Article pubs.acs.org/jpr
Regulation of Interleukin‑6 in Head and Neck Squamous Cell Carcinoma Is Related to Papillomavirus Infection Ida Chiara Guerrera,†,‡ Ivan Quetier,‡,○ Rachid Fetouchi,§,○ Frederique Moreau,‡,§,∥,○ Christelle Vauloup-Fellous,‡,⊥,○ Bouchra Lekbaby,‡,∥ Caroline Rousselot,‡ Cerina Chhuon,† Aleksander Edelman,†,‡ Marine Lefevre,# Jean-Claude Nicolas,§ Dina Kremsdorf,‡,∥ Jean Lacau Saint Guily,∥,▽ and Patrick Soussan*,‡,§,∥ †
Plateau Protéome Necker, IFR 94, Université Paris Descartes, Paris, France Inserm U845 et Faculté de Médecine, Université Paris Descartes, Paris, France § Servic de Virologie, Hôpital Tenon et Faculté de Médecine, Université Pierre et Marie Curie, Paris, France ∥ Institut Universitaire de Cancerologie, Université Pierre et Marie Curie, Paris, France ⊥ Service de Virologie, Hôpital Antoine Béclère, Clamart, France # Service d’Anatomo-Pathologie, Hôpital Tenon et Faculté de Médecine, Université Pierre et Marie Curie, Paris, France ▽ Service d’Oto-Rhino-Laryngologie et Chirurgie Cervico-Faciale, Hôpital Tenon, Faculté de Médecine, Université Pierre et Marie Curie, Paris, France ‡
S Supporting Information *
ABSTRACT: The prevalence of head and neck squamous cell carcinoma (HNSCC) related to human papillomavirus (HPV) is increasing, unlike tobacco- and alcohol-associated cancers. To gain a clearer understanding of the molecular mechanisms implicated in HNSCC, depending on the presence or not of a viral sequence, we investigated the expression of proteins detected in the tumor regions of HNSCC patients. Twenty-two untreated HNSCC patients were selected according to the presence of HPV-16. For six patients, tumor and controlateral healthy tissues were tested for viral detection before quantitative proteomic analysis. After confirmation by Western blot, proteins were connected into a network, leading to investigate interleukin-6 (IL-6) by immunocytochemistry and ELISA. 41 ± 5% of proteins quantified by proteomics were differentially expressed in tumor compared with healthy regions. Among them, 36 proteins were retained as modulated in HPV-16 positive or negative tumors, including cytokeratins, tubulins, annexin A1, and serpin B1. Network analysis suggested a central role of IL-6, confirmed by overexpression of IL-6 in tumor tissues as in sera of HPV-negative HNSCC compared with HPV-16-positive tumors. This modulation may contribute to the survival and proliferation of cancer cells, although it was not related to tumor stage or to the level of HPV-16 DNA. KEYWORDS: papillomavirus, head and neck squamous cell carcinoma, proteomics, iTraq, interleukin-6
■
INTRODUCTION
depending on the site of the tumor and HPV detection methods. HPVs are epitheliotropic oncogenic viruses with more than 130 identified genotypes in humans and are classified into high-risk or low-risk groups.3 High-risk HPVs are defined as being strongly associated with squamous carcinomas. Indeed, in women with cervical cancer, HPV viral DNA is very often detected and is mostly found to be integrated in cellular host DNA. By contrast with the episomal viral genome, this DNA integration is unable to produce viral
Head and neck squamous cell carcinomas (HNSCCs) are among the six most common malignant cancers worldwide. Most HNSCCs are originating from the epithelium of the upper aerodigestive tract. Historically, HNSCCs have been linked to well-known behavioral risk factors such as tobacco smoking and alcohol consumption. The role of HPV in HNSCC was suggested for the first time in 1983 through the immunochemical detection of viral antigens, which was confirmed in 1986 by the first detection of HPV-16 DNA in invasive HNSCC using Southern blot.1,2 Viral sequences are detected repeatedly in a variable proportion of HNSCC © XXXX American Chemical Society
Received: October 7, 2013
A
dx.doi.org/10.1021/pr401009f | J. Proteome Res. XXXX, XXX, XXX−XXX
Journal of Proteome Research
Article
Table 1. Clinical Characteristics and Disease Status of HNSCC Tumor Patients HPV status
negative
positive (genotype 16)
11 60.0 (35−81) 6/5 9/11 7/11
11 63.1 (33−83) 3/8 5/11 2/11
T1 T2 T3 T4
2 3 3 3
0 5 6 0
N0 N1 N2
5 0 6
4 2 5
tonsil base of tongue vocal fold
5 4 2 10/11
7 2 2 11/11
