G Model DESC 2679 No. of Pages 6
Journal of Dermatological Science xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Journal of Dermatological Science journal homepage: www.jdsjournal.com
Regulation of keratinocyte differentiation by O-GlcNAcylation Kyung-Cheol Sohn a , Eun Jin Lee a , Jung-Min Shin a , Eun-Hwa Lim a , Yoonoo No b , Ji Yeoun Lee b , Tae Young Yoon b , Young Ho Lee c, Myung Im a , Young Lee a , Young-Joon Seo a , Jeung-Hoon Lee a , Chang Deok Kim a, * a
Department of Dermatology and Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, Republic of Korea Department of Dermatology, School of Medicine and Medical Research Institute, Chungbuk National University, Cheongju, Republic of Korea c Department of Anatomy, School of Medicine, Chungnam National University, Daejeon, Republic of Korea b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 12 July 2013 Received in revised form 4 April 2014 Accepted 21 April 2014
Background: O-linked b-N-acetylglucosamine (O-GlcNAc) modification is one of the posttranslational modification, emerging as an important regulatory mechanism in various cellular events. Objective: We attempted to investigate whether O-GlcNAcylation is involved in keratinocyte differentiation. Methods: Immunohistochemistry and Western blot were performed to demonstrate O-GlcNAcylation in keratinocyte differentiation. Results: During calcium-induced keratinocyte differentiation, overall O-GlcNAcylation was decreased in a temporal manner. We focused our attention on transcription factor Sp-1, which is implicated in keratinocyte differentiation. Total Sp-1 level did not change during keratinocyte differentiation. However, O-GlcNAcylated Sp-1 was decreased in a keratinocyte differentiation-dependent manner. Interestingly, transcriptional activity of Sp-1, in terms of involucrin and loricrin promoter activities, was markedly increased by overexpression of O-GlcNAcase (OGA). In addition, membrane permeable non-OGlcNAcylated Sp-1 did show transcriptional activity, while membrane permeable O-GlcNAcylated Sp-1 did not, suggesting O-GlcNAcylated Sp-1 is an inactive form in keratinocyte differentiation. Conclusion: Our results reveal that O-GlcNAcylation is a dynamic regulatory mechanism for keratinocyte differentiation. ã 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Keywords: Keratinocyte differentiation O-GlcNAcylation Sp-1
1. Introduction O-linked b-N-acetylglucosamine (O-GlcNAc) modification of protein is a monosaccharide modification abundant on serine and threonine residues [1]. This O-GlcNAcylation is catalyzed by the enzyme O-GlcNAc transferase (OGT) that transfer GlcNAc from UDP-GlcNAc to the target protein in a way similar to the phosphorylation by kinase. Conversely, O-GlcNAc can be removed from the protein by O-GlcNAcase (OGA) like phosphatase in phosphorylation system [2,3]. So far, large number of proteins have been identified to be O-GlcNAcylated. These include cytoskeletal components, metabolic enzymes, signaling molecules, transcription factors and epigenetic regulators [4–7]. OGlcNAcylation can modulate protein’s activity; for example
* Corresponding author at: Department of Dermatology, School of Medicine, Chungnam National University, 266 Munhwa-ro, Jung-gu, Daejeon, 301-747, Republic of Korea. Tel.: +82 42 580 8346; fax: +82 42 255 5098. E-mail addresses: [email protected], [email protected] (C.D. Kim).
transcription factors such as estrogen receptor, c-myc and Sp-1 are O-GlcNAcylated, which in turn affects the stability and transcriptional activities [8–10]. Keratinocyte differentiation is a process by which skin barrier is produced. During this process, gene expression is drastically changed in a spatiotemporal manner. For instance, the cornified envelope proteins such as involucrin, loricrin and filaggrin are highly increased, while the cytokeratin 5 and 14 are decreased [11]. Besides, various signaling cascades are activated and/or repressed, although the total levels for signaling proteins are not changed. The activation of intracellular signaling network leads to the activation of downstream effectors including transcription factors such as AP1, Ets and Sp-1 [12]. As mentioned before, interestingly, Sp-1 is posttranslationally modified by O-GlcNAcylation [10], we hypothesized that O-GlcNAcylation may be one of regulatory mechanisms governing the keratinocyte differentiation. In this study, we investigate whether O-GlcNAcylation is involved in keratinocyte differentiation, and provide evidence that O-GlcNAcylation is a dynamic regulatory mechanism for keratinocyte differentiation.
