopropyl-β-D-1thiogalactopyranoside (IPTG) was purchased from Genebase Company (Guangzhou, China). The active segment of Nogo66 (Nogo-P4) was obtained from ADI Company (San Antonio, TX, USA). Anti-ROCK2, anti-Phospho-CRMP2 (Thr 514), anti-CRMP2, anti-Phospho-MLC (Ser 19), and anti-MLC were obtained from Cell Signaling Technology, Inc. (Shanghai, China). Anti-NgR was purchased from Merck Millipore (Billerica, MA, USA). Cell culture Human breast cancer cells MDA-MB-231 (ATCC HTB-26) and rat pheochromocytoma cells PC12 (ATCC CRL-1721) cells were obtained from the American Type Culture Collection (Manassas, VA, USA). The MDA-MB-231 cells were cultured in DMEM medium supplemented with 10 % (v/v) fetal bovine serum (FBS), and the PC12 cells were cultured in RPMI 1640 medium supplemented with 10 % normal horse serum and 5 % FBS. Cerebellar granule cells (CGCs) were prepared from postnatal 6–8-day-old Sprague-Dawley rats (zur Nedden et al. 2014). CGCs were plated at a density of 2×105 cells on poly-L-lysine-coated borosilicate glass coverslips (VWR, 16-mm diameter) with neurobasal medium, containing KCl 25 mM, B27 2 %, glutamine 1.5 mM, and penicillin/streptomycin 0.01 %. The MDA-MB-231, PC12, and cerebellar granule cells were all maintained at 37 °C in a humidified atmosphere at 5 % CO2 before being used for the experiments. SUMO-Nogo-66 fusion gene synthesis and construction of pET-20b/SUMO-Nogo-66 plasmid Based on the preferred codons of E. coli, an artificial gene (Genebank ID KP315948) encoding the Nogo-66 protein was synthesized by the Invitrogen Company and cloned into the pUC57 vector. Illustrations of the target gene construction are shown in Fig. S1. The molecular chaperone, SUMO gene, was fused to the target gene, Nogo-66, at its N terminus to improve target protein folding and protect the target protein from degradation (Zhang et al. 2013a). Overlapping PCR was applied to amplify the DNA fragments encoding the fusion protein, SUMO-Nogo-66, with forward and reverse primers
Appl Microbiol Biotechnol Table 1 PCR primers for amplifying the gene encoding SUMONogo-66 Primers (5′–3′) F1 (35 nt): GGGAATTCCATATGCATCATCATCATCATCACGGC R1 (34 nt): TATAGATGCGACCACCAATCTGTTCTCTGTGAGC F2 (35 nt): AGATTGGTGGTCGCATCTATAAAGGCGTGATTCAG R2 (35 nt): CGCGGATCCTTATTTCAGGCTATCCACCAGATCAT The restriction enzyme recognition sites used for cloning were NdeI (F1) and BamHI (R1). The sites are indicated by boxes. The sequence of bold letters shown in F1 is a 6× His tag nt nucleotide
(Table 1) harboring NdeI and BamHI restriction endonuclease recognition sites, respectively (Fig. S1). The recombinant plasmid was transformed into E. coli Origami B (DE3) cells. The recombinant transformants were selected for based on their ampicillin resistance, and sequencing was performed by the Shanghai Sangon Biological Engineering Technology and Services Co., Ltd. (Shanghai, China). Expression and analysis of SUMO-Nogo-66 Fermentation of SUMO-Nogo-66 was performed as described previously (Hu et al. 2014). To evaluate SUMO-Nogo-66 expression, the concentrated cells were resuspended in 50 mM Tris–HCl buffer (pH 7.4) at 1:10 ratio (w/v) and were disrupted by sonication. Following centrifugation at 12, 000×g for 30 min at 4 °C, protein fractions from both the supernatant and pellet were analyzed to determine protein solubility by 12 % sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Then, ImageJ software, which measures the ratio of target protein to total protein based on gel band intensity, was used to quantify the protein content of the protein fractions. Purification and identification of recombinant SUMO-Nogo-66 The supernatant was then applied to a Ninitrilotriacetate (Ni-NTA) Sepharose column that was pre-equilibrated with phosphate-buffered saline (PBS, pH 7.0). After washing with three column volumes of wash buffer (PBS containing 20 mM imidazole, pH 7.0), the 6× His-tagged SUMONogo-66 was eluted using elution buffer (PBS containing 300 mM imidazole, pH 7.0). The fraction containing SUMO-Nogo-66 was desalted by a Sephadex S-100 column with PBS buffer containing 10 % glycerol (pH 7.0). The purity and concentration of the fusion protein were evaluated by SDS-PAGE and bicinchoninic acid (BCA) protein assay, respectively. The purified fusion proteins were diluted to a concentration of 1 mg/mL and cleaved by SUMO protease (final concentration 10 IU/mL) at 30 °C for 1 h. The cleaved
