Nutrition 30 (2014) 584–589
Contents lists available at ScienceDirect
Nutrition journal homepage: www.nutritionjrnl.com
Basic nutritional investigation
Regulation of an antioxidant blend on intestinal redox status and major microbiota in early weaned piglets Jianxiong Xu M.A. a, b, Congcong Xu Ph.D. b, Xiaolian Chen Ph.D. b, Xuan Cai Ph.D. b, Shoufeng Yang M.A. b, Yongshuai Sheng M.A. b, Tian Wang Ph.D. a, * a b
College of Animal Science and Technology, Nanjing Agricultural University, Nanjing, China School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai Key Laboratory for Veterinary and Biotechnology, Shanghai, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 April 2013 Accepted 21 October 2013
Objective: According to the “antioxidants network” theory, the present study was conducted to evaluate the regulation of an antioxidant blend on intestinal redox status and major microbiota of early-weaned piglets. Methods: Piglets from 15 litters were randomly allocated by litter to the control group (suckling normally, fed the basal diet, n ¼ 5), the weaning group (weaned at age 21 d, fed the basal diet, n ¼ 5), and the repair group (weaned at age 21 d, fed the basal diet supplemented with an antioxidant blend, n ¼ 5). The redox status and major microbiota in jejunum and colon tracts of 24-d-old piglets were detected, respectively. Results: Early weaning resulted in significant decreases in jejunum and colon antioxidant capacities, Lactobacillus and Bifidobacterium counts, and significant increases in levels of jejunum malondialdehyde, colon hydroxyl radicals, jejunum and colon H2O2, and Escherichia coli counts in piglets. The observed imbalance of the intestinal redox status and microbiota was significantly restored by the antioxidant blend. Interestingly, intestinal selected antioxidative items presented a positive correlation with potential beneficial bacteria and a negative correlation with E. coli. Nevertheless, selected oxidative items and the bacteria presented an inverse relationship in piglets. Conclusion: Supplementation of the antioxidant blend effectively restored intestinal redox status and microbiota balance in the porcine intestine in response to early weaning stress, enhancing intestinal health and function of piglets. Ó 2014 Elsevier Inc. All rights reserved.
Keywords: Antioxidant Redox status Microbiota Intestine Weaned Piglets
Introduction Young mammals are often challenged by weaning stress, which may induce oxidative stress, injuring intestinal morphology, lowering food intake and performance, decreasing immunity [1–4], disturbing the dynamic balance of intestinal microbiota [5–9], and enhancing a risk for diarrhea and inflammation in infants and young animals. As reviewed previously [10], accumulated evidences have shown that supplementation of natural antioxidants such as vitamins E and C, tea polyphenols, and probiotics has been practiced to enhance the antioxidant Congcong Xu and Jianxiong Xu contributed equally to this study. Xiaolian Chen is presently affiliated with the Institute of Animal Husbandry and Veterinary Science, Jiangxi Academy of Agricultural Science, Nanchang, China. * Corresponding author. Tel: þ86-25-84395106; fax: þ86-25-84395314. E-mail address: [email protected] (T. Wang). 0899-9007/$ - see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.nut.2013.10.018
system, relieve stress, and regulate the dynamic balance of intestinal microbiota in livestock husbandry. However, this approach has demonstrated limited effectiveness; therefore, according to the “antioxidants network” theory, the present study was conducted to investigate the regulation of an antioxidant blend on intestinal redox status and major microbiota of piglets in response to early weaning stress. Additionally, although weaned piglets have been widely studied, most of the work has been concentrated on either the redox status and immunity in vivo [11–14] or the state of intestinal microbiota [15,16]. The underlying relationship between intestinal redox status and microbiota in piglets is still unclear. To our knowledge, the present study was the first conducted to explore the relationship between intestinal redox status and major microbiota of piglets, which is potentially instructive for purposefully enhancing intestinal health and function of piglets.
J. Xu et al. / Nutrition 30 (2014) 584–589 Materials and methods Animals and experiment design The experiment was a single-factor randomized block experiment. In all, one hundred and twenty 24-d-old piglets (Duroc [Large white Landrace]) from 15 litters were randomly divided by litter to three treatment groups with five litters per group. The treatment groups were designated as control, weaning, and repair groups. The size of every litter is eight piglets. The animal experiment was approved by the Shanghai Jiaotong University Institutional Animal Care and Use Committee. From 14 to 24 d of age, the control and weaning piglets had access to the basal diet (Table 1) and the repair piglets were fed with the basal diet supplemented with 6.75 g/kg of the antioxidant blends including 200 mg vitamin C, 100 mg vitamin E, 450 mg tea polyphenols, 1 g lipoic acid, and 5 g microbial antioxidants fermented by bacillus, lactobacillus, photosynthetic bacteria, and beer yeast based on a previous study [4]. The microbial antioxidants were inactivated after the fermentation. Piglets were kept with the sow in conventional farrowing pens and suckled until 21 d of age. At 21 d of age, weaning and repair piglets were weaned and moved from the farrowing pens to nursery pens without mixing any litters. Control piglets remained suckling in the farrowing pens and had ad libitum access to the basal diet until the end of the experiment. Room temperature in the farrowing and nursery building was maintained at about 30 C. Sample collection At 24 d of age, one piglet was randomly chosen from each litter, resulting in a total of five replicates per treatment. Jejunum and colon digesta were collected under sterile conditions and immediately stored at 80 C for the evaluation of microbiota quantity using SYBR Green real-time absolute quantitative polymerase chain reaction (PCR) technique. Jejunum and colon tissues were collected for the detection of free radicals, oxidative, and antioxidative items, respectively. Determination of redox status of intestine tissues After homogenization of jejunum and colon tissues in saline solution (1:10, w:v) and centrifugation at 4000 g for 20 min, the supernatants were diluted to the optimal content for detecting the intestinal redox status. According to the manufacturer’s instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), total antioxidant capacity (T-AOC), superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), malondialdehyde (MDA) as an indicator of lipid peroxidation, inhibition capacity of hydroxyl radical (IHR) indirectly reflecting the hydroxyl radical (OH) level, and hydrogen peroxide (H2O2) were measured and the changes in absorbance at 520, 550, 412, 532, 550, and 405 nm were recorded, respectively. All absorbance levels were measured using an ultravioletvisible spectrophotometer (Tongfang Inc., Shanghai, China).
585
Table 1 Dietary ingredient and analyzed energy and nutrient contents of the basic diets (as-fed basis) Item
Amount
Ingredient (%) Corn Soybean meal, fermented Soybean meal, peeled Extruded soybean Fish meal Plasma protein Whey powder Limestone Monocalcium phosphate Choline Lactose Sodium chloride Vitamin premix* Mineral premixy Nutrition levels Digestible Energy (MJ/kg) Crude protein (nitrogen 6.25) (%) Ca (%) Total P (%) Available P (%) Lysine (%) Methionine (%) Methionine þ Cysteine (%) Tryptophane (%) Threonine (%)
41.18 5.00 7.00 11.22 5.00 4.00 15.00 0.50 0.90 0.10 8.75 0.35 0.50 0.50 14.48 20.50 0.85 0.67 0.55 1.55 0.42 0.83 0.27 1.01
* Provided per kg of mixed diet: vitamin A, 12 000 IU/kg; vitamin D3, 3200 IU/ kg; vitamin K3, 2.5 mg; vitamin E, 80 mg; vitamin B1, 2.5 mg; vitamin B2, 6.5 mg; vitamin B6, 5 mg; vitamin B12, 0.05 mg; niacin, 45 mg; and D-pantothenic acid, 20 mg. y Provided per kg of mixed diet: folic acid, 1.5 mg; biotin, 0.15 mg; Fe, 150 mg as ferrous sulfate; Cu, 125 mg as copper sulfate; Zn, 200 mg as zinc oxide; Mn, 30 mg as manganous oxide; I, 0.3 mg as potassium iodide; and Se, 0.3 mg as selenium selenite.
were considered statistically significant at P < 0.05. All statistical analyses were done using SPSS19.0 software (SPSS Inc., Chicago, IL, USA).
