The Plant Journal (2014) 77, 85–96

doi: 10.1111/tpj.12364

Redox signaling mediates the expression of a sulfate-deprivation-inducible microRNA395 in Arabidopsis Guru Jagadeeswaran, Yong-Fang Li and Ramanjulu Sunkar* Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK 740748, USA Received 7 August 2013; revised 9 October 2013; accepted 18 October 2013; published online 24 October 2013. *For correspondence (e-mail [email protected]).

SUMMARY MicroRNA395 (miR395) is a conserved miRNA that targets a low-affinity sulfate transporter (AST68) and three ATP sulfurylases (APS1, APS3 and APS4) in higher plants. In this study, At2g28780 was confirmed as another target of miR395 in Arabidopsis. Interestingly, several dicots contained genes homologous to At2g28780 and a cognate miR395 complementary site but possess a gradient of mismatches at the target site. It is well established that miR395 is induced during S deprivation in Arabidopsis; however, the signaling pathways that mediate this regulation are unknown. Several findings in the present study demonstrate that redox signaling plays an important role in induction of miR395 during S deprivation. These include the following results: (i) glutathione (GSH) supplementation suppressed miR395 induction in S-deprived plants (ii) miR395 is induced in Arabidopsis seedlings exposed to Arsenate or Cu2+, which induces oxidative stress (iii), S deprivation-induced oxidative stress, and (iv) compromised induction of miR395 during S deprivation in cad2 mutant (deficient in GSH biosynthesis) that is defective in glutaredoxin-dependent redox signaling and ntra/ntrb (defective in thioredoxin reductases a and b) double mutants that are defective in thioredoxin-dependent redox signaling. Collectively, these findings strongly support the involvement of redox signaling in inducing the expression of miR395 during S deprivation in Arabidopsis. Keywords: Arabidopsis thaliana, microRNA395, oxidative stress, redox signaling, sulfate deprivation.

INTRODUCTION Throughout their life cycle, plants require sulfur, an essential macronutrient for normal growth. Sulfate transporters in plant root hairs absorb inorganic sulfate from the soil, which is then loaded into the xylem for transport to leaves. Sulfate is metabolized in chloroplasts, where it is first activated into adenosine 5′-phosphosulfate (APS) by ATP sulfurylases. APS is then reduced to sulfite by APS reductase, which is further reduced to sulfide by sulfite reductase or used to synthesize sulfolipids for chloroplast membranes. Sulfide is then assimilated into the amino acid cysteine (Leustek et al., 2000), which is a precursor for methionine, S-adenosylmethionine, glutathione (GSH) and glucosinolates (Rausch and Wachter, 2005). GSH is a major metabolite of S assimilation in plants; its concentration ranges between 0.1–1.5 mM in leaves and up to 20 mM in chloroplasts (Klapheck et al., 1987; Mullineaux and Rausch, 2005). GSH is a major redox regulator and also functions as an antioxidant in heavy metal detoxification. GSH-mediated redox regulation occurs via thiol (GSH-reduced)/disulfide (GSSG-oxidized) states of the molecule. GSH oxidation is © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd

determined by reactive oxygen species and other oxidants, whereas GSSG reduction is mediated by glutathione reductase. MicroRNAs (miRNAs) are major post-transcriptional regulators of gene expression and down-regulate the expression of target genes by guiding degradation and/or by translational repression of the target mRNAs (Sunkar and Zhu, 2004; Bartel, 2009; Voinnet, 2009; Axtell, 2013). MicroRNAs have been implicated in regulating plant growth and development (Jones-Rhoades et al., 2006; Chen, 2010) and adaptation to biotic and abiotic stress (Voinnet, 2009; Sunkar et al., 2012). Recent studies have shown that several miRNAs function as integral parts of gene regulatory networks associated with nutrient homeostasis during nutrient deprivation (Chiou, 2007; Kehr, 2013). For example, miR395 is induced during S deprivation (Jones-Rhoades and Bartel, 2004; Kawashima et al., 2009; Liang et al., 2010); miR399 is induced during P deprivation (Fujii et al., 2005; Chiou et al., 2006); miR397, miR398 and miR408 are up-regulated during copper 85

86 Guru Jagadeeswaran et al. deprivation (Yamasaki et al., 2007; Jagadeeswaran et al., 2009a; Zhang et al., 2011); and miR167 and miR393 are upregulated during N-starvation (Gifford et al., 2008; Vidal et al., 2010). With the exception of transcription factors (SLIM1, SPL7 and PHR1) that regulate the expression of miRNAs induced during nutrient starvation, upstream signaling events are unknown. It has been speculated that GSH senses sulfur status and modulates genes involved in S metabolism and homeostasis in plants (Lappartient and Touraine, 1996; Kopriva and Rennenberg, 2004; Noctor et al., 2011). In Arabidopsis, GSH pools decline (Kawashima et al., 2011; Matthewman et al., 2012), and miR395 levels are induced during S deprivation (Jones-Rhoades and Bartel, 2004). Analysis of the fou8 mutant during S deprivation revealed that miR395 responds to internal rather than external S levels (Matthewman et al., 2012). Because GSH is a component of cellular redox system, we hypothesized that redox signaling could play a role in miR395 regulation during S deprivation. Therefore, miR395 regulation in mutants that are defective in both GSH-dependent (GRX) and thioredoxin-dependent (TRX) redox signaling was analyzed in this study. The results indicate that redox signaling plays a critical role in miR395 regulation during S deprivation in Arabidopsis. RESULTS Identification of At2g28780 as a target for miR395 in Arabidopsis In Arabidopsis, miR395 expression is highly induced in response to S deprivation. It targets three ATP sulfurylase genes (APS1, APS3 and APS4) and a low-affinity sulfate transporter, AST68, which facilitates S transport between plant organs. miR395 and target genes are conserved in angiosperms and in more primitive plants, such as the moss Physcomitrella patens (Jones-Rhoades and Bartel, 2004; Allen et al., 2005; Fattash et al., 2007; Sunkar and Jagadeeswaran, 2008). Of the four targets, miR395-guided cleavage on APS1, APS4 and AST68 mRNAs was confirmed both in leaves and roots (Kawashima et al., 2009). However, miR395-directed cleavage of APS3 was detected in leaves but not in roots, which led the authors to conclude that miR395 does not regulate APS3 in roots (Kawashima et al., 2009). In this study, we confirmed miR395-guided cleavage on four miR395 targets (data not shown), including APS3 in leaves and roots of Arabidopsis during S deprivation (Figure 1(a)). In addition to the four conserved targets, At2g28780 was predicted as a target for miR395 because of mere 1.5 mismatches between miR395 and At2g28780 (Adai et al., 2005); however, previous attempts to confirm miR395-guided cleavage on At2g28780 were unsuccessful, which led authors to suggest that miR395 does not regulate the At2g28780 transcript despite high complementarity (Kawashima et al., 2009). In this study, we detected