sample was reloaded on the Ni-NTA resin and eluted by PBS containing 10 % glycerol (v/v). The apparent molecular weight and purity of these recombinant proteins were detected by SDS-PAGE. Electrospray ionization-mass spectrometry analysis (ESI-MS) was used to accurately determine the molecular weight of the recombinant proteins (Fig. S2). The colocalization of Nogo-66 to NgR The method of Nogo-66 labeled with FITC was referred the instructions of FITC Labeling Kit (no. 53027, Pierce, Rockford, USA). Briefly, 40 μL of the borate buffer (0.67 M, pH 8.5), 0.5 mL of 2 mg/mL recombinant protein in PBS and FITC reagent was mixed thoroughly. Then, the mixture was incubated in the darkness for 2 h at room temperature. The labeled solution was applied onto SephadexG25 column, and the labeled protein (yellowish color) was pooled and stored at −80 °C. The binding of FITC-Nogo-66 proteins to NgRs on the cells was observed using confocal microscopy (Dai et al. 2014). When the MDA-MB-231 cells, PC12 cells, and CGCs reached approx. 80 % confluence on coverslips, the cells were washed with PBS and fixed in 4 % paraformaldehyde at 37 °C for 15 min. After blocking with 0.5 % (w/v) BSA, the cells were incubated with 0.1 μM FITC-Nogo-66 protein for 30 min at 37 °C. Subsequently, 4′,6-diamidino-2-phenylindole (DAPI) was applied to all slides for nuclear staining. All slides were visualized by laser scanning confocal microscopy (LSM 700, Carl Zeiss Inc., Germany). The colocalization of the purified Nogo-66 proteins and anti-NgR antibodies on the PC12 cells and the CGCs was performed using the same method, with the following exceptions: the cells were incubated with anti-NgR (1:1000) at 4 °C overnight, followed by incubation with donkey anti-rabbit IgG H&L Dylight 594 for 2 h at room temperature and were then washed in PBS three times. FITC-conjugated Nogo-66 was then added and left for 2 h at room temperature. Neurite outgrowth assay Chamber slides were coated with 0.01 % poly-L-lysine (PLL) at room temperature overnight. The PC12 cells and the CGCs were seeded at a volume of 100 μL and a density of 2.5×106 cells per well. After 24 h, fresh media with nerve growth factor (NGF, 100 ng/mL) was added to the PC12 cells, and the cells were incubated for 2 days. Then, the cells were treated with serially diluted Nogo-66 and Nogo-P4. After culturing for 48 h, neurons were fixed with 4 % paraformaldehyde and immunostained with mouse anti-tubulin-βIII antibody (1:800; Sigma-Aldrich). Each experiment was performed in duplicate, and the experiments were repeated four times. For
Appl Microbiol Biotechnol
quantification analysis, the percentage of neurons with neurites was counted and neurons with neurites longer than the diameter of the cell body were considered to be neuritebearing. The length of the longest neurite of each neuron was measured using ImageJ software. The first 100 neurons encountered when scanning the slides were measured for each batch of the experiment. Western blot analysis of ROCK2, CRMP2, and MLC activation The PC12 cells and CGCs were seeded in six-well plates (5.0×106 cells/well) for 24 h. Then, fresh media with NGF (100 ng/mL) was added to the PC12 cells, and the cells were incubated for 2 days. Then, the cells were treated with serially diluted purified Nogo-66 for 48 h. Membranes were blocked and incubated overnight at 4 °C in 5 % BSA in TBS containing 0.05 % Tween 20 (TBST) with the following primary antibodies: anti-ROCK2 (1:1000; Cell Signaling), antiPhospho-CRMP2 (Thr 514) (1:1000; Cell Signaling), and anti-Phospho-MLC (Ser 19) (1:1000; Cell Signaling). Then, the membranes were incubates with a goat anti-rabbit IgG, HRP-linked antibody (1:1000) at room temperature for 1 h. Blots were developed using the enhanced chemiluminescence Western blot substrate. Quantification was performed using QuantityOne software (Bio-Rad).
Results Amplification of the SUMO-Nogo-66 fusion gene and construction of the recombinant plasmid pET-20b/SUMO-Nogo-66 The DNA segment coding the SUMO-Nogo-66 fusion protein, which had a predicted size of approximately 519 bp, was inserted into the pET-20b expression vector to generate the recombinant plasmid pET-20b/SUMO-Nogo-66 (Table 1). Then, the recombinant plasmid was used to express recombinant Nogo-66 in the E. coli strain BL21 Origami B (DE3) (Fig. 1). After digestion of the recombinant plasmid, it was sequenced and was found to be identical to the predicted sequence (data not shown). The expression and fermentation of SUMO-Nogo-66 To optimize the expression of recombinant SUMO-Nogo-66 in 10-L scale fermentation, the cells harboring pET20b/ SUMO-Nogo-66 were treated with 1 mM IPTG when the culture reached the beginning of the logarithmic growth phase (OD600 =0.6–0.8). After induction for 4 h, the biomass yielded 33±3.8 g/L wet cell weight. The cells were sonicated, and the lysate was centrifuged at 4 °C for 30 min. The SDS-PAGE