Results Redox status
Quantification of intestinal major microbiota Total DNA of jejunum and colon digesta was extracted using dung genome extraction kit (Tiangen, Beijing, China). The primers of interest and the optimal annealing temperature of the PCR reaction were employed in this study (Table 2). After PCR amplification with Taq DNA polymerase kit (TaKaRa, Otsu, Japan) and electrophoresis on a 1.5% agarose gel, PCR products were purified according to the manufacturer’s protocol (Dongsheng, Guangzhou, China) and cloned in Escherichia coli DH5-a (Tiangen, Beijing, China) using the pMD18-T vector system (TaKaRa, Otsu, Japan). The extracted plasmids containing targeted fragments were sequenced commercially, obtaining the positive plasmids (Invitrogen, Carlsbad, CA, USA). The real-time absolute quantitative PCR reaction was applied to quantification of the selected bacteria. Standard curves were generated with 10-fold serial dilutions of the respective positive plasmids (108 104 copies mL1). The concentration of the positive plasmids was plotted against the threshold cycle (Ct) value. The reaction was performed in a total volume of 20 mL and carried out in an Eppendorf Mastercycler ep Realplex (Eppendorf, Hamburg, Germany). A control without template was included in all batches. Polymerase chain reaction conditions were as follows: 95 C for 30 sec, 35 cycles of 95 C for 5 sec, annealing and extension: Annealing temperature (Table 2) for 20 sec, followed by a product melting curve to determine the specificity of amplification. Statistical analysis All results were presented as mean SEM. Differences between the means were examined with multiple comparisons using the Duncan test. Bivariate correlation was conducted and Pearson’s correlation coefficients were calculated by combining the data from the control and weaning groups to address associations between piglets’ intestinal redox status and major microbiota. Differences
After early weaning, the jejunum and colon tissues of 24-dold piglets exhibited significant decreases in the capacities of T-AOC, GSH-Px, SOD, and significant increases in the H2O2 level (P < 0.05). There was also a significant decrease in colon IHR and a significant increase in jejunum MDA concentration (P < 0.05). Inversely, compared with weaned piglets, the piglets with diets supplemented with the antioxidant blend had significantly elevated capacities of T-AOC, GSH-Px, SOD, and reduced MDA concentration and H2O2 levels in jejunum and colon tissues (P < 0.05). Colon IHR was also observably elevated (P < 0.05), Table 2 16S rRNA gene-targeted group-specific primers Item
Primer, 50 -30
Total bacteria
F: ACTCCTACGGGAGGCAGCAG R: ATTACCGCGGCTGCTGG Lactobacillus F: AGCAGTAGGGAATCTTCCA R: CACCGCTACACATGGAG Bifidobacterium F:GATTCTGGCTCAGGATGAACGC R:CTGATAGGACGCGACCCCAT Escherichia coli F: CATGCCGCGTGTATGAAGAA R: CGGGTAACGTCAATGAGCAAA F, forward; R, reverse
Annealing temperature ( C)
Reference
60
[17]
60.8
[18]
62.3
[19]
60
[20]
586
J. Xu et al. / Nutrition 30 (2014) 584–589
Table 3 Redox status in jejunum and colon tissues of 24-d-old piglets fed experimental diets* Item
Treatment Control (n ¼ 5)
Jejunum T-AOC (U/mg protein) GSH-Px (U/mg protein) SOD (U/mg protein) IHR (U/mg protein) MDA (nmol/mg) H2O2 (mmol/g) Colon T-AOC (U/mg protein) GSH-Px (U/mg protein) SOD (U/mg protein) IHR (U/mg protein) MDA (nmol/mg) H2O2 (mmol/g)
Weaning (n ¼ 5)
Repair (n ¼ 5)
0.36 25.52 19.88 35.36 0.79 11.92
0.04b* 1.47c 1.30c 3.53 0.12a 1.05a
0.23 14.36 14.81 26.47 1.20 19.76
0.01a 1.53a 0.90a 2.99 0.113b 1.00b
0.323 19.05 24.23 34.05 0.81 14.70
0.03c 0.61b 1.96b 2.06 0.10a 1.19a
0.46 32.46 17.46 28.15 1.34 16.23
0.07b 2.59b 1.04b 1.57b 0.19a,b 0.92a
0.24 26.75 13.59 21.90 1.80 19.17
0.05a 1.36a 1.24a 1.77a 0.21b 1.06b
0.39 44.74 23.76 29.72 0.71 15.80
0.03b 1.00c 0.72c 2.10b 0.09a 0.51a
GSH-Px, glutathione peroxidase; H2O2, hydrogen peroxide; IHR, inhibition capacity of hydroxyl radical; MDA, malondialdehyde; SOD, superoxide dismutase; T-AOC, total antioxidant capacity * Mean SEM. Values within a row without a common letter differ (P < 0.05).
which indirectly indicated the decrease of OH in the repair group (Table 3). Intestinal major microbiota The functions describing the relationship between Ct and X (Log10 16 S rRNA gene copies/g contents) for the different assays were Ct ¼ 2.9876 X þ 32.404; R2 ¼ 0.9990 for total bacteria; Ct ¼ 2.9002 X þ 30.335; R2 ¼ 0.9992 for Lactobacillus; Ct ¼ 2.9880 X þ 30.603; R2 ¼ 0.9996 for Bifidobacterium; Ct ¼ 2.9419 X þ 34.020; R2 ¼ 0.9990 for Escherichia coli. The proliferation of total bacteria, Lactobacillus, and Bifidobacterium was significantly restrained, and E. coli counts were obviously increased in jejunum and colon tracts of 24-d-old piglets after early weaning (P < 0.05; Fig. 1). Conversely, in jejunum and colon tracts of repaired piglets, a significant increase of the counts of total bacteria, Lactobacillus, and Bifidobacterium, and a decrease of E. coli counts were observed (P < 0.05; Fig. 1). The correlation between intestinal redox status and major microbiota In jejunum of the piglets, there was a significant positive correlation between T-AOC, SOD, GSH-Px, IHR and Lactobacillus; T-AOC, SOD, IHR and Bifidobacterium; accompanied by T-AOC, GSH-Px and total bacteria (P < 0.05). MDA and H2O2 performed a significantly inverse correlation with total bacteria, Lactobacillus (P < 0.05), and a slightly inverse correlation with Bifidobacterium (P > 0.05). On the contrary, E. coli presented a significantly negative correlation with T-AOC, SOD, GSH-Px, IHR, and a positive correlation with MDA and H2O2 (P < 0.05). The relationship between the IHR and intestinal major microbiota, indirectly, indicated that OH performed a negative correlation with Lactobacillus and Bifidobacterium, and a positive correlation with E. coli (Table 4). In colon of the piglets, an obvious positive correlation between T-AOC, SOD, GSH-Px and total bacteria, Lactobacillus, and with T-AOC and Bifidobacterium was observed, whereas an obvious negative relationship was observed between H2O2 and
Fig. 1. Changes of major microbiota counts in jejunum and colon tracts of 24-d-old piglets fed experimental diets. * Significant difference compared with control group;y significant difference compared with weaning group (P < 0.05). Tot: Total bacteria; Lac: Lactobacillus; Bif: Bifidobacterium; Eco: Escherichia coli; Log10: 16 S rRNA gene copies/g contents; A: jejunum; B: colon. All results were presented as mean SEM (n ¼ 5).
total bacteria, Lactobacillus and Bifidobacterium, as well as between MDA and total bacteria (P < 0.05). Inversely, E. coli and the monitored antioxidative enzymes presented an obviously negative correlation, whereas an obviously positive correlation with MDA and H2O2 was seen (P < 0.05). Additionally, IHR performed a positive correlation with Bifidobacterium and Lactobacillus (P < 0.05), and a slightly inverse correlation with E. coli (P > 0.05), similarly, indirectly reflecting the relationship between OH and intestinal major microbiota in piglets (Table 4).
J. Xu et al. / Nutrition 30 (2014) 584–589
587
Table 4 Correlation coefficient between redox status and bacteria counts in jejunum and colon tracts of piglets Item
Jejunum Total bacteria Lactobacillus Bifidobacterium Escherichia coli Colon Total bacteria Lactobacillus Bifidobacterium Escherichia coli
Correlation coefficient T-AOC
GSH-Px
SOD
MDA
H2O2
IHR
0.541* 0.566* 0.518* 0.662y
0.874y 0.712y 0.461 0.731y
0.482 0.595* 0.596* 0.630*
0.675y 0.549* 0.466 0.588*
0.894y 0.786y 0.452 0.830y
0.468 0.650y 0.626* 0.557*
0.588* 0.582* 0.552* 0.585*
0.569* 0.586* 0.385 0.810y
0.679y 0.611* 0.482 0.818y
0.583* 0.453 0.389 0.680y
0.735y 0.667y 0.645y 0.578*
0.49 0.577* 0.561* 0.417
GSH-Px, glutathione peroxidase; H2O2, hydrogen peroxide; IHR, inhibition capacity of hydroxyl radical; MDA, malondialdehyde; SOD, superoxide dismutase; T-AOC, total antioxidant capacity * Significant correlation between major microbiota and redox items analyzed at P < 0.05. y Significant correlation between major microbiota and redox items analyzed at P < 0.01.
