PDFlib PLOP: PDF Linearization, Optimization, Protection Page inserted by evaluation version www.pdflib.com – [email protected]

Regulation of -Keratin Gene Expression in Hair Follicle Differentiation" BARRY C. POWELL, ANTONIETTA NESCI, AND GEORGE E. ROGERS Department of Biochemistry University of Adelaide South Australia 5000, Australia

INTRODUCTION The morphogenesis of most hairs follows a cyclic theme of cell proliferation and differentiation initiated in mid to late embryonic development and repeated throughout life.14 The focus of this growth is the production of hair fiber. A central feature of hair keratinocyte differentiation is the activation of families of keratin genes, ultimately producing cells filled with keratin protein. The formation of the first hair follicles during fetal life is noted as a thickening and subsequent down-growth of the epidermis. Once the follicle structure is organized in the deep dermis, an active period of follicle differentiation and hair growth follows (termed anagen), which is as brief as 10 days in mice but lasts for years in some species (e.g., Merino sheep). At the end of the anagen phase a short transitionary phase (catagen) leads to a dormant state (telogen) in which the fully formed hair is retained in the follicle as a club hair. A new hair is initiated alongside the old hair after replication and differentiation of the hair follicle stem cells. The stem cells responsible for the continual renewal of follicle activity, long thought to reside in the follicle bulb, are now known, at least for mouse hairs, to be in the follicle bulge, about two-thirds of the way up the f ~ l l i c l eThe . ~ cells in the bulb that give rise to the hair fiber and the inner root sheath appear to have a more limited lifespan and have been termed transiently amplifying cells.5 However, depending upon the type of hair and the species, the lifespans of these bulb cells may vary from days to years. In the natural progression of events in the hair cycle many different cell types are produced. The active hair follicle is a major structure incorporating at least 10 different cell types. Cells in the follicle bulb form the proliferative population. Up to 80% of them are committed to the inner root sheath. The remainder develop into the cells of the hair cuticle and cortex and, in large fibers, the medulla. Cell differentiation is coordinated, and a hierarchy of expression of the major structural genes is established. The hair keratin genes are activated in the cuticle and cortical keratinocytes, and the trichohyalin gene is activated in the medulla and inner root sheath cells. A major focus of our research on follicle development concerns keratin and trichohyalin gene expression and regulation. The present paper summarizes recent

'This work was supported by a grant from the Wool Research Trust Fund on the recommendation of the Australian Wool Corporation.

1

ANNALS NEW YORK ACADEMY OF SCIENCES

2

data on fundamental aspects of keratin gene expression, whereas trichohyalin gene expression is described in an accompanying paper.6

THE NUMBER OF HAIR KERATIN GENES The structural, component proteins of hairs are the keratins, which are traditionally identified as cysteine-containing proteins.' The keratin proteins form two large groups that are approximately equally abundant in most hairs. They are known as the intermediate filament proteins (IF) and the intermediate filament associated, or matrix, proteins (IFAP). The IF group comprise two protein families and the IFAP group at least six protein families (TABLE1).The IFAP group is subdivided into the high-sulphur (HS), ultrahigh-sulphur (UHS) and high-glycinehyrosine (HGT) keratin protein classes on the basis of their most abundant amino acids6 Many proteins have been sequenced, primarily from w00ls.~In total there are some 50 or more proteins. Most of the hair keratin gene families have been identified in the sheep genome. Many representative genes have been isolated and sequenced (Powell et al., unpublished data).1G15One hair keratin gene has been isolated from the human genome's and one from the mouse genome.16 Each keratin gene family seems to contain several genes, which are readily detected with a conserved probe from the coding region of any of the genes in the family. Keratin genes are also readily detected in marsupial genomes, which have been evolutionarily separate from the sheep genome for about 120 million years (FIG.1 and Powell et af., unpublished data). One interesting and useful feature of the IFAP group is that the genes lack introns and are therefore quite small, typically 1 kb or less in size (TABLE 1).8 When conserved family probes from this group are used on genomic blots of digested sheep DNA, multiple bands, each usually representing a gene, are detected. TABLE 1 lists the known wool keratin gene families and their members. For other hairs the gene data are not as extensive, but similar estimates are likely to apply based on protein analy~es'~ and genomic blots (for example, see FIG. 1 and Powell et al., unpublished data). TABLE 1. Sheep Wool Keratin Genes"

Group IF

Family IF type 1 IF type I1

IFAP

High-sulphur B2 High-sulphur BIIIA High-sulphur BIIIB Ultrahigh-sulphur cortex Ultrahigh-sulphur cuticle High-glycine/tyrosine type I F High-glycine/tyrosine type I C2 High-glycine/tyrosine type I1

Numbers 56 56

Av. Gene Size 4-5 kb 7-9 kb

7

0.9 kb

11 4

0.9 kb 0.8 kb

-1W -66

1 1 -1Oe

aData from Powell and Rogers* and references therein, except as indicated. bFrom Heid ef aL2* =From Powell el d.,unpublished data. dFrom MacKinnon et al. l5 eFrom Fratini and Rogers, unpublished data.

1 kb 1 kb 0.6 kb 0.6 kb 0.6 kb

POWELL et al.: REGULATION OF KERATIN GENE EXPRESSION

FIGURE 1. Placental and marsupial mammal zoo blot with a cuticle UHS keratin gene probe. Four pg of Eco Rl-digested D N A from placental mammals (sheep, human, and mouse) and marsupial mammals (possum, quoll, and wallaby) were electrophoresed through a 0.8% agarose gel in TAE buffer18 and transferred to Zetaprobe membrane (BIO-RAD Laboratories) using a vacuum blotting apparatus (LKB). A 1-kb fragment containing the complete human cuticle genel5 was oligolabeledlg and hybridized as described.I5 The final wash stringency was 0.1 x SSPE, 1% SDS at 65 "C.The upper and lower bands marked in the human track are 14 kb and 1 kb in size, respectively.