Fig. 1 Analysis of PCR fragments coding SUMO-Nogo-66. Lane 1, PCR fragment coding SUMO; lane 2, PCR fragment coding SUMONogo-66; lane M, DNA molecular weight marker (from top to bottom, 5000, 3000, 2000, 1500, 1000, 750, 500, 250, and 100 bp); lane 3, PCR fragment coding Nogo-66
results showed that the SUMO-Nogo-66 fusion protein (molecular mass, 21 kDa) was expressed in soluble form and composed an average of 33.6±3.2 % of the total supernatant protein (Figs. 2 and 3). Purification and identification of the recombinant Nogo-66 protein By Ni-NTA Sepharose and Sephadex S-100 column chromatography, the purity of the recombinant SUMO-Nogo-66 was over 87 %. After cleaving the recombinant Nogo-66 with SUMO protease, the protein mixture was applied to a NiNTA Sepharose column to further purify it (Fig. 4a). Table 2 summarizes the recombinant protein isolation and purification process. The SDS-PAGE results indicated that the final yield of recombinant Nogo-66 was 23±1.5 mg/L, with 93 % purity. The authenticity of Nogo-66 was also confirmed by electrospray ionization-mass spectrometry analysis (Fig. 4b). The MS data showed that the molecular weight of Nogo-66 was 7536.6 Da, which was closed to its theoretical mass of 7534.6 Da. The colocalization of Nogo-66 to NgR Nogo-66 exerts its biological functions by binding to the NgR. To evaluate the binding ability of the purified Nogo-66 to
Appl Microbiol Biotechnol
Fig. 3 Variation in parameters of 10-L scale fermentation production of SUMO-Nogo-66. Under the optimal fermentation conditions, the expression level of SUMO-Nogo-66 gradually increased over time and achieved its maximum level at 6 h after induction. Changes in parameters, including wet cell weight and expression level, were recorded throughout the process of 10-L fermentation
Nogo-66 induced neurite outgrowth inhibition
Fig. 2 SDS-PAGE analysis of SUMO-Nogo-66. a SDS-PAGE analysis of SUMO-Nogo-66 expression. Lane 1, pre-induced Origami B (DE3)/ pET-SUMO-Nogo-66; lane M, protein molecular weight markers (from top to bottom, 116, 66.2, 45.0, 35.0, 25.0, 18.4, and 14.4 kDa); lanes 2–4, Origami B (DE3)/pET-SUMO-Nogo-66 induced by 1 mM IPTG at 37 °C for 4 h. b SDS-PAGE analysis of SUMO-Nogo-66 during the process of fermentation. Lane M, protein molecular weight markers; lanes 1, preinduction as a control; lanes 2–4, expression of SUMO-Nogo-66 in a 10-L fermenter, induced for 1, 2, and 4 h, respectively
NgR, FITC-labeled Nogo-66 was applied to MDA-MB-231 cells, PC12 cells, and CGCs. Confocal microscopy images showed that the FITC-labeled Nogo-66 uniformly surrounded the membranes of PC12 cells and CGCs. The treatment of MDA-MB-231 cells with FITC-labeled Nogo-66 served as a negative control, and no FITC-labeled Nogo-66 fluorescence staining was observed on the membranes of those cells, as they do not express NgR (Fig. 5a). To further assess the specificity of the purified Nogo-66 proteins, PC12 cells, and CGCs were incubated with FITClabeled Nogo-66 and anti-NgR antibody. As shown in Fig. 5b, FITC-labeled Nogo-66 and anti-NgR antibody were colocalized on the surface of the PC12 cells and the CGCs. Therefore, these results demonstrate that the recombinant Nogo-66 protein was capable of binding to NgR specifically.
It has been reported that NGF can stimulate neurite outgrowth, while Nogo-66 can inhibit neurite outgrowth (Zhang et al. 2013b). To investigate the inhibition of neurite growth by recombinant Nogo-66 in vitro, two neuronal cell lines, PC12 and CGC, were treated with Nogo66 at different concentrations. As shown in Fig. 6a–j, the neurons grew numerous neurites radically from the PC12 cells treated with NGF and CGCs not treated with Nogo66. This outgrowth was drastically reduced in a dosedependent manner when the cells were treated with various concentrations of purified Nogo-66. Quantification of the neurite outgrowth generated by the aggregated cells demonstrated statistically significant enhancement of neurite outgrowth inhibition (Fig. 6k, l). Therefore, purified Nogo-66 has the potential to inhibit neurite growth. To further understand the effect of recombinant Nogo66, we compared the inhibitory function of Nogo-66 on neurite growth with that of the commercial peptide NogoP4. The peptide Nogo-P4 is composed of the 31st–55th amino acids of the Nogo-66 peptide and has been reported to have the core inhibitory activity of Nogo-66 (GrandPre et al. 2000). Our results showed that the recombinant Nogo-66 possessed higher neurite growth inhibition than Nogo-P4 at the same concentration (Fig. 6m, n). The halfmaximal effect concentration (EC50) of purified Nogo-66 (0.3±0.13 and 0.6±0.16 μM in PC12 cells and cerebellar granule cells, respectively) was much lower than that of Nogo-P4 (1.2±0.15 and 1.8±0.17 μM in PC12 cells and cerebellar granule cells, respectively).