N= age (years) sex (M/F) smoking history (>5 pack-years and/or pipe) alcohol (>20 g/day) T stage
N stage
primary site
subsequent therapy (surgery, chemotherapy, radiotherapy)
with a tobacco risk factor. The good prognosis of HPV-positive HNSSC seems to result from a greater sensitivity to both treatments.11 Although molecular and cellular differences have been described between HPV-positive and HPV-negative HNSCC, the influence of HPV on the carcinogenesis process is still under investigation. A clearer understanding of the molecular mechanisms underlying the development of HNSCC depending on the presence or not of a HPV-DNA sequence is crucial to improve the specific management of these cancers. The aim of our study was therefore to use a quantitative proteomic approach to identify the differential regulation of the expression of proteins detected in the tumor regions of HNSCC patients with HPV DNA-positive or -negative and to determine the impact of HPV on this type of cancer. This global approach could shed light on the difference of signaling pathways modulated in HNSCC in the presence or not of papillomavirus. A better characterization of both types of HNSCC may provide new insight into the clinical management and in the development of specific therapies appropriate for each group of cancer.
particles but may contribute to the oncogenic properties of HPV, either because of the genomic instability generated or due to the deregulation of viral protein expression. Numerous in vitro studies have shown that the activities of viral proteins and particularly those of E6 and E7 proteins play an important role during carcinogenesis by neutralizing the p53 and retinoblastoma tumor (Rb) protein pathways.4 Unlike the cervical carcinomas generally associated with HPV infection, viral evidence in head and neck squamous cell carcinoma (HNSCC) is only observed in around 20 to 30% of malignancies, preferentially in the oropharyngeal region.5 Despite the existence of a transgenic mouse model in which HPV DNA is associated with squamous cell carcinoma, the direct involvement of HPV in HNSCC remains a matter of debate.6 Nevertheless, when tumors are located in the oral cavity or pharynx, high-risk HPV, and predominantly HPV-16, is the most prevalent viral genotype detected in up to 90% of HPVrelated HNSSC.7 Low-risk HPV may also be detected in the oropharyngeal cavity but is mainly associated with benign cellular proliferation in young patients. Recent data have suggested that the prevalence of HPVrelated head and neck cancers is increasing, while that of tobacco- and alcohol-related cancers is declining.5 Despite similar clinical and morphological features, the molecular signature differs between HPV-positive and HPV-negative HNSCC. Indeed, an overexpression of p16INK4A (probably due to functional inactivation of the Rb protein) has been reported in HPV-associated cancers, while under expression of p16INK4A and p21 Cip1/WAF1 is frequently observed in tobacco-related HNSCC.8,9 Furthermore, p53 mutations, lowlevel DNA methylation, and genomic instability tend to be observed mostly in tobacco-related HNSCC.8,10 In addition to these molecular differences, the presence of HPV may also modulate the local and systemic immune response and thus contribute to the control of cell proliferation during carcinogenesis. Altogether, the molecular profiles of HPV positive and negative HNSCC may explain the different outcomes observed after treatment. Indeed, the presence of HPV has been associated with a better diagnosis following both radiotherapy and chemotherapy when compared with HNSSC associated
■
EXPERIMENTAL SECTION
Patient Cohort and Sample Collection
Our study included 22 untreated HNSCC patients at Hôpital Tenon (Paris − France) who were selected according to the presence of HPV-16 or the absence of HPV DNA in a tumor section (Table 1). Biological samples were tested for HPV using the INNO-LiPA HPV Genotyping Extra commercial assay (Innogenetics, Belgium). A proteomic analysis was performed on biopsies from six of these patients who were positive (n = 3) or not (n = 3) for HPV-16 DNA. They were selected according to their tumor localizations (vocal fold, base of tongue, and tonsil) (Table 2). In addition, healthy tissues from regions adjacent to the selected tumors in these six patients were collected and studied in the same proteomic analysis to compare protein expression levels. HPV detection and quantification was also performed in these healthy tissues. Furthermore, in one HPV-positive patient (tonsil carcinoma), biopsies (tumor and controlateral healthy tissues) were B