3

4

ANNALS NEW YORK ACADEMY OF SCIENCES

CELL TYPE AND KERATIN GENE EXPRESSION IN HAIR GROWTH In the follicle bulb there is a pool of cells that are committed to hair growth and have a sustained but finite proliferative capacity.5 Whereas few of the genes expressed in the bulb cells are known, the expression of hair keratin genes is known to be the major activity of the terminally differentiating hair keratinocytes. Once terminal differentiation is initiated, there is a rapid differentiation of the follicle bulb cells into the cells of the cuticle or cortex. The cuticle is composed of one cell type and, in general, accounts for less than 10% of the volume of the hair. In the cortex of most hair fibers two cell types predominate, known as orthocortical and paracortical cells. Cells of intermediate morphology (meso- and metacortical cells) have also been reported in some hairs.3 The different cell types have been distinguished by histochemical and electron microscopic techniques that have been interpreted as reflecting differing combinations or amounts of keratin proteins. The cortical keratinocytes contain similar amounts of the IF and IFAP groups of proteins, whereas the cuticle cells seem to contain little IF protein and a large proportion of an IFAP class, the UHS keratin proteins.8.17 The activation of specific keratin gene families is a central feature of hair keratinocyte differentiation in hair growth. The expression of many of them is being defined15J6.*0(Powell et al., in preparation) and is briefly described below.

Keratin Gene Expression in Hair Cuticle Cell Development The cellular changes that occur in cuticle cell differentiation have been detailed by electron microscopy,21 and only recently have immunological studiesZ2J3and in situ hybridization data15 begun to identify the genes that are expressed. Two cuticle keratin genes have recently been isolated and characterized.15 The genes encode small proteins (16 kDa) containing > 50 cysteine residues that belong to the class of UHS keratin proteins, a major constituent of cuticle protein.24 Once cuticle differentiation of follicle bulb cells has begun, cystine-rich granules appear in the cytoplasm.2.21The protein granules move to the cell periphery, primarily on the inner root sheath side of the cell, and the continued synthesis and accretion of granules occurs, compressing the cytoplasm and nucleus to the cortex side of the cell. Although the major layer is granular, there are filamentous aggregates in the cuticle cells visible by electron microscopy.21 They differ from the arrays seen in the cortical cells. It is interesting to speculate that they may perform some role in the transport or guidance of the granules to the cell periphery. While the composition of these filaments is not known, antibody studies suggest that not only are some of the hair cortical IF keratins synthesized in the cuticle cells, but the epithelial IF keratins 1,7, and 10 and/or 11 are also synthesized.22.23 The expression patterns of individual hair keratin IF components were not distinguishable because the hair IF antibodies cross-reacted with all the known hair IF keratins. Whereas the hair IF and K7 antibodies appeared to stain the whole cuticle layer, the K1 and K10/11 antibodies reacted only with the suprabulbar cuticle cells. This may indicate more specialized roles in cuticle cell differentiation. The relationship of these IF proteins to the cystine-rich granules and whether they are involved in the asymmetric granule movement is not known; these remain intriguing questions. The human and sheep cuticle keratin genes recently isolated encode UHS keratin proteins that belong to multigene families, and the genes appear to represent the same family in the different species.15 When the human cuticle keratin gene was used to

POWELL et al.: REGULATION OF KERATIN GENE EXPRESSION

5

probe a mammalian zoo blot at high stringency, at least 15 different bands were detected in human DNA (FIG.1).Many bands were also detected in other genomes, including those of marsupials. If the small size of the isolated, intronless cuticle UHS keratin genesI5 is typical, then many of the bands could mark separate genes, and there may be many genes in the family. Both characterized genes are expressed in the hair cuticle in a narrow developmental window, well above the follicle bulb and well after the start of cuticle cell differentiation (FIG. 2).15However, EM studies describe the appearance of cystine-rich granules in differentiating cuticle cells in the upper region of the follicle bulb.2,21It therefore seems likely that there are other UHS keratin genes that have a different developmental expression pattern and are expressed at an earlier stage of cuticle cell differentiation. One or more of the closely-related genes identified by Southern blot analysis (FIG. 1) could be involved, or, possibly, different UHS keratin genes.

Keratin Gene Expression in the Hair Cortex

In nonmedullated hairs the cortex is the major histological component, accounting for up to 90% of the cellular mass of the hair. The IF, HGT, HS, and UHS keratin proteins are the structural proteins of the cortical keratinocytes. Their relative proportions vary depending on the hair type, with the most variable being the HGT and UHS protein classes.17 By using electron microscopy two or more cell types can often be distinguished within the cortex by the arrangement of their keratin proteins. This has been interpreted as reflecting different combinations or proportions of keratin proteins. One of the major questions concerning hair cortical differentiation has long been the timing of expression of the hair keratin genes. Early protein chemical techniques2s25 could distinguish, at best, the IF group and resolve the IFAP,or matrix group, into fractions of high or low sulphur content. Antibodies have been made that have been specific for the hair IF, HGT, and HS groups22s26-28but not for the families or individual proteins within each group because of the high degree of amino acid conservation. No comprehensive study has been undertaken with all of them. To investigate the activation of the keratin genes we have mapped their expression by in situ hybridization. The molecular approach, using a bank of %-labeled probes complementary to the keratin gene families listed in TABLE1 allows the distinction between individual keratin mRNAs in the follicle, permitting high resolution. Application of the radioactive probes to consecutive longitudinal sections of the follicles allows the comparison of gene expression along the length of the follicle during fiber development. Analysis of cross sections shows the expression in the cells across the follicle at a particular development stage. In Merino fine wool follicles this technique is revealing striking sequential and spatial patterns of keratin gene expression (FIG.3 and 4). The IF genes are the first keratin genes to be activated in the development of the wool fiber; they appear to be expressed in all cortical cell types. Subsequently, the genes encoding the HGT keratin proteins are activated in the cells of one-half of the cortex, followed a little later by the genes encoding the HS and UHS keratin proteins in the cells of the complementary half of the cortex. Higher up the follicle most cortical cells then produce both HGT and HS keratin proteins, but the expression of the cortical UHS keratin genes is restricted to one-half of the cortex. Another UHS keratin protein family is synthesized exclusively in the wool c~tic1e.l~ Interestingly, these cuticle keratins are probably the last keratin proteins to be produced in hair fiber formation. The follicle cells that initially show HS and UHS

FIGURE 2. I n situ localization of human cuticle keratin UHS gene expression. Seven-pm sections of human beard hair follicles were hybridized with 35S-labeled antisense or sense (data not shown) RNA probes corresponding to the complete human cuticle keratin UHS gene, as described by MacKinnon er aLlS(A) and (B), longitudinal sections, bright field and dark field, respectively. Note that expression is first detected well above the follicle bulb and is restricted to the cuticle layer, which is several cell layers thick in these follicles. (C) and (D), oblique sections, bright field and dark field, respectively. Exposure was for 28 days. Bars: 250 pm.

z

Qm

8

4

2

z

v,

i2

POWELL et al.: REGULATION OF KERATIN GENE EXPRESSION

7

FIGURE 3. Sequential expression of keratin genes in wool follicle differentiation. A summary of gene expression in one follicle showing overlapping and discrete patterns of gene expression (Powell et al., in preparation). Consecutive longitudinal sections of fine-wool (-20 pm) Merino follicles were hybridized with antisense radioactive probes specific for each of the wool keratin gene families (see TABLE 1). A composite picture of wool keratin gene expression was assembled by comparing many sections.