Appl Microbiol Biotechnol Fig. 4 Analysis of SUMONogo-66 digested by SUMO protease and purified target proteins. a Cleavage and purification of SUMO-Nogo-66 detected by SDS-PAGE. Lane M, low molecular protein marker; lane 1, purified SUMO-Nogo-66; lane 2, mixture of SUMO-Nogo66 digested by SUMO protease at 30 °C for 1 h; lane 3, purified Nogo-66 obtained by Ni-NTA Sepharose chromatography. b ESI-MS analysis of purified Nogo-66
Nogo-66 induced neurite outgrowth inhibition by regulating the expression of ROCK2, phosphorylation of CRMP2, and MLC The mechanism of the inhibition of neurite outgrowth by recombinant Nogo-66 was assessed by Western
blot analysis. As shown in Fig. 7, the expression and phosphorylation of ROCK2, CRMP2, and MLC signal molecules were downregulated by NGF, while the treatment of cells with purified Nogo-66 proteins resulted in significant stimulation of the activation of the three signal molecules in a dose-dependent
Appl Microbiol Biotechnol Table 2
Summary of the purification of the recombinant protein
Purification steps
Total protein (mg)
Targeted protein (form) (mg)
Recovery (%)
Purity (%)
Yield (mg/L)
Ni-NTA Sepharose Sephadex S-100 Ni-NTA Sepharose
2710.22±99.5 836.73±29.1 531.56±36.27
SUMO-Nogo-66 SUMO-Nogo-66 Nogo-66
35 76 25
85 87 93
123.5±3.4 86.12±2.1 23±1.5
manner. These results indicate that the mechanism of the inhibition of neurite outgrowth by recombinant Fig. 5 Fluorescence imaging of purified Nogo-66 proteins binding to NgR. a Specific binding of FITC-labeled Nogo-66 proteins to NgR. b Colocalization of FITC-labeled Nogo-66 proteins with anti-NgR antibody (red) in PC12 cells and CGCs. Cells were observed by confocal laser microscopy (magnification×60) (color figure online)
898.41±58.3 612.31±15.3 123.94±13.2
Nogo-66 involved the activation of ROCK2, CRMP2, and MLC.
Appl Microbiol Biotechnol Fig. 6 Nogo-66-induced neurite outgrowth inhibition. PC12 cells were treated with 100 ng/ml NGF (b), or 100 ng/ml NGF plus various concentrations of Nogo66 (c–e 0.1, 1, and 2 μM) for 48 h. CGCs were treated with various concentrations of Nogo-66 (g–j 0.01, 0.1, 1, and 2 μM) for 48 h. a, f Control cells without NGF or Nogo-66 treatment. k, l Quantification of Nogo-66induced neurite outgrowth inhibition in PC12 cells and CGCs. m, n The neurite growth inhibition rate of purified Nogo66 and Nogo-P4 in PC12 cells and CGCs. *p
APPLIED MICROBIAL AND CELL PHYSIOLOGY
Recombinant Nogo-66 via soluble expression with SUMO fusion in Escherichia coli inhibits neurite outgrowth in vitro Xiaoyong Dai & Zhongqing Sun & Rui Liang & Yu Li & Huanmin Luo & Yadong Huang & Meiwan Chen & Zhijian Su & Fei Xiao
Received: 18 December 2014 / Revised: 10 February 2015 / Accepted: 12 February 2015 # Springer-Verlag Berlin Heidelberg 2015
Abstract Nogo-66, a hydrophilic loop of 66 amino acids flank two hydrophobic domains of the Nogo-A C terminus, interacts with the Nogo-66 receptor (NgR) to exert numerous functions in the central nervous system (CNS). Nogo-66 has important roles in aspects of neuronal development, including cell migration, axon guidance, fasciculation, and dendritic branching, and in aspects of CNS plasticity, including oligodendrocyte differentiation and myelination. Here, the small ubiquitin-related modifier (SUMO) was fused to the target gene, Nogo-66, and the construct was expressed in Escherichia coli (E. coli). Under the optimal fermentation conditions, the soluble expression level of the fusion protein was 33 % of the total supernatant protein. After cleaving the fusion proteins with SUMO protease and purifying them by NiNTA affinity chromatography, the yield and purity of recombinant Nogo-66 obtained by 10-L scale fermentation were 23±1.5 mg/L and greater than 93 %, respectively. The authenticity of the recombinant Nogo-66 was Xiaoyong Dai and Zhongqing Sun contributed equally to this work. Electronic supplementary material The online version of this article (doi:10.1007/s00253-015-6477-5) contains supplementary material, which is available to authorized users. X. Dai : R. Liang : Y. Huang : Z. Su (*) Guangdong Provincial Key Laboratory of Bioengineering Medicine, Jinan University, Guangzhou 510632, People’s Republic of China e-mail: [email protected] Z. Sun : Y. Li : H. Luo : F. Xiao (*) Department of Pharmacology, School of Medicine, Jinan University, Guangzhou 510632, People’s Republic of China e-mail: [email protected] M. Chen State Key Laboratory of Quality Research in Chinese Medicine, Institute of Chinese Medical Sciences, University of Macau, Macau 999078, People’s Republic of China
confirmed by an electrospray ionization-mass spectrometry analysis. The functional analyses indicated that the recombinant Nogo-66 was capable of binding the NgR specifically. The immunofluorescence results showed that the recombinant Nogo-66 could significantly inhibit neurite outgrowth of rat pheochromocytoma (PC12) cells stimulated by nerve growth factor and cerebellar granule cells (CGCs). Furthermore, Nogo-66 inhibited neurite outgrowth by increasing the level of phosphorylated Rhoassociated coiled-coil-containing protein kinase 2 (ROCK2), collapsin response mediator protein 2 (CRMP2), and myosin light chain (MLC). This study provided a feasible and convenient production method for generating sufficient recombinant Nogo-66 for experimental and clinical applications. Keywords Nogo-66 . Small ubiquitin-related modifier . Expression . Purification . Bioassay
Introduction It is well established that the neuronal regeneration ability of patients with injuries to the central nervous system (CNS) or diseases of the CNS, including spinal cord injuries and strokes, is limited (Fitch and Silver 2008; Hellal et al. 2011). Injuries and diseases of the CNS often lead to dysfunction of the lesion area, causing permanent paralysis, insensitivity, and a lack of vegetative functions (Schwab et al. 2006). Research indicates that the major inhibitory proteins of myelin in the CNS are Nogo-A, myelin-associated glycoprotein (MAG), and oligodendrocyte myelin glycoprotein (OMgp) (Akbik et al. 2012; Schwab 2010). Nogo-66, the major inhibitory region of Nogo-A, is responsible for inhibiting neurite growth and inducing the