canonical cleavage in the complementary region (between 10th and 11th nucleotides) of At2g28780 transcripts in roots and shoots of Arabidopsis exposed to S deprivation (Figure 1(b)), which confirms that miR395 regulates At2g28780 expression in Arabidopsis. Because conserved miRNA target sites are usually conserved, we searched for complementary sites on homologous transcripts available at NCBI. This analysis revealed that the miR395 target site is conserved in Arabidopsis lyrata, Capsella rubella, and Populus trichocarpa (1.5 mismatches). However in other dicots, the number of mismatches increased (Figure 1(c)). For example, 2.5 mismatches in tomato (Solanum lycopersicum) and Ricinus communis; 3.5 in Brassica napus and Prunus persica; 4.0 in Fragaria vesca; 5.0 in grape (Vitis vinifera); and 6.0–6.5 in legumes (Glycine max, and Medicago truncatula). Interestingly, in sacred lotus (Nelumbo nucifera), a basal eudicot, there are 6.5 mismatches. In Cucumis sativus, there are 10 mismatches in the complementary region (Figure 1(c)). It is noteworthy that the CCS1 transcript (encoding a chaperone for Cu/ZnSOD) contains 5.5 mismatches with miR398 and has been confirmed as a target in Arabidopsis and rice (Beauclair et al., 2010; Li et al., 2010). More recently, several transcripts were confirmed as genuine miRNA targets despite weak complementarity (5 or more mismatches) (Li et al., 2010; Chorostecki et al., 2012; Zheng et al., 2012). Although we only validated At2g28780 as a miR395 target in Arabidopsis, homologous transcripts are likely to be regulated by miR395 in A. lyrata, B. napus, and possibly in distantlyrelated plants such as P. trichocarpa, S. lycopersicum, and R. communis. Expression analysis of miR395 and targets in different tissues of Arabidopsis Mature miR395 has two variants represented by six loci (miR395a, d, e and miR395b, c, f) in Arabidopsis (Sunkar and Zhu, 2004; Kawashima et al., 2009). Under conditions of sulfate sufficiency, mature miR395 is barely detectable by small RNA blot analysis (Jones-Rhoades and Bartel, 2004). However, the six MIR395 precursors were amplified by polymerase chain reaction (PCR) (data not shown) or real-time PCR (Figure 2(a)), suggesting that miR395 is expressed under normal growth conditions but at very low levels. Despite low abundance, miR395 may fine-tune the target gene expression in a tissue-specific manner by differentially accumulating in selected tissues. To test this, we determined the expression levels of six MIR395 precursors (real-time PCR) and target genes (northern blots) in RNA isolated from roots, stems, rosettes, cauline leaves, and flowers (Figure 2(a)). Of the six loci, priMIR395b and pri-MIR395d were expressed at the highest and lowest levels, respectively, regardless of tissue type (Figure 2(a)). Expression of the six loci was highest in cauline leaves and lowest in rosettes (Figure 2(a)), which

© 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 85–96

Redox signaling in miR395 regulation 87

6/12

(a)

(b)

8/12 5’ UGAGUGCCUCCAAACACUUCAGG 3’ At2g28780 (Root) ||||0||:||||||||||||| CUCAAGGGGGUUUGUGAAGUC miR395 7/11 5’ UGAGUGCCUCCAAACACUUCAGG At2g28780 (Shoot) ||||0||:||||||||||||| CUCAAGGGGGUUUGUGAAGUC miR395

(c) C. N. V. M. C. C G. F. P. B. R. S. P. C. A. A.

sativus nucifera vinifera truncatula arietinum i ti max vesca Persica napus communis lycopersicum trichocorpa rubella lyrata thaliana

5’GAUGAACACCAUCCAAUUAAU 5’AAAUUUAUGCAAAUCCUUCAG 5’GAAGUCCCUCCAGAACUUUCA 5’CAUUUUCUUCAAUCCCUUCAU 5’CAUUUUCUCCAAUCCCUUCAU 5’CAUUUUCUCCAAUCCCUUCAC 5’AGGUGCCUCCAAACACUUCAA 5’AGGUUCCUCCAAACACUUAAA 5’GAGUGCCUCCAAAAACUUCAA 5’GAGUCCCUCCAAACUCUUCAA 5’AAGUUCCUCCAAACACUUCAA 5’GAGUGCCUCCAAACACUUCAG 5’GAGUGCCUCCAAACACUUCAG 5’GAGUGCCUCCAAACACUUCAG 5’GAGUGCCUCCAAACACUUCAG ||||0||:||||||||||||| CUCAAGGGGGUUUGUGAAGUC CUCAGGGGGGUUUGUGAAGUC

(a)

(b) 5 4

MIR395 a

(10.0) (6.5) (6.5) (6.5) (6.0) (6 0) (6.0) (4.0) (3.5) (3.5) (2.5) (2.5) (1.5) (1.5) (1.5) (1.5) 5’ miR395 a,d,e 5’ miR395 b,c,f

Ro ot St em Ro se tte Ca ul in e Fl ow er

Figure 2. Expression analysis of miR395 and target genes in Arabidopsis during S sufficient conditions. (a) Relative expression levels of individual MIR395 members in different tissues as determined by realtime PCR. The abundance of different MIR395 loci was quantified after normalizing to Actin2. Three biological replicates were used for statistical analysis, and vertical bars denote the standard deviation. (b) Tissue-specific expression patterns of targets as determined by RNA blot analysis. Total RNA (10 lg) from different tissues was loaded, and the blots were hybridized with probes of APS1, APS3, APS4, AST68 and At2g28780. Ribosomal RNA (rRNA) staining is shown as a loading control.

5’ UGAGUUCCUCCAAACUCUUCAUU 3’ At4g14680 (APS3 in root) |||||||:||||||0|||||0 CUCAAGGGGGUUUGUGAAGUC miR395

Relative expression

Figure 1. Confirmation of APS3 and At2g28780 as miR395 targets in Arabidopsis and multiple sequence alignment of miR395 complementary sites on At2g28780 homologous transcripts from various plant species. (a) Validation of APS3 as a target of miR395 in roots using 5′ RACE. (b) Detection of At2g28780 as a target of miR395 in roots and shoots by 5′ RACE. Partial mRNA sequences from target genes were aligned with the miRNAs. Arrows depict the cleavage site and the fraction of cloned products that terminated at the predicted cleavage site. (c) Alignment of miR395-complementary regions from At2g28780 and homologs from diverse dicots. The number of mismatches in these transcripts is shown in parenthesis. Complementary nucleotides in the alignments are indicated by green highlighting, wobble pairing (:) is indicated by light blue highlighting and mismatches (0) are shown in red letters. Two variants of miR395 were used to determine complementarity, and the nucleotide variation between miR395 variants is highlighted in yellow.

AST68

MIR395 b MIR395 c

3

MIR395 d

APS1

MIR395 e

2

MIR395 f

APS3

1 Root

Stem Rosette Cauline Flower

APS4 At2g28780 rRNA

suggests a role for miR395 even during S sufficient conditions. Northern blot analysis revealed that AST68, APS1, APS3, APS4 and At2g28780 are abundantly expressed in roots and stems but barely detectable in flowers (Figure 2(b)).

