Article pubs.acs.org/JAFC
Reduction of the Off-Flavor Volatile Generated by the Yogurt Starter Culture Including Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus in Soymilk Daisuke Kaneko,* Toshinori Igarashi, and Kenji Aoyama Research and Development Division, Kikkoman Corporation, 399 Noda, Noda, Chiba 278-0037, Japan ABSTRACT: Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus establish a symbiotic relationship in milk; however, S. thermophilus predominantly grows in soymilk. This study determined that excess diacetyl was notably generated mainly by S. thermophilus in soymilk, and this flavor compound created an unpleasant odor in fermented soymilk. The addition of L-valine to soymilk reduced the amount of diacetyl and increased the levels of acetoin during fermentation by S. thermophilus. In addition, it was found that the expression of the ilvC gene was repressed and that of the als and aldB genes was stimulated in S. thermophilus by L-valine. Sensory evaluations with the triangle difference test and a preference test showed that the soymilk fermented with L-valine was significantly preferred compared with that without L-valine. In this study, we successfully controlled the metabolic flux of S. thermophilus in soymilk and produced more favorable fermented soymilk without the use of genetically modified lactic acid bacteria strains. KEYWORDS: milk, soymilk, fermentation, yogurt, volatile, aroma, off-flavor, headspace, GC-MS, diacetyl, 2,3-pentanedione, acetaldehyde, acetoin, L-valine, Streptococcus thermophilus, Lactobacillus delbrueckii subsp. bulgaricus
■
INTRODUCTION Soybeans (Glycine max) contain abundant plant-derived proteins, isoflavones, and other high nutritional ingredients such as saponin and phytic acid. This is one of the reasons why soybean products, such as soymilk and tofu, are important protein sources and have been favorably consumed, particularly in Asia, for a long time.1 Recently, many studies have reported that these soybean products have high nutritional value and are beneficial to consumers due to their hypolipidemic, anticholesterolemic, and counter-atherogenic properties and reduced allergenicity.2,3 In addition to soymilk itself, fermented soymilk generated with lactic acid bacteria was focused on due to beneficial functionalities such as preventing hepatic lipid accumulation in rats,4 modulating cholesterol metabolism in rats fed a high-cholesterol diet,5 and possibly enhancing anticancer activity.6 Previous studies have shown that the bioavailability of isoflavones is more effective and isoflavones are better absorbed into fermented soymilk compared with unfermented soymilk because fermented soymilk contains more isoflavone aglycone than isoflavone glucoside due to βglucosidase activity in some lactic acid bacteria.7,8 In addition, the lactic acid bacteria used for the fermentation of soymilk could have beneficial functions for consumers as probiotics. Despite the fact that fermented soymilk has several benefits for consumers, it has not yet been widely accepted due to its off-flavors. In many plants, the off-flavors are believed to be generated by various aldehydes known as C6-aldehydes or green leaf volatiles.9 One of the major green leaf volatiles in soymilk has been identified as hexanal, which is derived from the oxidation of linoleic acid and lipoxygenase activities.10 Previously, many studies have reported methodologies for lowering off-flavor-related volatiles in soymilk itself.11−13 For instance, genetically modified soybean, which lacks lipoxygenase genes and has improved breeding technology, has © 2014 American Chemical Society
been developed to produce soymilk with a reduced beany flavor. In addition, recent improvements in the manufacturing process have made it possible to produce more favorable soymilk. However, fermented soymilk produced by lactic acid bacteria used for yogurt, Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus, has a less desirable flavor than fermented milk. Therefore, the aim of this study was to (i) find the major different flavors between fermented milk and fermented soymilk produced by the yogurt bacteria, S. thermophilus and L. delbrueckii subsp. bulgaricus, using commercially available yogurt starter culture, (ii) to investigate which flavor compounds differ between milk and soymilk and which contribute to the off-flavors in fermented soymilk by both lactic acid bacteria, and (iii) to determine the method to control the metabolism of the two lactic acid bacteria during fermentation in soymilk in order to reduce the off-flavor without the use of genetically modified strains.
■
MATERIALS AND METHODS
Chemicals. Diacetyl (2,3-butanedione) and acetoin were obtained from Tokyo Chemical Industry Co., Ltd. (Tokyo, Japan), acetaldehyde was from Wako Pure Chemical Industries, Ltd. (Osaka, Japan), and Lalanine, L-phenylalanine, L-isoleucine, L-methionine, L-lysine, Lthreonine, L-histidine, L-cysteine, L-arginine, L-serine, L-valine, glycine, L-tryptophan, L-glutamine, L-asparagine, L-tyrosine, L-glutamic acid, Lproline, L-aspartic acid, and L-leucine were from Sigma-Aldrich Co. LLC (St. Louis, MO, USA). Casamino acids were from Becton, Dickinson and Company (Franklin Lakes, NJ, USA). Received: Revised: Accepted: Published: 1658
October 17, 2013 January 29, 2014 February 3, 2014 February 3, 2014 dx.doi.org/10.1021/jf404567e | J. Agric. Food Chem. 2014, 62, 1658−1663
Journal of Agricultural and Food Chemistry
Article
Bacterial Cultures and Materials. S. thermophilus NBRC 13957 (National Institute of Technology and Evaluation Biological Resource Center, Chiba, Japan) and the commercially available lactic acid bacteria starter culture, YO-MIX505, from Danisco USA Inc. (Wilmington, DE, USA) were used in this study. The starter culture, which consisted of S. thermophilus and L. delbrueckii subsp. bulgaricus, was freeze-dried and stored at −20 °C and was used according to the manufacturer’s description. S. thermophilus NBRC 13957 was stored at −80 °C in an MRS broth with 30% (v/v) sterile glycerol and was cultured in an MRS broth for 16−24 h at 37 °C. The bacterial cells of S. thermophilus NBRC 13957 were washed twice with saline and were used for subsequent experiments. Commercially available pasteurized milk (Meiji Holdings Co., Ltd., Tokyo, Japan) and commercially available sterilized unprepared soymilk (Kikkoman Corporation, Tokyo, Japan) were used to produce fermented milk and soymilk, respectively. Soymilk whey solution was obtained from sterilized soymilk using a microfiltration module with a pore size of 1.0 μm (Asahi Kasei Chemicals Corp., Tokyo, Japan). Fermentation Conditions. The commercially available starter culture, YO-MIX505, and S. thermophilus NBRC 13957 were cultured at 37 °C for 16 h in all the samples that were used in this study. A total of 128 mg of powdered YO-MIX505 starter was suspended in 5 mL of sterile water, and the 0.05% (v/v) of the starter solution was then inoculated into each sample. Casamino acids were sterilized as a 10% solution and then aseptically added to soymilk whey (final concentrations of 0.05%, 0.1%, and 0.5% (v/v)) before fermentation. Each amino acid solution (100 mM) was sterilized with filtration using 0.2 μm pore size membrane filter unit (Toyo Roshi Kaisha, Ltd., Tokyo, Japan) and then added to the soymilk whey to create a final concentration of 1.0 mM before fermentation. Gas Chromatography and Mass Spectrometry Analysis. Ten grams of fermented soymilk whey samples were weighed into headspace vials, and 5.0 g of fermented soymilk was diluted with 5.0 g of sterile water and added to the headspace vials. Volatiles of each of the fermented products were equilibrated in the vials by heating for 20 min at 60 °C under strong agitation, and they were then injected onto a gas chromatography (GC) column with G1888 Network headspace sampler (Agilent Technologies, Inc., Santa Clara, CA, USA). The concentrations of diacetyl, acetoin, and acetoaldehyde in the fermented samples were quantified with the standard addition method with a HP 5973 mass spectrometry (MS) detector (Hewlett-Packard Company, Palo Alto, CA, USA). Briefly, four samples were prepared in the vials separately; next, each authentic preparation was added to each sample to result in the concentrations of 0, 1, 5, 10, and 20 ppm (v/v). The standard curve was prepared within the relative peak area against the concentration. Isolation and Purification of Bacterial RNA. One milliliter of cultured soymilk whey with S. thermophilus NBRC 13957 was obtained in the middle of the logarithmic growth phase, and 2.0 mL of RNAprotect bacteria reagent (QIAGEN KK, Tokyo, Japan) was added. The cell pellets from the mixture of the cultured soymilk whey and the RNAprotect bacteria reagent were obtained by centrifugation at 8000g and 4 °C for 10 min, and the cell pellets were stored at −20 °C until RNA isolation. The cell pellets were lysed with lysozyme and proteinase K using an RNeasy Kit (QIAGEN KK) as per the manufacturer’s instructions. Subsequently, RNA was isolated by phenol-chloroform extraction using TRIzol reagent (Life Technologies Corporation, Grand Island, NY, USA) in accordance with the manufacturer’s instructions. The quantity and quality of isolated RNA were checked using a ND-1000 photospectrometer (Nanodrop Products, Wilmington, DE, USA), and RNA samples with an A260/ A280 ratio over 1.8 and a clear two-peak (16S and 23S rRNA) pattern were included in the real-time quantitative polymerase chain reaction (RT-qPCR) analysis. cDNA Synthesis and Real-Time Quantitative PCR. A total of 0.5 μg of total RNA was reverse transcribed into cDNA using a PrimeScript RT Reagent Kit (Takara Bio Inc., Shiga, Japan). Briefly, reverse transcription was performed in the Mastercycler gradient (Eppendorf AG, Hamburg, Germany) as follows: 37 °C for 15 min and 85 °C for 5 s in one cycle. The primers for the RT-qPCR were