Discussion Early weaning is a critical and essential stage for young mammals. However, young mammals often are challenged by weaning stress, leading to oxidative stress. Young animals, generally without an appropriate balance and mature antioxidant system in the gastrointestinal tract, are easily exposed to oxidative damage [1,21,22]. Previous studies have demonstrated that early weaning stress may lead to villus atrophy, low food intake, and the imbalance of oxidative and antioxidant systems in liver and serum of piglets [4,23]. In the present study, the redox status in jejunum and colon tissues was evaluated by monitoring the oxidative and antioxidative items. The results illustrated that early weaning stress significantly caused imbalance of the oxidative and antioxidant systems, as well as increased levels of MDA and free radicals such as H2O2 and OH and decreased antioxidant enzyme capacities in the intestinal tissues of piglets, which is in accordance with previous studies [24,25]. Additionally, gut environmental changes caused by early weaning stress in the gastrointestinal tract were reflected in changes of the intestinal microbiota. The results indicated that early weaning stress significantly decreased total bacteria, Lactobacillus, and Bifidobacterium counts, and increased E. coli counts in jejunum and colon tracts of piglets, which were consistent with existing reports [26,27]. Moreover, E. coli, as a conditional pathogen in the gastrointestinal tract, is characterized by colonization in the brush border of the swine intestine and secretion of enterotoxins that cause diarrhea [28]. Therefore, owing to the imbalance of intestinal redox status, the decrease of potential beneficial bacteria, and the increase of conditional pathogen (E. coli), early-weaned piglets may be easily exposed to weaning-induced diseases. Recently, accumulated evidences have shown that supplementation of various natural antioxidants such as vitamins E and C, tea polyphenols, and probiotics has relieved stress and enhanced health in livestock husbandry. Vitamin E, the primary endogenous lipid-soluble, chain-breaking antioxidant in cellular membranes can act directly with various reactive oxygen species (ROS), including H2O2, superoxide radical and OH. Vitamin E can transfer its phenolic hydrogen to an H2O2, breaking the radical chain reaction and preventing the peroxidation of cellular and subcellular membrane phospholipids. Vitamin C, the watersoluble antioxidant, can quench directly H2O2, OH, and singlet oxygen to protect lipids and lipid structures against peroxidation [29,30]. Tea polyphenols can effectively scavenge H2O2 and OH,
decrease the concentration of MDA, and enhance copper (Cu), zinc (Zn)-SOD activity to inhibit oxidative damage in vivo [31]. Lipoic acid, or its reduced form, dihydrolipoate, reacts with ROS like superoxide radicals, OH, H2O2, peroxynitrite, and singlet oxygen [32]. Notably, protection against lipid peroxidation can be ascribed completely to reduction of oxidized glutathione to reduced glutathione by decreased lipoic acid [33]. Microbial antioxidants contain various B vitamins, reduced vitamin C, carotene, minerals, and so on. For instance, in endothelial cells, homocysteine may contribute to oxidative stress. Vitamins B6 and B12, serving as cofactors, are essential for homocysteine metabolism. Therefore, B vitamins may reduce the risk for oxidative damage. Minerals, usually as cofactors, occur bound to proteins. Iron is the most abundant trace element in the body, and almost all iron occur bound to proteins. Free iron concentrations are particularly low, exacerbating oxidative damage. Cu, Zn, and manganese (Mn) are indispensable for the activities of Cu, Zn-SOD, and Mn-SOD in vivo, respectively. Beta-carotene, as a potential antioxidant, reacts with a H2O2 to form a resonance to stabilized carbon-centered radicals within its conjugated alkyl structure, thereby inhibiting the chain propagation effect of ROS [31]. A previous study [34] found that natural antioxidants can regulate the dynamic balance of intestinal microbiota through scavenging excessive free radicals and strengthening organic immunity. However, it has been demonstrated that these approaches have limited effectiveness because the pathogenesis of oxidative tissue injury involves multiple disturbances of cellular physiological processes, including mitochondrial dysfunction [35]. According to the “antioxidants network” theory, network antioxidants can greatly enhance the power of one another, making them more effective than a single antioxidant for slowing down the aging process and boosting the body’s ability to fight disease [36]. For instance, vitamin C is useful during recovery from infection, probably because it directly or indirectly stimulates regeneration of vitamin E. Vitamin C also facilitates recovery from the lymphocyte damage caused by intermediate oxygen radicals through scavenging the free radicals, which reflects the synergistic effect [37]. Tea polyphenols can interact with vitamin C and glutathione to protect membranes, which may, in turn, recycle vitamin E [31]. Therefore, we explored an antioxidant blend including vitamins C and E, tea polyphenols, lipoic acid, and microbial antioxidants for the prevention and recovery of the complex diseases in early-weaned piglets. In the present study, the protective effects of the antioxidant blend in the diet were monitored. The
588
J. Xu et al. / Nutrition 30 (2014) 584–589
antioxidant blend effectively enhanced the capacities of antioxidant enzymes and relieved the levels of free radicals in earlyweaned piglets, in agreement with an earlier study of serum redox status of piglets [4]. Simultaneously, the effective regulation of the antioxidant blend on intestinal microbiota, increases in Lactobacillus and Bifidobacterium counts, and decreases in E. coli counts in the gut environment, were also observed. Interestingly, the monitored data indicated that oxidative status represented by MDA, H2O2, and OH presented a negative correlation with Lactobacillus and Bifidobacterium, and a positive correlation with gut E. coli in piglets. In contrast, antioxidant status represented by antioxidant enzymes demonstrated a positive correlation with Lactobacillus and Bifidobacterium, and a negative correlation with E. coli. Therefore, oxidative stress, resulting from changes of redox status in the gut, was directly related to changes of gut microbiota in weaned piglets. However, different strains of gut microbiota possess different tolerance to oxidative stress conditions [38]. E. coli have various ways to adapt to oxidative stress. For example, some OxyR-dependent proteins such as AhpF, Dps, and Fur, play a major role in the adaptation of E. coli to oxidative stress [39]. E. coli requires YhgI protein, involved in iron/sulfur biogenesis, to resist oxidative stress [40]. Additionally, the RpoS stress-response system cross-protects against multiple environmental stresses and the glutamate (AR2) or arginine (AR3) decarboxylase acid-resistance systems could simultaneously protect E. coli O157:H7 from oxidative stress during acid challenge [41]. Likewise, some evidences have indicated that Lactobacillus and Bifidobacterium possess excellent antioxidant capacity by scavenging free radicals [25,42–44]. However, most Lactobacillus is lack of the general defense system (SODs), which may be responsible for the high sensitivity of most species of Lactobacillus to oxidative stress [45]. Therefore, given the susceptibility of Lactobacillus and Bifidobacterium and the adaptation of E. coli to oxidative stress, early weaning might result in a significant decrease of Lactobacillus and Bifidobacterium. Consequently, E. coli were accordingly increased. Under antioxidant-enhanced environment, oxidative damage to Lactobacillus and Bifidobacterium was lowed. The proliferation of potential beneficial bacteria may inhibit the E. coli multiplication. Consequently, the changes of gut microbiota were restored in repaired piglets. Hence, we suggested that the gut redox rebalance attributing to the regulation of the antioxidant blend might be conducive to the restoration of gut microbiota balance in piglets. This interesting finding is potentially instructive for purposefully enhancing intestinal health and function of piglets.
Conclusion Our results demonstrated that supplementation of the antioxidant blend effectively restored redox status and microbiota balance in the porcine intestine in response to early weaning stress, enhancing intestinal health. However, further studies should be conducted to more completely determine the mechanism regulating intestinal environment after weaning.
Acknowledgments This study was supported financially by the National Natural Science Foundation of China (Grant No. 30972103). The authors acknowledge their colleagues for their helpful discussions and other kind members of the near laboratory for assisting with the sample collection.