dx.doi.org/10.1021/pr401009f | J. Proteome Res. XXXX, XXX, XXX−XXX
Journal of Proteome Research
Article
Table 2. Clinical Characteristics and Disease Status of HNSCC Tumor Patients Studied by Proteomic Analysis 1
2
3
HPV-16 (viral load)
neg
neg
neg
A
age sex smoking history (>5 pack-year and/or pipe) alcohol (>20 g/day) T stage N stage subsequent therapy primary site
68 male pos
52 female pos
55 male neg
pos T3 N0 Y base of tongue
neg T2 N0 Y tonsil
neg T1 N0 N vocal fold
B
pos (5.4 × 104/103cells) 47 female pos neg T2 N0 Y tonsil
pos (1.6 × 103/103cells) 54 male neg neg T3 N1 Y base of tongue
C pos (3.8 × 104/103cells) 33 female neg neg T2 N0 Y vocal fold
SDS-PAGE lanes and subjected to an “in-gel” tryptic digestion according to a previously described protocol.14
collected before and 2 months after the initiation of chemotherapy with docetaxel, 5-fluorouracil, and cisplatin (TPF). Serum samples from 52 HNSCC patients who had previously been characterized as being positive (n = 17) or negative (n = 35) for HPV-16 DNA were also included in our study. All biological samples were obtained from the clinical unit at Hôpital Tenon (Paris Public Hospitals, AP-HP) with an agreement of the local Ethics Committee, and written informed consent was obtained from all patients (in accordance with Article L-1245-2 of the French Huriet Law).
Nano-LC−MALDI-TOF/TOF Analysis
Digested peptides were suspended in 10% acetonitrile and 0.1% TFA and then separated using an Ultimate3000 series HPLC system (Dionex) over a 40 min gradient. Fractions were spotted online on a MALDI target using a Probot fraction collector (Dionex, Voisins le Bretonneux, France). For each band, 96 fractions were collected and analyzed using a 4800 MALDI-TOF/TOF analyzer (ABSCIEX). Spectra acquisition was performed in positive reflectron mode at fixed LASER fluency. For each spot, steps of 50 spectra were within the range 700 to 4000 Da. For each MS spectrum, the eight most abundant peaks were selected for fragmentation. One thousand MS/MS spectra per precursor were summed by increments of 50. The MS/MS peaklists obtained for one gel band were merged to obtain a single peaklist per sample lane. Peaklists were subsequently submitted to an in-house mascot version 2.2 search engine (Matrix science) for protein identification and quantification. The Swissprot 16.10.2013 (541 561 sequences; 192 480 382 residues) release database was used, selecting for Homo sapiens species. Parent and fragment mass tolerances were set, respectively, at 60 ppm and 0.3 Da; variable modifications (oxidation on methionines) and fixed modifications (carbamidomethylation on cysteine) were permitted. All proteins were identified using at least two unique peptides, a minimum ion score of 20, bold red was always required, and FDR for peptides was 1%. The MASCOT quantification protocol included no normalization, an average ratio for peptides from the same protein, fixed modifications by iTRAQ reagents on lysines and protein N-terminal, and variable modifications by iTRAQ reagents on tyrosine. Only peptides containing lysine were taken into account for the quantification to prevent any aberrant ratios. Labeling efficiency was evaluated searching the data setting iTRAQ reagents as variable modification (98.8 ± 1.5% across experiments). Whenever the results were ambiguous, the spectra in either MS or MS/MS were checked manually for proper matching, and the result was rejected or accepted accordingly. Data normalization was performed separately for each patient and each time point. Per each experiment, protein ratios were transformed in Log10, the average was calculated, and then all values were normalized to 1. In detail, the Gaussian distribution of the tumor/nontumor (t/nt) protein ratio values was normalized and the first and the last quartile of the ratio values were taken as threshold for relevant modulation of protein expression in tumor compared with healthy tissues.
