Food Chemistry 178 (2015) 208–211
Contents lists available at ScienceDirect
Food Chemistry journal homepage: www.elsevier.com/locate/foodchem
Short communication
Reduction of biogenic amines production by eliminating the PEP4 gene in Saccharomyces cerevisiae during fermentation of Chinese rice wine Xuewu Guo, Xiangyu Guan, Yazhou Wang, Lina Li, Deguang Wu, Yefu Chen, Huadong Pei, Dongguang Xiao ⇑ Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education, Tianjin Industrial Microbiology Key Lab, College of Biotechnology, Tianjin University of Science and Technology, No 29, 13ST. TEDA, Tianjin 300457, China
a r t i c l e
i n f o
Article history: Received 9 September 2014 Received in revised form 10 December 2014 Accepted 19 January 2015 Available online 24 January 2015 Keywords: Biogenic amines Proteinase A (PrA) PEP4 Yeast
a b s t r a c t Biogenic amines in Chinese rice wine have a potential threat of toxicity to human health. In this study, PEP4 gene in Saccharomyces cerevisiae was knocked out in order to evaluate its effect on biogenic amines production; the enzyme encodes proteinase A (PrA), an enzyme that is responsible for the production of free amino acids. It was found that compared to the wild type strain, the PrA activity and amino acid concentration decreased significantly, and the production of biogenic amines in this knockout strain decreased by 25.5%, from 180.1 mg/L to 134.2 mg/L. Especially, tyramine, cadaverine and histamine concentrations were also decreased by 57.5%, 24.6% and 54.3%, respectively. The main reason for the decrease of biogenic amines may be due to the low concentration of free amino acids. Our results provide a new strategy to minimize the biogenic amine production during fermentation of Chinese rice wine. Ó 2015 Elsevier Ltd. All rights reserved.
1. Introduction Biogenic amines are low molecular weight nitrogenous organic bases that have been identified as the toxicological agents in a number of foods such as fish products, cheese, meat, and wine (Lu et al., 2007; Zhong et al., 2012). Some individuals are sensitive to biogenic amines, resulting in symptoms resembling an allergic reaction. The main biogenic amines in Chinese rice wine are serotonin, tyramine, putrescine, cadaverine and histamine (Lu et al., 2007; Zhong et al., 2012). Biogenic amines are synthesized by the decarboxylation reaction of free amino acids by amino acid decarboxylases (Halász, Barátha, Simon-Sarkadib, & Holzapfel, 1994; Kirschbaum, Rebscher, & Brückner, 2000). The factors that govern the formation of biogenic amines include: the presence of an amino acid decarboxylase, free amino acid substrates, and appropriate reaction conditions (Pereira, Barreto Crespo, & San Romao, 2001). Many researchers have shown that lactic acid bacteria in fermented food can produce biogenic amines, however others have shown that biogenic amine synthesis is a complicated process requiring yeast. (Caruso et al., 2002; Costantini, Vaudano, Del Prete, Danei, & Garcia-Moruno, 2009; Rosi, Nannelli, & Giovani, 2009; Torrea &
⇑ Corresponding author. Tel.: +86 022 60601667. E-mail address: [email protected] (D. Xiao). http://dx.doi.org/10.1016/j.foodchem.2015.01.089 0308-8146/Ó 2015 Elsevier Ltd. All rights reserved.
Ancín, 2001). Costantini et al. (2009) reported that two yeasts (Saccharomyces cerevisiae commercial starters A and D) can produce tyramine and histamine during alcoholic fermentation of grape juice. Interestingly, compared to Saccharomyces pure cultures, the production of biogenic amines was decreased when non-Saccharomyces and spontaneous mixed culture was used in wine fermentation (Medina et al., 2013). The role of bacteria or yeast in the formation of biogenic amines is still unclear (Caruso et al., 2002; Izquierdo-Pulido, Font-Fábregas, & Vidal-Carou, 1995; Rosi et al., 2009). Chinese rice wine is one of the most popular alcoholic beverages in China, which has a long history of brewing this fermented alcoholic beverage. Chinese rice wine is rich in amino acids, oligosaccharides and microelements (Zhong et al., 2012). The fermentation process of the rice wine is a process involving several microorganisms (Zhang et al., 2013), and the biogenic amine concentration is elevated in this wine. PrA (EC 3.4.23.25), encoded by PEP4 in S. cerevisiae, is the most important and massive proteolytic enzyme in yeast (Rothman, Hunter, Valls, & Stevens, 1986; Rupp & Wolf, 1995). During beer production, yeast cells release PrA, which breaks down proteins resulting in abundant amino acids in beer (Teichert, Mechler, Mülle, & Wolf, 1989). Many studies have shown that the deletion of PEP4 gene in industrial brewer’s yeast helps beer maintain foam stability, as this decreases the concentration of PrA (Hao et al., 2008; Lu et al., 2012).