References [1] Khaled MA. Oxidative stress in childhood malnutrition and diarrhoeal diseases. J Diarrheal Dis Res 1994;12:165–72. [2] Semba RD, Tang AM. Micronutrients and the pathogenesis of human immunodeficiency virus infection. Brit J Nutr 1999;81:181–9. [3] Huang RH, Qiu XS, Shi FX, Hughes CL, Lu ZF, Zhu WY. Effects of dietary allicin on health and growth performance of weanling piglets and reduction in attractiveness of faeces to flies. Animal 2010;5:304–11. [4] Zhu LH, Zhao KL, Chen XL, Xu JX. Impact of weaning and an antioxidant blend on intestinal barrier function and antioxidant status in pigs. J Anim Sci 2012;90:2581–9. [5] Mathew AG, Sutton AL, Scheidt AB, Patterson JA, Kelly DT, Meyerholtz KA. Effect of galactan on selected microbial populations and pH and volatile fatty acids in the ileum of the weanling pig. J Anim Sci 1993;71: 1503–9. [6] Campbell JD, Cole M, Bunditrutavorn B, Vella AT. Ascorbic acid is a potent inhibitor of various forms of T cell apoptosis. Cell Immunol 1999;194:1–5. [7] Eicher SD, McKee CA, Carroll JA, Pajor EA. Supplemental vitamin C and yeast cell wall beta-glucan as growth enhancers in newborn pigs and as immunomodulators after an endotoxin challenge after weaning. J Anim Sci 2006;84:2352–60. [8] West CE, Gothefors L, Granstrom M, Kayhty H, Hammarstrom ML, Hernell O. Effects of feeding probiotics during weaning on infections and antibody responses to diphtheria, tetanus and Hib vaccines. Pediatr Allergy Immunol 2008;19:53–60. [9] Deng Q, Xu J, Yu B, He J, Zhang K, Ding X, et al. Effect of dietary tea polyphenols on growth performance and cell-mediated immune response of post-weaning piglets under oxidative stress. Arch Anim Nutr 2010;64: 12–21. [10] Kaminogawa S. Effects of food components on intestinal flora, intestinal immune system and their mutualis. Biosci Microflora 2010;29:69–82. [11] Schwerin M, Janczyk P, Ponsuksili S, Walz C, Souffrant WB. Effects of plant extract and natural substance food additives on stress and immune response in weaning piglets. Archiva Zootechnica 2009;12:5–21. [12] Wang XQ, Ou DY, Yin JD, Wu GY, Wang JJ. Proteomic analysis reveals altered expression of proteins related to glutathione metabolism and apoptosis in the small intestine of zinc oxide-supplemented piglets. Amino Acids 2009;37:209–18. [13] Levasta B, de Monte M, Chevaleyrea C, Meloa S, Berria M, Mangina F, et al. Ultra-early weaning in piglets results in low serum IgA concentration and IL17 mRNA expression. Vet Immunol Immunop 2010;137:261–8. [14] Cheng Q, Jiang ZG, Xu CC, Li HZ, Cao D, Yang ZH, et al. CpG oligodeoxynucleotide promotes protective immunity in the enteric mucosa and suppresses enterotoxigenic E.coli in the weaning piglets. Int Immunopharmacol 2010;10:1249–60. e SM, Manzanilla EG, Badiolab J, Martına M, Gasaa J. [15] Castillo M, Martın-Oru Quantification of total bacteria, enterobacteria and lactobacilli populations in pig digesta by real-time PCR. Vet Microbiol 2006;114:165–70. [16] Kima JC, Hansen CF, Mullan BP, Pluske JR. Nutrition and pathology of weaner pigs: nutritional strategies to support barrier function in the gastrointestinal tract. Anim Feed Sci Tech 2012;173:3–16. [17] Morgan JK, Zhou LJ, Li WB, Shatters RG, Keremane M, Duan YP. Improved real-time PCR detection of “Candidatus Liberibacter asiaticus” from citrus and psyllid hosts by targeting the intragenic tandem-repeats of its prophage genes. Mol Cell Probe 2012;26:90–8. [18] Kanno T, Matsuki T, Okaa M, Utsunomiya H, Inada K, Magari H, et al. Gastric acid reduction leads to an alteration in lower intestinal micromicrobiota. Biochem Bioph Res Co 2009;381:666–70. [19] Echarri PP, Graci a CM, Berruezo GR, Vives I, Ballesta M, Solısd G, et al. Assessment of intestinal microbiota of full-term breast-fed infants from two different geographical locations. Early Hum Dev 2011;87:511–3. [20] Jensen SR, Fink LN, Struve C, Sternberg C, Andersen JB, Brynskov J, et al. Quantification of specific E. coli in intestinal mucosa from Crohn’s disease patients. J Microbiol Meth2011;86:111–114. [21] Mccracken VJ, Lorenz RG. The gastrointestinal ecosystem: a precarious alliance among epithelium, immunity and microbiota. Cell Microbiol 2001;3:1–11. [22] Song PX, Zhang RJ, Wang XX, He PL, Tan LL, Ma X. Dietary grape-seed procyanidins decreased postweaning diarrhea by modulating intestinal permeability and suppressing oxidative stress in rats. J Agric Food Chem 2011;59:6227–32. ron V, Huërou-Luron IL, Lalle s JP, Se ve B. Weaning induces [23] Boudry G, Pe both transient and long-lasting modifications of absorptive, secretory, and barrier properties of piglet intestine. J Nutr 2004;134:2256–62. [24] Mueller K, Blum NM, Kluge H, Bauerfeind R, Froehlich J, Mader A, et al. Effects of broccoli extract and various essential oils on intestinal and faecal microflora and on xenobiotic enzymes and the antioxidant system of piglets. OJAS 2012;2:78–98. [25] Wang J, Ji HF, Wang SX, Zhang DY, Liu H, Shan DC, et al. Lactobacillus plantarum ZLP001: in vitro assessment of antioxidant capacity and effect on growth performance and antioxidant status in weaning piglets. AsianAust J Anim Sci 2012;25:1153–8.
J. Xu et al. / Nutrition 30 (2014) 584–589 [26] Canh TT, Sutton AL. Dietary carbohydrates alter the fecal composition and pH and the ammonia emission from slurry of growing pigs. J Anim Sci 1998;76:1887–95. [27] Konstantinov SR, Poznanski E, Fuentes S, Akkermans Antoon DL, Smidt H, et al. Lactobacillus sobrius sp. nov. abundant in the intestine of weaning piglets. Int J Syst Evol Micr 2006;56:29–32. Bissonnette N, Bissonnette N, [28] Daudelin JF, Lessard M, Beaudoin F, Nadeau E, et al. Administration of probiotics influences F4 (K88)-positive enterotoxigenic Escherichia coli attachment and intestinal cytokine expression in weaned pigs. Vet Res 2011;42:1–11. [29] Machlin LJ, Bendich A. Free radical tissue damage: protective role of antioxidant nutrients. Faseb J 1987;1:441–5. [30] Buettner GR. The pecking order of free radicals and antioxidants: lipid peroxidation, a-tocopherol, and ascorbate. Arch Biochem Biophys 1993;300:535–43. [31] Fang YZ, Yang S, Wu G. Free radicals, antioxidants, and nutrition. Nutrition 2002;18:872–9. [32] Packer L, Witt EH, Tritschler HJ. Alpha-lipoic acid as a biological antioxidant. Free Radical Bio Med 1995;19:227–50. [33] Bast A, Haenen GR. Interplay between lipoic acid and glutathione in the protection against microsomal lipid peroxidation. BBA 1988;963:558–61. [34] Maggini M, Eva SW, Beveridge S, Dietrich HH. Selected vitamins and trace elements support immune function by strengthening epithelial barriers and cellular and humoral immune responses. Brit J Nutr 2007;98: 29–35. [35] Lu M, Gong X. Upstream reactive oxidative species (ROS) signals in exogenous oxidative stress-induced mitochondrial dysfunction. Cell Biol Int 2009;33:658–64. [36] Packer L, Colman C. The antioxidant miracle. New York: Wiley & Sons; 1999.
589
[37] Brennan LA, Morris GM, Wasson GR, Hannigan BM, Barnett YA. The effect of vitamin C or vitamin E supplementation on basal and H2 O2-induced DNA damage in human lymphocytes. Brit J Nutr 2000;84:195–202. [38] Qiao Y, Sun J, Ding Y, Le G, Shi Y. Alterations of the gut microbiota in highfat diet mice is strongly linked to oxidative stress. Appl Microbiol Biot 2013;97:1689–97. [39] Rothe M, Alpert C, Engst W, Musiol S, Loh G, Blaut M. Impact of nutritional factors on the proteome of intestinal Escherichia coli: induction of OxyRdependent proteins AhpF and Dps by a lactose-rich diet. Appl Environ Microb 2012;78:3580–91. [40] Angelini S, Gerez C, Choudens SO, Sanakis Y, Fontecave M, Barras F, et al. NfuA, a new factor required for maturing Fe/S proteins in Escherichia coli under oxidative stress and iron starvation conditions. J Biol Chem 2008;283:14084–91. [41] Bearson BL, Lee IS, Casey AC. Escherichia coli O157: H7 glutamate-and arginine-dependent acid-resistance systems protect against oxidative stress during extreme acid challenge. Microbiology 2009;155:805–12. [42] Lin MY, Chang FJ. Antioxidative effect of intestinal bacteria Bifidobacterium longum ATCC 15708 and Lactobacillus acidophilus ATCC 4356. Digest Dis Sci 2000;45:1617–22. [43] Choi SS, Kim Y, Han KS, You S, Oh S, Kim SH. Effects of Lactobacillus strains on cancer cell proliferation and oxidative stress in vitro. Lett Appl Microbiol 2006;42:452–8. [44] Xiao M, Xu P, Zhao JY, Wang Z, Zuo FL, Zhang JW, et al. Oxidative stressrelated responses of Bifidobacterium longum subsp. longum BBMN68 at the proteomic level after exposure to oxygen. Microbiology 2011;157: 1573–88. [45] Roy DG, Klaenhammer TR, Hassan HM. Cloning and expression of the manganese superoxide dismutase gene of Escherichia coli in Lactococcus lactis and Lactobacillus gasseri. Mol Gen Genet 1993;239:33–40.