http://dx.doi.org/10.1016/j.jdermsci.2014.04.010 0923-1811/ ã 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Please cite this article in press as: Sohn K-C, et al. Regulation of keratinocyte differentiation by O-GlcNAcylation. J Dermatol Sci (2014), http:// dx.doi.org/10.1016/j.jdermsci.2014.04.010
G Model DESC 2679 No. of Pages 6
2
K.-C. Sohn et al. / Journal of Dermatological Science xxx (2014) xxx–xxx
2. Materials and methods
2.5. Cloning and creation of adenovirus
2.1. Ethics statement
Total RNA was isolated from cultured keratinocytes using Easyblue RNA extraction kit (Intron, Daejeon, Korea). 2 mg of total RNA was reverse transcribed with moloney-murine leukemia virus (MMLV) reverse transcriptase (ELPIS biotech, Dajeon, Korea). Aliquot of RT mixture was subjected to PCR cycles with primer set for Sp-1 (50 -ACTGAAGCTTATGAGCGACCAAGATCACTC-30 and 50 -ACTGCTCGAGTCAGAAGCCATTGCCACTGA-30 ), OGT (50 -ACTGGGATCCATGGCGTCTTCCGTGGGCAA-30 and 50 0 ACTGGCGGCCGCTTATGCTGACTCAGTGACTT-3 ), and OGA (50 ACTGGCGGCCGCATGGTGCAGAAGGAGAGTCA-30 and 50 -ACTGCTCGAGTCACAGGCTCCGACCAAGTA-30 ). The Sp-1, OGT and OGA cDNAs were subcloned into pENTR/CMV vector, and replication-incompetent adenoviruses were created using Virapower adenovirus expression system (Invitrogen, Carlsbad, CA) according to the method previously described [14].
All human skin samples were obtained under the written informed consent of donors, in accordance with the ethical committee approval process of the Institutional Review Board of Chungnam National University School of Medicine. 2.2. Reagents and antibodies The following primary antibodies were used in this study: Sp-1, hemagglutinin (HA), involucrin (Santa Cruz Biotechnology, Santa Cruz, CA), RL2, (Abcam, Cambridge, MA) Flag, OGT, OGA, actin (Sigma–Aldrich, St. Louis, MO). Secondary antibodies were purchased from Santa Cruz Biotechnology and Koma Biotech (Seoul, Korea). Calcium chloride and isopropylthiogalactoside (IPTG) were purchased from Sigma–Aldrich.
2.6. Production of membrane permeable recombinant protein 2.3. Immunohistochemistry Paraffin section of skin specimen was stained with appropriate antibodies, and visualized with Chemmate envision detection kit (Dako, Carpinteria, CA). 2.4. Cell culture Primary epidermal keratinocytes were cultured according to the method previously reported [13]. Keratinocytes were maintained in keratinocyte-serum free medium (K-SFM) supplemented with epidermal growth factor (EGF) and bovine pituitary extract (Life Technologies Corporation, Grand Island, NY). To induce differentiation, 1.2 mM calcium was added and further incubated for the indicated time points. 293A cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Life Technologies Corporation).