IF

HGT

HS

UHS Cortex

UHS Cuticle

START OF KERATINOCYTE DIFFERENTIATION FIGURE 4. Spatial expression of keratin genes in wool follicle differentiation. A summary of gene expression in one follicle showing overlapping and discrete patterns of gene expression (Powell et al., in preparation). Consecutive cross sections of fine-wool (-20 pm) Merino follicles were hybridized with antisense radioactive probes specific for each of the wool keratin gene families (see TABLE 1). A composite picture of wool keratin gene expression was assembled by comparing many sections.

8

ANNALS NEW YORK ACADEMY OF SCIENCES

keratin gene expression and to which the cortical UHS keratin gene expression is restricted are likely to be paracortical cells, as they are known to have a higher sulphur ~ o n t e n tWhy . ~ these sequential and spatial patterns of keratin gene expression exist, what molecular controls operate in the wool follicle to initiate them, and how they relate to the properties of the cells and fiber are not yet known, but we are now in a position to investigate these questions.

REGULATION OF HAIR KERATIN GENE EXPRESSION Transcription factors interact with specific DNA sequence motifs to determine particular patterns of gene transcription, and a comparison of promoter sequences can be profitable in identifying candidate regulatory motifs. Although transcriptional regulatory motifs are most often located in the proximal promoter regions of genes, there are many examples in more distal locations, including the 3' flanking region of genes and even within gene exons and introns. The interaction between transcription factors and their DNA binding sites is often precise. A single base change has been shown to diminish or even abolish binding of transcription factors in vitro (e.g., LV-~ but) there , ~ ~are examples of degenerate binding sites (e.g., the CAAT box30 and the AP-2 site3'). Nevertheless, highly conserved sequences would seem to be more suggestive of functional importance, and this possibility would be strengthened if they are located in similar positions. In a search for conserved sequence motifs we have limited our present comparisons to the immediate 5' flanking regions of the hair keratin genes. TABLE 2 lists a number of predicted regulatory motifs in the promoter regions of hair keratin genes that have been identified by sequence comparisons. Depending on the available data, 200-700 bp of 5' flanking sequences were compared, and consensus motifs were derived by comparisons between genes of the same family. In general, within a gene family the motifs are found in similar locations with respect to the transcription start site; many of them are perfectly conserved. Eight motifs not previously identified have been found in a comparison of 15 hair keratin 2). They range from 8-12 nucleotides in length and seem to be grouped genes (TABLE with particular gene families. For example, there are two motifs that have thus far been found only in the promoter regions of HGT keratin genes, a heptamer and an octamer, and they are perfectly conserved. The HK-1 motif is a 9-bp sequence with palindromic properties, and with one exception, it is found once in the promoter regions of six hair keratin genes located 180-240 bp upstream of the transcription start site. The second copy occurs in one of the IF type I1 promoters and is located further upstream. There are only three mismatches in the seven copies of the HK-1 motif. Another motif, CU-1, has been perfectly conserved between the sheep and human cuticle genes and could be involved in cuticle-specific gene expression (see below). Apart from the predicted motifs listed, each hair keratin gene examined contains the common transcriptional regulatory motifs known as the CAAT and TATA boxes, which are important in ensuring efficient and accurate transcription. A firm role has been established for the TATA box in eukaryotic gene expression as the binding site for the RNA polymerase I1 sub~nits.32,~~ The CAAT box appears to act as a transcripWhen present, it tional activator, promoting transcription from the TATA is always located close to the TATA box, unlike many other regulatory elements. A number of CAAT-binding proteins have been purified. In vitro studies indicate that they interact and function as heterodimers and that each factor can bind to a subset of CAAT boxesMIndeed, three different CAAT-binding proteins have been found

0

?.

@

8

@ @

HK-1

(8D)

J

(8W

2 J (8D) J J

J

J

(CTITGAAGA)

HGT-1

J J

J

(TCAGITT)

HGT-2

J J 2 J

(TAATCAGA)

HS-1

J (10/12) J (11/12)

J

J(10/12)

(CCAAAGGCAAAG)

HS-2

J (9/12)

J (9/12)

J (9/12)

J (11/12) J (11/12) J (11/12)

(ACAAAAGCAGGA)

HS-3

UHS-1

cu-1

J

J

J

2 J (8/9) 3 J (2 x 8/9) J (819) J (8D)

J (7/9) J (8/9)

J 2 J (10/11)

2 J (9/11) (10/11)

J (10/11)

(AAAAATGCT) (ACAAGGAAA) (CAGGAGGAAGG)

"Where a motif is identified ( J ) the preceding number indicates two or more copies, and the numbers in parentheses show the match to the consensus if there are differences. Thus, (8/11) indicates that 8 nucleotides match the 11-nucleotide consensus. Although an arbitrary cutoff for inclusion in this table was a maximum mismatch of 3 bases in the larger consensus sequences, of the 42 sequences there are 23 perfect matches, 16 with 1mismatch, 4 with 2 mismatches, and only 3 with 3 mismatches (all to the HS-2 consensus). bReference numbers indicate the sources of the sequences for comparison. cPowell et al., unpublished data. dFratini er al., unpublished data.

UHS cuticle15 Human Sheep

HS B2A'O HS B2C10 HS B2D'O HS BIIIA 9 HS BIIIB 414 UHS cortex RabbitC Mouse16

@

0

Q

Expression Pattern

IF type 113 IF type I1 BC IF type I1 LY HGTtypeIC212 HGTtypeIFl2 HGT type I1 Rabbi@

Geneb

TABLE2. Possible Regulatory Motifs Involved in Hair Keratin Gene Expression0

10

ANNALS NEW YORK ACADEMY OF SCIENCES

in HeLa3’ and rat liver nuclei.38It is possible that several factors with differing specificities may exist within a single nucleus. Interestingly, the CAAT boxes of genes within a hair keratin gene family are generally very similar and differ from those of other hair keratin gene families. Many of the genes also appear to have two CAAT boxes (for example, see FIG.5). The diversity and frequent multiplicity of CAAT boxes in the promoter regions of the hair keratin genes raises the possibility of several CAAT-binding proteins in a follicle cell promoting different degrees of transcriptional activation. There are some interesting sequence conservations between some of the identified motifs that could be significant. The CU-1 and HS-2 motifs each contain the sequence CAGGA; the CU-1 and UHS-1 motifs share a subset of this sequence. AGGAA, and the HGT-1 and HGT-2 motifs both contain the sequence TCAG. Within the HS-1 motif the sequence CAAAG is directly repeated. A subset (AAGGCAAA) of this 12-nucleotide motif is homologous with the octamer motif (AARCCAAA, where R is a purine nucleotide) identified in the promoter region of some epidermal IF keratin genes and i n v o l ~ c r i nThe . ~ ~ HK-1 motif has an internal palindrome, a feature noted in some DNA-binding elements (e.g.. AP-1). Common sequences between motifs could indicate a combinatorial interaction of transcription factors andlor conserved DNA-binding domains.