209
X. Guo et al. / Food Chemistry 178 (2015) 208–211
In this study, the PEP4 gene in S. cerevisiae was knocked out, and the biogenic amine production in the Chinese rice wine fermented using these yeast was monitored. The PrA activity of the recombinant industrial brewer’s yeast strain was also monitored, as well as the amino acid concentration in fermentation broth. 2. Materials and methods 2.1. Strains and plasmids All strains and plasmid used in this study are listed in Table 1. The plasmid pUC-ABK, constructed previously, was used as the original vector (Wu et al., 2013), and contained A and B fragments from the upstream and downstream prosequence of PEP4, respectively, and a drug-resistance gene, KanMX from pUG6 (Gueldener, Heinisch, Koehler, Voss, & Hegemann, 2002). The following primers were used for the amplification of DNA fragments via polymerase chain reaction (PCR): for the PEP4 open reading frame (ORF), A-up (CCCAAGCTTCGCTGCTATTTATTCATTCCACC; the Hind III restriction site is underlined) and B-down (CGAGCTCTGGTAGCCTCAGCGAA GTCT; the Sac I restriction site is underlined); and for the Kan ORF, KpnI-Kan-ORF-F (CGGGGTACCCAGCTGAAGCTTCGTACGC; the KpnI restriction site is underlined) and KpnI-Kan-ORF-R (CGGGGTACCGCATAGGCCACTAGTGGATCTG; the KpnI restriction site is underlined). 2.2. Media and culture conditions Yeast were routinely cultured at 28 °C in yeast extract peptone dextrose (YEPD) medium [2% glucose, 2% peptone (Difco) and 1% yeast extract] for growth, and in wort medium (prepared by treating freshly smashed malt with water at 65 °C for 30 min and adjusting the sugar content to 12 °Bx) for cell culture. For the selection of yeast transformants, 100 mg/mL G418 was added to a final concentration of 0.24 mg/mL. 2.3. Fermentation experiments The fermentation experiments were conducted using a previously described method (Zhang et al., 2012). A total of 100 g rice was dipped in water for 72 h at 25–30 °C. The dipped-rice was washed, and then cooked 20–30 min. The cooked rice was cooled at room temperature, and then transferred into 500 mL flasks. Finally, 10 g mature wheat koji, 105 mL water (consisting of 60 mL clean water and 45 mL serofluid) and 10 mL secondpreculture of yellow rice wine yeast were added into the flasks. (NH4)2SO4 was added in the rice fermentation medium with need. The pH of the rice fermentation medium with the addition of (NH4)2SO4 was adjusted to consist with before 1 M NaOH and
1 M HCl. The mixture was initially fermented at 28 °C for 5 days and then continuously fermented at 16 °C for 30 days. 2.4. Yeast transformation and screening The DNA fragment of PEP4 A-loxP-KanMX-loxP-PEP4 R was amplified and transformed into RY1. The fragment was integrated into the chromosome at the PEP4 locus of RY1 by homologous recombination to construct single PEP4 allele disruption. The transformants were screened on G418 selective plates after transformation and verified by polymerase chain reaction (PCR) using primer pairs YZ1/YZ2 (GTTAGCTCACTCATTAGGCA/GACTTTTGCAGC AACTTGGT) and YZ3/YZ4 (GTTAGCTCACTCATTAGGCA/CGCTGCTATTTATTCATTCCACC). The KanMX gene was excised from RY1-a-PEP4-K and RY1-a-PEP4, and obtained using the Cre-loxP recombination system. The recombinant diploid RY1-PEP4 was obtained after the fusion of the purified RY1-aPEP4-K and RY1-a-PEP4-K haploid recombinants and verified using the same method as the haploid. 2.5. Analytical methods PrA activity was assayed by a fluorescent method (Kondo et al., 1999). One unit of PrA will hydrolyze 1 mg of insulin chain B (oxidized) per minute at pH 6.0 (25 °C). Biogenic amines and amino acids were determined by a liquid chromatographic method as described by Lu et al. (2007) and Gómez-Alonso, HermosínGutiérrez, and García-Romero (2007) with some modified. Briefly, 1 mL rice wine sample and 200 lL NaHCO3 saturated solution, 20 lL NaOH solution (2 M), 2 mL dansyl chloride (10 mg/mL) were mixed, and the mixture was incubated in a water bath at 70 °C for 10 min, then 1 mL ammonia water (50 mg ammonia dissolved in water) was added to terminate the reaction. After centrifugation at 3000 rpm for 10 min, the supernatant were filtered by 45 lm filter, then the sample was analyzed by HPLC (Agilent 1100 series equipped with diode array detector, Waters-Atlantisd C18 (46 250 mm, 5 lm)). The C18 column was equilibrated at 30 °C with a mobile phase consisting of 55% methanol and 45% water. For amino acids determined, 1 mL rice wine sample, 1.75 mL of borate buffer 1 M (pH 9), 750 lL of methanol, 1 mL of target sample without any pretreatment, 20 lL of internal standard (L-2-aminoadipic acid, 1 g/L), and 30 lL of DEEMM were mixed in a screwcap test tube over 30 min in an ultrasound bath. The mixture was then heated at 70 °C for 2 h. The Agilent 1100 series equipped with array photodiode detector, Waters-Atlantisd C18 (46 250 mm, 5 lm) was used. The analyses were performed in triplicate. A gradient elution system with a mixture of A (25 mM acetate buffer pH = 5.8 with 0.02% sodium azide) and B (80:20 mixture of acetonitrile and methanol) was used.
Table 1 Strains and plasmid used in this study. Strain or plasmid
Relevant characteristic
Reference or source
Saccharomyces cerevisiae industrial strains RY1 RY1-a1 RY1-a2
Commercial yellow rice wine yeast strain Haploid yeast strain from RY1, a mating type Haploid yeast strain from RY1, a mating type
Zhang et al. (2012) This work This work
Transformants RY1-a-PEP4 RY1-a-PEP4 RY1-a-PEP4-K RY1-a-PEP4-K RY1-PEP4
PEP4::pABK, haploid yeast strain, a mating type PEP4::pABK, haploid yeast strain, a mating type PEP4::loxp, haploid yeast strain, a mating type PEP4::loxp, haploid yeast strain, a mating type The fusion of RY1-a1-PEP4-K and RY1-a2-PEP4-K
This This This This This
Plasmids pUC-ABK
Kanr, containing PEP4 A- loxP - KanMX-loxP - PEP4 R
Wu et al. (2013)
work work work work work
210
X. Guo et al. / Food Chemistry 178 (2015) 208–211
Fig. 1. PCR verification of the yeast recombinant strains and identification for KanMX losing. (A) M: marker DL 5000; DNA templates: M: DL5000; 2, 4, 6, 8: RY1-a1-PEP4/YZA, YZ-B, A-KanMX-B, KanMX; 3, 5, 7, 9: RY1/YZ-A, YZ-B, A-KanMX-B, KanMX; (B) M: DL5000 DNA Marker; 2: RY1-a1-PEP4; 3: RY1-a1-PEP4-K.
cassette A-KanMX-B fragment was successfully inserted into the locus of prosequence of PEP4 and the prosequence was replaced by KanMX. In addition, the KanMX gene was excised from the mutant strain RY1-a1-PEP4 and the final mutant strain RY1-a1PEP4-K was obtained and identified by PCR (Fig. 1B). 3.2. Determination of enzyme activity of proteinase A The intracellular and extracellular PrA activities of mutant strains were measured under the same conditions. As shown in Fig. 2, the intracellular and extracellular PrA activity of the recombinant RY1-PEP4 was 0.43 10 5 U/mg and 0.31 10 5 U/mL, which decreased by 96% and 97%, respectively, compared with the parental strain RY-1. These results confirmed that PEP4 was disrupted and deletion of the PEP4 could significantly decrease the PrA activity of S. cerevisiae. 3.3. Knock out of PEP4 regulated the production of biogenic amines Fig. 2. PrA activity of the recombinant strains and their host during fermentation.