designed using the Primer 3 software (http://primer3plus.com) and are listed in Table 1. RT-qPCR was performed as per the following
Table 1. Oligonucleotide Sequences Used for PCR gene
primer
sequences (5′-3′)
forward reverse
AAGCACGTAACTGGAATGCTGA GAATAGCGGGCAAAAGCAAG
forward reverse
CGGTGTGAGTGTTGCTGGTT GTCTTGAACTGGGAAGCGTTG
forward reverse
GGCAGTCAAACCACCACAAA GCCACAGGTAACGCTAAAGACA
als
product size 144
aldB
145
ilvC
147
program: initial denaturation at 95 °C for 10 s, which was followed by 40 cycles of amplification at 95 °C for 5 s and at 60 °C for 20 s. The reaction mixture contained 2 μL of the reverse transcription product, 12.5 μL of SYBR Premix Ex Taq II (2×), 0.5 μL of ROX Reference Dye II (Takara Bio Inc.), 0.4 μL of forward primer (10 μM), 0.4 μL of reverse primer (10 μM), and 9.2 μL of RNase-free water. The reverse transcription product was replaced with RNase-free water for negative controls. Individual RT-qPCR was performed in triplicate for each gene. Sensory Evaluation of Fermented Soymilk with Lactic Acid Bacteria. The sensory properties of fermented soymilk were evaluated with a method described previously.14 Briefly, for the triangle difference test, a series of three samples were presented to nine untrained panelists. One sample was fermented soymilk alone; the other two samples were fermented soymilk with 1.0 mM L-valine. For the preference test, two samples with and without 1.0 mM of L-valine were prepared, and 30 untrained assessors selected the preferred sample. In each test, the panelists selected a sample based on sniffing alone. All samples were fermented with S. thermophilus NBRC 13957 at 37 °C for 16 h and were kept at approximately 10 °C. Each fermented soymilk sample was coded with three random digit numbers. Statistical Analysis. The statistical significance of the differences between the experimental groups was determined with a two-tailed Student’s t-test for unpaired data, with P values less than 0.05 considered significant.
■
RESULTS AND DISCUSSION Comparison of the Flavor Components in Fermented Milk and Fermented Soymilk with Commercially Available Starter Culture. S. thermophilus and L. delbrueckii subsp. bulgaricus are defined as yogurt starter strains by Codex Alimentarius. In milk, S. thermophilus grows and produces formic acid, folic acid, and carbon dioxide. L. delbrueckii subsp. bulgaricus, which has high proteolytic activity, grows simultaneously by consuming these organic acids and digests casein to produce peptides and amino acids, which are advantageous for the further growth of S. thermophilus.15,16 These species establish a symbiotic relationship in milk and usually produce flavorful yogurt. However, in soymilk, only S. thermophilus can grow because L. delbrueckii subsp. bulgaricus cannot utilize sucrose, the main carbon source in soymilk. In other words, the mutual stimulation between these species does not occur during fermentation in soymilk. To analyze the flavor difference between fermented milk and fermented soymilk, a commercially available starter culture, which contained only S. thermophilus and L. delbrueckii subsp. bulgaricus, was inoculated in crude unprepared ultrahigh 1659
dx.doi.org/10.1021/jf404567e | J. Agric. Food Chem. 2014, 62, 1658−1663
Journal of Agricultural and Food Chemistry
Article
measured the concentration of diacetyl was produced in a chemically defined medium whose carbon source was sucrose or lactose. The approximate amount of diacetyl generated was detected in both media (data not shown). Therefore, it was suggested that the diacetyl levels generated by S. thermophilus did not depend on the carbon source. Next, we focused on the differences in the nitrogen source between soymilk and milk. Previous reports have shown that S. thermophilus grows in milk by utilizing the peptides and amino acids derived from the proteolysis of casein by L. delbrueckii subsp. bulgaricus. However, the proteolytic activity of L. delbrueckii subsp. bulgaricus would be restricted in soymilk because it has no capability of growing in soymilk due to the carbon source. Therefore, it was hypothesized that free amino acids formed in the hydrolysis of casein are important for regulating the generation of diacetyl by S. thermophilus. On the basis of this hypothesis, we investigated the effects of casamino acid supplementation on the generation of diacetyl. In this experiment, we used soymilk whey instead of soymilk itself because we found that S. thermophilus could grow in soymilk whey and that it generated approximately the same amount of diacetyl compared to that in soymilk itself (data not shown). Therefore, it was suggested that insoluble soy proteins, such as 7S globulin and 11S globulin, were not implicated in the production of diacetyl by S. thermophilus. Ten percent of casamino acid solution was supplemented in the soymilk whey to produce a final concentration of 0.05%, 0.1%, and 0.5%, and diacetyl levels were then investigated in the cultured soymilk whey with S. thermophilus. As a result, the concentration of diacetyl in fermented soymilk whey with 0.05% casamino acids added was significantly decreased compared with that in fermented soymilk alone. In addition, fermented soymilk whey with 0.5% casamino acids had significantly lower diacetyl levels than the others (Figure 2). These results indicated that casamino acids had an effect on diacetyl production during fermentation by S. thermophilus although they were not sources of carbon.
temperature treated milk and sterilized unprepared soymilk with the same fermentation conditions (37 °C, 16 h). The total ion chromatograms of fermented milk and fermented soymilk were obtained with the headspace sampler and GC-MS, as described in the Materials and Methods (Figure 1). Most of the
Figure 1. Total ion chromatograms of (a) fermented milk and (b) fermented soymilk with commercially available starter culture (S. thermophilus and L. delbrueckii subsp. bulgaricus) obtained from headspace gas chromatography−mass spectrometry. The fermentation conditions were the same (37 °C, 16 h). Each number in TIC indicates the following: (1) acetaldehyde, (2) acetone, (3) diacetyl, (4) 2,3-pentanedione, (5) acetoin, and (6) 1-hexanol.
flavors extracted, such as acetaldehyde, diacetyl, and acetoin, were qualitatively similar between fermented milk and fermented soymilk. However, the concentration of diacetyl was higher in fermented soymilk than in fermented milk, and 2,3-pentanedione was detected only in fermented soymilk. These compounds are vicinal diketones, and it is known that diacetyl has a much lower odor threshold than 2,3pentanedione. Although these compounds are responsible for key aromas of dairy products,17,18 the sensory test of this study suggested that the addition of a standard preparation of diacetyl, and not that of 2,3-pentanedione, contributed an unpleasant odor to fermented soymilk. In addition, it was suggested that the balance of the flavor compounds collapsed due to excess diacetyl production in fermented soymilk. In alcoholic beverages such as wine, beer, and Japanese sake, vicinal diketones, particularly diacetyl, contribute to off-flavors above a certain concentration.19−22 We demonstrated that excess diacetyl could be one of the major off-flavors generated with S. thermophilus in fermented soymilk. Influence of the Different Carbon Sources and Nitrogen Sources on Diacetyl Levels after Fermentation by S. thermophilus NBRC 13957 in Milk and Soymilk. To produce flavorful fermented soymilk, we first attempted to determine how diacetyl was excessively produced by S. thermophilus in soymilk. The main carbon sources of milk and soymilk are lactose and sucrose, respectively. Excess diacetyl was not detected in fermented milk. Thus, sucrose may have induced the generation of diacetyl by S. thermophilus. We
Figure 2. Evaluation of the diacetyl concentrations in fermented soymilk whey with each concentration of casamino acid added. The error bars indicate the standard deviations (SD) of the triplicate samples of the experiments. The statistical significance comparing the results from each concentration of casamino acid added to no casamino acid added is indicated (**P < 0.01). The error bars indicate the SD of the triplicate samples of experiments.