Cuticle Keratin Genes and a Possible Cuticle-Specific Motif The first cuticle-specific keratin genes to be described in cuticle cell differentiation were a human and sheep UHS keratin gene.15 They show the same expression pattern in hair follicle morphogenesis and are likely to be equivalent genes in the different species. A comparison of these genes has identified a conserved sequence that could be a regulatory element involved in cuticle gene expression (FIG.5). It is an 11-bp motif, designated CU-1, and is the only novel conserved motif found in over a few hundred bases of 5‘ flanking sequence. In both promoters the CU-1 motif is located 36-39 bp upstream of a CAAT box. In the sheep cuticle gene promoter there are two copies present as an inverted repeat. Of the three motifs found in the cuticle gene promoter regions there is just one mismatch, which is between the two copies in the sheep promoter. The conservation of motif sequence and position in the promoters of two genes, in genomes that have been evolutionarily separate for 90 million is significant and indicative of functional importance. Interestingly, the CU-1 motifs are more conserved between species than the predicted CAAT boxes. Further, a mouse UHS keratin gene that is clearly expressed in the hair cortex and may also be expressed in the hair cuticlem contains two tandem copies of the same motif similarly positioned in its promoter region; the nearest is 17 bp upstream from the predicted CAAT box. However, no CU-1 motif has been found within 300 bp of the transcription start site of a rabbit hair cortical UHS keratin gene (Powell et aL, unpublished data), and only one copy has been found in 11 other hair keratin genes (TABLE 2); this occurs in a wool IF type I keratin gene.I3 It is significant that immunochemical studies indicate that some hair-type IF keratins are synthesized in the cuticle.” In three of the four UHS keratin genes there are two CAAT boxes. The boxes are more conserved within a species, although there is complete identity between the primate and mouse cortical genes FIG.^). Apart from the common eukaryotic CAAT and TATA transcription signals, two other DNA sequence motifs were also identified in the promoter regions of these UHS keratin genes by comparison with other hair keratin genes (FIG.5 and TABLE 2). The “HS-2-like” motif in the sheep

11

POWELL et af.: REGULATION OF KERATIN GENE EXPRESSION

CMT

vv

TATA

C C A G G A G C T G T G T M C A G ~ M C ~ T G T G T T C C T A ~ ~ ~ ~ ~ A C A ~

Ma TGCACCTCCTTCTCACCTGCTCCTCTACCTGtTCCACCCTCMTCCACCA~CCATG

CvncLB KElAlM uIL9 cilpyp ‘Hs-2’ GTTTTTTTGTTTTTTTTTTTTMCTGTTTCCAGT~A-~MGM~A

CCACCTGCAGGTGACAGGCTCACAGGC

.m

TCTTf~CTCTACTCATGTMGAGTGACACCATCGTGGAG~CGCCAGCACAGCGM~MCA~GCCCGt~CTCCGtCATC~T AGGTCATCTGUjGZCAGAGAGA~CA~ACCAGTGCCCTffiA~CCC~GC~C-GCC~AffiTCCTMGTACA~