3. Results and discussion 3.1. Construction of PrA propeptide deletion mutants PrA propeptide deletion mutant RY1-a1-PEP4 was constructed via homologous recombination. Two primer pairs YZ1/YZ2 and YZ3/YZ4n were designed to verify the deletion of PEP4 gene. As shown in Fig. 1A, the targeted 2.0 kb and 1.6 kb bands were obtained from the genome of RY1-a1-PEP4, but they could not be obtained from the parental strain RY1. Therefore, the recombinant
RY1 and RY1-PEP4 were used for Chinese rice wine fermentation, and the influence of PrA on the biogenic amine production was investigated. As shown in Table 2, the biogenic amine concentration (serotonin, tyramine, putrescine, cadaverine and histamine) in the Chinese rice wines fermented by RY1-PEP4 decreased by 25.5%, from 180.1 mg/L to 134.2 mg/L. Among these, the tyramine, cadaverine and histamine concentrations decreased significantly: by 57.5%, 24.6% and 54.3%, respectively, as compared with the parent strain (Table 2). The concentrations of tyrosine, lysine and histidine also decreased. The main reason for the decrease of biogenic amines may be due to the low concentration of free amino acids in RY1-PEP4 strain.
Table 2 The contents of biogenic amines and amino acids of the recombinant and parent strains. Strains
5-Hydroxytryptophan (mg/mL)
Tyrosine (mg/mL)
Ornithine (mg/mL)
Lysine (mg/mL)
Histidine (mg/mL)
Serotonin (mg/L)
Tyramine (mg/L)
Putrescine (mg/L)
Cadaverine (mg/L)
Histamine (mg/L)
pH
RY1 RY1-a-PEP4 RY1-a-PEP4 RY1-PEP4
0.99 ± 0.05 0.49 ± 0.02 0.51 ± 0.02 0.69 ± 0.02
0.62 ± 0.02 0.19 ± 0.02 0.32 ± 0.02 0.29 ± 0.02
0.68 ± 0.05 0.41 ± 0.03 0.53 ± 0.03 0.43 ± 0.03
0.61 ± 0.04 0.28 ± 0.03 0.31 ± 0.04 0.38 ± 0.04
0.33 ± 0.01 0.21 ± 0.02 0.18 ± 0.02 0.19 ± 0.02
78.1 ± 0.8 48.3 ± 0.6 58.2 ± 0.6 68.2 ± 0.6
41.4 ± 0.5 15.4 ± 0.2 17.6 ± 0.4 17.6 ± 0.4
29.3 ± 0.4 22.6 ± 0.3 25.7 ± 0.3 27.2 ± 0.3
23.2 ± 0.3 14.5 ± 0.3 16.5 ± 0.3 17.5 ± 0.3
8.1 ± 0.1 2.8 ± 0.1 3.4 ± 0.1 3.7 ± 0.1
4.14 ± 0.31 5.00 ± 0.22 5.12 ± 0.22 5.05 ± 0.22
The values are the means of triplicate experiments after 35 days with standard deviations lower than 5%.
211
X. Guo et al. / Food Chemistry 178 (2015) 208–211 Table 3 Concentrations (mg/mL) of biogenic amines and amino acids in fermented rice wine with and without (NH4)2SO4 addition in medium. Condition 5-Hydroxytryptophan Tyrosine (mg/mL) (mg/mL) (NH4)2SO4 0.43 ± 0.03B – 0.99 ± 0.05B
Ornithine (mg/mL)
NDA 0.22 ± 0.02B 0.62 ± 0.02B 0.68 ± 0.05B
Lysine (mg/ Histidine mL) (mg/mL)
Serotonin (mg/L)
NDA NDA 45.2 ± 0.4B 0.61 ± 0.04B 0.33 ± 0.01B 78.1 ± 0.8B
Tyramine (mg/L)
Putrescine (mg/L)
Cadaverine (mg/L)
Histamine (mg/L)
pH
NDA 41.4 ± 0.5B
23.1 ± 0.4B 29.3 ± 0.4B
NDA 23.2 ± 0.3B
NDA 8.1 ± 0.1B
4.78 ± 0.21B 4.14 ± 0.31B
–: without (NH4)2SO4 addition. A ND, not detected. B Data were taken as a mean (n = 3) ± standard deviation calculated from three independent experiments performed in triplicate.