Influence of the 20 Essential Amino Acids on Diacetyl Levels after Lactic Acid Fermentation by S. thermophilus. The addition of casamino acids in soymilk whey had some impact on decreasing the diacetyl levels during fermentation. Therefore, to understand which amino acid mainly regulated diacetyl levels, each of the 20 essential amino acids was 1660
dx.doi.org/10.1021/jf404567e | J. Agric. Food Chem. 2014, 62, 1658−1663
Journal of Agricultural and Food Chemistry
Article
separately added to soymilk whey to produce a concentration of 1.0 mM. Of the 20 amino acids added, L-valine had a strong effect on decreasing the diacetyl levels in fermented soymilk whey (Figure 3). L-Cysteine, L-threonine, L-tryptophan, L-
Figure 3. Concentration of diacetyl (mM) in soymilk whey fermented with S. thermophilus in the presence of 1.0 mM of each amino acid. Figure 5. Comparison of the levels of expression of the als (A), aldB (B), and ilvC (C) genes that are involved in the biosynthesis of Lvaline, diacetyl, and acetoin in the presence of 1.0 mM of L-valine. The error bars indicate the SD of triplicate samples of the experiments. The statistical significance of the comparisons of the results for each concentration of L-valine added compared with no L-valine added is indicated (**P < 0.01). The error bars indicate the SD of the triplicate samples of the experiments.
leucine, and L-tyrosine also had small effects on reducing diacetyl. The other amino acids did not any influence diacetyl levels. In previous studies, it has been reported that the supplementation of L-valine regulates the production of diacetyl due to the inhibition of 2-acetolactate synthase and the activation of acetolactate decarboxylase in Escherichia coli.23,24 In addition, Ott et al. suggested an interconnection between the metabolism of L-valine and diacetyl in lactic acid bacteria.25 The results of this study supported the findings of these reports. Gene Expression Analysis of Metabolic Enzymes Related to the L-Valine Metabolic Pathway. Next, to investigate the effects of L-valine on the decline of diacetyl levels in fermented soymilk whey, the levels of expression of the als, aldB, and ilvC genes of S. thermophilus NBRC 13957 were examined with and without L-valine added in the middle of the exponential growth phase. The proposed schematic of the metabolic pathways involved in the biosynthesis of L-valine and diacetyl is shown in Figure 4. First, pyruvate is converted to αacetolactate, which is an unstable compound. Then αacetolactate is decarboxylated to diacetyl in the presence of oxygen without any enzymatic activity. With the addition of 1.0 mM of L-valine, the levels of expression of the als and aldB genes were significantly increased (Figure 5A,B), whereas the levels of expression of the ilvC gene were significantly repressed
(Figure 5C). Acetolactate decarboxylase (aldB) catalyzes the conversion of α-acetolactate to acetoin, and acetohydroxy acid isomeroreductase (ilvC) catalyzes the conversion of αacetolactate to the precursor of valine, 2,3-dihydroxy isovalerate.25 Goupil et al. have shown that diacetyl is accumulated in fermented milk by a Lactococcus lactis aldB mutant, whose acetolactate decarboxylase activity was suppressed, more than that in the wild type.26 On the basis of these results, it was suggested that supplementing L-valine into soymilk whey shifted the metabolic flux to produce more acetoin from α-acetolactate rather than the nonenzymatic oxidation from α-acetolactate to diacetyl in S. thermophilus. Quantification of the Flavor Compounds of Acetaldehyde, Diacetyl, and Acetoin Produced by S. thermophilus with the Supplementation of L-Valine into Soymilk. The expression analysis of this study suggested that the
Figure 4. Proposed schematic of the metabolic pathways involved in the biosynthesis of L-valine and diacetyl from pyruvate. 1661
dx.doi.org/10.1021/jf404567e | J. Agric. Food Chem. 2014, 62, 1658−1663
Journal of Agricultural and Food Chemistry
Article
metabolic flux might shift from the biosynthesis of L-valine to acetoin by the addition of L-valine. In addition, according to the database of the complete genome sequence, S. thermophilus lacks metabolic enzymes of both diacetyl reductase and acetoin reductase, which catalyze the conversion of diacetyl to acetoin and acetoin to 2,3-butanediol, respectively. Therefore, it was hypothesized that acetoin would accumulate in fermented soymilk in response to the addition of L-valine instead of the decline of diacetyl concentration. In addition to acetoin and diacetyl, the concentration of acetaldehyde, which is one of the important flavor compounds in yogurt, was determined in fermented soymilk in response to the addition of L-valine because acetaldehyde is also produced from pyruvate by acetylcoA. Figure 6 shows the concentration of acetaldehyde, diacetyl, and acetoin in fermented soymilk with S. thermophilus in the presence of increasing amounts of L-valine (0.0, 0.5, 1.0, and 5.0 mM). In the presence of L-valine, the concentration of
diacetyl was decreased, whereas acetoin accumulated in fermented soymilk. The concentration of acetaldehyde stayed constant with the addition of L-valine. Chaves et al. have previously shown that the supplementation of the growth medium with L-threonine led to an increase in acetaldehyde production and that the differences in acetaldehyde formation were correlated with the differences in threonine aldolase activity.27 Acetaldehyde is also generated by S. thermophilus through other metabolic pathways from citrate, which is already contained in soymilk itself. These findings suggested that the addition of L-valine had no effect on acetaldehyde production in soymilk. Like diacetyl, acetoin is characterized as having a butter-like aroma and it is important for the flavor of cheese. However, the odor threshold of acetoin is much higher than that of diacetyl. Therefore, fermented soymilk with L-valine added was expected to have fewer off-flavors than the one without L-valine supplementation. Sensory Evaluation. The sensory properties of fermented soymilk were evaluated by an untrained panel of nine assessors with a triangle difference test and 30 assessors with a preference test. The experimental design was outlined in the Materials and Methods. As a result, six of the nine assessors could identify the flavor difference between fermented soymilk with and without L-valine supplementation. This result suggested that these two samples were significantly different. In the preference test, 27 of 30 assessors preferred fermented soymilk with L-valine added for its decreased off-flavor compared to the one without L-valine added. On the basis of the results that were obtained in this study, we suggest that some natural ingredients consisting of highly concentrated branched-chain amino acids, such as powdered sugar beets, could be used for the enrichment of L-valine in soymilk instead of directly adding L-valine. In addition, the supplementation of a little protease (or peptidase)-treated soymilk could have enough L-valine to regulate diacetyl generation by S. thermophilus. Although it is well-known that a small amount of diacetyl is necessary for flavorful dairy yogurt, this study is the first to indicate that diacetyl could contribute an off-flavor in the case of fermented soymilk. Moreover, the present study showed that some metabolisms of lactic acid bacteria were controllable by modifying the amino acid compositions without the use of genetically modified lactic acid bacteria strains.