The low expression of miR395 (Figure 2(a)) and target genes in flowers was predicted because S assimilation occurs primarily in chloroplasts or plastids. Furthermore, AST68, APS1, and APS3 were more abundantly expressed in rosettes as compared to cauline leaves. The steady-state

© 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 85–96

88 Guru Jagadeeswaran et al. level of AST68 differed from APS genes with highest levels in rosette leaves; moderate levels in cauline leaves and stems; very low levels in roots; and barely detectable expression in flowers (Figure 2(b)). Levels of miR395 and target genes were inversely correlated in rosette and cauline leaves. Three of the five targets (AST68, APS1 and APS3) are abundantly expressed (Figure 2(b)) in rosette leaves, whereas miR395 is barely expressed (Figure 2(a)). In contrast, the expression levels of target genes in cauline leaves was about half of that observed in rosette leaves in which miR395 expression levels were the most abundant (Figure 2). These inverse correlations may indicate potential miR395-dependent expression of target genes in cauline and rosette leaves during S sufficient conditions. Expression analysis of miR395 and target genes in roots and shoots during S deprivation The relationship between miR395 and targets (APS1, APS3, APS4, AST68 and At2g28780) during S deprivation was evaluated in Arabidopsis plants subjected to different sulfate levels in this study. Evidently, miR395 genes were induced both in roots and shoots of seedlings grown during S deprivation (0.02 mM sulfate) (Figure 3(a,b)). To distinguish different loci, real-time PCR was used to measure pri-MIR395 expression in shoots and roots exposed to 0.02 mM sulfate. All six pri-MIR395 transcripts showed up-regulation in response to S deprivation, although the degree of induction differed among the loci. For instance, pri-MIR395e transcript levels were elevated nearly by approximately 6- and 3.5-fold in roots and shoots,

(a)

respectively. MIR395a and MIR395c showed similar degrees of up-regulation, e.g. 3.5- and 1.5-fold increase in roots and shoots, respectively. MIR395b was up-regulated approximately 1.5-fold in both roots and shoots. MIR395d and MIR395f showed slightly more induction in shoots versus roots (Figure 3(a)). Collectively, all six loci were up-regulated during S deprivation; MIR395a, MIR395c and MIR395e loci showed stronger induction in roots as compared to shoots, whereas MIR395b, MIR395d and MIR395f showed slightly more up-regulation in shoots (Figure 3(a)). Previously, Kawashima et al. (2009) analyzed the response of MIR395 loci to S deprivation using MIR395 promoter:: GFP expression which revealed that MIR395c and MIR395e loci were strongly up-regulated, MIR395a and MIR395b loci were moderately up-regulated, MIR395d locus was weakly up-regulated, and MIR395f expression was virtually unaltered during S deprivation in Arabidopsis. Our results are generally consistent with those of Kawashima et al. (2009) with the exception that the MIR395f expression pattern differed between these two studies. We show that, albeit at low levels, MIR395f also responds to S deprivation, whereas Kawashima et al. (2009) reported that this locus is inactive. It remains possible that the MIR395f promoter used by Kawashima et al. (2009) may not include all ciselements that are required for transcriptional activation during S deprivation. In roots, APS4 transcript levels decreased drastically, APS1 levels showed a slight decrease, APS3 levels were unaltered, and AST68 levels increased during S deprivation (Figure 3(b)). In shoots, APS1, APS3, APS4 and AST68 levels significantly decreased during S deprivation (0.02 mM

(b)

Relative expression

2.0

7 6 5 4 3 2 1 0

Root 0.2

Shoot 0.02

2.0

0.2 0. 02 mM sulfate miR395

Root Shoot

U6 APS1 APS3 APS4 AST68 At2g28780 rRNA

Figure 3. Expression analyzes of miR395 and its targets in roots and shoots during S deprivation in Arabidopsis. Columbia gl-1 plants were grown for 2 weeks in MS agar media containing 2.0 mM (control), 0.2 mM, and 0.02 mM sulfate concentrations. Total RNA was isolated from roots and shoots independently. (a) Relative induction using real-time PCR of individual MIR395 genes during sulfate deprivation (0.02 mM) as compared with the control (2.0 mM). Expression levels were normalized to Actin2. Three biological replicates were used for statistical analysis, and vertical bars denote the standard deviation. (b) Northern blot analysis of miR395, APS1, APS3, APS4, AST68 and At2g28780. For detecting miR395, total RNA (20 lg) was separated on a denaturing 15% PAGE gel and transferred to a membrane, which was hybridized with labeled, antisense miR395 oligonucleotide. Blots were stripped and re-probed with U6. For target detection, 10 lg total RNA from roots and shoots was used, and the blots were hybridized with probes of APS1, APS3, APS4, AST68 and At2g28780. Ribosomal RNA (rRNA) was used as a loading control.

© 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 85–96

Redox signaling in miR395 regulation 89 3 days 6 days 9 days 1.2 0.12 0.012 1.2 0.12 0.012 1.2 0.12 0.012 mM sulfate

R O O T

miR395 U6

S H O O T

miR395 U6

S H O O T

sulfate) relative to S sufficient conditions (2.0 mM, Figure 3(b)). The differential expression of AST68 in roots and shoots during S deprivation was reported previously (Takahashi et al., 1997; Kawashima et al., 2009). The positive correlation between miR395 and AST68 expression in roots during S deprivation was attributed to non-overlapping expression patterns of miR395 (in companion cells of the phloem) and AST68 (in xylem parenchyma) (Takahashi et al., 1997; Kawashima et al., 2009). Only APS4 transcript abundance was inversely correlated with miR395 in roots and shoots during S deprivation. The newly identified target, At2g28780, was abundantly expressed in roots but unaltered during S deprivation (Figure 3(b)). Further studies are required to assess the role of miR395-guided regulation of this gene during S deprivation. Northern analysis revealed that APS1 transcripts are only slightly decreased in roots, but markedly decreased in shoots during S deprivation (Figure 3(b)). This suggests that the induced miR395 negatively impacts APS1 levels in both roots and shoots, although the impact is stronger in shoots. These results are somewhat contradictory to previous results (Kawashima et al., 2011), where APS1 mRNA levels were unaffected during sulfate starvation in Arabidopsis. A possible explanation for this discrepancy is that expression profiling was done independently in roots and shoots in our study, while Kawashima et al. (2011) studied the expression in whole seedlings. Because of the differential abundance of APS1 transcripts in roots and shoots, capturing the differences in expression levels could be masked if whole seedlings were analyzed. Our results were also different from those of Liang et al. (2010) with respect to APS3 expression. In roots, Liang et al. (2010) showed that APS3 transcripts are induced; however, our results show a slight decrease in APS3 expression in the current study during S deprivation (Figure 3(b)). Most importantly, our analysis revealed that expression of the three APS genes in shoots was inversely correlated

(b)

APS1

rRNA

30 days No sulfate

(a)

1.2 mM

Figure 4. Expression analyzes of miR395 and APS1 in roots and shoots during S deprivation in rice. (a) RNA gel blot analysis of miR395 and APS1 in rice during S deprivation. Rice plants were grown hydroponically for 2 weeks at the indicated levels of sulfate [1.2 mM (control), 0.12 mM and 0.012 mM]. Root and shoot tissues were collected independently, and total RNA was isolated. RNA from the same extraction was used for detection of miR395 and APS1 as described above. (b) miR395 analysis in roots and shoots of rice grown hydroponically in 1.2 mM sulfate (control) and without sulfate for 30 days.