vv

MU

GGAGGCCCCACACTGAGCCGCTTCTCTCTCTCTCCACCTGCTCCTCTGACCTACTCCACCCTCMCCCACCAGMCCATG

~~~~~~~~~~~~~~~~~~ Wl

TTGtCTMTTTGATMTCACCTATTTATCA

1%

V

UHSI

GACTGCATCTGATGCCAGCAGtCCACGG

MU

FIGURE 5. Promoter regions of hair UHS keratin genes. The proximal promoter regions of four UHS keratin genes were compared15J6 (Powell et al., unpublished data). In addition to the general eukaryotic CAAT and TATA boxes involved in gene transcription, two types of conserved motifs were identified. They have been designated as either the UHS-1 motif or the CU-1 motif (TABLE 2). Another DNA sequence motif was identified by comparison with the promoter regions of sheep wool HS keratin genes and is denoted an ‘HS-2’4ike motif (Powell et aL, unpublished data, but see TABLE 2). The likely mRNA cap sites are indicated by arrowheads. In the promoter region of the mouse UHS gene two inverted repeats (depicted by opposing arrows) mark identical CAAT box sequences. The upstream CAAT box is identical to that found in the promoter of the rabbit UHS gene (highlighted sequence).

12

ANNALS NEW YOFtK ACADEMY OF SCIENCES

cuticle gene promoter is found in the promoter regions of three sheep wool HS B2 genes (TABLE 2); the UHS-1 motif is found in the promoter regions of hair UHS keratin genes expressed in human cuticle, mouse cortex/cuticle, and rabbit cortex. Intriguingly, the 5’ noncoding regions of the sheep and human UHS keratin genes are highly conserved, showing 90% similarity over 50 bp (the predicted sizes of the 5‘ noncoding regions are 65-70 bp). Genomic blots suggest that this sequence is also conserved in the other members of this multigene family.” The conserved sequence differs from any 5’ noncoding sequences found in wool follicle keratin genes that are expressed in the cortex and may therefore represent an element that could be involved in transcriptional or translational regulation of cuticle genes.

Conserved Motifs in the Promoter of a Hair IF Type II Gene We have investigated the developmental expression of a hair IF type I1 keratin gene in the wool follicle.20Its expression pattern is considerably different from the cuticle genes described. In situ hybridization studies suggest that it is probably activated in all the cortical cells as they leave the follicle bulb (Powell et al., in preparation).20It is difficult to assess whether it is also expressed in the cuticle, because the thin, single-celled cuticle layer of the wool fibers and the lack of fine resolution of in situ experiments with 3%-labeled cRNA preclude the unambiguous identification of cuticle expression when there is also expression throughout the cortex. Surprisingly, in the promoter region of this gene there are more than 10 conserved sequence motifs; its promoter region may be remarkably complex (FIG. 6).Not only are there two motifs identified in other hair keratin genes (see TABLE 2) and a number of other motifs in common with another hair IF type I1 gene (Powell et al., in preparation), but also there are two potential AP-1 and AP-2 sites, two AARCCAAA motifs (where R is a purine nucleotide) previously identified in epithelial IF g e n e ~ , 3and ~ a KTF-1 motif that was identified in a Xenopus IF type I gene4’ and thought to be a general activator of keratin gene transcription. The Xenopus KTF-1 motif is an imperfect palindrome. It is intriguing that, although the motif noted here only has an 8/11 match to the Xenopus sequence, the match is to the central sequence, and in fact, the different nucleotides in the IF type I1 motif create a perfect palindrome. Interestingly, some hair IF genes are expressed in other keratinizing epithelia, including hoof and nail>* t0ngue,42.~~ and possibly even some cells of the thymus.42Whether these different expression patterns represent the expression of related hair IF genes will require in situ hybridization with genespecific probes for clarification. Such studies are underway. Notwithstanding this, the multitude of motifs predicted in the promoter region of the wool IF type I1 gene could confer a considerable degree of flexibility and responsiveness on its promoter. There are two Ap-1 and two Ap-2 motifs within 700bp of the transcription start site. Notably, three of them are part of longer sequences conserved between two hair IF type I1 genes (PoweIl et a[., in preparation). The AP-1 and AP-2 motifs shown to be involved in the transcription of many could ensure high-level expression. The other identified motifs could determine tissue and cell specificity.

HAIR KERATIN GENE EXPRESSION IN TRANSGENIC MICE To study the controlling sequences involved in the regulation of wool keratin gene expression and the effects of extra keratin genes on wool and hair properties,

T

C

G

T

TTTGGGGX

GAGATTGTTGACACAGCTCTXTGMTAGGCMWMTTGGCTCTTM

TCCMCTATCGCCTGCACTCGGAGTCCIACTAGAT

1

-

+I

C

motifs have been identified within 700 bp of the transcriptional start site (+1) of the gene by comparison with other hair keratin genes and other published motifs thought to be important in the regulation of gene expression. The HK-1 and HS-1motifs were identified in other hair keratin genes (see TABLE 2) and the shadeci, unlabeled bares represent some of the homologous sequences present in another hair IF type I1 gene (Powell et ol., in preparation). The AARCCAAA box was identified by Blessing et al.39in the promoter regions of epidermal IF genes. The KTF-1 box was identified in a Xempus IF type I gene.41The consensus AP-1motif is TGA z: C TCA? The consensus AP-2 motif is CC G cC G c GGC."

FIGURE 6. Putative regulatory motifs in the promoter region of the wool cortical keratin IF type I1 gene. A number of conserved DNA sequence

CrCU;KXTCK;CCAGCTPCTTGTCTCCAXATG&CCTGT-EXON

Mat ThrCya

CMT KTF.-I TATA V GWXCXGGTGA~TGCAGCTGTTGTCTCTTTGCTGCCCCTTTTACTGC~TATCCTGG~CTGCCACAGCT~CTTTGG

C

-

z W

14

ANNALS NEW YORK ACADEMY OF SCIENCES