■
AUTHOR INFORMATION
Corresponding Author
*E-mail: [email protected]. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS We gratefully acknowledge Dr. A. Matsuyama and Dr. N. Kajiyama for their helpful advice and discussions, Y. Shimaoka for the helpful technical assistance, and all the colleagues who participated in the sensory panels.
■
Figure 6. The concentrations of acetaldehyde (A), diacetyl (B), and acetoin (C) in fermented soymilk with S. thermophilus in the presence of increasing amounts of L-valine (0.0, 0.5, 1.0, and 5.0 mM). The statistical significance of the comparisons of the results for each concentration of L-valine added compared with no L-valine added is indicated (*P < 0.05, **P < 0.01). The error bars indicate the SD of the triplicate samples of the experiments.
REFERENCES
(1) Golbitz, P. Traditional soyfoods: processing and products. J. Nutr. 1995, 125, 570S−572S. (2) Messina, M. J.; Persky, V.; Setchell, K. D.; Barnes, S. Soy intake and cancer risk: a review of the in vitro and in vivo data. Nutr. Cancer 1994, 21, 113−131.
1662
dx.doi.org/10.1021/jf404567e | J. Agric. Food Chem. 2014, 62, 1658−1663
Journal of Agricultural and Food Chemistry
Article
(3) Lopez-Lazaro, M.; Akiyama, M. Flavonoids as anticancer agents: structure−activity relationship study. Curr. Med. Chem. Anti- Cancer Agents 2002, 2, 691−714. (4) Kitawaki, R.; Nishimura, Y.; Takagi, N.; Iwasaki, M.; Tsuzuki, K.; Fukuda, M. Effects of Lactobacillus fermented soymilk and soy yogurt on hepatic lipid accumulation in rats fed a cholesterol-free diet. Biosci., Biotchnol., Biochem. 2009, 73 (7), 1484−1488. (5) Kobayashi, M.; Hirahata, R.; Egusa, S.; Fukuda, M. Hypocholesterolemic effects of lactic acid-fermented soymilk on rats fed a high cholesterol diet. Nutrients 2012, 4 (9), 1304−16. (6) Lai, L. R.; Hsieh, S. C.; Huang, H. Y.; Chou, C. C. Effect of lactic fermentation on the total phenolic, saponin and phytic acid contents as well as anti-colon cancer cell proliferation activity of soymilk. J. Biosci. Bioeng. 2013, 115 (5), 552−556. (7) Kano, M.; Takayanagi, T.; Harada, K.; Sawada, S.; Ishikawa, F. Bioavailability of isoflavones after ingestion of soy beverages in healthy adults. J. Nutr. 2006, 136, 2291−2296. (8) Izumi, T.; Piskula, M. K.; Osawa, S.; Obata, A.; Tobe, K.; Saito, M.; Kataoka, S.; Kubota, Y.; Kikuchi, M. Soy Isoflavone Aglycones Are Absorbed Faster and in Higher Amounts than Their Glucosides in Humans. J. Nutr. 2000, Feb, 1695−1699. (9) Mellor, N.; Bligh, F.; Chandler, I.; Hodgman, C. Reduction of Off-Flavor Generation in Soybean Homogenates: A Mathematical Model. J. Food Sci. 2010, 75 (7), R131−138. (10) Feussner, I.; Wasternack, C. The lipoxygenase pathway. Annu. Rev. Plant Biol. 2002, 53, 275−297. (11) Zhang, Y.; Guo, S.; Liu, Z.; Chang, S. K. C. Off-Flavor Related Volatiles in Soymilk As Affected by Soybean Variety, Grinding, and Heat-Processing Methods. J. Agric. Food Chem. 2012, 60, 7457−7462. (12) Lv, Y. C.; Song, H. L.; Li, X.; Wu, L.; Guo, S. T. Influence of blanching and grinding process with hot water on beany and nonbeany flavor in soymilk. J. Food Sci. 2011, Jan-Feb;76 (1), S20−825. (13) Yuan, S. H.; Chang, S. K. Selected odor compounds in cooked soymilk as affected by soybean materials and direct steam injection. J. Food Sci. 2007, Sep;72 (7), S481−S486. (14) Donkor, O. N.; Henriksson, A.; Vasiljevic, T.; Shah, N. P. Rheological Properties and Sensory Characteristics of Set-Type Soy Yogurt. J. Agric. Food Chem. 2007, 55, 9868−9876. (15) Sieuwerts, S.; Molenaar, D.; van Hijum, S. A.; Beerthuyzen, M.; Stevens, M. J. A.; Janssen, P. W. M.; Ingham, C. J.; de Bok, F. A. M.; de Vos, W. M.; van Hylckama; Vlieg, J. E. T. Mixed-culture transcriptome analysis reveals the molecular basis of mixed-culture growth in Streptococcus thermophilus and Lactobacillus bulgaricus. Appl. Environ. Microbiol. 2010, 76 (23), 7775−7784. (16) O’Leary, V. S.; Woychik, J. H. Utilization of lactose, glucose, and galactose by a mixed culture of Strepotoccocus thermophilus and Lactobacillus bulgaricus in milk treated with lactase enzyme. Appl. Environ. Microbiol. 1976, 32 (1), 89−94. (17) Imhof, R.; Glattli, H.; Bosset, J. O. Volatile organic compounds produced by thermophilic and mesophilic single strain dairy starter cultures. Lebensm.-Wiss.-Technol. 1995, 28, 78−86. (18) Ott, A.; Fay, L. B.; Chaintreau, A. Determination and origin of the aroma impact compounds of yogurt flavor. J. Agric. Food Chem. 1997, 45, 850−858. (19) Horie, K.; Oba, T.; Motomura, S.; Isogai, A.; Yoshimura, T.; Tsuge, K.; Koganemaru, K.; Kobayashi, G.; Kitagaki, H. Breeding of a low pyruvate-producing sake yeast by isolation of a mutant resistant to ethyl α-transcyanocinnamate, an inhibitor of mitochondrial pyruvate transport. Biosci., Biotechnol., Biochem. 2010, 74 (4), 843−847. (20) Hugenholtz, J. Citrate metabolism in lactic acid bacteria. FEMS Microbiol. Rev. 1993, 12, 165−178. (21) Blomqvist, K.; Suihko, M. L.; Knowles, J. K. C.; Penttila, M. E. Chromosomal integration and expression of two bacterial αacetolactate decarboxylase genes in brewer’s yeast. Appl. Environ. Microbiol. 1991, 57, 2796−2803. (22) Dasari, S.; Kölling, R. Cytosolic Localization of Acetohydroxyacid Synthase Ilv2 and Its Impact on Diacetyl Formation during Beer Fermentation. Appl. Environ. Microbiol. 2011, 77 (3), 727−731.
(23) Vyazmensky, M.; Sella, C.; Barak, Z.; Chipman, D. M. Isolation and characterization of subunits of acetohydroxy acid synthase isozyme III and reconstitution of the holoenzyme. Biochemistry 1996, 35, 10339−10346. (24) Phalip, V.; Monnet, C.; Schmitt, P.; Renault, P.; Godon, J. J.; Diviès, C. Purification and properties of the α-acetolactate decarboxylase from Lactococcus lactis subsp. lactis NCDO 2118. FEBS Lett. 1994, 351, 95−99. (25) Ott, A.; Germond, J. E.; Chaintreau, A. Vicinal diketone formation in yogurt: 13C precursors and effect of branched-chain amino acids. J. Agric. Food Chem. 2000, 48 (3), 724−731. (26) Goupil, N.; Corthier, G.; Ehrlich, S. D.; Renault, P. Imbalance of leucine flux in Lactococcus lactis and its use for the isolation of diacetyloverproducing strains. Appl. Environ. Microbiol. 1996, 62 (7), 2636− 2640. (27) Chaves, A.; Fernandez, M.; Lerayer, A.; Mierau, I.; Kleerebezem, M.; Hugenholtz, J. Metabolic Engineering of Acetaldehyde Production by Streptococcus thermophilus. Appl. Environ. Microbiol. 2002, 68 (11), 5656−5662.