HPV Viral Load and Genotype Identification
The INNO-LiPA HPV Genotyping Extra assay (Innogenetics, Belgium) is based on reverse hybridization identifying 32 different genotypes and was used according to the manufacturer’s instructions. Quantification of the high-risk (HR) HPV16 viral load was based on real-time PCR using a FAM/ MGB-labeled HPV E6 probe (FAM-5′CGACCCAGAAAGTTACCACAG3′-MGB) with two primer sets (HPV16 sense primer: 5′GAGAACTGCAATGTTTCAGGACC3′, HPV16 antisense primer: 5′TGTATAGTTGTTTGCAGCTCTGTGC3′). All PCR reactions were performed in a multiwell plate-based ABI-PRISM 7500, with each well containing a final volume of 20 μL PCR mix and 5 μL of extract. For each experiment, HPV quantification was performed using a standard curve obtained after serial dilutions of HPV16 plasmid. The amounts thus measured of HPV DNA were normalized using human genomic Albumin DNA with an inhouse real-time PCR technique, as previously described.12 Considering the uncertain relationship between HPV and HNSCC when HPV viral load is low, cancer samples with
Regulation of Interleukin‑6 in Head and Neck Squamous Cell Carcinoma Is Related to Papillomavirus Infection Ida Chiara Guerrera,†,‡ Ivan Quetier,‡,○ Rachid Fetouchi,§,○ Frederique Moreau,‡,§,∥,○ Christelle Vauloup-Fellous,‡,⊥,○ Bouchra Lekbaby,‡,∥ Caroline Rousselot,‡ Cerina Chhuon,† Aleksander Edelman,†,‡ Marine Lefevre,# Jean-Claude Nicolas,§ Dina Kremsdorf,‡,∥ Jean Lacau Saint Guily,∥,▽ and Patrick Soussan*,‡,§,∥ †
Plateau Protéome Necker, IFR 94, Université Paris Descartes, Paris, France Inserm U845 et Faculté de Médecine, Université Paris Descartes, Paris, France § Servic de Virologie, Hôpital Tenon et Faculté de Médecine, Université Pierre et Marie Curie, Paris, France ∥ Institut Universitaire de Cancerologie, Université Pierre et Marie Curie, Paris, France ⊥ Service de Virologie, Hôpital Antoine Béclère, Clamart, France # Service d’Anatomo-Pathologie, Hôpital Tenon et Faculté de Médecine, Université Pierre et Marie Curie, Paris, France ▽ Service d’Oto-Rhino-Laryngologie et Chirurgie Cervico-Faciale, Hôpital Tenon, Faculté de Médecine, Université Pierre et Marie Curie, Paris, France ‡
S Supporting Information *
ABSTRACT: The prevalence of head and neck squamous cell carcinoma (HNSCC) related to human papillomavirus (HPV) is increasing, unlike tobacco- and alcohol-associated cancers. To gain a clearer understanding of the molecular mechanisms implicated in HNSCC, depending on the presence or not of a viral sequence, we investigated the expression of proteins detected in the tumor regions of HNSCC patients. Twenty-two untreated HNSCC patients were selected according to the presence of HPV-16. For six patients, tumor and controlateral healthy tissues were tested for viral detection before quantitative proteomic analysis. After confirmation by Western blot, proteins were connected into a network, leading to investigate interleukin-6 (IL-6) by immunocytochemistry and ELISA. 41 ± 5% of proteins quantified by proteomics were differentially expressed in tumor compared with healthy regions. Among them, 36 proteins were retained as modulated in HPV-16 positive or negative tumors, including cytokeratins, tubulins, annexin A1, and serpin B1. Network analysis suggested a central role of IL-6, confirmed by overexpression of IL-6 in tumor tissues as in sera of HPV-negative HNSCC compared with HPV-16-positive tumors. This modulation may contribute to the survival and proliferation of cancer cells, although it was not related to tumor stage or to the level of HPV-16 DNA. KEYWORDS: papillomavirus, head and neck squamous cell carcinoma, proteomics, iTraq, interleukin-6