we have recently introduced a wool keratin IF type I1 gene into the germline of mice.46The microinjected gene contained 2.3 kb of 5’ flanking DNA and 4 kb of 3’ flanking DNA. The gene appears to be correctly expressed in all cortical cells during hair development. Several lines of transgenic mice have been established with different numbers of the wool keratin genes and different levels of transgene expression. Mice with a low level of transgene expression appear phenotypically normal, but two lines with a moderate and high level of expression show unusual hair phenotypes (FIG.7). The mice with a moderate level have wavy hairs; those with a high level show a more pronounced waviness and, strikingly, display a cyclic pattern of hair loss and regrowth. Thus, as the level of transgene expression increases, the phenotype becomes more extreme. In the hair-loss phenotype, the high level of expression of the transgene appears to weaken the hairs; they break off below the skin surface and fall out prematurely once hair growth has finished. The relatively short, synchronized hair cycle in mice, coupled with the premature hair loss during the dormant stage of the hair cycle in these transgenic mice leads to striking patterns of nakedness and hair regrowth. An investigation of the structure and protein composition of the hairs revealed changes in the amounts of the endogenous mouse HGT, HS, and UHS keratin proteins. Electrophoretic analyses show an increase in IF protein and a decrease in the IFAF’ group, particularly the HS and UHS keratin protein families.& Consequently, the orderly packed array of IF and IFAP that normally occupies most of a hardened hair keratinocyte is disrupted, and only small islands remain. Instead, large globular inclusions of amorphous staining material appear strewn throughout the cells (FIG.8).46They could be composed solely of IF protein produced by transgene expression or could also include IFAP protein in a disorganized pastiche. In the light of our in siru mapping data for the wool keratin genes (FIGS.3 and 4) we attribute these reduced levels of IFAP protein to a competition for common gene transcription factors and/or steric hindrance of the increased

FIGURE 7. Phenotypes of three separate transgenic mouse lines expressing sheep wool IF type I1 genes. (A) Hair-loss transgenic line, 218; F1. (B) Hair-loss transgenic line, 297; founder. (C) Wavy hair transgenic line, 291; F1. Note the curled vibrissae and slightly matted appearance in this line.

POWELL et al.: REGULATION OF KERATIN GENE EXPRESSION

15

FIGURE 8. Transmission electron microscopy of mouse hair keratinocytes from a hair-loss transgenic line (B and D) and normal mice (A and C). Hairs were fixed and embedded, and ultrathin cross sections (A and B) and longitudinal sections (C and D) were cut and stained for electron microscopy as described.& The orderly array of IF and IFAP protein present in normal hair appears as fingerprintlike patterns in cross section (A) and parallel lines in longitudinal section (C). In the hair-loss transgenic line large inclusions of amorphous staining material disrupt the normal orderly packing of IF and IFAP (B and D). Bars: (A) and (B), 165 nm; (C) and (D), 140 nm.

16

ANNALS NEW YORK ACADEMY OF SCIENCES

amounts of IF protein preventing the later mRNAs for the HGT, HS, and UHS keratin genes from reaching ribosomes. Another sheep wool keratin gene that we are analyzing in transgenic mice is the matrix high-sulphur BIIIA gene (HS BIIIA). This gene is activated after the IF and HGT keratin genes in wool follicle development (F1cs.3and 4). We have established three lines of transgenic mice carrying this gene, two exhibiting a moderate level of transgene expression and one a low level of expression. The HS BIIIA transgene appears to be expressed in mouse hair at the same stage of hair development as the endogenous gene in sheep wool follicles (Powell et al., in preparation). There do not appear to be any visible phenotypic consequences, and no difference is detectable in the regular IF-IFAP arrangement by electron microscopy. The establishment of these lines of transgenic mice suggests that the necessary controlling elements are present in our selected sheep wool genes and that they are functionally conserved between mammals. The conserved motifs we have identified in the promoter regions could perform these functions; however, attribution of any roles as regulatory motifs will require deletion and mutagenesis studies. One potentially valuable approach in studying any normal function is to examine a variant or mutant state. Transgenesis can be a powerful tool in creating defined genetic changes in v~vo.~’ To gain an insight into why different patterns of keratin gene expression exist, we are establishing transgenic mice in which introduced HS and HGT genes are expressed promiscuously in different cells and at different times by placing them under the control of different hair keratin gene promoters.

DISCUSSION The visual parameters of hair growth, its length and diameter, are determined by the number and proliferative capacity of the follicle bulb cells. Although only a small proportion of the bulb cells (up to 20%) give rise to the hair shaft, the number has been estimated to range upward from about 200 in wool follicles that produce fibers of about 25 pm in diameter.48For the short lifetime of the hair keratinocyte, once differentiation has been initiated, there is a demand for the synthesis of large amounts of keratin protein. This may be met transcriptionally in two ways, either with few genes with very active promoters or large numbers of genes with weaker promoters. Both transcriptional strategies may operate in hair keratinocytes during differentiation, because there are multiple, closely related genes in most hair keratin gene families (TABLE I), and a number of CAAT boxes and AP-1and AP-2 motifs have been identified in some genes that could promote different degrees of transcriptional efficiency (FIGS.5 and 6). By comparing DNA sequences, regulatory regions that could be involved in directing gene expression can be identified and can provide a handle with which to investigate transcriptional control mechanisms. Through the comparison of upstream regions from 15 hair keratin genes we have identified a number of potential regulatory elements in their 5‘ flanking regions. To determine the utility of these sequences, extensive deletion, mutagenesis, and footprinting studies need to be undertaken. To facilitate these studies, we are trying to develop homologous cell lines blocked at the start of keratin gene activation based on the targeted oncogene approach4*S2 and using our hair keratin promoters in transgenic mice. Notwithstanding the current lack of a suitable cell line, transgenic mouse experiments can be used to define regulatory gene elements, although a detailed study of a promoter via transgenesis would be time consuming and expensive. Thus, the establishment of

POWELL et al.: REGULATION OF KERATIN GENE EXPRESSION

17

several mouse lines expressing a hair IF type I1 gene suggest that the appropriate DNA sequence elements are present in our construct for its correct tissue and stage-specific expression. The conserved motifs in the proximal promoter region of this gene, depicted in FIGURE 6, could be involved in directing this expression. The activation of the hair keratin genes in follicle morphogenesis is probably the final commitment of the bulb cells. Surprisingly, there is a hierarchy of keratin gene expression and not simply an activation of all the keratin genes at once. We have described unique sequential and spatial expression patterns of the IF, HGT, HS, and UHS keratin gene families. Interestingly, some of the spatial patterns are similar to those predicted by Nagorcka and Mooney53 in their reaction-diffusion model for follicle morphogenesis. Presumably these patterns reflect a higher level of control in hair keratinocyte differentiation in which specific transcriptional control proteins are activated to govern the expression of the individual members of the keratin gene families and coordinate the sequential expression of different gene keratin families. Gradients of expression could be established in an analogous way to gene expression patterns set up in Drosophilu embryogenesis.54 Uncovering the regulatory controls that determine these expression patterns is an integral and challenging task in understanding hair keratin gene expression.