R O O T

miR395

S H O O T

miR395

U6

U6

with miR395 expression, which suggests that miR395 suppresses these targets in shoots during S deprivation. When sulfate availability is limited, induced miR395 could decrease the expression of APS genes, particularly those that are not required at high levels. The negative regulation of genes associated with S metabolism when sulfate is limited is an adaptive strategy (Matthewman et al., 2012). miR395 is also induced in rice during S deprivation miR395 is conserved in both angiosperms (Sunkar and Jagadeeswaran, 2008) and the bryophyte P. patens (Fattash et al., 2007). Despite this high level of conservation, recent studies revealed that miR395 regulation differed greatly among plant species. For instance, miR395 is induced in Arabidopsis, M. truncatula, and sorghum (Jagadeeswaran et al., 2009b; Zhang et al., 2011) and constitutively expressed in switchgrass (Matts et al., 2010) and Solanum pennellii, a species of wild tomato (Shivaprasad et al., 2012). Strikingly, miR395 is not induced in switchgrass during S deprivation (Matts et al., 2010), suggesting that regulation of miR395 varies between different plant species. These differences among plant species prompted us to ask whether miR395 expression is induced during S deprivation in rice. Indeed miR395 levels progressively increased with time during S stress (0.012 mM sulfate) in both roots and shoots of rice (Figure 4(a)). Surprisingly, miR395 levels were induced even after 30 days of treatment in both the tissues (Figure 4(b)), suggesting that induction was sustained for a long period of time. Consistent with miR395 induction, APS1 levels were down-regulated in rice (Figure 4(a)), which agrees with recent findings (Jeong et al., 2011). These results in Arabidopsis (Figure 3(a)) and rice (Figure 4) and those from switchgrass and S. pennellii (Matts et al., 2010; Shivaprasad et al., 2012) indicate that miR395 regulation is distinct between domesticated and wild plant species that are adapted to marginally fertile soils.

© 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 85–96

90 Guru Jagadeeswaran et al. Glutathione supplementation blocks the accumulation of S deprivation-inducible miR395

miR395 is induced in response to heavy metals such as As and Cu2+ Soil and water contamination with heavy metals (e.g. Cr, Cu, Cd, As, Pb, Ni, Hg and Zn) is a serious problem not only because these are phytotoxic elements but because such contamination also induces oxidative stress (Ernst et al., 2008). Plant tolerance to heavy metals has often been associated with the metal-binding capacity of proteins with sulfur-containing thiol groups such as GSH, which is also a precursor for phytochelatins (Ernst et al., 2008; Jozefczak et al., 2012). The increased oxidative stress coupled with the increasing demand for GSH during metal

SH G

SH

+

G +

S

+ S –

S +

S –

S –

GSH has been speculated to serve as a sensor of S status, thus regulating gene expression associated with sulfate assimilation and homeostasis (Takahashi et al., 1997; Kawashima et al., 2009). During S deprivation, GSH pools decline and miR395 levels are induced in Arabidopsis (Kawashima et al., 2011; Matthewman et al., 2012). miR395 is constitutively expressed in fou8, a mutant that is defective in S accumulation even during conditions of sufficient external S, implying that miR395 responds to internal rather than external S (Matthewman et al., 2012). This also led to the hypothesis that the decreased GSH pool under S deprivation could serve as a signal for miR395 induction (Matthewman et al., 2012), although experimental evidence for this was lacking. The possibility that GSH serves as an internal signal can be addressed by analyzing miR395 levels in GSH-supplemented plants deprived of sulfate. If GSH is involved in miR395 regulation, miR395 levels will decrease (equilibrate to normal levels) in S-deprived plants supplemented with external GSH. If GSH is not involved, miR395 levels will remain induced even after GSH is exogenously supplied to the S-deprived plants. To test these possibilities, seedlings grown on sulfate-deprived media for 10 days in which miR395 levels highly induced, were transferred to media supplemented with GSH in the presence or absence of sulfate. As expected, miR395 levels were further up-regulated in seedlings transferred to –S, but were significantly decreased in seedlings transferred to +S (Figure 5). Interestingly, S deprivation-induced miR395 levels decreased significantly (reverted to normal levels) in seedlings transferred to GSH medium without sulfate (Figure 5). These results suggest that the signal required for miR395 induction during S deprivation is lost when GSH is supplied, which suggests a role for GSH in regulating miR395 expression. The involvement of GSH in miR395 regulation was further supported by the analysis of miR395 expression in the cad2 mutant, which also has decreased GSH levels (see below).

7 days

miR395

U6

APS1

rRNA

Figure 5. Effect of glutathione (GSH) supplementation on miR395 levels in S-deprived plants. Plants were initially grown hydroponically in sulfate deficient (0.02 mM) medium for 10 days and then transferred to same media ( S), or media supplemented with S (+S), or media supplemented with 1.0 mM GSH S, + GSH) or media supplemented with both S and 1.0 mM GSH (+S, + GSH). After 7 days of transfer, the seedlings were harvested. Total RNA was extracted and miR395 and APS1 levels were determined by RNA gel blot analysis as described above.

toxicity could lead to depletion of internal sulfate levels. On this basis, we speculated that miR395 could also be induced under heavy metal stress due to low internal sulfate levels or oxidative stress or both. To address this question, 2-week-old Arabidopsis seedlings grown on MS (Murashige-Skoog) agar were transferred to plates containing arsenate, and seedlings were harvested at different time intervals and analyzed miR395 expression. This analysis indicated that miR395 levels were up-regulated after 12 h of exposure, and the abundance was further enhanced at 24 h (Figure 6(a)) and remained induced at 48 h (data not shown). A similar induction pattern was observed in roots and shoots (data not shown). To further confirm induction of miR395 levels in response to other heavy metals, we analyzed miR395 expression in Arabidopsis seedlings exposed to high Cu2+ (100 lM) and demonstrated that miR395 was induced in response to Cu2+ (Figure 6(b)). To verify whether miR395 is transcriptionally induced in response to As or Cu2+, we examined GFP expression in the MIR395c::GFP transgenic plants exposed to these heavy metals. As shown in Figure 6(c), induction of GFP was particularly evident in the vasculature of roots treated with As or Cu2+ (Figure 6(c)). The GFP signal was either absent or weak in plants under S sufficient levels (2 mM) (Figure 6(c)). The transcriptional regulation of miR395 was further verified using northern analysis. GFP transcript abundance was highly up-regulated in S-deprived and Cu2+ - and As-treated seedlings (Figure 6(d)), demonstrating that miR395 expression is

© 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 85–96

Redox signaling in miR395 regulation 91

(a) 0

1

AS 200 µM 3 6 12

24 h miR395

(c)

GFP florescence

TL

miR398 As U6 CSD1 Cu2+ rRNA

(b)

Cu2+ 100 µM 0

3

6

12

+sulfate

24 48 h miR395 miR398

(d) +S

–S

–Cu2+ +Cu2+ –As

+As GFP

U6

rRNA

Figure 6. miR395 expression in response to As and Cu2+ stress. (a) Two-week-old Arabidopsis seedlings were grown on MS agar, sprayed with 200 lM As, and tissues were collected at the indicated time points. For detecting miR395, total RNA (20 lg) was loaded and hybridized with the labeled, antisense miR395 oligonucleotide. Blots were stripped and re-probed with the antisense miR398 oligonucleotide and U6. For analysis of CSD1 (miR398 target), total RNA (10 lg) was loaded and the blot was hybridized with labeled CSD1. rRNA staining is shown as a loading control. (b) For Cu2+ treatment, 2-week-old Arabidopsis seedlings grown on MS agar, sprayed with 100 lM Cu2+, and tissues were collected at the indicated times. miR395, miR398 and U6 were detected as described earlier. (c) The MIR395c promoter::GFP transgenic seedlings grown on MS agar plates for 2 weeks were uniformly sprayed with (i) 200 lM As (ii) 100 lM Cu2+, and (iii) deionized water. Two days after stress treatment, greeen fluorescent protein (GFP) expression was analyzed using confocal microscopy. Left panel, laser-scanning confocal microscopy of GFP fluorescence; right panel, transmitted light (TL) image. (d) For gel blot analysis of the GFP expression in plants described above (Figure 6(c)) were used, Total RNA (10 lg) from treated seedlings was used for the electrophoresis, and hybridized the blot with the labeled GFP probe. Ribosomal RNA (rRNA) staining is shown as a loading control.

regulated at the transcriptional level during these treatments. Taken together, transcription of miR395 is induced during both S deprivation and metal stress conditions under which oxidative stress is likely a common factor suggesting possible involvement of redox signaling in miR395 regulation under these stresses. S deprivation induces oxidative stress Mineral nutrient deficiencies are known to induce oxidative stress in plants (Schachtman and Shin, 2007). However, whether S deprivation induces oxidative stress is unclear. S-deprived Arabidopsis seedlings were analyzed for expression of miR398 and CSD1 (copper/zinc superoxide dismutase), which can function as molecular markers for oxidative stress (Sunkar et al., 2006). Interestingly, miR398 expression was significantly down-regulated in S-deficient plants, and this down-regulation was inversely correlated with the up-regulation of CSD1 (Figure 7). These results confirmed that the S-deprived Arabidopsis plants are experiencing oxidative stress.