1663
dx.doi.org/10.1021/jf404567e | J. Agric. Food Chem. 2014, 62, 1658−1663
Reduction of the Off-Flavor Volatile Generated by the Yogurt Starter Culture Including Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus in Soymilk Daisuke Kaneko,* Toshinori Igarashi, and Kenji Aoyama Research and Development Division, Kikkoman Corporation, 399 Noda, Noda, Chiba 278-0037, Japan ABSTRACT: Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus establish a symbiotic relationship in milk; however, S. thermophilus predominantly grows in soymilk. This study determined that excess diacetyl was notably generated mainly by S. thermophilus in soymilk, and this flavor compound created an unpleasant odor in fermented soymilk. The addition of L-valine to soymilk reduced the amount of diacetyl and increased the levels of acetoin during fermentation by S. thermophilus. In addition, it was found that the expression of the ilvC gene was repressed and that of the als and aldB genes was stimulated in S. thermophilus by L-valine. Sensory evaluations with the triangle difference test and a preference test showed that the soymilk fermented with L-valine was significantly preferred compared with that without L-valine. In this study, we successfully controlled the metabolic flux of S. thermophilus in soymilk and produced more favorable fermented soymilk without the use of genetically modified lactic acid bacteria strains. KEYWORDS: milk, soymilk, fermentation, yogurt, volatile, aroma, off-flavor, headspace, GC-MS, diacetyl, 2,3-pentanedione, acetaldehyde, acetoin, L-valine, Streptococcus thermophilus, Lactobacillus delbrueckii subsp. bulgaricus
■
INTRODUCTION Soybeans (Glycine max) contain abundant plant-derived proteins, isoflavones, and other high nutritional ingredients such as saponin and phytic acid. This is one of the reasons why soybean products, such as soymilk and tofu, are important protein sources and have been favorably consumed, particularly in Asia, for a long time.1 Recently, many studies have reported that these soybean products have high nutritional value and are beneficial to consumers due to their hypolipidemic, anticholesterolemic, and counter-atherogenic properties and reduced allergenicity.2,3 In addition to soymilk itself, fermented soymilk generated with lactic acid bacteria was focused on due to beneficial functionalities such as preventing hepatic lipid accumulation in rats,4 modulating cholesterol metabolism in rats fed a high-cholesterol diet,5 and possibly enhancing anticancer activity.6 Previous studies have shown that the bioavailability of isoflavones is more effective and isoflavones are better absorbed into fermented soymilk compared with unfermented soymilk because fermented soymilk contains more isoflavone aglycone than isoflavone glucoside due to βglucosidase activity in some lactic acid bacteria.7,8 In addition, the lactic acid bacteria used for the fermentation of soymilk could have beneficial functions for consumers as probiotics. Despite the fact that fermented soymilk has several benefits for consumers, it has not yet been widely accepted due to its off-flavors. In many plants, the off-flavors are believed to be generated by various aldehydes known as C6-aldehydes or green leaf volatiles.9 One of the major green leaf volatiles in soymilk has been identified as hexanal, which is derived from the oxidation of linoleic acid and lipoxygenase activities.10 Previously, many studies have reported methodologies for lowering off-flavor-related volatiles in soymilk itself.11−13 For instance, genetically modified soybean, which lacks lipoxygenase genes and has improved breeding technology, has © 2014 American Chemical Society
been developed to produce soymilk with a reduced beany flavor. In addition, recent improvements in the manufacturing process have made it possible to produce more favorable soymilk. However, fermented soymilk produced by lactic acid bacteria used for yogurt, Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus, has a less desirable flavor than fermented milk. Therefore, the aim of this study was to (i) find the major different flavors between fermented milk and fermented soymilk produced by the yogurt bacteria, S. thermophilus and L. delbrueckii subsp. bulgaricus, using commercially available yogurt starter culture, (ii) to investigate which flavor compounds differ between milk and soymilk and which contribute to the off-flavors in fermented soymilk by both lactic acid bacteria, and (iii) to determine the method to control the metabolism of the two lactic acid bacteria during fermentation in soymilk in order to reduce the off-flavor without the use of genetically modified strains.
■
MATERIALS AND METHODS
Chemicals. Diacetyl (2,3-butanedione) and acetoin were obtained from Tokyo Chemical Industry Co., Ltd. (Tokyo, Japan), acetaldehyde was from Wako Pure Chemical Industries, Ltd. (Osaka, Japan), and Lalanine, L-phenylalanine, L-isoleucine, L-methionine, L-lysine, Lthreonine, L-histidine, L-cysteine, L-arginine, L-serine, L-valine, glycine, L-tryptophan, L-glutamine, L-asparagine, L-tyrosine, L-glutamic acid, Lproline, L-aspartic acid, and L-leucine were from Sigma-Aldrich Co. LLC (St. Louis, MO, USA). Casamino acids were from Becton, Dickinson and Company (Franklin Lakes, NJ, USA). Received: Revised: Accepted: Published: 1658
October 17, 2013 January 29, 2014 February 3, 2014 February 3, 2014 dx.doi.org/10.1021/jf404567e | J. Agric. Food Chem. 2014, 62, 1658−1663
Journal of Agricultural and Food Chemistry
Article
Bacterial Cultures and Materials. S. thermophilus NBRC 13957 (National Institute of Technology and Evaluation Biological Resource Center, Chiba, Japan) and the commercially available lactic acid bacteria starter culture, YO-MIX505, from Danisco USA Inc. (Wilmington, DE, USA) were used in this study. The starter culture, which consisted of S. thermophilus and L. delbrueckii subsp. bulgaricus, was freeze-dried and stored at −20 °C and was used according to the manufacturer’s description. S. thermophilus NBRC 13957 was stored at −80 °C in an MRS broth with 30% (v/v) sterile glycerol and was cultured in an MRS broth for 16−24 h at 37 °C. The bacterial cells of S. thermophilus NBRC 13957 were washed twice with saline and were used for subsequent experiments. Commercially available pasteurized milk (Meiji Holdings Co., Ltd., Tokyo, Japan) and commercially available sterilized unprepared soymilk (Kikkoman Corporation, Tokyo, Japan) were used to produce fermented milk and soymilk, respectively. Soymilk whey solution was obtained from sterilized soymilk using a microfiltration module with a pore size of 1.0 μm (Asahi Kasei Chemicals Corp., Tokyo, Japan). Fermentation Conditions. The commercially available starter culture, YO-MIX505, and S. thermophilus NBRC 13957 were cultured at 37 °C for 16 h in all the samples that were used in this study. A total of 128 mg of powdered YO-MIX505 starter was suspended in 5 mL of sterile water, and the 0.05% (v/v) of the starter solution was then inoculated into each sample. Casamino acids were sterilized as a 10% solution and then aseptically added to soymilk whey (final concentrations of 0.05%, 0.1%, and 0.5% (v/v)) before fermentation. Each amino acid solution (100 mM) was sterilized with filtration using 0.2 μm pore size membrane filter unit (Toyo Roshi Kaisha, Ltd., Tokyo, Japan) and then added to the soymilk whey to create a final concentration of 1.0 mM before fermentation. Gas Chromatography and Mass Spectrometry Analysis. Ten grams of fermented soymilk whey samples were weighed into headspace vials, and 5.0 g of fermented soymilk was diluted with 5.0 g of sterile water and added to the headspace vials. Volatiles of each of the fermented products were equilibrated in the vials by heating for 20 min at 60 °C under strong agitation, and they were then injected onto a gas chromatography (GC) column with G1888 Network headspace sampler (Agilent Technologies, Inc., Santa Clara, CA, USA). The concentrations of diacetyl, acetoin, and acetoaldehyde in the fermented samples were quantified with the standard addition method with a HP 5973 mass spectrometry (MS) detector (Hewlett-Packard Company, Palo Alto, CA, USA). Briefly, four samples were prepared in the vials separately; next, each authentic preparation was added to each sample to result in the concentrations of 0, 1, 5, 10, and 20 ppm (v/v). The standard curve was prepared within the relative peak area against the concentration. Isolation and Purification of Bacterial RNA. One milliliter of cultured soymilk whey with S. thermophilus NBRC 13957 was obtained in the middle of the logarithmic growth phase, and 2.0 mL of RNAprotect bacteria reagent (QIAGEN KK, Tokyo, Japan) was added. The cell pellets from the mixture of the cultured soymilk whey and the RNAprotect bacteria reagent were obtained by centrifugation at 8000g and 4 °C for 10 min, and the cell pellets were stored at −20 °C until RNA isolation. The cell pellets were lysed with lysozyme and proteinase K using an RNeasy Kit (QIAGEN KK) as per the manufacturer’s instructions. Subsequently, RNA was isolated by phenol-chloroform extraction using TRIzol reagent (Life Technologies Corporation, Grand Island, NY, USA) in accordance with the manufacturer’s instructions. The quantity and quality of isolated RNA were checked using a ND-1000 photospectrometer (Nanodrop Products, Wilmington, DE, USA), and RNA samples with an A260/ A280 ratio over 1.8 and a clear two-peak (16S and 23S rRNA) pattern were included in the real-time quantitative polymerase chain reaction (RT-qPCR) analysis. cDNA Synthesis and Real-Time Quantitative PCR. A total of 0.5 μg of total RNA was reverse transcribed into cDNA using a PrimeScript RT Reagent Kit (Takara Bio Inc., Shiga, Japan). Briefly, reverse transcription was performed in the Mastercycler gradient (Eppendorf AG, Hamburg, Germany) as follows: 37 °C for 15 min and 85 °C for 5 s in one cycle. The primers for the RT-qPCR were