SUMMARY In hair growth, as the follicle bulb cells rapidly differentiate into either cortical or cuticle hair keratinocytes, about 50-100 keratin genes are transcriptionally activated. However, this complexity can be reduced to several, highly conserved gene families. In studying the regulation of keratin gene expression in the hair follicle we have isolated genes from most of these families and have examined their expression patterns by in situ hybridization. In the cortical keratinocytes striking patterns of keratin gene expression exist, suggesting that different transcriptional hierarchies operate in the various cell types. Comparisons of the keratin gene promoter regions indicates conserved sequence motifs that could be involved in determining these cell specificities. Similarly, we have isolated related sheep and human cuticle keratin genes and find conserved DNA motifs and expression patterns in cuticle cell differentiation. Additionally, the expression of sheep wool follicle IF and high-sulfur keratin genes in transgenic mice suggests that the regulatory DNA elements and proteins of hair keratin genes are functionally conserved between mammals.

ACKNOWLEDGMENTS We thank our colleagues, Philip MacKinnon, Rebecca Keough, and Jane Arthur for clones and for sharing their data, and Brandt Clifford for photographic assistance. REFERENCES 1. MONTAGNA, W. & P. F. PARRAKAL. 1974. The Structure and Function of Skin. 3rd edit. Academic Press. New York, NY. 2. SWIFT, J. A. 1977. The histology of keratin fibres. I n Chemistry of Natural Protein Fibres. R. A. Asquith, Ed.: 81-146. Plenum Press. New York, NY. 3. ORWIN, D. F. G . 1979. The cytology and cytochemistry of the wool follicle. Int. Rev. Cytol. 60:331-374.

18

ANNALS N E W YORK ACADEMY OF SCIENCES

4. HOLBROOK, K. A., C. FISHER, B. A. DALE& R. HARTLEY. 1989. Morphogenesis of the hair

follicle during the ontogeny of human skin. In The Biology of Wool and Hair. G. E. Rogers, P. J. Reis, K. A. Ward & R. C. Marshall, Eds.: 15-35. Chapman & Hall. London. 5. CoTsARELIs,G., T.-T. SUN&R. M. LAVKER. 1990. Label-retainingcells reside in the bulge area of the pilosebaceous unit: Implications for follicular stem cells, hair cycle and skin carcinogenesis. Cell 61: 1329-1337. G. E., M. J. FIETZ& A. FRATINI. 1991. Trichohyalin and matrix proteins. Ann. 6. ROGERS, N. Y.Acad. Sci. This volume. 7. FRASER, R. D. B., T. P. MACRAE& G. E. ROGERS. 1972. Keratins, Their Composition, Structure and Biosynthesis. Thomas. Springfield, IL. 8. POWELL, B. C. & G. E. ROGERS, 1990. Hard keratin IF and associated proteins. In Cellular and Molecular Biology of Intermediate Filaments. R. D. Goldman & P. M. Steinert, Eds.: 267-300. Plenum Press. New York, NY. 9. CREWTHER, W. G. 1976. Primary structure and chemical properties of wool. In Proceedings of the 5th International Wool Textile Research Conference, Vol. 1. K. Ziegler, Ed.: 1-101. German Wool Research Institute. Aachen. 10. POWELL, B. C., M. J. SLEIGH,K. A. WARD & G. E. ROGERS. 1983. Mammalian keratin gene families: Organisation of genes coding for the B2 high-sulphur proteins of sheep wool. Nucl. Acids Res. 11: 5327-5346. B. C., G. R. CAM,M. J. FlETZ & G. E. ROGERS. 1986. Clustered arrangement of 11. POWELL, keratin intermediate filament genes. Proc. Natl. Acad. Sci. USA 83: 5048-5052. 12. KUCZEK, E. S. & G. E. ROGERS. 1987. Sheep wool (glycine + tyrosinekrich keratin genes. A family of low sequence homology. Eur. J. Biochem. 166: 79-85. 13. WILSON, B. W., K. J. EDWARDS, M. J. SLEIGH, C. R. BYRNE & K. A. WARD.1988. Complete sequence of a type I-microfibrillar keratin gene. Gene 73: 21-31. M. J., M. J, SLEIGH, K. A. WARD,B. C. POWELL & G. E. ROGERS 1989. The 14. FRENKEL, Keratin BIIIB gene family: Isolation of cDNA clones and structure of a gene and a related pseudogene. Genomics 4: 182-191. 15. MAcKiNNoN, P. J., B. C. POWELL & G. E. ROGERS.1990. Structure and expression of genes for a class of cysteine-rich proteins of the cuticle layers of differentiating wool and hair follicles. J. Cell Biology 111: 2587-2600. 16. MCNAB,A. R., L. WOOD, N. THERIAULT, T. G l E R M A N & G . VOGELI. 1989. An Ultrahigh-sulphur keratin gene is specifically expressed during hair growth. J. Invest. Dermatol. 92: 263-266. 17. GILLEspiE, J. M. 1983. The structural proteins of hair: Isolation, characterization and regulation of biosynthesis. In Biochemistry and Physiology of the Skin, Vol. 1. L. A. Goldsmith, Ed.: 475-510. Oxford University Press. London. 18. MANiATis, T., E. F. FRITSCH & J. SAMBROOK. 1982. Molecular Cloning: A laboratory manual. Cold Spring Harbor Laboratory. Cold Spring Harbor, NY. 19. FEINBERG, A. P. & B. VOGELSTEIN. 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specificity. Anal. Biochem. 132: 6-13. B., E. KUCZEK, L. CROCKER, M. O'DONNELL & G. E. ROGERS. 1989. Keratin 20. POWELL, gene expression in wool fibre development. In The Biology of Wool and Hair. G . E. Rogers, P. J. Reis, K. A. Ward & R. C. Marshall, Eds.: 325-335. Chapman & Hall. London. 21. WOODS, J. L. & D. F. G. ORWIN. 1980. Studies on the surface layers of the wool fibre cuticle. In Fibrous Proteins: Scientific, Industrial and Medical Aspects, Vol. 2. D. A. D. Parry & L. K. Creamer, Eds.: 141-150. Academic Press. London. 22. HEID, H. W., I. MOLL& W. W. FRANKE, 1988. Patterns of expression of trichocytic and epithelial cytokeratins in mammalian tissues. I. Human and bovine hair follicles. Differentiation 37: 137-157. 23. STARK, H.-J., D. BREITKREUTZ, A. LIMAT, C. M. RYLE,D. ROOP, I. LEIGH& N. FUSE~1c.1990. Keratins 1 and 10 or homologues as regular constituents of inner root sheath and cuticle cells in the human hair follicle. Eur. J. Cell Biology 53: 359-372. 1980. The proteins of the wool cuticle. In Proceedings of 24. LEY,K. F. & W. G. CREWTHER. the 6th International Wool Textile Research Conference, Vol. 2: 13-28. South African Wool Textile Research Institute. Pretoria.

POWELL er al.: REGULATION OF KERATIN GENE EXPRESSION

19