■
INTRODUCTION
depending on the site of the tumor and HPV detection methods. HPVs are epitheliotropic oncogenic viruses with more than 130 identified genotypes in humans and are classified into high-risk or low-risk groups.3 High-risk HPVs are defined as being strongly associated with squamous carcinomas. Indeed, in women with cervical cancer, HPV viral DNA is very often detected and is mostly found to be integrated in cellular host DNA. By contrast with the episomal viral genome, this DNA integration is unable to produce viral
Head and neck squamous cell carcinomas (HNSCCs) are among the six most common malignant cancers worldwide. Most HNSCCs are originating from the epithelium of the upper aerodigestive tract. Historically, HNSCCs have been linked to well-known behavioral risk factors such as tobacco smoking and alcohol consumption. The role of HPV in HNSCC was suggested for the first time in 1983 through the immunochemical detection of viral antigens, which was confirmed in 1986 by the first detection of HPV-16 DNA in invasive HNSCC using Southern blot.1,2 Viral sequences are detected repeatedly in a variable proportion of HNSCC © XXXX American Chemical Society
Received: October 7, 2013
A
dx.doi.org/10.1021/pr401009f | J. Proteome Res. XXXX, XXX, XXX−XXX
Journal of Proteome Research
Article
Table 1. Clinical Characteristics and Disease Status of HNSCC Tumor Patients HPV status
negative
positive (genotype 16)
11 60.0 (35−81) 6/5 9/11 7/11
11 63.1 (33−83) 3/8 5/11 2/11
T1 T2 T3 T4
2 3 3 3
0 5 6 0
N0 N1 N2
5 0 6
4 2 5
tonsil base of tongue vocal fold
5 4 2 10/11
7 2 2 11/11
N= age (years) sex (M/F) smoking history (>5 pack-years and/or pipe) alcohol (>20 g/day) T stage
N stage
primary site
subsequent therapy (surgery, chemotherapy, radiotherapy)
with a tobacco risk factor. The good prognosis of HPV-positive HNSSC seems to result from a greater sensitivity to both treatments.11 Although molecular and cellular differences have been described between HPV-positive and HPV-negative HNSCC, the influence of HPV on the carcinogenesis process is still under investigation. A clearer understanding of the molecular mechanisms underlying the development of HNSCC depending on the presence or not of a HPV-DNA sequence is crucial to improve the specific management of these cancers. The aim of our study was therefore to use a quantitative proteomic approach to identify the differential regulation of the expression of proteins detected in the tumor regions of HNSCC patients with HPV DNA-positive or -negative and to determine the impact of HPV on this type of cancer. This global approach could shed light on the difference of signaling pathways modulated in HNSCC in the presence or not of papillomavirus. A better characterization of both types of HNSCC may provide new insight into the clinical management and in the development of specific therapies appropriate for each group of cancer.