The Sp-1 cDNA was subcloned into pET-Hph(1), a protein transduction domain vector [15], and the OGT cDNA was subcloned into pMALc2x vector (New England Biolabs, Ipswich, MA). These vectors were introduced into E. Coli strain BL21(DE3) together or alone, then transformed bacteria were induced with 0.3 mM IPTG. Recombinant proteins were purified using Ni-NTA agarose (Qiagen, Hilden, Germany). 2.7. Western blot analysis Cells were lysed in Proprep solution (Intron, Daejeon, Korea). Samples were run on SDS-polyacrylamide gels, transferred onto nitrocellulose membranes and incubated with appropriate antibodies. Blots were then incubated with peroxidase-conjugated secondary antibodies, visualized by enhanced chemiluminescence (Intron).
Fig. 1. O-GlcNAcylation in keratinocyte differentiation. (A) Normal human epidermal keratinocytes (NHEKs) were differentiated using 1.2 mM calcium for the indicated time points. For determination of O-GlcNAcylation, cellular extracts were subjected to Western blot using anti-O-GlcNAc antibody RL2. Overall O-GlcNAcylation is decreased in keratinocyte differentiation. The protein levels for OGT and OGA were also detected by Western blot. Involucrin was used as a differentiation marker, and actin was used for loading control. (B) Immunohistochemical analysis of O-GlcNAcylation in epidermis. RL2 positive staining is slightly decreased in upper layer. OGT is observed in all layers, and intense OGA staining is seen in upper layer. Scale bar = 100 mm.
Please cite this article in press as: Sohn K-C, et al. Regulation of keratinocyte differentiation by O-GlcNAcylation. J Dermatol Sci (2014), http:// dx.doi.org/10.1016/j.jdermsci.2014.04.010
G Model DESC 2679 No. of Pages 6
K.-C. Sohn et al. / Journal of Dermatological Science xxx (2014) xxx–xxx
3
Fig. 2. O-GlcNAcylation of Sp-1 in keratinocyte differentiation. (A) Keratinocytes were induced to differentiation using 1.2 mM calcium. Protein level of Sp-1 during keratinocyte differentiation was verified by Western blot. (B) Immunohistochemical staining shows the nuclear Sp-1 staining in all epidermal layers. (C) Keratinocytes were treated with 1.2 mM calcium for the indicated time points. Cellular extracts were immunoprecipitated with anti-Sp-1 antibody, and then immunoblotted with RL2 antibody. O-GlcNAcylated Sp-1 is decreased in keratinocyte differentiation. Scale bar = 100 mm.
2.8. Luciferase reporter assay
3. Results
For creation of involucrin-luc reporter adenovirus (Ad/Invluc) and loricrin-luc reporter adenovirus (Ad/Lor-luc), genomic DNA isolated from keratinocytes was used as a template for PCR. Primer sequences were as follows: involucrin promoter, 50 CTCCATGTGTCATGGGATATG and 50 -TCAACCTGAAAGACAGAAGAG; loricrin promoter, 50 -TACCAAGCAATCCTCTCACCTTGG and 50 -TGAGGAGAGAAGATGCTGGC. The resultant PCR fragments cover from 2467 to +1239 base pairs of involucrin transcription site, and from 2033 to +12 base pairs of loricrin transcription site (http://www.ensembl.org/Multi/blastview). The promoter fragments were subcloned into pGL3 vector (Promega, Madison, WI), then moved to pENTR vector and adenoviruses were created. Keratinocytes were seeded in 6-well plate, then transduced with involucrin reporter adenovirus together with Sp-1 and/or OGT expressing adenoviruses. In some experiments, cells were first transduced with involucrin reporter adenovirus then incubated with recombinant proteins. Luciferase activity was measured using the dual luciferase reporter assay system (Promega, Madison, WI).