designed using the Primer 3 software (http://primer3plus.com) and are listed in Table 1. RT-qPCR was performed as per the following
Table 1. Oligonucleotide Sequences Used for PCR gene
primer
sequences (5′-3′)
forward reverse
AAGCACGTAACTGGAATGCTGA GAATAGCGGGCAAAAGCAAG
forward reverse
CGGTGTGAGTGTTGCTGGTT GTCTTGAACTGGGAAGCGTTG
forward reverse
GGCAGTCAAACCACCACAAA GCCACAGGTAACGCTAAAGACA
als
product size 144
aldB
145
ilvC
147
program: initial denaturation at 95 °C for 10 s, which was followed by 40 cycles of amplification at 95 °C for 5 s and at 60 °C for 20 s. The reaction mixture contained 2 μL of the reverse transcription product, 12.5 μL of SYBR Premix Ex Taq II (2×), 0.5 μL of ROX Reference Dye II (Takara Bio Inc.), 0.4 μL of forward primer (10 μM), 0.4 μL of reverse primer (10 μM), and 9.2 μL of RNase-free water. The reverse transcription product was replaced with RNase-free water for negative controls. Individual RT-qPCR was performed in triplicate for each gene. Sensory Evaluation of Fermented Soymilk with Lactic Acid Bacteria. The sensory properties of fermented soymilk were evaluated with a method described previously.14 Briefly, for the triangle difference test, a series of three samples were presented to nine untrained panelists. One sample was fermented soymilk alone; the other two samples were fermented soymilk with 1.0 mM L-valine. For the preference test, two samples with and without 1.0 mM of L-valine were prepared, and 30 untrained assessors selected the preferred sample. In each test, the panelists selected a sample based on sniffing alone. All samples were fermented with S. thermophilus NBRC 13957 at 37 °C for 16 h and were kept at approximately 10 °C. Each fermented soymilk sample was coded with three random digit numbers. Statistical Analysis. The statistical significance of the differences between the experimental groups was determined with a two-tailed Student’s t-test for unpaired data, with P values less than 0.05 considered significant.
■
RESULTS AND DISCUSSION Comparison of the Flavor Components in Fermented Milk and Fermented Soymilk with Commercially Available Starter Culture. S. thermophilus and L. delbrueckii subsp. bulgaricus are defined as yogurt starter strains by Codex Alimentarius. In milk, S. thermophilus grows and produces formic acid, folic acid, and carbon dioxide. L. delbrueckii subsp. bulgaricus, which has high proteolytic activity, grows simultaneously by consuming these organic acids and digests casein to produce peptides and amino acids, which are advantageous for the further growth of S. thermophilus.15,16 These species establish a symbiotic relationship in milk and usually produce flavorful yogurt. However, in soymilk, only S. thermophilus can grow because L. delbrueckii subsp. bulgaricus cannot utilize sucrose, the main carbon source in soymilk. In other words, the mutual stimulation between these species does not occur during fermentation in soymilk. To analyze the flavor difference between fermented milk and fermented soymilk, a commercially available starter culture, which contained only S. thermophilus and L. delbrueckii subsp. bulgaricus, was inoculated in crude unprepared ultrahigh 1659
dx.doi.org/10.1021/jf404567e | J. Agric. Food Chem. 2014, 62, 1658−1663
Journal of Agricultural and Food Chemistry
Article
measured the concentration of diacetyl was produced in a chemically defined medium whose carbon source was sucrose or lactose. The approximate amount of diacetyl generated was detected in both media (data not shown). Therefore, it was suggested that the diacetyl levels generated by S. thermophilus did not depend on the carbon source. Next, we focused on the differences in the nitrogen source between soymilk and milk. Previous reports have shown that S. thermophilus grows in milk by utilizing the peptides and amino acids derived from the proteolysis of casein by L. delbrueckii subsp. bulgaricus. However, the proteolytic activity of L. delbrueckii subsp. bulgaricus would be restricted in soymilk because it has no capability of growing in soymilk due to the carbon source. Therefore, it was hypothesized that free amino acids formed in the hydrolysis of casein are important for regulating the generation of diacetyl by S. thermophilus. On the basis of this hypothesis, we investigated the effects of casamino acid supplementation on the generation of diacetyl. In this experiment, we used soymilk whey instead of soymilk itself because we found that S. thermophilus could grow in soymilk whey and that it generated approximately the same amount of diacetyl compared to that in soymilk itself (data not shown). Therefore, it was suggested that insoluble soy proteins, such as 7S globulin and 11S globulin, were not implicated in the production of diacetyl by S. thermophilus. Ten percent of casamino acid solution was supplemented in the soymilk whey to produce a final concentration of 0.05%, 0.1%, and 0.5%, and diacetyl levels were then investigated in the cultured soymilk whey with S. thermophilus. As a result, the concentration of diacetyl in fermented soymilk whey with 0.05% casamino acids added was significantly decreased compared with that in fermented soymilk alone. In addition, fermented soymilk whey with 0.5% casamino acids had significantly lower diacetyl levels than the others (Figure 2). These results indicated that casamino acids had an effect on diacetyl production during fermentation by S. thermophilus although they were not sources of carbon.
temperature treated milk and sterilized unprepared soymilk with the same fermentation conditions (37 °C, 16 h). The total ion chromatograms of fermented milk and fermented soymilk were obtained with the headspace sampler and GC-MS, as described in the Materials and Methods (Figure 1). Most of the
Figure 1. Total ion chromatograms of (a) fermented milk and (b) fermented soymilk with commercially available starter culture (S. thermophilus and L. delbrueckii subsp. bulgaricus) obtained from headspace gas chromatography−mass spectrometry. The fermentation conditions were the same (37 °C, 16 h). Each number in TIC indicates the following: (1) acetaldehyde, (2) acetone, (3) diacetyl, (4) 2,3-pentanedione, (5) acetoin, and (6) 1-hexanol.
flavors extracted, such as acetaldehyde, diacetyl, and acetoin, were qualitatively similar between fermented milk and fermented soymilk. However, the concentration of diacetyl was higher in fermented soymilk than in fermented milk, and 2,3-pentanedione was detected only in fermented soymilk. These compounds are vicinal diketones, and it is known that diacetyl has a much lower odor threshold than 2,3pentanedione. Although these compounds are responsible for key aromas of dairy products,17,18 the sensory test of this study suggested that the addition of a standard preparation of diacetyl, and not that of 2,3-pentanedione, contributed an unpleasant odor to fermented soymilk. In addition, it was suggested that the balance of the flavor compounds collapsed due to excess diacetyl production in fermented soymilk. In alcoholic beverages such as wine, beer, and Japanese sake, vicinal diketones, particularly diacetyl, contribute to off-flavors above a certain concentration.19−22 We demonstrated that excess diacetyl could be one of the major off-flavors generated with S. thermophilus in fermented soymilk. Influence of the Different Carbon Sources and Nitrogen Sources on Diacetyl Levels after Fermentation by S. thermophilus NBRC 13957 in Milk and Soymilk. To produce flavorful fermented soymilk, we first attempted to determine how diacetyl was excessively produced by S. thermophilus in soymilk. The main carbon sources of milk and soymilk are lactose and sucrose, respectively. Excess diacetyl was not detected in fermented milk. Thus, sucrose may have induced the generation of diacetyl by S. thermophilus. We
Figure 2. Evaluation of the diacetyl concentrations in fermented soymilk whey with each concentration of casamino acid added. The error bars indicate the standard deviations (SD) of the triplicate samples of the experiments. The statistical significance comparing the results from each concentration of casamino acid added to no casamino acid added is indicated (**P < 0.01). The error bars indicate the SD of the triplicate samples of experiments.