The concentrations of free amino acids indicated the supply of nitrogen source in the medium. The fermentation with (NH4)2SO4 addition in the rice fermentation medium was conducted. As shown at Table 3, the concentrations of tyramine, cadaverine and histamine were not detected with (NH4)2SO4 addition, and the concentrations of corresponding tyrosine, lysine and histidine were also undetected. Our results indicated that the concentrations of free amino acids was decreased when (NH4)2SO4 were added into the medium, perhaps this is because the nitrogen source in the fermentation medium was adequate, which can reduced the proteinase activity of yeast. Amino acid are the precursors of biogenic amines, which can synthesize biogenic amines by the decarboxylation reaction. Although it was difficult to establish a direct connection between amines and amino acids, our results showed that elevated levels of tyramine, cadaverine and histamine correlated with a decrease in tyrosine, lysine and histidine, confirming that higher concentrations of amino acid precursors could result in more biogenic amine production, although the detailed mechanism is not clear. 3.4. Conclusions In conclusion, the removal of PEP4 can decrease the activity of PrA in yeast, and reduce the production of biogenic amines. This is the first demonstration that the PrA activity of yeast can regulate the production of biogenic amines in Chinese rice wine. Our study provides a new strategy for increasing the food safety of Chinese rice wine, and brings new information to the field regarding the regulation of biogenic amines in fermented foods. Acknowledgements This research was financed by the Cheung Kong Scholars and Innovative Research Team Program of the Ministry of Education of China (Grant No. IRT1166), the National High Technology Research and Development Program of China (863Program) (Grant No. 2012AA022108) and the National Science and Technology Support Program under Contract No. 2012BAK17B11-05. References Caruso, M., Fiore, C., Contursi, M., Salzano, G., Paparella, A., & Romano, P. (2002). Formation of biogenic amines as criteria for the selection of wine yeasts. World Journal of Microbiology & Biotechnology, 18, 159–163. Costantini, A., Vaudano, E., Del Prete, V., Danei, M., & Garcia-Moruno, E. (2009). Biogenic amine production by contaminating bacteria found in starter preparations used in winemaking. Journal of Agriculture and Food Chemistry, 57(22), 10664–10669. Gómez-Alonso, S., Hermosín-Gutiérrez, I., & García-Romero, E. (2007). Simultaneous HPLC analysis of biogenic amines, amino acids, and ammonium ion as aminoenone derivatives in wine and beer samples. Journal of Agriculture and Food Chemistry, 55(3), 608–613.
Gueldener, U., Heinisch, J., Koehler, G. J., Voss, D., & Hegemann, J. H. (2002). A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Research, 30, e23. Halász, A., Barátha, A., Simon-Sarkadib, L., & Holzapfel, W. (1994). Biogenic amines and their production by microorganisms in food. Trends in Food Science & Technology, 5, 42–48. Hao, J., Dong, J., Speers, R. A., Shen, W., Shan, L., Fan, W., et al. (2008). Construction of a single PEP4 allele deletion in Saccharomyces carlsbergensis and a preliminary evaluation of its brewing performance. Journal of the Institute of Brewing, 114(4), 322–328. Izquierdo-Pulido, M., Font-Fábregas, J., & Vidal-Carou, C. (1995). Influence of Saccharomyces cerevisiae var. uvarum on histamine and tyramine formation during beer fermentation. Food Chemistry, 54, 51–54. Kirschbaum, J., Rebscher, K., & Brückner, H. (2000). Liquid chromatographic determination of biogenic amines in fermented foods after derivatization with 3,5-dinitrobenzoyl chloride. Journal of Chromatography A, 881(1–2), 517–530. Kondo, H., Yomo, H., Furukubo, S., Fukui, N., Nakatani, K., & Kawasaki, Y. (1999). Advanced method for measuring proteinase A in beer and application to brewing. Journal of the Institute of Brewing, 105(5), 293–300. Lu, J., Dong, J., Wu, D., Chen, Y., Guo, X., Shi, Y., et al. (2012). Construction of recombinant industrial brewer’s yeast with lower diacetyl production and proteinase A activity. European Food Research and Technology, 235, 951–961. Lu, Y., Lu, X., Chen, X., Jiang, M., Li, C., & Dong, M. (2007). A survey of biogenic amines in Chinese rice wines. Food Chemistry, 100, 1424–1428. Medina, K., Boido, E., Fariña, L., Gioia, O., Gomez, M. E., Barquet, M., et al. (2013). Increased flavour diversity of Chardonnay wines by spontaneous fermentation and co-fermentation with Hanseniaspora vineae. Food Chemistry, 141(3), 2513–2521. Pereira, C., Barreto Crespo, M., & San Romao, M. (2001). Evidence for proteolytic activity and biogenic amines production in Lactobacillus curvatus and L. homohiochii. International Journal of Food Microbiology, 68(3), 211–216. Rosi, I., Nannelli, F., & Giovani, G. (2009). Biogenic amine production by Oenococcus oeni during malolactic fermentation of wines obtained using different strains of Saccharomyces cerevisiae. LWT – Food Science and Technology, 42, 525–530. Rothman, J. H., Hunter, C. P., Valls, L. A., & Stevens, T. H. (1986). Overproductioninduced mislocalization of a yeast vacuolar protein allows isolation of its structural gene. Proceedings of the National academy of Sciences of the United States of America, 83(10), 3248–3252. Rupp, S., & Wolf, D. H. (1995). Biogenesis of the yeast vacuole (lysosome). The use of active-site mutants of proteinase yscA to determine the necessity of the enzyme for vacuolar proteinase maturation and proteinase yscB stability. European Journal of Biochemistry, 231, 115–125. Teichert, U., Mechler, B., Müller, H., & Wolf, D. H. (1989). Lysosomal (vacuolar) proteases of yeast are essential catalysts for protein degradation, differentiation, and cell survival. Journal of Biological Chemistry, 264(27), 16037–16045. Torrea, D., & Ancín, C. (2001). Influence of yeast strain on biogenic amines content in wines: Relationship with the utilization of amino acids during fermentation. American Journal of Enology and Viticulture, 52, 185–190. Wu, D. G., Guo, X. W., Lu, J., Sun, X., Li, F., & Chen, Y. F. (2013). A rapid and efficient one-step site-directed deletion, insertion, and substitution mutagenesis protocol. Analytical Biochemistry, 434(2), 254–258. Zhang, F., Xue, J., Wang, D., Wang, Y., Zou, H., & Zhu, B. (2013). Dynamic changes of the content of biogenic amines in Chinese rice wine during the brewing process. Journal of the Institute of Brewing. http://dx.doi.org/10.1002/jib.93. Zhang, J. W., Zhang, C. Y., Dai, L. H., Dong, J., Liu, Y. L., Guo, X. W., et al. (2012). Effects of overexpression of the alcohol acetyltransferase encoding gene ATF1 and disruption of the esterase-encoding gene IAH1 on the flavour profiles of Chinese yellow rice wine. The International Journal of Food Science and Technology, 47, 2590–2596. Zhong, J. J., Ye, X. Q., Fang, Z. X., Xie, G. F., Liao, N. B., Shu, J., et al. (2012). Determination of biogenic amines in semi-dry and semi-sweet Chinese rice wines from the Shaoxing region. Food Control, 28, 151–156.