Redox signaling plays an important role in miR395 induction during S deprivation Decline in GSH levels was reported in Arabidopsis during S deprivation (Matthewman et al., 2012). In addition to S deprivation, miR395 is also induced under oxidative stress (Figure 6). S deprivation induces oxidative stress (see expression of miR398 and CSD1, Figure 7). Furthermore, GSH feeding to S-deprived plants suppresses miR395 induction (Figure 5), all support the contention that GSH play an important role in miR395 regulation during S deprivation. GSH is a major redox regulator that feed into GRX system and subsequently into the thiol redox network (Dietz, 2008). In plants, cellular redox homeostasis is maintained by NAD(P)H-dependent thioredoxin (TRX) and glutaredoxin (GRX) systems via sensing and transferring reducing equivalents to numerous target proteins, which are implicated in a wide range of plant functions including stress responses (Meyer et al., 2012). Cytosolic and mitochondrial

© 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 85–96

92 Guru Jagadeeswaran et al.

(a) +S –S

+S –S

+S –S

+S –S

0.54

1.00

miR395 0.81

0.41

miR398

U6

(b) APS4 AST68

APS3

CSD1

rRNA

Figure 7. Expression analysis of miR395, miR398 and their target genes during S deprivation in mutants that are defective in redox signaling. (a). Expression analysis of miR395, miR398 in cad2, ntra/ntrb (ntr-a/b) and ntra/ntrb/cad2 (ntr-a/b/c) mutants. For detecting miR395, total RNA (20 lg) was loaded and hybridized with the labeled, antisense miR395 oligonucleotide. Blots were stripped and hybridized with antisense miR398 and U6 probes. (b). Northern blot analysis of target genes of miR395 (APS4, AST68, APS3) and miR398 (CSD1) in cad2, ntra/ntrb (ntr-a/b) and ntra/ntrb/cad2 (ntr-a/b/c) mutants was performed as described above. Ribosomal RNA (rRNA) staining is shown as a loading control.

thioredoxins are reduced by NTRa and NTRb [NAD(P)Hdependent thioredoxin reductase a and b, respectively], while the reduction of glutaredoxin depends on glutathione reductase. Therefore, miR395 regulation was examined during S deprivation in the cad2 mutant and ntra/ntrb double mutant, which are defective in GRX and TRX redox signaling, respectively. miR395 regulation was also analyzed in ntra/ntrb/cad2 triple mutants. The cad2 (cadmium-sensitive 2–1) mutant is deficient in c-glutamylcysteine synthetase, the first enzyme in the glutathione biosynthesis pathway; this mutant has approximately 30% of wild-type glutathione levels (Cobbett et al., 1998). ntra and ntrb mutants are defective in NADPH-dependent thioredoxin reductase a and b, respectively. Interestingly, ntra and ntrb were also shown to have slightly lower pools of GSH as compared to wild-type plants (Reichheld et al., 2007). In the cad2 mutant, miR395 levels were reduced by 20% as compared with the wild-type during S deprivation,

suggesting that reduced GSH interferes with miR395 induction during S deprivation (Figure 7). In the ntra/ntrb double and ntra/ntrb/cad2 triple mutants, miR395 levels were induced approximately 50% of the wild-type (Figure 7). These results firmly establish a role for redox signaling in miR395 regulation during S deprivation. DISCUSSION At2g28780 homologous transcripts are evolving as miR395 targets In addition to the four (AST68, APS1, APS3, and APS4) known targets, At2g28780 was confirmed as a target for miR395 in Arabidopsis in the present study. At2g28780 encodes a protein with five putative transmembrane domains, and its function is unknown. The predicted plasma membrane localization suggests a potential role for At2g28780 in the uptake or internal transport of S/ S-assimilated compounds in the root or in translocation from roots to shoots. Consistent with this suggestion, At2g28780 is abundantly expressed in roots compared to shoots (Figure 2(b)). Unlike AST68 and the three APS genes, which are highly conserved targets, At2g28780 homologs harboring the miR395 target site were only identified in eudicots such as Arabidopsis, Populus, tomato, Ricinus, Fragaria, Vitis, Medicago, soybean and chickpea, but not in monocots. The gradient of mismatches (1.5 through 10.0) within dicots suggests that this gene is an evolving miR395 target within dicots. This suggestion was further supported by analysis of the At2g28780 homologous transcript in sacred lotus, a basal eudicot that expresses miR395 (Ming et al., 2013; Zheng et al., 2013). The high number of mismatches in sacred lotus (6.5) and grape (5.5) compared with the low number of mismatches in Arabidopsis (1.5) and closely related species further support the hypothesis that this gene is evolving as a miR395 target. These findings also suggest that conserved miRNAs can pick up additional targets; this is an exception to the widely-accepted theory of inverted gene duplication as the cause for miRNA evolution (Allen et al., 2004). Transcriptional and post-transcriptional regulation of miR395 target genes during S sufficient and deficient conditions Systematic expression profiling of miR395 and target genes in Arabidopsis revealed both transcriptional and miR395-dependent post-transcriptional regulation during S sufficient and deficient conditions. During S sufficient conditions, miR395, AST68, APS1, APS3, APS4 and At2g28780 are abundantly expressed in roots and stems, whereas all of these genes are expressed at low levels in flowers (Figure 2(a,b)). However, the expression of miR395 and targets were negatively correlated in cauline and rosette leaves suggesting that APS1, APS3, APS4, AST68 and