Influence of the 20 Essential Amino Acids on Diacetyl Levels after Lactic Acid Fermentation by S. thermophilus. The addition of casamino acids in soymilk whey had some impact on decreasing the diacetyl levels during fermentation. Therefore, to understand which amino acid mainly regulated diacetyl levels, each of the 20 essential amino acids was 1660
dx.doi.org/10.1021/jf404567e | J. Agric. Food Chem. 2014, 62, 1658−1663
Journal of Agricultural and Food Chemistry
Article
separately added to soymilk whey to produce a concentration of 1.0 mM. Of the 20 amino acids added, L-valine had a strong effect on decreasing the diacetyl levels in fermented soymilk whey (Figure 3). L-Cysteine, L-threonine, L-tryptophan, L-
Figure 3. Concentration of diacetyl (mM) in soymilk whey fermented with S. thermophilus in the presence of 1.0 mM of each amino acid. Figure 5. Comparison of the levels of expression of the als (A), aldB (B), and ilvC (C) genes that are involved in the biosynthesis of Lvaline, diacetyl, and acetoin in the presence of 1.0 mM of L-valine. The error bars indicate the SD of triplicate samples of the experiments. The statistical significance of the comparisons of the results for each concentration of L-valine added compared with no L-valine added is indicated (**P < 0.01). The error bars indicate the SD of the triplicate samples of the experiments.
leucine, and L-tyrosine also had small effects on reducing diacetyl. The other amino acids did not any influence diacetyl levels. In previous studies, it has been reported that the supplementation of L-valine regulates the production of diacetyl due to the inhibition of 2-acetolactate synthase and the activation of acetolactate decarboxylase in Escherichia coli.23,24 In addition, Ott et al. suggested an interconnection between the metabolism of L-valine and diacetyl in lactic acid bacteria.25 The results of this study supported the findings of these reports. Gene Expression Analysis of Metabolic Enzymes Related to the L-Valine Metabolic Pathway. Next, to investigate the effects of L-valine on the decline of diacetyl levels in fermented soymilk whey, the levels of expression of the als, aldB, and ilvC genes of S. thermophilus NBRC 13957 were examined with and without L-valine added in the middle of the exponential growth phase. The proposed schematic of the metabolic pathways involved in the biosynthesis of L-valine and diacetyl is shown in Figure 4. First, pyruvate is converted to αacetolactate, which is an unstable compound. Then αacetolactate is decarboxylated to diacetyl in the presence of oxygen without any enzymatic activity. With the addition of 1.0 mM of L-valine, the levels of expression of the als and aldB genes were significantly increased (Figure 5A,B), whereas the levels of expression of the ilvC gene were significantly repressed
(Figure 5C). Acetolactate decarboxylase (aldB) catalyzes the conversion of α-acetolactate to acetoin, and acetohydroxy acid isomeroreductase (ilvC) catalyzes the conversion of αacetolactate to the precursor of valine, 2,3-dihydroxy isovalerate.25 Goupil et al. have shown that diacetyl is accumulated in fermented milk by a Lactococcus lactis aldB mutant, whose acetolactate decarboxylase activity was suppressed, more than that in the wild type.26 On the basis of these results, it was suggested that supplementing L-valine into soymilk whey shifted the metabolic flux to produce more acetoin from α-acetolactate rather than the nonenzymatic oxidation from α-acetolactate to diacetyl in S. thermophilus. Quantification of the Flavor Compounds of Acetaldehyde, Diacetyl, and Acetoin Produced by S. thermophilus with the Supplementation of L-Valine into Soymilk. The expression analysis of this study suggested that the
Figure 4. Proposed schematic of the metabolic pathways involved in the biosynthesis of L-valine and diacetyl from pyruvate. 1661
dx.doi.org/10.1021/jf404567e | J. Agric. Food Chem. 2014, 62, 1658−1663
Journal of Agricultural and Food Chemistry
Article
metabolic flux might shift from the biosynthesis of L-valine to acetoin by the addition of L-valine. In addition, according to the database of the complete genome sequence, S. thermophilus lacks metabolic enzymes of both diacetyl reductase and acetoin reductase, which catalyze the conversion of diacetyl to acetoin and acetoin to 2,3-butanediol, respectively. Therefore, it was hypothesized that acetoin would accumulate in fermented soymilk in response to the addition of L-valine instead of the decline of diacetyl concentration. In addition to acetoin and diacetyl, the concentration of acetaldehyde, which is one of the important flavor compounds in yogurt, was determined in fermented soymilk in response to the addition of L-valine because acetaldehyde is also produced from pyruvate by acetylcoA. Figure 6 shows the concentration of acetaldehyde, diacetyl, and acetoin in fermented soymilk with S. thermophilus in the presence of increasing amounts of L-valine (0.0, 0.5, 1.0, and 5.0 mM). In the presence of L-valine, the concentration of
diacetyl was decreased, whereas acetoin accumulated in fermented soymilk. The concentration of acetaldehyde stayed constant with the addition of L-valine. Chaves et al. have previously shown that the supplementation of the growth medium with L-threonine led to an increase in acetaldehyde production and that the differences in acetaldehyde formation were correlated with the differences in threonine aldolase activity.27 Acetaldehyde is also generated by S. thermophilus through other metabolic pathways from citrate, which is already contained in soymilk itself. These findings suggested that the addition of L-valine had no effect on acetaldehyde production in soymilk. Like diacetyl, acetoin is characterized as having a butter-like aroma and it is important for the flavor of cheese. However, the odor threshold of acetoin is much higher than that of diacetyl. Therefore, fermented soymilk with L-valine added was expected to have fewer off-flavors than the one without L-valine supplementation. Sensory Evaluation. The sensory properties of fermented soymilk were evaluated by an untrained panel of nine assessors with a triangle difference test and 30 assessors with a preference test. The experimental design was outlined in the Materials and Methods. As a result, six of the nine assessors could identify the flavor difference between fermented soymilk with and without L-valine supplementation. This result suggested that these two samples were significantly different. In the preference test, 27 of 30 assessors preferred fermented soymilk with L-valine added for its decreased off-flavor compared to the one without L-valine added. On the basis of the results that were obtained in this study, we suggest that some natural ingredients consisting of highly concentrated branched-chain amino acids, such as powdered sugar beets, could be used for the enrichment of L-valine in soymilk instead of directly adding L-valine. In addition, the supplementation of a little protease (or peptidase)-treated soymilk could have enough L-valine to regulate diacetyl generation by S. thermophilus. Although it is well-known that a small amount of diacetyl is necessary for flavorful dairy yogurt, this study is the first to indicate that diacetyl could contribute an off-flavor in the case of fermented soymilk. Moreover, the present study showed that some metabolisms of lactic acid bacteria were controllable by modifying the amino acid compositions without the use of genetically modified lactic acid bacteria strains.