Appl Microbiol Biotechnol
collapse of the growth cone (Fournier and Strittmatter 2001). It can exert these biological effects by acting on the Nogo-66 receptor (NgR), which is a 473 amino acid glycosylphosphatidylionsitol (GPI)-linked protein (Fournier et al. 2001). Nogo-66 binds to the NgR and, subsequently, activates the RhoA/ROCK signaling pathway as follows: activated RhoA is able to bind to the Rho-binding domain (RBD) of the Rho-associated coiled-coil-containing protein kinase (ROCK), resulting in the activation of downstream effectors, including ROCK2, collapsin response mediator protein 2 (CRMP2), and myosin light chain (MLC). These results in rearrangement of the cytoskeleton (Schmandke et al. 2007; Nash et al. 2009). In general, Nogo-66 plays a pivotal role in the prevention of axonal regeneration after CNS injury in mammals (Petrinovic et al. 2013; Chong et al. 2012; Wang et al. 2008). However, recent studies have suggested a novel role of Nogo-A signaling in the regulation of synaptic plasticity in the CNS: the maintenance of stable memory engrams (Zagrebelsky and Korte 2014; Delekate et al. 2011). In addition, Nogo-66 is implicated in neurological traumas, such as spinal cord injury and stroke (Zorner and Schwab 2010; Lindau et al. 2014), neurodegenerative diseases, such as Alzheimer’s disease (Zhou et al. 2011), amyotrophic lateral sclerosis, and multiple sclerosis (Theotokis et al. 2012; Yang et al. 2009), and schizophrenia (Tews et al. 2013). Furthermore, Nogo-A has been shown to mediate apoptosis in hepatocellular carcinoma SMMC-7721 cells and, thus, is a potential therapeutic agent for the treatment of liver cancer (Hao et al. 2014). Several studies have generated recombinant Nogo-66 by prokaryotic expression, but large amounts of soluble Nogo-66 have not been obtained (GrandPre et al. 2000; Vasudevan et al. 2010). Neither a glutathione Stransferase (GST) tag nor a hexahistidine (His) tag is able to improve the solubility of Nogo-66 in E. coli. Small ubiquitin-like modifier (SUMO) proteins are covalently linked to a variety of proteins that regulate diverse cellular processes, including transcription, replication, chromosome segregation, and DNA repair (Johnson 2004; Geiss-Friedlander and Melchior 2007). It has been well documented that the use of SUMO as a chaperone can significantly increase recombinant protein expression levels, correctly facilitate target protein folding, and increase protein solubility (Butt et al. 2005). Therefore, in order to obtain a sufficient amount of soluble, bioactive Nogo-66, we tagged Nogo-66 with SUMO by fusing their DNA sequences and we induced the expression of the recombinant protein in the E. coli strain Origami B (DE3). This study provides a novel expression strategy that could significantly increase the yield of recombinant Nogo-66 to meet the demand of experimental and clinical applications of the protein.
Materials and methods Reagents Pyrobest DNA polymerase, restriction endonucleases, a polymerase chain reaction purification kit, a gel extraction kit, and a MiniBest plasmid purification kit were purchased from Takara Company (Dalian, China). The expression vector pET-3c, the E. coli strain Origami B (DE3), and SUMO protease were maintained by the Biopharmaceutical Research and Development Center of Jinan University. Isopropyl-β-D-1thiogalactopyranoside (IPTG) was purchased from Genebase Company (Guangzhou, China). The active segment of Nogo66 (Nogo-P4) was obtained from ADI Company (San Antonio, TX, USA). Anti-ROCK2, anti-Phospho-CRMP2 (Thr 514), anti-CRMP2, anti-Phospho-MLC (Ser 19), and anti-MLC were obtained from Cell Signaling Technology, Inc. (Shanghai, China). Anti-NgR was purchased from Merck Millipore (Billerica, MA, USA). Cell culture Human breast cancer cells MDA-MB-231 (ATCC HTB-26) and rat pheochromocytoma cells PC12 (ATCC CRL-1721) cells were obtained from the American Type Culture Collection (Manassas, VA, USA). The MDA-MB-231 cells were cultured in DMEM medium supplemented with 10 % (v/v) fetal bovine serum (FBS), and the PC12 cells were cultured in RPMI 1640 medium supplemented with 10 % normal horse serum and 5 % FBS. Cerebellar granule cells (CGCs) were prepared from postnatal 6–8-day-old Sprague-Dawley rats (zur Nedden et al. 2014). CGCs were plated at a density of 2×105 cells on poly-L-lysine-coated borosilicate glass coverslips (VWR, 16-mm diameter) with neurobasal medium, containing KCl 25 mM, B27 2 %, glutamine 1.5 mM, and penicillin/streptomycin 0.01 %. The MDA-MB-231, PC12, and cerebellar granule cells were all maintained at 37 °C in a humidified atmosphere at 5 % CO2 before being used for the experiments. SUMO-Nogo-66 fusion gene synthesis and construction of pET-20b/SUMO-Nogo-66 plasmid Based on the preferred codons of E. coli, an artificial gene (Genebank ID KP315948) encoding the Nogo-66 protein was synthesized by the Invitrogen Company and cloned into the pUC57 vector. Illustrations of the target gene construction are shown in Fig. S1. The molecular chaperone, SUMO gene, was fused to the target gene, Nogo-66, at its N terminus to improve target protein folding and protect the target protein from degradation (Zhang et al. 2013a). Overlapping PCR was applied to amplify the DNA fragments encoding the fusion protein, SUMO-Nogo-66, with forward and reverse primers
Appl Microbiol Biotechnol Table 1 PCR primers for amplifying the gene encoding SUMONogo-66 Primers (5′–3′) F1 (35 nt): GGGAATTCCATATGCATCATCATCATCATCACGGC R1 (34 nt): TATAGATGCGACCACCAATCTGTTCTCTGTGAGC F2 (35 nt): AGATTGGTGGTCGCATCTATAAAGGCGTGATTCAG R2 (35 nt): CGCGGATCCTTATTTCAGGCTATCCACCAGATCAT The restriction enzyme recognition sites used for cloning were NdeI (F1) and BamHI (R1). The sites are indicated by boxes. The sequence of bold letters shown in F1 is a 6× His tag nt nucleotide