Contents lists available at ScienceDirect
Nutrition journal homepage: www.nutritionjrnl.com
Basic nutritional investigation
Regulation of an antioxidant blend on intestinal redox status and major microbiota in early weaned piglets Jianxiong Xu M.A. a, b, Congcong Xu Ph.D. b, Xiaolian Chen Ph.D. b, Xuan Cai Ph.D. b, Shoufeng Yang M.A. b, Yongshuai Sheng M.A. b, Tian Wang Ph.D. a, * a b
College of Animal Science and Technology, Nanjing Agricultural University, Nanjing, China School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai Key Laboratory for Veterinary and Biotechnology, Shanghai, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 April 2013 Accepted 21 October 2013
Objective: According to the “antioxidants network” theory, the present study was conducted to evaluate the regulation of an antioxidant blend on intestinal redox status and major microbiota of early-weaned piglets. Methods: Piglets from 15 litters were randomly allocated by litter to the control group (suckling normally, fed the basal diet, n ¼ 5), the weaning group (weaned at age 21 d, fed the basal diet, n ¼ 5), and the repair group (weaned at age 21 d, fed the basal diet supplemented with an antioxidant blend, n ¼ 5). The redox status and major microbiota in jejunum and colon tracts of 24-d-old piglets were detected, respectively. Results: Early weaning resulted in significant decreases in jejunum and colon antioxidant capacities, Lactobacillus and Bifidobacterium counts, and significant increases in levels of jejunum malondialdehyde, colon hydroxyl radicals, jejunum and colon H2O2, and Escherichia coli counts in piglets. The observed imbalance of the intestinal redox status and microbiota was significantly restored by the antioxidant blend. Interestingly, intestinal selected antioxidative items presented a positive correlation with potential beneficial bacteria and a negative correlation with E. coli. Nevertheless, selected oxidative items and the bacteria presented an inverse relationship in piglets. Conclusion: Supplementation of the antioxidant blend effectively restored intestinal redox status and microbiota balance in the porcine intestine in response to early weaning stress, enhancing intestinal health and function of piglets. Ó 2014 Elsevier Inc. All rights reserved.
Keywords: Antioxidant Redox status Microbiota Intestine Weaned Piglets
Introduction Young mammals are often challenged by weaning stress, which may induce oxidative stress, injuring intestinal morphology, lowering food intake and performance, decreasing immunity [1–4], disturbing the dynamic balance of intestinal microbiota [5–9], and enhancing a risk for diarrhea and inflammation in infants and young animals. As reviewed previously [10], accumulated evidences have shown that supplementation of natural antioxidants such as vitamins E and C, tea polyphenols, and probiotics has been practiced to enhance the antioxidant Congcong Xu and Jianxiong Xu contributed equally to this study. Xiaolian Chen is presently affiliated with the Institute of Animal Husbandry and Veterinary Science, Jiangxi Academy of Agricultural Science, Nanchang, China. * Corresponding author. Tel: þ86-25-84395106; fax: þ86-25-84395314. E-mail address: [email protected] (T. Wang). 0899-9007/$ - see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.nut.2013.10.018
system, relieve stress, and regulate the dynamic balance of intestinal microbiota in livestock husbandry. However, this approach has demonstrated limited effectiveness; therefore, according to the “antioxidants network” theory, the present study was conducted to investigate the regulation of an antioxidant blend on intestinal redox status and major microbiota of piglets in response to early weaning stress. Additionally, although weaned piglets have been widely studied, most of the work has been concentrated on either the redox status and immunity in vivo [11–14] or the state of intestinal microbiota [15,16]. The underlying relationship between intestinal redox status and microbiota in piglets is still unclear. To our knowledge, the present study was the first conducted to explore the relationship between intestinal redox status and major microbiota of piglets, which is potentially instructive for purposefully enhancing intestinal health and function of piglets.
J. Xu et al. / Nutrition 30 (2014) 584–589 Materials and methods Animals and experiment design The experiment was a single-factor randomized block experiment. In all, one hundred and twenty 24-d-old piglets (Duroc [Large white Landrace]) from 15 litters were randomly divided by litter to three treatment groups with five litters per group. The treatment groups were designated as control, weaning, and repair groups. The size of every litter is eight piglets. The animal experiment was approved by the Shanghai Jiaotong University Institutional Animal Care and Use Committee. From 14 to 24 d of age, the control and weaning piglets had access to the basal diet (Table 1) and the repair piglets were fed with the basal diet supplemented with 6.75 g/kg of the antioxidant blends including 200 mg vitamin C, 100 mg vitamin E, 450 mg tea polyphenols, 1 g lipoic acid, and 5 g microbial antioxidants fermented by bacillus, lactobacillus, photosynthetic bacteria, and beer yeast based on a previous study [4]. The microbial antioxidants were inactivated after the fermentation. Piglets were kept with the sow in conventional farrowing pens and suckled until 21 d of age. At 21 d of age, weaning and repair piglets were weaned and moved from the farrowing pens to nursery pens without mixing any litters. Control piglets remained suckling in the farrowing pens and had ad libitum access to the basal diet until the end of the experiment. Room temperature in the farrowing and nursery building was maintained at about 30 C. Sample collection At 24 d of age, one piglet was randomly chosen from each litter, resulting in a total of five replicates per treatment. Jejunum and colon digesta were collected under sterile conditions and immediately stored at 80 C for the evaluation of microbiota quantity using SYBR Green real-time absolute quantitative polymerase chain reaction (PCR) technique. Jejunum and colon tissues were collected for the detection of free radicals, oxidative, and antioxidative items, respectively. Determination of redox status of intestine tissues After homogenization of jejunum and colon tissues in saline solution (1:10, w:v) and centrifugation at 4000 g for 20 min, the supernatants were diluted to the optimal content for detecting the intestinal redox status. According to the manufacturer’s instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), total antioxidant capacity (T-AOC), superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), malondialdehyde (MDA) as an indicator of lipid peroxidation, inhibition capacity of hydroxyl radical (IHR) indirectly reflecting the hydroxyl radical (OH) level, and hydrogen peroxide (H2O2) were measured and the changes in absorbance at 520, 550, 412, 532, 550, and 405 nm were recorded, respectively. All absorbance levels were measured using an ultravioletvisible spectrophotometer (Tongfang Inc., Shanghai, China).
585
Table 1 Dietary ingredient and analyzed energy and nutrient contents of the basic diets (as-fed basis) Item
Amount
Ingredient (%) Corn Soybean meal, fermented Soybean meal, peeled Extruded soybean Fish meal Plasma protein Whey powder Limestone Monocalcium phosphate Choline Lactose Sodium chloride Vitamin premix* Mineral premixy Nutrition levels Digestible Energy (MJ/kg) Crude protein (nitrogen 6.25) (%) Ca (%) Total P (%) Available P (%) Lysine (%) Methionine (%) Methionine þ Cysteine (%) Tryptophane (%) Threonine (%)
41.18 5.00 7.00 11.22 5.00 4.00 15.00 0.50 0.90 0.10 8.75 0.35 0.50 0.50 14.48 20.50 0.85 0.67 0.55 1.55 0.42 0.83 0.27 1.01
* Provided per kg of mixed diet: vitamin A, 12 000 IU/kg; vitamin D3, 3200 IU/ kg; vitamin K3, 2.5 mg; vitamin E, 80 mg; vitamin B1, 2.5 mg; vitamin B2, 6.5 mg; vitamin B6, 5 mg; vitamin B12, 0.05 mg; niacin, 45 mg; and D-pantothenic acid, 20 mg. y Provided per kg of mixed diet: folic acid, 1.5 mg; biotin, 0.15 mg; Fe, 150 mg as ferrous sulfate; Cu, 125 mg as copper sulfate; Zn, 200 mg as zinc oxide; Mn, 30 mg as manganous oxide; I, 0.3 mg as potassium iodide; and Se, 0.3 mg as selenium selenite.
were considered statistically significant at P < 0.05. All statistical analyses were done using SPSS19.0 software (SPSS Inc., Chicago, IL, USA).