The easiest way to determine the O-GlcNAcylation in whole cell condition is Western blot analysis using a specific antibody that can recognize the O-GlcNAc epitope. To examine the global change in O-GlcNAcylation during keratinocyte differentiation, we treated the cultured normal human epidermal keratinocytes (NHEKs) with 1.2 mM calcium (Supplementary Fig. 1), and performed Western blot analysis using anti-O-GlcNAc antibody (RL2) [16]. Overall OGlcNAcylation decreased during keratinocyte differentiation, OGT level did not change significantly, however OGA level was highly increased at late stage of differentiation (Fig. 1A, Supplementary Fig. 2). Similarly, it looked like that overall O-GlcNAcylation decreased slightly in upper layer of normal skin tissue. OGT is observed in all epidermal layers, and OGA level was increased in upper layer (Fig. 1B). We decided to find the putative transcription factors that can be modulated by O-GlcNAcylation during keratinocyte differentiation. Since Sp-1 has a role in keratinocyte differentiation [12] and also it is O-GlcNAcylated [10], we chose Sp-1 for a further study. First, we confirmed whether Sp-1 can be O-GlcNAcylated. We transiently transfected 293A cells with plasmids for Sp-1 together with OGT or OGA, then performed immunoprecipitation. Consistent with previous data [10], Sp-1 was dynamically O-GlcNAcylated by overexpression of OGT. In contrast, overexpression of OGA resulted in remarkable decrease of O-GlcNAcylated Sp-1 (Supplementary Fig. 3).
2.9. Statistical analysis Data were evaluated statistically using Student’s t-test. Statistical significance was set at P < 0.01.
Please cite this article in press as: Sohn K-C, et al. Regulation of keratinocyte differentiation by O-GlcNAcylation. J Dermatol Sci (2014), http:// dx.doi.org/10.1016/j.jdermsci.2014.04.010
G Model DESC 2679 No. of Pages 6
4
K.-C. Sohn et al. / Journal of Dermatological Science xxx (2014) xxx–xxx
We examined the Sp-1 level during keratinocyte differentiation by Western blot analysis. Sp-1 was detected in nuclear fraction (Supplementary Fig. 4), and Sp-1 level did not change remarkably after calcium treatment of NHEKs (Fig. 2A). Consistent with this data, immunohistochemical analysis showed that Sp-1 was expressed in all epidermal layers (Fig. 2B, Supplementary Fig. 5). These results suggest that activity of Sp-1 is modulated by the posttranslational modification, rather than the change of gene expression. Indeed, we found that O-GlcNAcylated Sp-1 was decreased during keratinocyte differentiation by immunoprecipitation (Fig. 2C, Supplementary Fig. 6). We created recombinant adenoviruses expressing HA-tagged Sp-1 (Ad/HA-Sp-1), Flag-tagged OGT (Ad/Flag-OGT) and Flagtagged OGA (Ad/Flag-OGA). After transduction into NHEKs, all exogenous gene products were detected by Western blot. When OGT was overexpressed overall O-GlcNAcylation was increased, while OGA overexpression decreased overall O-GlcNAcylation in keratinocytes, confirming their functionalities (Fig. 3A). To investigate whether O-GlcNAcylation affects the transcriptional activity of Sp-1, NHEKs were transduced with involucrin reporter adenovirus (Ad/Inv-luc) and/or loricrin reporter adenovirus (Ad/ Lor-luc), together with Sp-1, OGT and OGA expressing adenoviruses. Overexpression of Sp-1 increased dramatically the involucrin and loricrin promoter activities. When OGT was cooverexpressed, transcriptional activity of Sp-1 was not affected. While, overexpression of OGA significantly increased Sp-1-induced involucrin promoter activity. With respect to loricrin promoter
activity, overexpression of OGT markedly inhibited Sp-1-induced loricrin promoter activity, somewhat different as compared with involucrin promoter. In contrast, OGA overexpression significantly increased Sp-1-induced loricrin promoter activity, similar to involucrin promoter (Fig. 3B). Based on these results, we suggest that late increase of OGA may be an important regulatory mechanism governing Sp-1 activity during keratinocyte differentiation. To further confirm this idea, we made the recombinant proteins that can penetrate cell membrane. To this end, we used a wellestablished protein transduction domain (PTD) system [15]. And, to make O-GlcNAcylated form of Sp-1, we transformed E. Coli with two different vectors; one for PTD-Sp-1, the other for OGT (Fig. 4A). Using two vector system in one E. Coli, we successfully made both non-O-GlcNAcylated and O-GlcNAcylated recombinant Sp-1 proteins (Fig. 4B). After purification, we incubated 293A cells with recombinant proteins, and confirmed that PTD-conjugated proteins can penetrate cell membrane without any change of OGlcNAcylation status (Fig. 4C). Finally, we transduced NHEKs with involucrin reporter adenovirus, then incubated with cell permeable recombinant proteins. Interestingly, when non-O-GlcNAcylated Sp-1 was introduced into the keratinocyte, involucrin promoter activity was significantly increased, however, O-GlcNAcylated Sp-1 failed to increase involucrin promoter activity (Fig. 4D). These data support the idea that O-GlcNAcylated Sp-1 is an inactive form, and Sp-1 activity is regulated by OGlcNAcylation during keratinocyte differentiation.