particles but may contribute to the oncogenic properties of HPV, either because of the genomic instability generated or due to the deregulation of viral protein expression. Numerous in vitro studies have shown that the activities of viral proteins and particularly those of E6 and E7 proteins play an important role during carcinogenesis by neutralizing the p53 and retinoblastoma tumor (Rb) protein pathways.4 Unlike the cervical carcinomas generally associated with HPV infection, viral evidence in head and neck squamous cell carcinoma (HNSCC) is only observed in around 20 to 30% of malignancies, preferentially in the oropharyngeal region.5 Despite the existence of a transgenic mouse model in which HPV DNA is associated with squamous cell carcinoma, the direct involvement of HPV in HNSCC remains a matter of debate.6 Nevertheless, when tumors are located in the oral cavity or pharynx, high-risk HPV, and predominantly HPV-16, is the most prevalent viral genotype detected in up to 90% of HPVrelated HNSSC.7 Low-risk HPV may also be detected in the oropharyngeal cavity but is mainly associated with benign cellular proliferation in young patients. Recent data have suggested that the prevalence of HPVrelated head and neck cancers is increasing, while that of tobacco- and alcohol-related cancers is declining.5 Despite similar clinical and morphological features, the molecular signature differs between HPV-positive and HPV-negative HNSCC. Indeed, an overexpression of p16INK4A (probably due to functional inactivation of the Rb protein) has been reported in HPV-associated cancers, while under expression of p16INK4A and p21 Cip1/WAF1 is frequently observed in tobacco-related HNSCC.8,9 Furthermore, p53 mutations, lowlevel DNA methylation, and genomic instability tend to be observed mostly in tobacco-related HNSCC.8,10 In addition to these molecular differences, the presence of HPV may also modulate the local and systemic immune response and thus contribute to the control of cell proliferation during carcinogenesis. Altogether, the molecular profiles of HPV positive and negative HNSCC may explain the different outcomes observed after treatment. Indeed, the presence of HPV has been associated with a better diagnosis following both radiotherapy and chemotherapy when compared with HNSSC associated
■
EXPERIMENTAL SECTION
Patient Cohort and Sample Collection
Our study included 22 untreated HNSCC patients at Hôpital Tenon (Paris − France) who were selected according to the presence of HPV-16 or the absence of HPV DNA in a tumor section (Table 1). Biological samples were tested for HPV using the INNO-LiPA HPV Genotyping Extra commercial assay (Innogenetics, Belgium). A proteomic analysis was performed on biopsies from six of these patients who were positive (n = 3) or not (n = 3) for HPV-16 DNA. They were selected according to their tumor localizations (vocal fold, base of tongue, and tonsil) (Table 2). In addition, healthy tissues from regions adjacent to the selected tumors in these six patients were collected and studied in the same proteomic analysis to compare protein expression levels. HPV detection and quantification was also performed in these healthy tissues. Furthermore, in one HPV-positive patient (tonsil carcinoma), biopsies (tumor and controlateral healthy tissues) were B
dx.doi.org/10.1021/pr401009f | J. Proteome Res. XXXX, XXX, XXX−XXX
Journal of Proteome Research
Article
Table 2. Clinical Characteristics and Disease Status of HNSCC Tumor Patients Studied by Proteomic Analysis 1
2
3
HPV-16 (viral load)
neg
neg
neg
A
age sex smoking history (>5 pack-year and/or pipe) alcohol (>20 g/day) T stage N stage subsequent therapy primary site
68 male pos
52 female pos
55 male neg
pos T3 N0 Y base of tongue
neg T2 N0 Y tonsil
neg T1 N0 N vocal fold
B
pos (5.4 × 104/103cells) 47 female pos neg T2 N0 Y tonsil
pos (1.6 × 103/103cells) 54 male neg neg T3 N1 Y base of tongue
C pos (3.8 × 104/103cells) 33 female neg neg T2 N0 Y vocal fold
SDS-PAGE lanes and subjected to an “in-gel” tryptic digestion according to a previously described protocol.14
collected before and 2 months after the initiation of chemotherapy with docetaxel, 5-fluorouracil, and cisplatin (TPF). Serum samples from 52 HNSCC patients who had previously been characterized as being positive (n = 17) or negative (n = 35) for HPV-16 DNA were also included in our study. All biological samples were obtained from the clinical unit at Hôpital Tenon (Paris Public Hospitals, AP-HP) with an agreement of the local Ethics Committee, and written informed consent was obtained from all patients (in accordance with Article L-1245-2 of the French Huriet Law).