Contents lists available at ScienceDirect
Food Chemistry journal homepage: www.elsevier.com/locate/foodchem
Short communication
Reduction of biogenic amines production by eliminating the PEP4 gene in Saccharomyces cerevisiae during fermentation of Chinese rice wine Xuewu Guo, Xiangyu Guan, Yazhou Wang, Lina Li, Deguang Wu, Yefu Chen, Huadong Pei, Dongguang Xiao ⇑ Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education, Tianjin Industrial Microbiology Key Lab, College of Biotechnology, Tianjin University of Science and Technology, No 29, 13ST. TEDA, Tianjin 300457, China
a r t i c l e
i n f o
Article history: Received 9 September 2014 Received in revised form 10 December 2014 Accepted 19 January 2015 Available online 24 January 2015 Keywords: Biogenic amines Proteinase A (PrA) PEP4 Yeast
a b s t r a c t Biogenic amines in Chinese rice wine have a potential threat of toxicity to human health. In this study, PEP4 gene in Saccharomyces cerevisiae was knocked out in order to evaluate its effect on biogenic amines production; the enzyme encodes proteinase A (PrA), an enzyme that is responsible for the production of free amino acids. It was found that compared to the wild type strain, the PrA activity and amino acid concentration decreased significantly, and the production of biogenic amines in this knockout strain decreased by 25.5%, from 180.1 mg/L to 134.2 mg/L. Especially, tyramine, cadaverine and histamine concentrations were also decreased by 57.5%, 24.6% and 54.3%, respectively. The main reason for the decrease of biogenic amines may be due to the low concentration of free amino acids. Our results provide a new strategy to minimize the biogenic amine production during fermentation of Chinese rice wine. Ó 2015 Elsevier Ltd. All rights reserved.
1. Introduction Biogenic amines are low molecular weight nitrogenous organic bases that have been identified as the toxicological agents in a number of foods such as fish products, cheese, meat, and wine (Lu et al., 2007; Zhong et al., 2012). Some individuals are sensitive to biogenic amines, resulting in symptoms resembling an allergic reaction. The main biogenic amines in Chinese rice wine are serotonin, tyramine, putrescine, cadaverine and histamine (Lu et al., 2007; Zhong et al., 2012). Biogenic amines are synthesized by the decarboxylation reaction of free amino acids by amino acid decarboxylases (Halász, Barátha, Simon-Sarkadib, & Holzapfel, 1994; Kirschbaum, Rebscher, & Brückner, 2000). The factors that govern the formation of biogenic amines include: the presence of an amino acid decarboxylase, free amino acid substrates, and appropriate reaction conditions (Pereira, Barreto Crespo, & San Romao, 2001). Many researchers have shown that lactic acid bacteria in fermented food can produce biogenic amines, however others have shown that biogenic amine synthesis is a complicated process requiring yeast. (Caruso et al., 2002; Costantini, Vaudano, Del Prete, Danei, & Garcia-Moruno, 2009; Rosi, Nannelli, & Giovani, 2009; Torrea &
⇑ Corresponding author. Tel.: +86 022 60601667. E-mail address: [email protected] (D. Xiao). http://dx.doi.org/10.1016/j.foodchem.2015.01.089 0308-8146/Ó 2015 Elsevier Ltd. All rights reserved.
Ancín, 2001). Costantini et al. (2009) reported that two yeasts (Saccharomyces cerevisiae commercial starters A and D) can produce tyramine and histamine during alcoholic fermentation of grape juice. Interestingly, compared to Saccharomyces pure cultures, the production of biogenic amines was decreased when non-Saccharomyces and spontaneous mixed culture was used in wine fermentation (Medina et al., 2013). The role of bacteria or yeast in the formation of biogenic amines is still unclear (Caruso et al., 2002; Izquierdo-Pulido, Font-Fábregas, & Vidal-Carou, 1995; Rosi et al., 2009). Chinese rice wine is one of the most popular alcoholic beverages in China, which has a long history of brewing this fermented alcoholic beverage. Chinese rice wine is rich in amino acids, oligosaccharides and microelements (Zhong et al., 2012). The fermentation process of the rice wine is a process involving several microorganisms (Zhang et al., 2013), and the biogenic amine concentration is elevated in this wine. PrA (EC 3.4.23.25), encoded by PEP4 in S. cerevisiae, is the most important and massive proteolytic enzyme in yeast (Rothman, Hunter, Valls, & Stevens, 1986; Rupp & Wolf, 1995). During beer production, yeast cells release PrA, which breaks down proteins resulting in abundant amino acids in beer (Teichert, Mechler, Mülle, & Wolf, 1989). Many studies have shown that the deletion of PEP4 gene in industrial brewer’s yeast helps beer maintain foam stability, as this decreases the concentration of PrA (Hao et al., 2008; Lu et al., 2012).