© 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 85–96

Redox signaling in miR395 regulation 93 At2g28780 in roots, stems and flowers could be regulated at the transcriptional level, whereas expression of these genes in cauline and rosette leaves could be post-transcriptionally regulated. During S deprivation, the dynamics and magnitude of miR395 induction was similar both in roots and shoots, although target genes were modulated differently, i.e., APS1, APS3, APS4, AST68 were clearly down-regulated in shoots, but in roots, expression of several of these genes were either slightly decreased or unaltered and more over AST68 levels were up-regulated (Figure 3b). These data indicate that miR395-dependent post-transcriptional gene regulation plays an important role in down-regulating target genes in shoots; however, a concerted action of transcriptional and post-transcriptional regulations is apparent in roots during S deprivation. Redox signaling, a potential link between S deprivation and miR395 regulation Redox equilibrium in cells is dependent on a fine balance between energy supply and utilization. Cellular NAD(P)H redox equilibrium is maintained by NADPH-dependent thioredoxin reductase (NTR) and NADPH-dependent glutathione reductase (GTR), which are systems that feed into the thiol redox network (Dietz, 2008). Under normal conditions, feedback regulation adjusts the upstream and downstream activities; however, under stress, the redox states of NADH/NAD+ and NADPH/NADP+ may shift to a more oxidized state. Changes in the NADPH redox state via TRX and GRX systems modify the redox state of over 300 target proteins in Arabidopsis (Rouhier et al., 2005). The partial impairment (approximately 20% reduction) in miR395 induction in cad2 mutant indirectly establishes a connection with GRX signaling because reduced GRX depends on reduced GSH. However, analysis of the cad2 mutant did not clearly indicate that GSH functions as the major signal for miR395 regulation. The cad2 mutant accumulated 20–30% of wild-type GSH levels, and the TRX system was fully operational in the cad2 mutant. Thus, possible redundancy between the TRX and GRX systems can explain the modest reduction in miR395 accumulation during S deprivation. The 60 and 45% impairment in miR395 induction during S deprivation in double (ntra/ntrb) and triple (ntra/ntrb/ cad2) mutants, respectively, suggests that redox signaling plays a major role in miR395 regulation. The partial decrease in miR395 induction in S-deprived ntra/ntrb mutants could be due to redundancy in the TRX system (Meyer et al., 2012). The NTR system comprises cytosolic NTRa, mitochondrial NTRb, and chloroplastic NTRc (Meyer et al., 2012). In the current study, we analyzed the ntra/ntrb double mutant but did not include ntrc mutant. NTRc, a chloroplast-localized thioreductase, maintains redox homeostasis in green tissues and plastids of

non-photosynthetic tissues (Kirchsteiger et al., 2012). More over, GRX system is unaffected in ntra/ntrb double mutant. Furthermore, it is possible that redox signaling is not the sole controller of miR395 regulation; therefore, additional parallel pathways for controlling miR395 regulation cannot be excluded. These observations highlight the fact that miR395 regulation is complex and may involve several pathways. Approximately 60% compromise in miR395 induction in ntra/ntrb double mutant compared with 45% compromise in ntra/ntrb/cad2 triple mutant suggest that there was no additive effect on miR395 regulation. The TRX and GRX systems are essential for diverse functions in plants. The lack of additive effect on miR395 expression in triple mutant compared with the double mutant could be due to activation of other compensatory (backup) pathways after certain threshold level of compromise of both the TRX and GRX systems as in case of triple (ntra/ntrb/cad2) mutant compared with double (ntra/ntrb) mutant in which only NTR is partly compromised. Previous studies have shown that similar backup systems exist in these pathways. For example, Trxh3 is not completely oxidized in the ntra/ntrb double mutant suggesting existence of an alternative TRX reduction system in Arabidopsis (Reichheld et al., 2007). Similarly, NTRA/Trxh3 system acts as a backup system for GSSG reduction, in the absence of glutathione reductase (GR) that is involved in reduction of GSSG to GSH (Marty et al., 2009). The genes encoding S transport and assimilation are coordinately regulated at the transcriptional level in response to S status (Saito, 2004). SLIM1 regulates the expression of several genes involved in primary and secondary S metabolism including miR395 during S deprivation (Maruyama-Nakashita et al., 2006; Kawashima et al., 2009). Our analysis firmly placed redox signaling upstream to SLIM1 in the miR395 regulatory network (Figure 8). The reported involvement of the redox signaling in miR395 expression during S deprivation in this study has also implications for several other protein-coding genes that are regulated by SLIM1 during S deprivation (Maruyama-Nakashita et al., 2006). Surprisingly, SLIM1 transcript abundance is not altered during S deprivation, consequently the involvement of post-transcriptional regulation of SLIM1 was suspected (Maruyama-Nakashita et al., 2006). Whether SLIM1 itself is a target of redox signaling warrants further study. EXPERIMENTAL PROCEDURES Plant material and growth conditions Arabidopsis (Columbia 0 gl-1) seeds were surface sterilized and plated on MS agar medium. Plates were kept at 4°C for 2 days for and then transferred to a growth chamber with a 16 h/8 h light/ dark cycle at 22°C and 200 lmol m 2 sec 1 light intensity. To impose sulfate deficiency, seeds were surface sterilized and plated on Murashige-Skoog (MS) agar plates containing 2.0 mM (control),

© 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 85–96

94 Guru Jagadeeswaran et al. 0.2 mM, and 0.02 mM sulfate concentrations by replacing the sulfate anion with equivalent amounts of chloride or nitrate salts. For analyzing tissue-specific expression of miR395 and its target genes shown in Figure 2, plants were grown on potting mix (MetroMix 360 that has 10.8 mM sulfate) in growth chambers at 22–23°C and 75% humidity under a 14 h/10 h light/dark cycle for 5–6 weeks until the tissues were harvested.

–S, As, Cu

Altered redox status - NAD(P)H/NADP+

As or Cu2+ treatments After 2 weeks, the Arabidopsis seedlings grown on MS agar plates were thoroughly and uniformly sprayed with sodium arsenate (200 lM) or copper sulfate (100 lM). The seedlings were harvested at different time points (0, 1, 3, 6, 12, 24 and 48 h) to evaluate the expression of small RNAs or their targets.

NTR

GR

RNA isolation and expression analysis Total RNA was extracted from seedlings or tissues of 4-week-old plants with TRIzol reagent (Invitrogen, http://www.lifetechnolo gies.com/). For target analysis, 10 lg of total RNA was separated on 1.5% agarose gels and transferred to Hybond-N+ membranes (Amersham). Probes were labeled with [a-32P] dCTP using the Klenow fragment. Northern blot hybridizations were performed as described previously (Sunkar et al., 2006). For detection of miRNAs, total RNA (20 lg) was extracted, separated by electrophoresis on 15% denaturing polyacrylamide gels, and transferred to Hybond-N+ membranes. The membranes were hybridized with miRNA-specific probes; these probes were prepared by end-labeling antisense DNA oligos with [c-32P] dATP and T4 polynucleotide kinase (New England Biolabs, https://www. neb.com/). Hybridizations and washings were performed as described previously (Sunkar et al., 2006).

Real-time PCR Real-time PCR was conducted using the RNA samples isolated for northern blot analysis. Total RNA (1 lg) was treated with DNase I, and then reverse-transcribed using oligo-dT primers, reverse transcriptase, and deoxynucleotides. Real-time PCR was conducted using the MaximaTM (http://www.thermoscientificbio.com/qpcrmaster-mixes-and-assays/maxima-sybr-green-qpcr-master-mixes/) SYBR Green PCR Master Mix in a 7500 Real-time PCR System; reactions contained 100 ng cDNA and 7.5 pmol of each gene-specific primer. The analysis was performed using two independent cDNA preparations and triplicate PCR. The relative expression ratio was calculated using the 2 ΔΔCt method (Livak and Schmittgen, 2001) with actin as a reference gene.

Rapid amplification of cDNA ends (RACE) To validate miR395 targets, a modified 5′-RACE assay was performed using the GeneRacer Kit (Invitrogen). Briefly, RNA from plant tissue was ligated with a 5′ RNA adapter and reverse transcription was performed. The resulting cDNA was used as template for PCR amplification with the 5′ GeneRacer primer and a gene-specific primer. A second PCR was performed using nested primers (5′ GeneRacer nested primer and a gene-specific nested primer). Amplified products were gel-purified, cloned and sequenced.