Results Redox status
Quantification of intestinal major microbiota Total DNA of jejunum and colon digesta was extracted using dung genome extraction kit (Tiangen, Beijing, China). The primers of interest and the optimal annealing temperature of the PCR reaction were employed in this study (Table 2). After PCR amplification with Taq DNA polymerase kit (TaKaRa, Otsu, Japan) and electrophoresis on a 1.5% agarose gel, PCR products were purified according to the manufacturer’s protocol (Dongsheng, Guangzhou, China) and cloned in Escherichia coli DH5-a (Tiangen, Beijing, China) using the pMD18-T vector system (TaKaRa, Otsu, Japan). The extracted plasmids containing targeted fragments were sequenced commercially, obtaining the positive plasmids (Invitrogen, Carlsbad, CA, USA). The real-time absolute quantitative PCR reaction was applied to quantification of the selected bacteria. Standard curves were generated with 10-fold serial dilutions of the respective positive plasmids (108 104 copies mL1). The concentration of the positive plasmids was plotted against the threshold cycle (Ct) value. The reaction was performed in a total volume of 20 mL and carried out in an Eppendorf Mastercycler ep Realplex (Eppendorf, Hamburg, Germany). A control without template was included in all batches. Polymerase chain reaction conditions were as follows: 95 C for 30 sec, 35 cycles of 95 C for 5 sec, annealing and extension: Annealing temperature (Table 2) for 20 sec, followed by a product melting curve to determine the specificity of amplification. Statistical analysis All results were presented as mean SEM. Differences between the means were examined with multiple comparisons using the Duncan test. Bivariate correlation was conducted and Pearson’s correlation coefficients were calculated by combining the data from the control and weaning groups to address associations between piglets’ intestinal redox status and major microbiota. Differences
After early weaning, the jejunum and colon tissues of 24-dold piglets exhibited significant decreases in the capacities of T-AOC, GSH-Px, SOD, and significant increases in the H2O2 level (P < 0.05). There was also a significant decrease in colon IHR and a significant increase in jejunum MDA concentration (P < 0.05). Inversely, compared with weaned piglets, the piglets with diets supplemented with the antioxidant blend had significantly elevated capacities of T-AOC, GSH-Px, SOD, and reduced MDA concentration and H2O2 levels in jejunum and colon tissues (P < 0.05). Colon IHR was also observably elevated (P < 0.05), Table 2 16S rRNA gene-targeted group-specific primers Item
Primer, 50 -30
Total bacteria
F: ACTCCTACGGGAGGCAGCAG R: ATTACCGCGGCTGCTGG Lactobacillus F: AGCAGTAGGGAATCTTCCA R: CACCGCTACACATGGAG Bifidobacterium F:GATTCTGGCTCAGGATGAACGC R:CTGATAGGACGCGACCCCAT Escherichia coli F: CATGCCGCGTGTATGAAGAA R: CGGGTAACGTCAATGAGCAAA F, forward; R, reverse
Annealing temperature ( C)
Reference
60
[17]
60.8
[18]
62.3
[19]
60
[20]
586
J. Xu et al. / Nutrition 30 (2014) 584–589
Table 3 Redox status in jejunum and colon tissues of 24-d-old piglets fed experimental diets* Item
Treatment Control (n ¼ 5)
Jejunum T-AOC (U/mg protein) GSH-Px (U/mg protein) SOD (U/mg protein) IHR (U/mg protein) MDA (nmol/mg) H2O2 (mmol/g) Colon T-AOC (U/mg protein) GSH-Px (U/mg protein) SOD (U/mg protein) IHR (U/mg protein) MDA (nmol/mg) H2O2 (mmol/g)
Weaning (n ¼ 5)
Repair (n ¼ 5)
0.36 25.52 19.88 35.36 0.79 11.92
0.04b* 1.47c 1.30c 3.53 0.12a 1.05a
0.23 14.36 14.81 26.47 1.20 19.76
0.01a 1.53a 0.90a 2.99 0.113b 1.00b
0.323 19.05 24.23 34.05 0.81 14.70
0.03c 0.61b 1.96b 2.06 0.10a 1.19a
0.46 32.46 17.46 28.15 1.34 16.23
0.07b 2.59b 1.04b 1.57b 0.19a,b 0.92a
0.24 26.75 13.59 21.90 1.80 19.17
0.05a 1.36a 1.24a 1.77a 0.21b 1.06b
0.39 44.74 23.76 29.72 0.71 15.80
0.03b 1.00c 0.72c 2.10b 0.09a 0.51a
GSH-Px, glutathione peroxidase; H2O2, hydrogen peroxide; IHR, inhibition capacity of hydroxyl radical; MDA, malondialdehyde; SOD, superoxide dismutase; T-AOC, total antioxidant capacity * Mean SEM. Values within a row without a common letter differ (P < 0.05).
which indirectly indicated the decrease of OH in the repair group (Table 3). Intestinal major microbiota The functions describing the relationship between Ct and X (Log10 16 S rRNA gene copies/g contents) for the different assays were Ct ¼ 2.9876 X þ 32.404; R2 ¼ 0.9990 for total bacteria; Ct ¼ 2.9002 X þ 30.335; R2 ¼ 0.9992 for Lactobacillus; Ct ¼ 2.9880 X þ 30.603; R2 ¼ 0.9996 for Bifidobacterium; Ct ¼ 2.9419 X þ 34.020; R2 ¼ 0.9990 for Escherichia coli. The proliferation of total bacteria, Lactobacillus, and Bifidobacterium was significantly restrained, and E. coli counts were obviously increased in jejunum and colon tracts of 24-d-old piglets after early weaning (P < 0.05; Fig. 1). Conversely, in jejunum and colon tracts of repaired piglets, a significant increase of the counts of total bacteria, Lactobacillus, and Bifidobacterium, and a decrease of E. coli counts were observed (P < 0.05; Fig. 1). The correlation between intestinal redox status and major microbiota In jejunum of the piglets, there was a significant positive correlation between T-AOC, SOD, GSH-Px, IHR and Lactobacillus; T-AOC, SOD, IHR and Bifidobacterium; accompanied by T-AOC, GSH-Px and total bacteria (P < 0.05). MDA and H2O2 performed a significantly inverse correlation with total bacteria, Lactobacillus (P < 0.05), and a slightly inverse correlation with Bifidobacterium (P > 0.05). On the contrary, E. coli presented a significantly negative correlation with T-AOC, SOD, GSH-Px, IHR, and a positive correlation with MDA and H2O2 (P < 0.05). The relationship between the IHR and intestinal major microbiota, indirectly, indicated that OH performed a negative correlation with Lactobacillus and Bifidobacterium, and a positive correlation with E. coli (Table 4). In colon of the piglets, an obvious positive correlation between T-AOC, SOD, GSH-Px and total bacteria, Lactobacillus, and with T-AOC and Bifidobacterium was observed, whereas an obvious negative relationship was observed between H2O2 and
Fig. 1. Changes of major microbiota counts in jejunum and colon tracts of 24-d-old piglets fed experimental diets. * Significant difference compared with control group;y significant difference compared with weaning group (P < 0.05). Tot: Total bacteria; Lac: Lactobacillus; Bif: Bifidobacterium; Eco: Escherichia coli; Log10: 16 S rRNA gene copies/g contents; A: jejunum; B: colon. All results were presented as mean SEM (n ¼ 5).
total bacteria, Lactobacillus and Bifidobacterium, as well as between MDA and total bacteria (P < 0.05). Inversely, E. coli and the monitored antioxidative enzymes presented an obviously negative correlation, whereas an obviously positive correlation with MDA and H2O2 was seen (P < 0.05). Additionally, IHR performed a positive correlation with Bifidobacterium and Lactobacillus (P < 0.05), and a slightly inverse correlation with E. coli (P > 0.05), similarly, indirectly reflecting the relationship between OH and intestinal major microbiota in piglets (Table 4).
J. Xu et al. / Nutrition 30 (2014) 584–589
587
Table 4 Correlation coefficient between redox status and bacteria counts in jejunum and colon tracts of piglets Item
Jejunum Total bacteria Lactobacillus Bifidobacterium Escherichia coli Colon Total bacteria Lactobacillus Bifidobacterium Escherichia coli
Correlation coefficient T-AOC
GSH-Px
SOD
MDA
H2O2
IHR
0.541* 0.566* 0.518* 0.662y
0.874y 0.712y 0.461 0.731y
0.482 0.595* 0.596* 0.630*
0.675y 0.549* 0.466 0.588*
0.894y 0.786y 0.452 0.830y
0.468 0.650y 0.626* 0.557*
0.588* 0.582* 0.552* 0.585*
0.569* 0.586* 0.385 0.810y
0.679y 0.611* 0.482 0.818y
0.583* 0.453 0.389 0.680y
0.735y 0.667y 0.645y 0.578*
0.49 0.577* 0.561* 0.417
GSH-Px, glutathione peroxidase; H2O2, hydrogen peroxide; IHR, inhibition capacity of hydroxyl radical; MDA, malondialdehyde; SOD, superoxide dismutase; T-AOC, total antioxidant capacity * Significant correlation between major microbiota and redox items analyzed at P < 0.05. y Significant correlation between major microbiota and redox items analyzed at P < 0.01.