209
X. Guo et al. / Food Chemistry 178 (2015) 208–211
In this study, the PEP4 gene in S. cerevisiae was knocked out, and the biogenic amine production in the Chinese rice wine fermented using these yeast was monitored. The PrA activity of the recombinant industrial brewer’s yeast strain was also monitored, as well as the amino acid concentration in fermentation broth. 2. Materials and methods 2.1. Strains and plasmids All strains and plasmid used in this study are listed in Table 1. The plasmid pUC-ABK, constructed previously, was used as the original vector (Wu et al., 2013), and contained A and B fragments from the upstream and downstream prosequence of PEP4, respectively, and a drug-resistance gene, KanMX from pUG6 (Gueldener, Heinisch, Koehler, Voss, & Hegemann, 2002). The following primers were used for the amplification of DNA fragments via polymerase chain reaction (PCR): for the PEP4 open reading frame (ORF), A-up (CCCAAGCTTCGCTGCTATTTATTCATTCCACC; the Hind III restriction site is underlined) and B-down (CGAGCTCTGGTAGCCTCAGCGAA GTCT; the Sac I restriction site is underlined); and for the Kan ORF, KpnI-Kan-ORF-F (CGGGGTACCCAGCTGAAGCTTCGTACGC; the KpnI restriction site is underlined) and KpnI-Kan-ORF-R (CGGGGTACCGCATAGGCCACTAGTGGATCTG; the KpnI restriction site is underlined). 2.2. Media and culture conditions Yeast were routinely cultured at 28 °C in yeast extract peptone dextrose (YEPD) medium [2% glucose, 2% peptone (Difco) and 1% yeast extract] for growth, and in wort medium (prepared by treating freshly smashed malt with water at 65 °C for 30 min and adjusting the sugar content to 12 °Bx) for cell culture. For the selection of yeast transformants, 100 mg/mL G418 was added to a final concentration of 0.24 mg/mL. 2.3. Fermentation experiments The fermentation experiments were conducted using a previously described method (Zhang et al., 2012). A total of 100 g rice was dipped in water for 72 h at 25–30 °C. The dipped-rice was washed, and then cooked 20–30 min. The cooked rice was cooled at room temperature, and then transferred into 500 mL flasks. Finally, 10 g mature wheat koji, 105 mL water (consisting of 60 mL clean water and 45 mL serofluid) and 10 mL secondpreculture of yellow rice wine yeast were added into the flasks. (NH4)2SO4 was added in the rice fermentation medium with need. The pH of the rice fermentation medium with the addition of (NH4)2SO4 was adjusted to consist with before 1 M NaOH and
1 M HCl. The mixture was initially fermented at 28 °C for 5 days and then continuously fermented at 16 °C for 30 days. 2.4. Yeast transformation and screening The DNA fragment of PEP4 A-loxP-KanMX-loxP-PEP4 R was amplified and transformed into RY1. The fragment was integrated into the chromosome at the PEP4 locus of RY1 by homologous recombination to construct single PEP4 allele disruption. The transformants were screened on G418 selective plates after transformation and verified by polymerase chain reaction (PCR) using primer pairs YZ1/YZ2 (GTTAGCTCACTCATTAGGCA/GACTTTTGCAGC AACTTGGT) and YZ3/YZ4 (GTTAGCTCACTCATTAGGCA/CGCTGCTATTTATTCATTCCACC). The KanMX gene was excised from RY1-a-PEP4-K and RY1-a-PEP4, and obtained using the Cre-loxP recombination system. The recombinant diploid RY1-PEP4 was obtained after the fusion of the purified RY1-aPEP4-K and RY1-a-PEP4-K haploid recombinants and verified using the same method as the haploid. 2.5. Analytical methods PrA activity was assayed by a fluorescent method (Kondo et al., 1999). One unit of PrA will hydrolyze 1 mg of insulin chain B (oxidized) per minute at pH 6.0 (25 °C). Biogenic amines and amino acids were determined by a liquid chromatographic method as described by Lu et al. (2007) and Gómez-Alonso, HermosínGutiérrez, and García-Romero (2007) with some modified. Briefly, 1 mL rice wine sample and 200 lL NaHCO3 saturated solution, 20 lL NaOH solution (2 M), 2 mL dansyl chloride (10 mg/mL) were mixed, and the mixture was incubated in a water bath at 70 °C for 10 min, then 1 mL ammonia water (50 mg ammonia dissolved in water) was added to terminate the reaction. After centrifugation at 3000 rpm for 10 min, the supernatant were filtered by 45 lm filter, then the sample was analyzed by HPLC (Agilent 1100 series equipped with diode array detector, Waters-Atlantisd C18 (46 250 mm, 5 lm)). The C18 column was equilibrated at 30 °C with a mobile phase consisting of 55% methanol and 45% water. For amino acids determined, 1 mL rice wine sample, 1.75 mL of borate buffer 1 M (pH 9), 750 lL of methanol, 1 mL of target sample without any pretreatment, 20 lL of internal standard (L-2-aminoadipic acid, 1 g/L), and 30 lL of DEEMM were mixed in a screwcap test tube over 30 min in an ultrasound bath. The mixture was then heated at 70 °C for 2 h. The Agilent 1100 series equipped with array photodiode detector, Waters-Atlantisd C18 (46 250 mm, 5 lm) was used. The analyses were performed in triplicate. A gradient elution system with a mixture of A (25 mM acetate buffer pH = 5.8 with 0.02% sodium azide) and B (80:20 mixture of acetonitrile and methanol) was used.
Table 1 Strains and plasmid used in this study. Strain or plasmid
Relevant characteristic
Reference or source
Saccharomyces cerevisiae industrial strains RY1 RY1-a1 RY1-a2
Commercial yellow rice wine yeast strain Haploid yeast strain from RY1, a mating type Haploid yeast strain from RY1, a mating type
Zhang et al. (2012) This work This work
Transformants RY1-a-PEP4 RY1-a-PEP4 RY1-a-PEP4-K RY1-a-PEP4-K RY1-PEP4
PEP4::pABK, haploid yeast strain, a mating type PEP4::pABK, haploid yeast strain, a mating type PEP4::loxp, haploid yeast strain, a mating type PEP4::loxp, haploid yeast strain, a mating type The fusion of RY1-a1-PEP4-K and RY1-a2-PEP4-K
This This This This This
Plasmids pUC-ABK
Kanr, containing PEP4 A- loxP - KanMX-loxP - PEP4 R
Wu et al. (2013)
work work work work work
210
X. Guo et al. / Food Chemistry 178 (2015) 208–211
Fig. 1. PCR verification of the yeast recombinant strains and identification for KanMX losing. (A) M: marker DL 5000; DNA templates: M: DL5000; 2, 4, 6, 8: RY1-a1-PEP4/YZA, YZ-B, A-KanMX-B, KanMX; 3, 5, 7, 9: RY1/YZ-A, YZ-B, A-KanMX-B, KanMX; (B) M: DL5000 DNA Marker; 2: RY1-a1-PEP4; 3: RY1-a1-PEP4-K.
cassette A-KanMX-B fragment was successfully inserted into the locus of prosequence of PEP4 and the prosequence was replaced by KanMX. In addition, the KanMX gene was excised from the mutant strain RY1-a1-PEP4 and the final mutant strain RY1-a1PEP4-K was obtained and identified by PCR (Fig. 1B). 3.2. Determination of enzyme activity of proteinase A The intracellular and extracellular PrA activities of mutant strains were measured under the same conditions. As shown in Fig. 2, the intracellular and extracellular PrA activity of the recombinant RY1-PEP4 was 0.43 10 5 U/mg and 0.31 10 5 U/mL, which decreased by 96% and 97%, respectively, compared with the parental strain RY-1. These results confirmed that PEP4 was disrupted and deletion of the PEP4 could significantly decrease the PrA activity of S. cerevisiae. 3.3. Knock out of PEP4 regulated the production of biogenic amines Fig. 2. PrA activity of the recombinant strains and their host during fermentation.