(Table 1) harboring NdeI and BamHI restriction endonuclease recognition sites, respectively (Fig. S1). The recombinant plasmid was transformed into E. coli Origami B (DE3) cells. The recombinant transformants were selected for based on their ampicillin resistance, and sequencing was performed by the Shanghai Sangon Biological Engineering Technology and Services Co., Ltd. (Shanghai, China). Expression and analysis of SUMO-Nogo-66 Fermentation of SUMO-Nogo-66 was performed as described previously (Hu et al. 2014). To evaluate SUMO-Nogo-66 expression, the concentrated cells were resuspended in 50 mM Tris–HCl buffer (pH 7.4) at 1:10 ratio (w/v) and were disrupted by sonication. Following centrifugation at 12, 000×g for 30 min at 4 °C, protein fractions from both the supernatant and pellet were analyzed to determine protein solubility by 12 % sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Then, ImageJ software, which measures the ratio of target protein to total protein based on gel band intensity, was used to quantify the protein content of the protein fractions. Purification and identification of recombinant SUMO-Nogo-66 The supernatant was then applied to a Ninitrilotriacetate (Ni-NTA) Sepharose column that was pre-equilibrated with phosphate-buffered saline (PBS, pH 7.0). After washing with three column volumes of wash buffer (PBS containing 20 mM imidazole, pH 7.0), the 6× His-tagged SUMONogo-66 was eluted using elution buffer (PBS containing 300 mM imidazole, pH 7.0). The fraction containing SUMO-Nogo-66 was desalted by a Sephadex S-100 column with PBS buffer containing 10 % glycerol (pH 7.0). The purity and concentration of the fusion protein were evaluated by SDS-PAGE and bicinchoninic acid (BCA) protein assay, respectively. The purified fusion proteins were diluted to a concentration of 1 mg/mL and cleaved by SUMO protease (final concentration 10 IU/mL) at 30 °C for 1 h. The cleaved
sample was reloaded on the Ni-NTA resin and eluted by PBS containing 10 % glycerol (v/v). The apparent molecular weight and purity of these recombinant proteins were detected by SDS-PAGE. Electrospray ionization-mass spectrometry analysis (ESI-MS) was used to accurately determine the molecular weight of the recombinant proteins (Fig. S2). The colocalization of Nogo-66 to NgR The method of Nogo-66 labeled with FITC was referred the instructions of FITC Labeling Kit (no. 53027, Pierce, Rockford, USA). Briefly, 40 μL of the borate buffer (0.67 M, pH 8.5), 0.5 mL of 2 mg/mL recombinant protein in PBS and FITC reagent was mixed thoroughly. Then, the mixture was incubated in the darkness for 2 h at room temperature. The labeled solution was applied onto SephadexG25 column, and the labeled protein (yellowish color) was pooled and stored at −80 °C. The binding of FITC-Nogo-66 proteins to NgRs on the cells was observed using confocal microscopy (Dai et al. 2014). When the MDA-MB-231 cells, PC12 cells, and CGCs reached approx. 80 % confluence on coverslips, the cells were washed with PBS and fixed in 4 % paraformaldehyde at 37 °C for 15 min. After blocking with 0.5 % (w/v) BSA, the cells were incubated with 0.1 μM FITC-Nogo-66 protein for 30 min at 37 °C. Subsequently, 4′,6-diamidino-2-phenylindole (DAPI) was applied to all slides for nuclear staining. All slides were visualized by laser scanning confocal microscopy (LSM 700, Carl Zeiss Inc., Germany). The colocalization of the purified Nogo-66 proteins and anti-NgR antibodies on the PC12 cells and the CGCs was performed using the same method, with the following exceptions: the cells were incubated with anti-NgR (1:1000) at 4 °C overnight, followed by incubation with donkey anti-rabbit IgG H&L Dylight 594 for 2 h at room temperature and were then washed in PBS three times. FITC-conjugated Nogo-66 was then added and left for 2 h at room temperature. Neurite outgrowth assay Chamber slides were coated with 0.01 % poly-L-lysine (PLL) at room temperature overnight. The PC12 cells and the CGCs were seeded at a volume of 100 μL and a density of 2.5×106 cells per well. After 24 h, fresh media with nerve growth factor (NGF, 100 ng/mL) was added to the PC12 cells, and the cells were incubated for 2 days. Then, the cells were treated with serially diluted Nogo-66 and Nogo-P4. After culturing for 48 h, neurons were fixed with 4 % paraformaldehyde and immunostained with mouse anti-tubulin-βIII antibody (1:800; Sigma-Aldrich). Each experiment was performed in duplicate, and the experiments were repeated four times. For
Appl Microbiol Biotechnol
quantification analysis, the percentage of neurons with neurites was counted and neurons with neurites longer than the diameter of the cell body were considered to be neuritebearing. The length of the longest neurite of each neuron was measured using ImageJ software. The first 100 neurons encountered when scanning the slides were measured for each batch of the experiment. Western blot analysis of ROCK2, CRMP2, and MLC activation The PC12 cells and CGCs were seeded in six-well plates (5.0×106 cells/well) for 24 h. Then, fresh media with NGF (100 ng/mL) was added to the PC12 cells, and the cells were incubated for 2 days. Then, the cells were treated with serially diluted purified Nogo-66 for 48 h. Membranes were blocked and incubated overnight at 4 °C in 5 % BSA in TBS containing 0.05 % Tween 20 (TBST) with the following primary antibodies: anti-ROCK2 (1:1000; Cell Signaling), antiPhospho-CRMP2 (Thr 514) (1:1000; Cell Signaling), and anti-Phospho-MLC (Ser 19) (1:1000; Cell Signaling). Then, the membranes were incubates with a goat anti-rabbit IgG, HRP-linked antibody (1:1000) at room temperature for 1 h. Blots were developed using the enhanced chemiluminescence Western blot substrate. Quantification was performed using QuantityOne software (Bio-Rad).