Discussion Early weaning is a critical and essential stage for young mammals. However, young mammals often are challenged by weaning stress, leading to oxidative stress. Young animals, generally without an appropriate balance and mature antioxidant system in the gastrointestinal tract, are easily exposed to oxidative damage [1,21,22]. Previous studies have demonstrated that early weaning stress may lead to villus atrophy, low food intake, and the imbalance of oxidative and antioxidant systems in liver and serum of piglets [4,23]. In the present study, the redox status in jejunum and colon tissues was evaluated by monitoring the oxidative and antioxidative items. The results illustrated that early weaning stress significantly caused imbalance of the oxidative and antioxidant systems, as well as increased levels of MDA and free radicals such as H2O2 and OH and decreased antioxidant enzyme capacities in the intestinal tissues of piglets, which is in accordance with previous studies [24,25]. Additionally, gut environmental changes caused by early weaning stress in the gastrointestinal tract were reflected in changes of the intestinal microbiota. The results indicated that early weaning stress significantly decreased total bacteria, Lactobacillus, and Bifidobacterium counts, and increased E. coli counts in jejunum and colon tracts of piglets, which were consistent with existing reports [26,27]. Moreover, E. coli, as a conditional pathogen in the gastrointestinal tract, is characterized by colonization in the brush border of the swine intestine and secretion of enterotoxins that cause diarrhea [28]. Therefore, owing to the imbalance of intestinal redox status, the decrease of potential beneficial bacteria, and the increase of conditional pathogen (E. coli), early-weaned piglets may be easily exposed to weaning-induced diseases. Recently, accumulated evidences have shown that supplementation of various natural antioxidants such as vitamins E and C, tea polyphenols, and probiotics has relieved stress and enhanced health in livestock husbandry. Vitamin E, the primary endogenous lipid-soluble, chain-breaking antioxidant in cellular membranes can act directly with various reactive oxygen species (ROS), including H2O2, superoxide radical and OH. Vitamin E can transfer its phenolic hydrogen to an H2O2, breaking the radical chain reaction and preventing the peroxidation of cellular and subcellular membrane phospholipids. Vitamin C, the watersoluble antioxidant, can quench directly H2O2, OH, and singlet oxygen to protect lipids and lipid structures against peroxidation [29,30]. Tea polyphenols can effectively scavenge H2O2 and OH,
decrease the concentration of MDA, and enhance copper (Cu), zinc (Zn)-SOD activity to inhibit oxidative damage in vivo [31]. Lipoic acid, or its reduced form, dihydrolipoate, reacts with ROS like superoxide radicals, OH, H2O2, peroxynitrite, and singlet oxygen [32]. Notably, protection against lipid peroxidation can be ascribed completely to reduction of oxidized glutathione to reduced glutathione by decreased lipoic acid [33]. Microbial antioxidants contain various B vitamins, reduced vitamin C, carotene, minerals, and so on. For instance, in endothelial cells, homocysteine may contribute to oxidative stress. Vitamins B6 and B12, serving as cofactors, are essential for homocysteine metabolism. Therefore, B vitamins may reduce the risk for oxidative damage. Minerals, usually as cofactors, occur bound to proteins. Iron is the most abundant trace element in the body, and almost all iron occur bound to proteins. Free iron concentrations are particularly low, exacerbating oxidative damage. Cu, Zn, and manganese (Mn) are indispensable for the activities of Cu, Zn-SOD, and Mn-SOD in vivo, respectively. Beta-carotene, as a potential antioxidant, reacts with a H2O2 to form a resonance to stabilized carbon-centered radicals within its conjugated alkyl structure, thereby inhibiting the chain propagation effect of ROS [31]. A previous study [34] found that natural antioxidants can regulate the dynamic balance of intestinal microbiota through scavenging excessive free radicals and strengthening organic immunity. However, it has been demonstrated that these approaches have limited effectiveness because the pathogenesis of oxidative tissue injury involves multiple disturbances of cellular physiological processes, including mitochondrial dysfunction [35]. According to the “antioxidants network” theory, network antioxidants can greatly enhance the power of one another, making them more effective than a single antioxidant for slowing down the aging process and boosting the body’s ability to fight disease [36]. For instance, vitamin C is useful during recovery from infection, probably because it directly or indirectly stimulates regeneration of vitamin E. Vitamin C also facilitates recovery from the lymphocyte damage caused by intermediate oxygen radicals through scavenging the free radicals, which reflects the synergistic effect [37]. Tea polyphenols can interact with vitamin C and glutathione to protect membranes, which may, in turn, recycle vitamin E [31]. Therefore, we explored an antioxidant blend including vitamins C and E, tea polyphenols, lipoic acid, and microbial antioxidants for the prevention and recovery of the complex diseases in early-weaned piglets. In the present study, the protective effects of the antioxidant blend in the diet were monitored. The
588
J. Xu et al. / Nutrition 30 (2014) 584–589
antioxidant blend effectively enhanced the capacities of antioxidant enzymes and relieved the levels of free radicals in earlyweaned piglets, in agreement with an earlier study of serum redox status of piglets [4]. Simultaneously, the effective regulation of the antioxidant blend on intestinal microbiota, increases in Lactobacillus and Bifidobacterium counts, and decreases in E. coli counts in the gut environment, were also observed. Interestingly, the monitored data indicated that oxidative status represented by MDA, H2O2, and OH presented a negative correlation with Lactobacillus and Bifidobacterium, and a positive correlation with gut E. coli in piglets. In contrast, antioxidant status represented by antioxidant enzymes demonstrated a positive correlation with Lactobacillus and Bifidobacterium, and a negative correlation with E. coli. Therefore, oxidative stress, resulting from changes of redox status in the gut, was directly related to changes of gut microbiota in weaned piglets. However, different strains of gut microbiota possess different tolerance to oxidative stress conditions [38]. E. coli have various ways to adapt to oxidative stress. For example, some OxyR-dependent proteins such as AhpF, Dps, and Fur, play a major role in the adaptation of E. coli to oxidative stress [39]. E. coli requires YhgI protein, involved in iron/sulfur biogenesis, to resist oxidative stress [40]. Additionally, the RpoS stress-response system cross-protects against multiple environmental stresses and the glutamate (AR2) or arginine (AR3) decarboxylase acid-resistance systems could simultaneously protect E. coli O157:H7 from oxidative stress during acid challenge [41]. Likewise, some evidences have indicated that Lactobacillus and Bifidobacterium possess excellent antioxidant capacity by scavenging free radicals [25,42–44]. However, most Lactobacillus is lack of the general defense system (SODs), which may be responsible for the high sensitivity of most species of Lactobacillus to oxidative stress [45]. Therefore, given the susceptibility of Lactobacillus and Bifidobacterium and the adaptation of E. coli to oxidative stress, early weaning might result in a significant decrease of Lactobacillus and Bifidobacterium. Consequently, E. coli were accordingly increased. Under antioxidant-enhanced environment, oxidative damage to Lactobacillus and Bifidobacterium was lowed. The proliferation of potential beneficial bacteria may inhibit the E. coli multiplication. Consequently, the changes of gut microbiota were restored in repaired piglets. Hence, we suggested that the gut redox rebalance attributing to the regulation of the antioxidant blend might be conducive to the restoration of gut microbiota balance in piglets. This interesting finding is potentially instructive for purposefully enhancing intestinal health and function of piglets.
Conclusion Our results demonstrated that supplementation of the antioxidant blend effectively restored redox status and microbiota balance in the porcine intestine in response to early weaning stress, enhancing intestinal health. However, further studies should be conducted to more completely determine the mechanism regulating intestinal environment after weaning.
Acknowledgments This study was supported financially by the National Natural Science Foundation of China (Grant No. 30972103). The authors acknowledge their colleagues for their helpful discussions and other kind members of the near laboratory for assisting with the sample collection.