3. Results and discussion 3.1. Construction of PrA propeptide deletion mutants PrA propeptide deletion mutant RY1-a1-PEP4 was constructed via homologous recombination. Two primer pairs YZ1/YZ2 and YZ3/YZ4n were designed to verify the deletion of PEP4 gene. As shown in Fig. 1A, the targeted 2.0 kb and 1.6 kb bands were obtained from the genome of RY1-a1-PEP4, but they could not be obtained from the parental strain RY1. Therefore, the recombinant
RY1 and RY1-PEP4 were used for Chinese rice wine fermentation, and the influence of PrA on the biogenic amine production was investigated. As shown in Table 2, the biogenic amine concentration (serotonin, tyramine, putrescine, cadaverine and histamine) in the Chinese rice wines fermented by RY1-PEP4 decreased by 25.5%, from 180.1 mg/L to 134.2 mg/L. Among these, the tyramine, cadaverine and histamine concentrations decreased significantly: by 57.5%, 24.6% and 54.3%, respectively, as compared with the parent strain (Table 2). The concentrations of tyrosine, lysine and histidine also decreased. The main reason for the decrease of biogenic amines may be due to the low concentration of free amino acids in RY1-PEP4 strain.
Table 2 The contents of biogenic amines and amino acids of the recombinant and parent strains. Strains
5-Hydroxytryptophan (mg/mL)
Tyrosine (mg/mL)
Ornithine (mg/mL)
Lysine (mg/mL)
Histidine (mg/mL)
Serotonin (mg/L)
Tyramine (mg/L)
Putrescine (mg/L)
Cadaverine (mg/L)
Histamine (mg/L)
pH
RY1 RY1-a-PEP4 RY1-a-PEP4 RY1-PEP4
0.99 ± 0.05 0.49 ± 0.02 0.51 ± 0.02 0.69 ± 0.02
0.62 ± 0.02 0.19 ± 0.02 0.32 ± 0.02 0.29 ± 0.02
0.68 ± 0.05 0.41 ± 0.03 0.53 ± 0.03 0.43 ± 0.03
0.61 ± 0.04 0.28 ± 0.03 0.31 ± 0.04 0.38 ± 0.04
0.33 ± 0.01 0.21 ± 0.02 0.18 ± 0.02 0.19 ± 0.02
78.1 ± 0.8 48.3 ± 0.6 58.2 ± 0.6 68.2 ± 0.6
41.4 ± 0.5 15.4 ± 0.2 17.6 ± 0.4 17.6 ± 0.4
29.3 ± 0.4 22.6 ± 0.3 25.7 ± 0.3 27.2 ± 0.3
23.2 ± 0.3 14.5 ± 0.3 16.5 ± 0.3 17.5 ± 0.3
8.1 ± 0.1 2.8 ± 0.1 3.4 ± 0.1 3.7 ± 0.1
4.14 ± 0.31 5.00 ± 0.22 5.12 ± 0.22 5.05 ± 0.22
The values are the means of triplicate experiments after 35 days with standard deviations lower than 5%.
211
X. Guo et al. / Food Chemistry 178 (2015) 208–211 Table 3 Concentrations (mg/mL) of biogenic amines and amino acids in fermented rice wine with and without (NH4)2SO4 addition in medium. Condition 5-Hydroxytryptophan Tyrosine (mg/mL) (mg/mL) (NH4)2SO4 0.43 ± 0.03B – 0.99 ± 0.05B
Ornithine (mg/mL)
NDA 0.22 ± 0.02B 0.62 ± 0.02B 0.68 ± 0.05B
Lysine (mg/ Histidine mL) (mg/mL)
Serotonin (mg/L)
NDA NDA 45.2 ± 0.4B 0.61 ± 0.04B 0.33 ± 0.01B 78.1 ± 0.8B
Tyramine (mg/L)
Putrescine (mg/L)
Cadaverine (mg/L)
Histamine (mg/L)
pH
NDA 41.4 ± 0.5B
23.1 ± 0.4B 29.3 ± 0.4B
NDA 23.2 ± 0.3B
NDA 8.1 ± 0.1B
4.78 ± 0.21B 4.14 ± 0.31B
–: without (NH4)2SO4 addition. A ND, not detected. B Data were taken as a mean (n = 3) ± standard deviation calculated from three independent experiments performed in triplicate.