Green fluorescent protein imaging Seeds of MIR395c promoter–GFP transgenic plants were obtained from T. Dalmay, and the progenies of these plants were used for GFP imaging studies. The MIR395c promoter::GFP Arabidopsis

GSSG/GSH

GRX

TRX

Target proteins

SLIM1?

miR395 Figure 8. Model for the involvement of classical NADPH/NTR/Trx and NADPH/GR/Grx system in regulating miR395 expression during S deprivation and heavy metal (As and Cu) stress. SLIM1 transcription factor is responsible for induction of miR395 under S deprivation (Kawashima et al., 2009) and possibly other stress conditions. Whether SLIM1 is a target of Trx/Grx system(s) is unknown and this is indicated with a question mark. Grx-dependent Trx reduction and Trx-dependent GSSG reduction are shown by dashed lines [Figure is modified from Meyer et al. (2012)].

seedlings grown on MS agar plates containing 2.0 mM (control) sulfate concentration by replacing the sulfate anion with equivalent amounts of chloride or nitrate salts. After 2 weeks of growth, the seedlings were uniformly sprayed with 200 lM As or 100 lM Cu or deionized water (control). Laser-scanning confocal imaging system [Leica TCS SP2 (http://www.leica-microsystems.com/products/ confocal-microscopes/details/product/leica-tcs-sp2/) equipped with a Leica DMRE upright microscope was used for the analysis of tissue-specific expression of GFP. Figures shown are a longitudinal confocal section of primary root of MIR395c promoter-GFP plants. An argon laser at 488-nm wavelength was used to excite GFP while the fluorescence emission was detected between 522 and 535 nm. Images were compiled into figures using ADOBE PHOTOSHOP CS software (Adobe Systems, Inc., San Jose, CA, USA, http://www. adobe.com/products/photoshop.html)].

ACKNOWLEDGEMENTS This work was supported by the Oklahoma Agricultural Experiment Station and the NSF EPSCoR award EPS0814361 and the

© 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 85–96

Redox signaling in miR395 regulation 95 Oklahoma Center for the Advancement of Science and Technology award PS13-012. We sincerely thank Dr Tamas Dalmay, University of East Anglia, for providing the MIR395c promoter::GFP seeds and Dr Jean-Philippe Reichhold, Universite de Perpignan, for the cad2, ntra/ntrb, and ntra/ntrb/cad2 mutants. The authors declare no competing financial interests.

REFERENCES Adai, A., Johnson, C., Mlotshwa, S., Archer-Evans, S., Manocha, V., Vance, V. and Sundaresan, V. (2005) Computational prediction of miRNAs in Arabidopsis thaliana. Genome Res. 15, 78–91. Allen, E., Xie, Z.X., Gustafson, A.M., Sung, G.H., Spatafora, J.W. and Carrington, J.C. (2004) Evolution of microRNA genes by inverted duplication of target gene sequences in Arabidopsis thaliana. Nat. Genet. 36, 1282–1290. Allen, E., Xie, Z.X., Gustafson, A.M. and Carrington, J.C. (2005) microRNA-directed phasing during trans-acting siRNA biogenesis in plants. Cell, 121, 207–221. Aung, K., Lin, S.I., Wu, C.C., Huang, Y.T., Su, C.L. and Chiou, T.J. (2006) pho2, a phosphate overaccumulator, is caused by a nonsense mutation in a microRNA399 target gene. Plant Physiol. 141, 1000–1011. Axtell, M.J. (2013) Classification and comparison of small RNAs from plants. Annu. Rev. Plant Biol. 64, 137–159. Bari, R., Pant, B.D., Stitt, M. and Scheible, W.R. (2006) PHO2, microRNA399, and PHR1 define a phosphate-signaling pathway in plants. Plant Physiol. 141, 988–999. Bartel, D.P. (2009) MicroRNAs: target recognition and regulatory functions. Cell, 136, 215–233. Beauclair, L., Yu, A. and Bouche, N. (2010) microRNA-directed cleavage and translational repression of the copper chaperone for superoxide dismutase mRNA in Arabidopsis. Plant J. 62, 454–462. Chen, X.M. (2010) Plant microRNAs at a glance. Semin. Cell Dev. Biol. 21, 781. Chiou, T.J. (2007) The role of microRNAs in sensing nutrient stress. Plant, Cell Environ. 30, 323–332. Chiou, T.J., Aung, K., Lin, S.I., Wu, C.C., Chiang, S.F. and Su, C.L. (2006) Regulation of phosphate homeostasis by microRNA in Arabidopsis. Plant Cell, 18, 412–421. Chorostecki, U., Crosa, V.A., Lodeyro, A.F., Bologna, N.G., Martin, A.P., Carrillo, N., Schommer, C. and Palatnik, J.F. (2012) Identification of new microRNA-regulated genes by conserved targeting in plant species. Nucleic Acids Res. 40, 8893–8904. Cobbett, C.S., May, M.J., Howden, R. and Rolls, B. (1998) The glutathione-deficient, cadmium-sensitive mutant, cad2-1, of Arabidopsis thaliana is deficient in gamma-glutamylcysteine synthetase. Plant J. 16, 73–78. Dietz, K.J. (2008) Redox signal integration: from stimulus to networks and genes. Physiol. Plant. 133, 459–468. Ernst, W.H., Krauss, G.J., Verkleij, J.A. and Wesenberg, D. (2008) Interaction of heavy metals with the sulphur metabolism in angiosperms from an ecological point of view. Plant, Cell Environ. 31, 123–143. Fattash, I., Voss, B., Reski, R., Hess, W.R. and Frank, W. (2007) Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution. BMC Plant Biol. 7, 13. Fujii, H., Chiou, T.J., Lin, S.I., Aung, K. and Zhu, J.K. (2005) A miRNA involved in phosphate-starvation response in Arabidopsis. Curr. Biol. 15, 2038–2043. Gifford, M.L., Dean, A., Gutierrez, R.A., Coruzzi, G.M. and Birnbaum, K.D. (2008) Cell-specific nitrogen responses mediate developmental plasticity. Proc. Natl Acad. Sci. USA 105, 803–808. Jagadeeswaran, G., Saini, A. and Sunkar, R. (2009a) Biotic and abiotic stress down-regulate miR398 expression in Arabidopsis. Planta, 229, 1009– 1014. Jagadeeswaran, G., Zheng, Y., Li, Y.F. et al. (2009b) Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families. New Phytol. 184, 85–98. Jeong, D.H., Park, S., Zhai, J., Gurazada, S.G., De Paoli, E., Meyers, B.C. and Green, P.J. (2011) Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage. Plant Cell, 23, 4185–4207.