References [1] Khaled MA. Oxidative stress in childhood malnutrition and diarrhoeal diseases. J Diarrheal Dis Res 1994;12:165–72. [2] Semba RD, Tang AM. Micronutrients and the pathogenesis of human immunodeficiency virus infection. Brit J Nutr 1999;81:181–9. [3] Huang RH, Qiu XS, Shi FX, Hughes CL, Lu ZF, Zhu WY. Effects of dietary allicin on health and growth performance of weanling piglets and reduction in attractiveness of faeces to flies. Animal 2010;5:304–11. [4] Zhu LH, Zhao KL, Chen XL, Xu JX. Impact of weaning and an antioxidant blend on intestinal barrier function and antioxidant status in pigs. J Anim Sci 2012;90:2581–9. [5] Mathew AG, Sutton AL, Scheidt AB, Patterson JA, Kelly DT, Meyerholtz KA. Effect of galactan on selected microbial populations and pH and volatile fatty acids in the ileum of the weanling pig. J Anim Sci 1993;71: 1503–9. [6] Campbell JD, Cole M, Bunditrutavorn B, Vella AT. Ascorbic acid is a potent inhibitor of various forms of T cell apoptosis. Cell Immunol 1999;194:1–5. [7] Eicher SD, McKee CA, Carroll JA, Pajor EA. Supplemental vitamin C and yeast cell wall beta-glucan as growth enhancers in newborn pigs and as immunomodulators after an endotoxin challenge after weaning. J Anim Sci 2006;84:2352–60. [8] West CE, Gothefors L, Granstrom M, Kayhty H, Hammarstrom ML, Hernell O. Effects of feeding probiotics during weaning on infections and antibody responses to diphtheria, tetanus and Hib vaccines. Pediatr Allergy Immunol 2008;19:53–60. [9] Deng Q, Xu J, Yu B, He J, Zhang K, Ding X, et al. Effect of dietary tea polyphenols on growth performance and cell-mediated immune response of post-weaning piglets under oxidative stress. Arch Anim Nutr 2010;64: 12–21. [10] Kaminogawa S. Effects of food components on intestinal flora, intestinal immune system and their mutualis. Biosci Microflora 2010;29:69–82. [11] Schwerin M, Janczyk P, Ponsuksili S, Walz C, Souffrant WB. Effects of plant extract and natural substance food additives on stress and immune response in weaning piglets. Archiva Zootechnica 2009;12:5–21. [12] Wang XQ, Ou DY, Yin JD, Wu GY, Wang JJ. Proteomic analysis reveals altered expression of proteins related to glutathione metabolism and apoptosis in the small intestine of zinc oxide-supplemented piglets. Amino Acids 2009;37:209–18. [13] Levasta B, de Monte M, Chevaleyrea C, Meloa S, Berria M, Mangina F, et al. Ultra-early weaning in piglets results in low serum IgA concentration and IL17 mRNA expression. Vet Immunol Immunop 2010;137:261–8. [14] Cheng Q, Jiang ZG, Xu CC, Li HZ, Cao D, Yang ZH, et al. CpG oligodeoxynucleotide promotes protective immunity in the enteric mucosa and suppresses enterotoxigenic E.coli in the weaning piglets. Int Immunopharmacol 2010;10:1249–60. e SM, Manzanilla EG, Badiolab J, Martına M, Gasaa J. [15] Castillo M, Martın-Oru Quantification of total bacteria, enterobacteria and lactobacilli populations in pig digesta by real-time PCR. Vet Microbiol 2006;114:165–70. [16] Kima JC, Hansen CF, Mullan BP, Pluske JR. Nutrition and pathology of weaner pigs: nutritional strategies to support barrier function in the gastrointestinal tract. Anim Feed Sci Tech 2012;173:3–16. [17] Morgan JK, Zhou LJ, Li WB, Shatters RG, Keremane M, Duan YP. Improved real-time PCR detection of “Candidatus Liberibacter asiaticus” from citrus and psyllid hosts by targeting the intragenic tandem-repeats of its prophage genes. Mol Cell Probe 2012;26:90–8. [18] Kanno T, Matsuki T, Okaa M, Utsunomiya H, Inada K, Magari H, et al. Gastric acid reduction leads to an alteration in lower intestinal micromicrobiota. Biochem Bioph Res Co 2009;381:666–70. [19] Echarri PP, Graci a CM, Berruezo GR, Vives I, Ballesta M, Solısd G, et al. Assessment of intestinal microbiota of full-term breast-fed infants from two different geographical locations. Early Hum Dev 2011;87:511–3. [20] Jensen SR, Fink LN, Struve C, Sternberg C, Andersen JB, Brynskov J, et al. Quantification of specific E. coli in intestinal mucosa from Crohn’s disease patients. J Microbiol Meth2011;86:111–114. [21] Mccracken VJ, Lorenz RG. The gastrointestinal ecosystem: a precarious alliance among epithelium, immunity and microbiota. Cell Microbiol 2001;3:1–11. [22] Song PX, Zhang RJ, Wang XX, He PL, Tan LL, Ma X. Dietary grape-seed procyanidins decreased postweaning diarrhea by modulating intestinal permeability and suppressing oxidative stress in rats. J Agric Food Chem 2011;59:6227–32. ron V, Huërou-Luron IL, Lalle s JP, Se ve B. Weaning induces [23] Boudry G, Pe both transient and long-lasting modifications of absorptive, secretory, and barrier properties of piglet intestine. J Nutr 2004;134:2256–62. [24] Mueller K, Blum NM, Kluge H, Bauerfeind R, Froehlich J, Mader A, et al. Effects of broccoli extract and various essential oils on intestinal and faecal microflora and on xenobiotic enzymes and the antioxidant system of piglets. OJAS 2012;2:78–98. [25] Wang J, Ji HF, Wang SX, Zhang DY, Liu H, Shan DC, et al. Lactobacillus plantarum ZLP001: in vitro assessment of antioxidant capacity and effect on growth performance and antioxidant status in weaning piglets. AsianAust J Anim Sci 2012;25:1153–8.
J. Xu et al. / Nutrition 30 (2014) 584–589 [26] Canh TT, Sutton AL. Dietary carbohydrates alter the fecal composition and pH and the ammonia emission from slurry of growing pigs. J Anim Sci 1998;76:1887–95. [27] Konstantinov SR, Poznanski E, Fuentes S, Akkermans Antoon DL, Smidt H, et al. Lactobacillus sobrius sp. nov. abundant in the intestine of weaning piglets. Int J Syst Evol Micr 2006;56:29–32. Bissonnette N, Bissonnette N, [28] Daudelin JF, Lessard M, Beaudoin F, Nadeau E, et al. Administration of probiotics influences F4 (K88)-positive enterotoxigenic Escherichia coli attachment and intestinal cytokine expression in weaned pigs. Vet Res 2011;42:1–11. [29] Machlin LJ, Bendich A. Free radical tissue damage: protective role of antioxidant nutrients. Faseb J 1987;1:441–5. [30] Buettner GR. The pecking order of free radicals and antioxidants: lipid peroxidation, a-tocopherol, and ascorbate. Arch Biochem Biophys 1993;300:535–43. [31] Fang YZ, Yang S, Wu G. Free radicals, antioxidants, and nutrition. Nutrition 2002;18:872–9. [32] Packer L, Witt EH, Tritschler HJ. Alpha-lipoic acid as a biological antioxidant. Free Radical Bio Med 1995;19:227–50. [33] Bast A, Haenen GR. Interplay between lipoic acid and glutathione in the protection against microsomal lipid peroxidation. BBA 1988;963:558–61. [34] Maggini M, Eva SW, Beveridge S, Dietrich HH. Selected vitamins and trace elements support immune function by strengthening epithelial barriers and cellular and humoral immune responses. Brit J Nutr 2007;98: 29–35. [35] Lu M, Gong X. Upstream reactive oxidative species (ROS) signals in exogenous oxidative stress-induced mitochondrial dysfunction. Cell Biol Int 2009;33:658–64. [36] Packer L, Colman C. The antioxidant miracle. New York: Wiley & Sons; 1999.
589
[37] Brennan LA, Morris GM, Wasson GR, Hannigan BM, Barnett YA. The effect of vitamin C or vitamin E supplementation on basal and H2 O2-induced DNA damage in human lymphocytes. Brit J Nutr 2000;84:195–202. [38] Qiao Y, Sun J, Ding Y, Le G, Shi Y. Alterations of the gut microbiota in highfat diet mice is strongly linked to oxidative stress. Appl Microbiol Biot 2013;97:1689–97. [39] Rothe M, Alpert C, Engst W, Musiol S, Loh G, Blaut M. Impact of nutritional factors on the proteome of intestinal Escherichia coli: induction of OxyRdependent proteins AhpF and Dps by a lactose-rich diet. Appl Environ Microb 2012;78:3580–91. [40] Angelini S, Gerez C, Choudens SO, Sanakis Y, Fontecave M, Barras F, et al. NfuA, a new factor required for maturing Fe/S proteins in Escherichia coli under oxidative stress and iron starvation conditions. J Biol Chem 2008;283:14084–91. [41] Bearson BL, Lee IS, Casey AC. Escherichia coli O157: H7 glutamate-and arginine-dependent acid-resistance systems protect against oxidative stress during extreme acid challenge. Microbiology 2009;155:805–12. [42] Lin MY, Chang FJ. Antioxidative effect of intestinal bacteria Bifidobacterium longum ATCC 15708 and Lactobacillus acidophilus ATCC 4356. Digest Dis Sci 2000;45:1617–22. [43] Choi SS, Kim Y, Han KS, You S, Oh S, Kim SH. Effects of Lactobacillus strains on cancer cell proliferation and oxidative stress in vitro. Lett Appl Microbiol 2006;42:452–8. [44] Xiao M, Xu P, Zhao JY, Wang Z, Zuo FL, Zhang JW, et al. Oxidative stressrelated responses of Bifidobacterium longum subsp. longum BBMN68 at the proteomic level after exposure to oxygen. Microbiology 2011;157: 1573–88. [45] Roy DG, Klaenhammer TR, Hassan HM. Cloning and expression of the manganese superoxide dismutase gene of Escherichia coli in Lactococcus lactis and Lactobacillus gasseri. Mol Gen Genet 1993;239:33–40.