■
AUTHOR INFORMATION
Corresponding Author
*E-mail: [email protected]. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS We gratefully acknowledge Dr. A. Matsuyama and Dr. N. Kajiyama for their helpful advice and discussions, Y. Shimaoka for the helpful technical assistance, and all the colleagues who participated in the sensory panels.
■
Figure 6. The concentrations of acetaldehyde (A), diacetyl (B), and acetoin (C) in fermented soymilk with S. thermophilus in the presence of increasing amounts of L-valine (0.0, 0.5, 1.0, and 5.0 mM). The statistical significance of the comparisons of the results for each concentration of L-valine added compared with no L-valine added is indicated (*P < 0.05, **P < 0.01). The error bars indicate the SD of the triplicate samples of the experiments.
REFERENCES
(1) Golbitz, P. Traditional soyfoods: processing and products. J. Nutr. 1995, 125, 570S−572S. (2) Messina, M. J.; Persky, V.; Setchell, K. D.; Barnes, S. Soy intake and cancer risk: a review of the in vitro and in vivo data. Nutr. Cancer 1994, 21, 113−131.
1662
dx.doi.org/10.1021/jf404567e | J. Agric. Food Chem. 2014, 62, 1658−1663
Journal of Agricultural and Food Chemistry
Article
(3) Lopez-Lazaro, M.; Akiyama, M. Flavonoids as anticancer agents: structure−activity relationship study. Curr. Med. Chem. Anti- Cancer Agents 2002, 2, 691−714. (4) Kitawaki, R.; Nishimura, Y.; Takagi, N.; Iwasaki, M.; Tsuzuki, K.; Fukuda, M. Effects of Lactobacillus fermented soymilk and soy yogurt on hepatic lipid accumulation in rats fed a cholesterol-free diet. Biosci., Biotchnol., Biochem. 2009, 73 (7), 1484−1488. (5) Kobayashi, M.; Hirahata, R.; Egusa, S.; Fukuda, M. Hypocholesterolemic effects of lactic acid-fermented soymilk on rats fed a high cholesterol diet. Nutrients 2012, 4 (9), 1304−16. (6) Lai, L. R.; Hsieh, S. C.; Huang, H. Y.; Chou, C. C. Effect of lactic fermentation on the total phenolic, saponin and phytic acid contents as well as anti-colon cancer cell proliferation activity of soymilk. J. Biosci. Bioeng. 2013, 115 (5), 552−556. (7) Kano, M.; Takayanagi, T.; Harada, K.; Sawada, S.; Ishikawa, F. Bioavailability of isoflavones after ingestion of soy beverages in healthy adults. J. Nutr. 2006, 136, 2291−2296. (8) Izumi, T.; Piskula, M. K.; Osawa, S.; Obata, A.; Tobe, K.; Saito, M.; Kataoka, S.; Kubota, Y.; Kikuchi, M. Soy Isoflavone Aglycones Are Absorbed Faster and in Higher Amounts than Their Glucosides in Humans. J. Nutr. 2000, Feb, 1695−1699. (9) Mellor, N.; Bligh, F.; Chandler, I.; Hodgman, C. Reduction of Off-Flavor Generation in Soybean Homogenates: A Mathematical Model. J. Food Sci. 2010, 75 (7), R131−138. (10) Feussner, I.; Wasternack, C. The lipoxygenase pathway. Annu. Rev. Plant Biol. 2002, 53, 275−297. (11) Zhang, Y.; Guo, S.; Liu, Z.; Chang, S. K. C. Off-Flavor Related Volatiles in Soymilk As Affected by Soybean Variety, Grinding, and Heat-Processing Methods. J. Agric. Food Chem. 2012, 60, 7457−7462. (12) Lv, Y. C.; Song, H. L.; Li, X.; Wu, L.; Guo, S. T. Influence of blanching and grinding process with hot water on beany and nonbeany flavor in soymilk. J. Food Sci. 2011, Jan-Feb;76 (1), S20−825. (13) Yuan, S. H.; Chang, S. K. Selected odor compounds in cooked soymilk as affected by soybean materials and direct steam injection. J. Food Sci. 2007, Sep;72 (7), S481−S486. (14) Donkor, O. N.; Henriksson, A.; Vasiljevic, T.; Shah, N. P. Rheological Properties and Sensory Characteristics of Set-Type Soy Yogurt. J. Agric. Food Chem. 2007, 55, 9868−9876. (15) Sieuwerts, S.; Molenaar, D.; van Hijum, S. A.; Beerthuyzen, M.; Stevens, M. J. A.; Janssen, P. W. M.; Ingham, C. J.; de Bok, F. A. M.; de Vos, W. M.; van Hylckama; Vlieg, J. E. T. Mixed-culture transcriptome analysis reveals the molecular basis of mixed-culture growth in Streptococcus thermophilus and Lactobacillus bulgaricus. Appl. Environ. Microbiol. 2010, 76 (23), 7775−7784. (16) O’Leary, V. S.; Woychik, J. H. Utilization of lactose, glucose, and galactose by a mixed culture of Strepotoccocus thermophilus and Lactobacillus bulgaricus in milk treated with lactase enzyme. Appl. Environ. Microbiol. 1976, 32 (1), 89−94. (17) Imhof, R.; Glattli, H.; Bosset, J. O. Volatile organic compounds produced by thermophilic and mesophilic single strain dairy starter cultures. Lebensm.-Wiss.-Technol. 1995, 28, 78−86. (18) Ott, A.; Fay, L. B.; Chaintreau, A. Determination and origin of the aroma impact compounds of yogurt flavor. J. Agric. Food Chem. 1997, 45, 850−858. (19) Horie, K.; Oba, T.; Motomura, S.; Isogai, A.; Yoshimura, T.; Tsuge, K.; Koganemaru, K.; Kobayashi, G.; Kitagaki, H. Breeding of a low pyruvate-producing sake yeast by isolation of a mutant resistant to ethyl α-transcyanocinnamate, an inhibitor of mitochondrial pyruvate transport. Biosci., Biotechnol., Biochem. 2010, 74 (4), 843−847. (20) Hugenholtz, J. Citrate metabolism in lactic acid bacteria. FEMS Microbiol. Rev. 1993, 12, 165−178. (21) Blomqvist, K.; Suihko, M. L.; Knowles, J. K. C.; Penttila, M. E. Chromosomal integration and expression of two bacterial αacetolactate decarboxylase genes in brewer’s yeast. Appl. Environ. Microbiol. 1991, 57, 2796−2803. (22) Dasari, S.; Kölling, R. Cytosolic Localization of Acetohydroxyacid Synthase Ilv2 and Its Impact on Diacetyl Formation during Beer Fermentation. Appl. Environ. Microbiol. 2011, 77 (3), 727−731.
(23) Vyazmensky, M.; Sella, C.; Barak, Z.; Chipman, D. M. Isolation and characterization of subunits of acetohydroxy acid synthase isozyme III and reconstitution of the holoenzyme. Biochemistry 1996, 35, 10339−10346. (24) Phalip, V.; Monnet, C.; Schmitt, P.; Renault, P.; Godon, J. J.; Diviès, C. Purification and properties of the α-acetolactate decarboxylase from Lactococcus lactis subsp. lactis NCDO 2118. FEBS Lett. 1994, 351, 95−99. (25) Ott, A.; Germond, J. E.; Chaintreau, A. Vicinal diketone formation in yogurt: 13C precursors and effect of branched-chain amino acids. J. Agric. Food Chem. 2000, 48 (3), 724−731. (26) Goupil, N.; Corthier, G.; Ehrlich, S. D.; Renault, P. Imbalance of leucine flux in Lactococcus lactis and its use for the isolation of diacetyloverproducing strains. Appl. Environ. Microbiol. 1996, 62 (7), 2636− 2640. (27) Chaves, A.; Fernandez, M.; Lerayer, A.; Mierau, I.; Kleerebezem, M.; Hugenholtz, J. Metabolic Engineering of Acetaldehyde Production by Streptococcus thermophilus. Appl. Environ. Microbiol. 2002, 68 (11), 5656−5662.
1663
dx.doi.org/10.1021/jf404567e | J. Agric. Food Chem. 2014, 62, 1658−1663