Jones-Rhoades, M.W. and Bartel, D.P. (2004) Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Mol. Cell, 14, 787–799. Jones-Rhoades, M.W., Bartel, D.P. and Bartel, B. (2006) MicroRNAs and their regulatory roles in plants. Annu. Rev. Plant Biol. 57, 19–53. Jozefczak, M., Remans, T., Vangronsveld, J. and Cuypers, A. (2012) Glutathione is a key player in metal-induced oxidative stress defenses. Int. J. Mol. Sci. 13, 3145–3175. Kawashima, C.G., Yoshimoto, N., Maruyama-Nakashita, A., Tsuchiya, Y.N., Saito, K., Takahashi, H. and Dalmay, T. (2009) Sulphur starvation induces the expression of microRNA-395 and one of its target genes but in different cell types. Plant J. 57, 313–321. Kawashima, C.G., Matthewman, C.A., Huang, S. et al. (2011) Interplay of SLIM1 and miR395 in the regulation of sulfate assimilation in Arabidopsis. Plant J. 66, 863–876. Kehr, J. (2013) Systemic regulation of mineral homeostasis by micro RNAs. Front Plant Sci. 4, 145. Kirchsteiger, K., Ferrandez, J., Pascual, M.B., Gonzalez, M. and Cejudo, F.J. (2012) NADPH thioredoxin reductase C is localized in plastids of photosynthetic and nonphotosynthetic tissues and is involved in lateral root formation in Arabidopsis. Plant Cell, 24, 1534–1548. Klapheck, S., Latus, C. and Bergmann, L. (1987) Localization of glutathione synthetase and distribution of glutathione in leaf cells of Pisum sativum L. J. Plant Physiol. 131, 123–131. Kopriva, S. and Rennenberg, H. (2004) Control of sulphate assimilation and glutathione synthesis: interaction with N and C metabolism. J. Exp. Bot. 55, 1831–1842. Lappartient, A.G. and Touraine, B. (1996) Demand-driven control of root ATP sulfurylase activity and SO42-uptake in intact canola (the role of phloem-translocated glutathione). Plant Physiol. 111, 147–157. Leustek, T., Martin, M.N., Bick, J.A. and Davies, J.P. (2000) Pathways and regulation of sulfur metabolism revealed through molecular and genetic studies. Annu. Rev. Plant Physiol. Plant Mol. Biol. 51, 141–165. Li, Y.F., Zheng, Y., Addo-Quaye, C., Zhang, L., Saini, A., Jagadeeswaran, G., Axtell, M.J., Zhang, W. and Sunkar, R. (2010) Transcriptome-wide identification of microRNA targets in rice. Plant J. 62, 742–759. Liang, G., Yang, F. and Yu, D. (2010) MicroRNA395 mediates regulation of sulfate accumulation and allocation in Arabidopsis thaliana. Plant J. 62, 1046–1057. Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2–DDCT method. Methods, 25, 402–408. Mallory, A.C. and Vaucheret, H. (2006) Functions of microRNAs and related small RNAs in plants. Nat. Genet. 38, S37. Marty, L., Siala, W., Schwarzlander, M., Coruzzi, G.M. and Birnbaum, K.D. (2009) The NADPH-dependent thioredoxin system constitutes a functional backup for cytosolic glutathione reductase in Arabidopsis. Proc. Natl. Acad. Sci. USA, 106, 9109–9114. Maruyama-Nakashita, A., Nakamura, Y., Tohge, T., Saito, K. and Takahashi, H. (2006) Arabidopsis SLIM1 is a central transcriptional regulator of plant sulfur response and metabolism. Plant Cell, 18, 3235–3251. Matthewman, C.A., Kawashima, C.G., Huska, D., Csorba, T., Dalmay, T. and Kopriva, S. (2012) miR395 is a general component of the sulfate assimilation regulatory network in Arabidopsis. FEBS Lett. 586, 3242–3248. Matts, J., Jagadeeswaran, G., Roe, B.A. and Sunkar, R. (2010) Identification of microRNAs and their targets in switchgrass, a model biofuel plant species. J. Plant Physiol. 167, 896–904. Meyer, Y., Belin, C., Delorme-Hinoux, V., Reichheld, J.P. and Riondet, C. (2012) Thioredoxin and glutaredoxin systems in plants: molecular mechanisms, crosstalks, and functional significance. Antioxid. Redox Signal. 17, 1124–1160. Ming, R., Vanburen, R., Liu, Y. et al. (2013) Genome of the long-living sacred lotus (Nelumbo nucifera Gaertn.). Genome Biol. 14, R41. Mullineaux, P. and Rausch, T. (2005) Glutathione, photosynthesis and the redox regulation of stress-responsive gene expression. Photosynth. Res. 86, 459–474. Noctor, G., Queval, G., Mhamdi, A., Chaouch, S. and Foyer, C.H. (2011) Glutathione. The Arabidopsis Book. 9, e0142. Rausch, T. and Wachter, A. (2005) Sulfur metabolism: a versatile platform for launching defence operations. Trends Plant Sci. 10, 503–509.

© 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 85–96

96 Guru Jagadeeswaran et al. Reichheld, J.P., Khafif, M., Riondet, C., Droux, M., Bonnard, G. and Meyer, Y. (2007) Inactivation of thioredoxin reductases reveals a complex interplay between thioredoxin and glutathione pathways in Arabidopsis development. Plant Cell, 19, 1851–1865. Rouhier, N., Villarejo, A., Srivastava, M. et al. (2005) Identification of plant glutaredoxin targets. Antioxid. Redox Signal. 7, 919–929. Saito, K. (2004) Sulfur assimilatory metabolism. The long and smelling road. Plant Physiol. 136, 2443–2450. Schachtman, D.P. and Shin, R. (2007) Nutrient sensing and signaling: NPKS. Annu. Rev. Plant Biol. 58, 47–69. Shivaprasad, P.V., Dunn, R.M., Santos, B.A., Bassett, A. and Baulcombe, D.C. (2012) Extraordinary transgressive phenotypes of hybrid tomato are influenced by epigenetics and small silencing RNAs. EMBO J. 31, 257–266. Sunkar, R. and Jagadeeswaran, G. (2008) In silico identification of conserved microRNAs in large number of diverse plant species. BMC Plant Biol. 8, 37. doi: 10.1186/1471-2229-8-37. Sunkar, R. and Zhu, J.K. (2004) Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis. Plant Cell, 16, 2001–2019. Sunkar, R., Kapoor, A. and Zhu, J.K. (2006) Posttranscriptional induction of two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation of miR398 and important for oxidative stress tolerance. Plant Cell, 18, 2051–2065. Sunkar, R., Li, Y.F. and Jagadeeswaran, G. (2012) Functions of microRNAs in plant stress responses. Trends Plant Sci. 17, 196–203.

Takahashi, H., Yamazaki, M., Sasakura, N., Watanabe, A., Leustek, T., Engler, J.D., Engler, G., VanMontagu, M. and Saito, K. (1997) Regulation of sulfur assimilation in higher plants: a sulfate transporter induced in sulfate-starved roots plays a central role in Arabidopsis thaliana. Proc. Natl Acad. Sci. USA, 94, 11102–11107. Vidal, E.A., Araus, V., Lu, C., Parry, G., Green, P.J., Coruzzi, G.M. and Gutierrez, R.A. (2010) Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in Arabidopsis thaliana. Proc. Natl Acad. Sci. USA, 107, 4477–4482. Voinnet, O. (2009) Origin, biogenesis, and activity of plant microRNAs. Cell, 136, 669–687. Yamasaki, H., Abdel-Ghany, S.E., Cohu, C.M., Kobayashi, Y., Pilon, M. and Shikanai, T. (2007) The mechanism of adaptation to copper deficient conditions via microRNA in Arabidopsis. Plant Cell Physiol. 48, S106. Zhang, L., Zheng, Y., Jagadeeswaran, G., Li, Y., Gowdu, K. and Sunkar, R. (2011) Identification and temporal expression analysis of conserved and novel microRNAs in Sorghum. Genomics, 98, 460–468. Zheng, Y., Li, Y.F., Sunkar, R. and Zhang, W. (2012) SeqTar: an effective method for identifying microRNA guided cleavage sites from degradome of polyadenylated transcripts in plants. Nucleic Acids Res. 40, e28. Zheng, Y., Jagadeeswaran, G., Gowdu, K., Wang, N., Li, S., Ming, R. and Sunkar, R. (2013) Genome-wide analysis of MicroRNAs in sacred lotus, Nelumbo nucifera (Gaertn). Trop Plant Biol. 6, 117–130.

© 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd, The Plant Journal, (2014), 77, 85–96