Results Amplification of the SUMO-Nogo-66 fusion gene and construction of the recombinant plasmid pET-20b/SUMO-Nogo-66 The DNA segment coding the SUMO-Nogo-66 fusion protein, which had a predicted size of approximately 519 bp, was inserted into the pET-20b expression vector to generate the recombinant plasmid pET-20b/SUMO-Nogo-66 (Table 1). Then, the recombinant plasmid was used to express recombinant Nogo-66 in the E. coli strain BL21 Origami B (DE3) (Fig. 1). After digestion of the recombinant plasmid, it was sequenced and was found to be identical to the predicted sequence (data not shown). The expression and fermentation of SUMO-Nogo-66 To optimize the expression of recombinant SUMO-Nogo-66 in 10-L scale fermentation, the cells harboring pET20b/ SUMO-Nogo-66 were treated with 1 mM IPTG when the culture reached the beginning of the logarithmic growth phase (OD600 =0.6–0.8). After induction for 4 h, the biomass yielded 33±3.8 g/L wet cell weight. The cells were sonicated, and the lysate was centrifuged at 4 °C for 30 min. The SDS-PAGE
Fig. 1 Analysis of PCR fragments coding SUMO-Nogo-66. Lane 1, PCR fragment coding SUMO; lane 2, PCR fragment coding SUMONogo-66; lane M, DNA molecular weight marker (from top to bottom, 5000, 3000, 2000, 1500, 1000, 750, 500, 250, and 100 bp); lane 3, PCR fragment coding Nogo-66
results showed that the SUMO-Nogo-66 fusion protein (molecular mass, 21 kDa) was expressed in soluble form and composed an average of 33.6±3.2 % of the total supernatant protein (Figs. 2 and 3). Purification and identification of the recombinant Nogo-66 protein By Ni-NTA Sepharose and Sephadex S-100 column chromatography, the purity of the recombinant SUMO-Nogo-66 was over 87 %. After cleaving the recombinant Nogo-66 with SUMO protease, the protein mixture was applied to a NiNTA Sepharose column to further purify it (Fig. 4a). Table 2 summarizes the recombinant protein isolation and purification process. The SDS-PAGE results indicated that the final yield of recombinant Nogo-66 was 23±1.5 mg/L, with 93 % purity. The authenticity of Nogo-66 was also confirmed by electrospray ionization-mass spectrometry analysis (Fig. 4b). The MS data showed that the molecular weight of Nogo-66 was 7536.6 Da, which was closed to its theoretical mass of 7534.6 Da. The colocalization of Nogo-66 to NgR Nogo-66 exerts its biological functions by binding to the NgR. To evaluate the binding ability of the purified Nogo-66 to
Appl Microbiol Biotechnol
Fig. 3 Variation in parameters of 10-L scale fermentation production of SUMO-Nogo-66. Under the optimal fermentation conditions, the expression level of SUMO-Nogo-66 gradually increased over time and achieved its maximum level at 6 h after induction. Changes in parameters, including wet cell weight and expression level, were recorded throughout the process of 10-L fermentation
Nogo-66 induced neurite outgrowth inhibition
Fig. 2 SDS-PAGE analysis of SUMO-Nogo-66. a SDS-PAGE analysis of SUMO-Nogo-66 expression. Lane 1, pre-induced Origami B (DE3)/ pET-SUMO-Nogo-66; lane M, protein molecular weight markers (from top to bottom, 116, 66.2, 45.0, 35.0, 25.0, 18.4, and 14.4 kDa); lanes 2–4, Origami B (DE3)/pET-SUMO-Nogo-66 induced by 1 mM IPTG at 37 °C for 4 h. b SDS-PAGE analysis of SUMO-Nogo-66 during the process of fermentation. Lane M, protein molecular weight markers; lanes 1, preinduction as a control; lanes 2–4, expression of SUMO-Nogo-66 in a 10-L fermenter, induced for 1, 2, and 4 h, respectively
NgR, FITC-labeled Nogo-66 was applied to MDA-MB-231 cells, PC12 cells, and CGCs. Confocal microscopy images showed that the FITC-labeled Nogo-66 uniformly surrounded the membranes of PC12 cells and CGCs. The treatment of MDA-MB-231 cells with FITC-labeled Nogo-66 served as a negative control, and no FITC-labeled Nogo-66 fluorescence staining was observed on the membranes of those cells, as they do not express NgR (Fig. 5a). To further assess the specificity of the purified Nogo-66 proteins, PC12 cells, and CGCs were incubated with FITClabeled Nogo-66 and anti-NgR antibody. As shown in Fig. 5b, FITC-labeled Nogo-66 and anti-NgR antibody were colocalized on the surface of the PC12 cells and the CGCs. Therefore, these results demonstrate that the recombinant Nogo-66 protein was capable of binding to NgR specifically.