Nano-LC−MALDI-TOF/TOF Analysis
Digested peptides were suspended in 10% acetonitrile and 0.1% TFA and then separated using an Ultimate3000 series HPLC system (Dionex) over a 40 min gradient. Fractions were spotted online on a MALDI target using a Probot fraction collector (Dionex, Voisins le Bretonneux, France). For each band, 96 fractions were collected and analyzed using a 4800 MALDI-TOF/TOF analyzer (ABSCIEX). Spectra acquisition was performed in positive reflectron mode at fixed LASER fluency. For each spot, steps of 50 spectra were within the range 700 to 4000 Da. For each MS spectrum, the eight most abundant peaks were selected for fragmentation. One thousand MS/MS spectra per precursor were summed by increments of 50. The MS/MS peaklists obtained for one gel band were merged to obtain a single peaklist per sample lane. Peaklists were subsequently submitted to an in-house mascot version 2.2 search engine (Matrix science) for protein identification and quantification. The Swissprot 16.10.2013 (541 561 sequences; 192 480 382 residues) release database was used, selecting for Homo sapiens species. Parent and fragment mass tolerances were set, respectively, at 60 ppm and 0.3 Da; variable modifications (oxidation on methionines) and fixed modifications (carbamidomethylation on cysteine) were permitted. All proteins were identified using at least two unique peptides, a minimum ion score of 20, bold red was always required, and FDR for peptides was 1%. The MASCOT quantification protocol included no normalization, an average ratio for peptides from the same protein, fixed modifications by iTRAQ reagents on lysines and protein N-terminal, and variable modifications by iTRAQ reagents on tyrosine. Only peptides containing lysine were taken into account for the quantification to prevent any aberrant ratios. Labeling efficiency was evaluated searching the data setting iTRAQ reagents as variable modification (98.8 ± 1.5% across experiments). Whenever the results were ambiguous, the spectra in either MS or MS/MS were checked manually for proper matching, and the result was rejected or accepted accordingly. Data normalization was performed separately for each patient and each time point. Per each experiment, protein ratios were transformed in Log10, the average was calculated, and then all values were normalized to 1. In detail, the Gaussian distribution of the tumor/nontumor (t/nt) protein ratio values was normalized and the first and the last quartile of the ratio values were taken as threshold for relevant modulation of protein expression in tumor compared with healthy tissues.
HPV Viral Load and Genotype Identification
The INNO-LiPA HPV Genotyping Extra assay (Innogenetics, Belgium) is based on reverse hybridization identifying 32 different genotypes and was used according to the manufacturer’s instructions. Quantification of the high-risk (HR) HPV16 viral load was based on real-time PCR using a FAM/ MGB-labeled HPV E6 probe (FAM-5′CGACCCAGAAAGTTACCACAG3′-MGB) with two primer sets (HPV16 sense primer: 5′GAGAACTGCAATGTTTCAGGACC3′, HPV16 antisense primer: 5′TGTATAGTTGTTTGCAGCTCTGTGC3′). All PCR reactions were performed in a multiwell plate-based ABI-PRISM 7500, with each well containing a final volume of 20 μL PCR mix and 5 μL of extract. For each experiment, HPV quantification was performed using a standard curve obtained after serial dilutions of HPV16 plasmid. The amounts thus measured of HPV DNA were normalized using human genomic Albumin DNA with an inhouse real-time PCR technique, as previously described.12 Considering the uncertain relationship between HPV and HNSCC when HPV viral load is low, cancer samples with