25. POWELL, B. C. & G. E. ROGERS. 1986. Hair Keratin: Composition, structure and biogenesis. In Biology of the Integument, Vol. 2. J. Bereiter-Hahn, A. G. Maltotsy & K. S. Richards, Eds.: 695-721. Springer-Verlag. Berlin. 26. HEWISH, D. R. & P. W. FRENCH. 1986. Monoclonal antibodies to a subfraction of merino wool high-tyrosine proteins. Aust. J. Biol. Sci. 3 9 341-351. P. W. & D. R. HEWISH. 1986. Localization of low-sulphur keratin proteins in the 27. FRENCH, wool follicle using monoclonal antibodies. J. Cell Biol. 102: 1412-1418. M. H., W. M. O’GUIN, C. HARDY, L. MAK& T.-T. SUN.1986. Acidic and basic 28. LYNCH, nailhair (“hard”) keratins: Their colocalization in upper cortical and cuticle cells of the human hair follicle and their relationship to “soft” keratins. J. Cell Biol. 103: 25932606. 29. RISSE,G., K. Jooss, M. NEUBERG, H.-J. BRULLER & R. MULLER. 1989. Asymmetrical recognition of the palindromic AP-1 binding site (TRE) by Fos protein complexes. EMBO J. 8: 3825-3832. 30. JOHNSON, P. F. & S. L. MCKNIGHT. 1989. Eukaryotic transcriptional regulatory proteins. Annu. Rev. Biochem. 58: 799-839. P. J., C. WANG& R. TJIAN.1987. Positive and negative regulation of transcrip31. MITCHELL, tion in vitro: Enhancer-binding protein AP-2 is inhibited by SV40 T antigen. Cell 50: 847-861. S., S. HAHN, L. GUARENTE & P. A. SHARP. 1989. Five intermediate com32. BURKATOWSKI, plexes in transcription initiation by RNA polymerase 11. Cell 5 6 549-561. K. 1989. Molecular mechanisms of transcriptional regulation in yeast. Annu. 33. STRUHL, Rev. Biochem. 58: 1051-1077. G. C., A. ROSENTHAL & R. A. FLAVELL. 1982. Sequence requirements for the 34. GROSVELD, transcription of the rabbit fJ-globin gene in vitro: The -80 region. Nucleic Acids Res. 1 0 4951-4971. Y. GLUZMAN & T. MANIATIS. 1981. Identification of DNA 35. MELLON,P., V. PARKER, sequences required for transcription of the human a 1-globin gene in a new SV40 host-vector system. Cell 27: 279-288. 36. MYERS,R. M., K. TILLEY & T. MANIATIS. 1986. Fine structure genetic analysis of a p-globin promoter. Science 232: 613-618. L. A., A. S. BALDWIN, R. W. CARTHEW & P. A. SHARP. 1988. Human CCAAT37. CHODOSH, binding proteins have heterologous subunits. Cell 53: 11-24. 38. RAYMONDJEAN, M., S. CEREGHINI & M. YANIV.1988. Several distinct “ccu?*’ box binding proteins coexist in eukaryotic cells. Proc. Natl. Acad. Sci. 85: 757-761. & J. L. JORCANO. 1987. Differentially expressed bovine 39. BLESSING, M., H. ZENTGRAF cytokeratin genes. Analysis of gene linkage and evolutionary conservation of 5‘-upstream sequences. EMBO J. 6 567-575. 40 MCNAB,A. R., P. ANDRUS, T. E. WAGNER, A. E. BUHL,D. J. WALDON, T. T. KAWABE, T. J. REA,V. GRopPl & G. Vocm. 1990. Hair-specific expression of chloramphenicol acetyltransferase in transgenic mice under the control of an ultra-high-sulphur keratin promoter. Proc. Natl. Acad. Sci. 87: 6848-6852. A. M., E. A. JONAS & T. D. SARGENT. 1990. KTF-1, a transcriptional activator of 41. SNAPE, Xenopus embryonic keratin expression. Development 109: 157-165. 1988. Patterns of expression of trichocytic and 42. HEID, H. W., I. MOLL & W. W. FRANKE. epithelial cytokeratins in mammalian tissues. 11. Concomittant and mutually exclusive synthesis of trichocytic and epithelial cytokeratins in diverse human and bovine tissues (hair follicle, nail bed and matrix, lingual papilla and thymic reticulum). Differentiation 37: 215-230. A. SCHERMER & T.-T. SUN. 1989. Expression O f 43. DHOUAILLY, D., C. XU,M. MANABE, hair-related keratins in a soft epithelium: Subpopulations of human and mouse dorsal tongue keratinocytes express keratin markers for hair-, skin-, and esophageal-type of differentiation. Exp. Cell Res. 181: 141-158. 44. CURRAN, T. & B. R. FRANZA. JR. 1988. Fos and Jun: The Ap-1 connection. Cell 55: 395-397. 45, SCHULE, R., K. UMESONO, D. J. MANGELSDORF, J. BOLADO, J. W. PIKE & R. M. EVANS. 1990. Jun-Fos and receptors for vitamins A and D recognize a common response element in the human osteocalcin gene. Cell 61: 496-504.

20

ANNALS NEW YORK ACADEMY OF SCIENCES

46. POWELL, B. C. & G. E. ROGERS. 1990. Cyclic hair-loss and regrowth in transgenic mice overexpressing an intermediate filament gene. EMBO J. 9 1485-1493. 47. HANAHAN, D. 1989. Transgenic mice as probes into complex systems. Science 246: 1265-1274. 48. HYND,P. I. 1989. Effects of nutrition on wool follicle cell kinetics in sheep differing in efficiency of wool production. Aust. J. Agric. Res. 40: 409417. 49. HANAHAN, D. 1988. Dissecting multistep tumourigenesis in transgenic mice. Annu. Rev. Genet. 22: 479-519. 50. EFRAT, S., S. LINDE,H. KOFOD,D. SPECTOR, M. DELANNOY, S. GRANT, D. HANAHAN& S. BAEKKESKOV. 1988. Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene. Proc. Natl. Acad. Sci. USA 85: 9037-9041. MISKIN, A. DEY, T. KUWABARA & H. WESTPHAL. 1989. 51. NAKAMURA, T., K. A. MAHON.R. Differentiation and oncogenesis: Phenotypically distinct lens tumours in transgenic mice. New Biologist 1: 193-204. & 1. DAMJANOV. 1990. Osteosarcomas 52. KNOWLES, B. B., J. MCCARRICK, N. Fox, D. SOLTER in transgenic mice expressing an a-amylase-SV40 T-antigen hybrid gene. Am. J. Pathol. 137: 259-262. 53. NAGORCKA, B. N. & J. R. MOONEY. 1989. The reaction-diffusion system as a spatial organiser during initiation and development of hair follicles and formation of the fibre. In The Biology of Wool and Hair. G. E. Rogers, P. J. Reis, K. A. Ward & R. C. Marshall, Eds.: 365-379. Chapman & Hall. London. 54. PANKRATZ, M. J. & H. JACKLE. 1990. Making stripes in Drosophiln embryo. Trends Genet. 6: 287-292. 55. GOODMAN, M., A. E. ROMERO-HERRERA, H. DENE,J. CZELUSNIAK & R. E. TASHIAN. 1982. Amino acid sequence evidence on the phylogeny of primates and other eutherians. I n Macromolecular Sequences in Systematic and Evolutionary Biology. M. Goodman, Ed.: 115-191. Plenum Press. New York, NY.

DISCUSSION OF THE PAPER B. HOGAN(Vanderbilt Medical School, Nashville, Tenn.): How do these gradients compare with the anteriodposterior or dorsavventral gradients of the whole animal? B. C. POWELL: I couldn’t answer that. Probably as they differentiate the follicles actually twist, so there is not a dorsalhentral side of the follicles. E. FUCHS (University of Chicago, Chicago, Ill.):Is that pattern consistent with the organization of the sebaceous gland or the muscle that is attached to the hair follicle? Or, is there any difference in terms of blood vessels or nerve endings that you can see in examining the pattern of gradient? POWELL: It is something I haven’t looked at. HOGAN:If you take a look in certain areas, are they all oriented in the same direction, or is it completely random among hair follicles close to each other? It’s random. POWELL: A. P. BERTOLINO (New York University Medical Center, New York, N.Y.): Have you examined the elements, 3‘, to your type I1 gene to see if there is anything that’s really requisite for transgenic mouse expression? POWELL: Not specifically. We had made some constructs taking the 5‘ region and part of the first exon. Linking it to an SV40 gene (3’), we see a different phenotype.