It has been reported that NGF can stimulate neurite outgrowth, while Nogo-66 can inhibit neurite outgrowth (Zhang et al. 2013b). To investigate the inhibition of neurite growth by recombinant Nogo-66 in vitro, two neuronal cell lines, PC12 and CGC, were treated with Nogo66 at different concentrations. As shown in Fig. 6a–j, the neurons grew numerous neurites radically from the PC12 cells treated with NGF and CGCs not treated with Nogo66. This outgrowth was drastically reduced in a dosedependent manner when the cells were treated with various concentrations of purified Nogo-66. Quantification of the neurite outgrowth generated by the aggregated cells demonstrated statistically significant enhancement of neurite outgrowth inhibition (Fig. 6k, l). Therefore, purified Nogo-66 has the potential to inhibit neurite growth. To further understand the effect of recombinant Nogo66, we compared the inhibitory function of Nogo-66 on neurite growth with that of the commercial peptide NogoP4. The peptide Nogo-P4 is composed of the 31st–55th amino acids of the Nogo-66 peptide and has been reported to have the core inhibitory activity of Nogo-66 (GrandPre et al. 2000). Our results showed that the recombinant Nogo-66 possessed higher neurite growth inhibition than Nogo-P4 at the same concentration (Fig. 6m, n). The halfmaximal effect concentration (EC50) of purified Nogo-66 (0.3±0.13 and 0.6±0.16 μM in PC12 cells and cerebellar granule cells, respectively) was much lower than that of Nogo-P4 (1.2±0.15 and 1.8±0.17 μM in PC12 cells and cerebellar granule cells, respectively).
Appl Microbiol Biotechnol Fig. 4 Analysis of SUMONogo-66 digested by SUMO protease and purified target proteins. a Cleavage and purification of SUMO-Nogo-66 detected by SDS-PAGE. Lane M, low molecular protein marker; lane 1, purified SUMO-Nogo-66; lane 2, mixture of SUMO-Nogo66 digested by SUMO protease at 30 °C for 1 h; lane 3, purified Nogo-66 obtained by Ni-NTA Sepharose chromatography. b ESI-MS analysis of purified Nogo-66
Nogo-66 induced neurite outgrowth inhibition by regulating the expression of ROCK2, phosphorylation of CRMP2, and MLC The mechanism of the inhibition of neurite outgrowth by recombinant Nogo-66 was assessed by Western
blot analysis. As shown in Fig. 7, the expression and phosphorylation of ROCK2, CRMP2, and MLC signal molecules were downregulated by NGF, while the treatment of cells with purified Nogo-66 proteins resulted in significant stimulation of the activation of the three signal molecules in a dose-dependent
Appl Microbiol Biotechnol Table 2
Summary of the purification of the recombinant protein
Purification steps
Total protein (mg)
Targeted protein (form) (mg)
Recovery (%)
Purity (%)
Yield (mg/L)
Ni-NTA Sepharose Sephadex S-100 Ni-NTA Sepharose
2710.22±99.5 836.73±29.1 531.56±36.27
SUMO-Nogo-66 SUMO-Nogo-66 Nogo-66
35 76 25
85 87 93
123.5±3.4 86.12±2.1 23±1.5
manner. These results indicate that the mechanism of the inhibition of neurite outgrowth by recombinant Fig. 5 Fluorescence imaging of purified Nogo-66 proteins binding to NgR. a Specific binding of FITC-labeled Nogo-66 proteins to NgR. b Colocalization of FITC-labeled Nogo-66 proteins with anti-NgR antibody (red) in PC12 cells and CGCs. Cells were observed by confocal laser microscopy (magnification×60) (color figure online)
898.41±58.3 612.31±15.3 123.94±13.2
Nogo-66 involved the activation of ROCK2, CRMP2, and MLC.
Appl Microbiol Biotechnol Fig. 6 Nogo-66-induced neurite outgrowth inhibition. PC12 cells were treated with 100 ng/ml NGF (b), or 100 ng/ml NGF plus various concentrations of Nogo66 (c–e 0.1, 1, and 2 μM) for 48 h. CGCs were treated with various concentrations of Nogo-66 (g–j 0.01, 0.1, 1, and 2 μM) for 48 h. a, f Control cells without NGF or Nogo-66 treatment. k, l Quantification of Nogo-66induced neurite outgrowth inhibition in PC12 cells and CGCs. m, n The neurite growth inhibition rate of purified Nogo66 and Nogo-P4 in PC12 cells and CGCs. *p