The concentrations of free amino acids indicated the supply of nitrogen source in the medium. The fermentation with (NH4)2SO4 addition in the rice fermentation medium was conducted. As shown at Table 3, the concentrations of tyramine, cadaverine and histamine were not detected with (NH4)2SO4 addition, and the concentrations of corresponding tyrosine, lysine and histidine were also undetected. Our results indicated that the concentrations of free amino acids was decreased when (NH4)2SO4 were added into the medium, perhaps this is because the nitrogen source in the fermentation medium was adequate, which can reduced the proteinase activity of yeast. Amino acid are the precursors of biogenic amines, which can synthesize biogenic amines by the decarboxylation reaction. Although it was difficult to establish a direct connection between amines and amino acids, our results showed that elevated levels of tyramine, cadaverine and histamine correlated with a decrease in tyrosine, lysine and histidine, confirming that higher concentrations of amino acid precursors could result in more biogenic amine production, although the detailed mechanism is not clear. 3.4. Conclusions In conclusion, the removal of PEP4 can decrease the activity of PrA in yeast, and reduce the production of biogenic amines. This is the first demonstration that the PrA activity of yeast can regulate the production of biogenic amines in Chinese rice wine. Our study provides a new strategy for increasing the food safety of Chinese rice wine, and brings new information to the field regarding the regulation of biogenic amines in fermented foods. Acknowledgements This research was financed by the Cheung Kong Scholars and Innovative Research Team Program of the Ministry of Education of China (Grant No. IRT1166), the National High Technology Research and Development Program of China (863Program) (Grant No. 2012AA022108) and the National Science and Technology Support Program under Contract No. 2012BAK17B11-05. References Caruso, M., Fiore, C., Contursi, M., Salzano, G., Paparella, A., & Romano, P. (2002). Formation of biogenic amines as criteria for the selection of wine yeasts. World Journal of Microbiology & Biotechnology, 18, 159–163. Costantini, A., Vaudano, E., Del Prete, V., Danei, M., & Garcia-Moruno, E. (2009). Biogenic amine production by contaminating bacteria found in starter preparations used in winemaking. Journal of Agriculture and Food Chemistry, 57(22), 10664–10669. Gómez-Alonso, S., Hermosín-Gutiérrez, I., & García-Romero, E. (2007). Simultaneous HPLC analysis of biogenic amines, amino acids, and ammonium ion as aminoenone derivatives in wine and beer samples. Journal of Agriculture and Food Chemistry, 55(3), 608–613.
Gueldener, U., Heinisch, J., Koehler, G. J., Voss, D., & Hegemann, J. H. (2002). A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Research, 30, e23. Halász, A., Barátha, A., Simon-Sarkadib, L., & Holzapfel, W. (1994). Biogenic amines and their production by microorganisms in food. Trends in Food Science & Technology, 5, 42–48. Hao, J., Dong, J., Speers, R. A., Shen, W., Shan, L., Fan, W., et al. (2008). Construction of a single PEP4 allele deletion in Saccharomyces carlsbergensis and a preliminary evaluation of its brewing performance. Journal of the Institute of Brewing, 114(4), 322–328. Izquierdo-Pulido, M., Font-Fábregas, J., & Vidal-Carou, C. (1995). Influence of Saccharomyces cerevisiae var. uvarum on histamine and tyramine formation during beer fermentation. Food Chemistry, 54, 51–54. Kirschbaum, J., Rebscher, K., & Brückner, H. (2000). Liquid chromatographic determination of biogenic amines in fermented foods after derivatization with 3,5-dinitrobenzoyl chloride. Journal of Chromatography A, 881(1–2), 517–530. Kondo, H., Yomo, H., Furukubo, S., Fukui, N., Nakatani, K., & Kawasaki, Y. (1999). Advanced method for measuring proteinase A in beer and application to brewing. Journal of the Institute of Brewing, 105(5), 293–300. Lu, J., Dong, J., Wu, D., Chen, Y., Guo, X., Shi, Y., et al. (2012). Construction of recombinant industrial brewer’s yeast with lower diacetyl production and proteinase A activity. European Food Research and Technology, 235, 951–961. Lu, Y., Lu, X., Chen, X., Jiang, M., Li, C., & Dong, M. (2007). A survey of biogenic amines in Chinese rice wines. Food Chemistry, 100, 1424–1428. Medina, K., Boido, E., Fariña, L., Gioia, O., Gomez, M. E., Barquet, M., et al. (2013). Increased flavour diversity of Chardonnay wines by spontaneous fermentation and co-fermentation with Hanseniaspora vineae. Food Chemistry, 141(3), 2513–2521. Pereira, C., Barreto Crespo, M., & San Romao, M. (2001). Evidence for proteolytic activity and biogenic amines production in Lactobacillus curvatus and L. homohiochii. International Journal of Food Microbiology, 68(3), 211–216. Rosi, I., Nannelli, F., & Giovani, G. (2009). Biogenic amine production by Oenococcus oeni during malolactic fermentation of wines obtained using different strains of Saccharomyces cerevisiae. LWT – Food Science and Technology, 42, 525–530. Rothman, J. H., Hunter, C. P., Valls, L. A., & Stevens, T. H. (1986). Overproductioninduced mislocalization of a yeast vacuolar protein allows isolation of its structural gene. Proceedings of the National academy of Sciences of the United States of America, 83(10), 3248–3252. Rupp, S., & Wolf, D. H. (1995). Biogenesis of the yeast vacuole (lysosome). The use of active-site mutants of proteinase yscA to determine the necessity of the enzyme for vacuolar proteinase maturation and proteinase yscB stability. European Journal of Biochemistry, 231, 115–125. Teichert, U., Mechler, B., Müller, H., & Wolf, D. H. (1989). Lysosomal (vacuolar) proteases of yeast are essential catalysts for protein degradation, differentiation, and cell survival. Journal of Biological Chemistry, 264(27), 16037–16045. Torrea, D., & Ancín, C. (2001). Influence of yeast strain on biogenic amines content in wines: Relationship with the utilization of amino acids during fermentation. American Journal of Enology and Viticulture, 52, 185–190. Wu, D. G., Guo, X. W., Lu, J., Sun, X., Li, F., & Chen, Y. F. (2013). A rapid and efficient one-step site-directed deletion, insertion, and substitution mutagenesis protocol. Analytical Biochemistry, 434(2), 254–258. Zhang, F., Xue, J., Wang, D., Wang, Y., Zou, H., & Zhu, B. (2013). Dynamic changes of the content of biogenic amines in Chinese rice wine during the brewing process. Journal of the Institute of Brewing. http://dx.doi.org/10.1002/jib.93. Zhang, J. W., Zhang, C. Y., Dai, L. H., Dong, J., Liu, Y. L., Guo, X. W., et al. (2012). Effects of overexpression of the alcohol acetyltransferase encoding gene ATF1 and disruption of the esterase-encoding gene IAH1 on the flavour profiles of Chinese yellow rice wine. The International Journal of Food Science and Technology, 47, 2590–2596. Zhong, J. J., Ye, X. Q., Fang, Z. X., Xie, G. F., Liao, N. B., Shu, J., et al. (2012). Determination of biogenic amines in semi-dry and semi-sweet Chinese rice wines from the Shaoxing region. Food Control, 28, 151–156.