Fig. 3. Effect of O-GlcNAcylation on transcriptional activity of Sp-1. (A) Adenoviruses expressing HA-tagged Sp-1 (Ad/HA-Sp-1), Flag-tagged OGT (Ad/Flag-OGT) and Flagtagged OGA (Ad/Flag-OGA) were transduced into normal human epidermal keratinocytes (NHEKs) at the indicated multiplicity of infection (MOI) for 6 h. Cells were replenished with fresh medium and incubated for 2 d. Exogenously expressed genes were verified using Western blot. (B) NHEKs were transduced with 1 MOI of involucrin
Please cite this article in press as: Sohn K-C, et al. Regulation of keratinocyte differentiation by O-GlcNAcylation. J Dermatol Sci (2014), http:// dx.doi.org/10.1016/j.jdermsci.2014.04.010
G Model DESC 2679 No. of Pages 6
K.-C. Sohn et al. / Journal of Dermatological Science xxx (2014) xxx–xxx
5
Fig. 4. Effect of cell permeable recombinant Sp-1 proteins on involucrin promoter activity. (A) E. Coli vector for making the protein transduction domain (PTD)-containing Sp1 (upper). Vectors for O-GlcNAcylation in E. Coli (lower). (B) BL21(DE3) bacterial cells were transformed with Sp-1 vector alone and/or together with OGT vector. Bacterial cell extracts were prepared, and Western blot against anti-Sp-1 antibody shows that recombinant Sp-1 proteins were well produced in both cases (left). Western blot against antiRL2 antibody shows that O-GlcNAcylated Sp-1 was well produced in two vector-transformed group only (right). (C) 293A cells were incubated with purified recombinant proteins (1.0 mg/ml) for overnight. Cell extracts were then prepared and recombinant Sp-1 proteins were pull-downed using Ni-NTA agarose that can bind to His-tag of recombinant Sp-1 proteins. Western blot shows that both non-O-GlcNAcylated Sp-1 (Sp-1) and O-GlcNAcylated Sp-1 (Sp-1-O-GlcNAc) penetrate cell membrane. Control (CTL) cells were incubated in parallel without recombinant proteins. (D) Keratinocytes were transduced with involucrin reporter adenovirus at the indicated multiplicity of infection (MOI) for 6 h. Cells were replenish with fresh medium containing cell permeable recombinant proteins (0.4 mg/ml), and incubated overnight. Involucrin promoter activity was measured by luciferase. Data are expressed as fold induction SD (n = 3). *P < 0.01. Sp-1: non-O-GlcNAcylated Sp-1, Sp-1-G: O-GlcNAcylated Sp-1.
4. Discussion The results presented here highlight previously unrecognized role of O-GlcNAcylation in keratinocyte differentiation. Specifically, we demonstrated that global O-GlcNAcylation is decreased during keratinocyte differentiation; transcription factors Sp-1 is an authentic O-GlcNAcylated protein; O-GlcNAcylated Sp-1 is decreased in a keratinocyte differentiation-dependent manner; OGlcNAcase (OGA) increased Sp-1-induced involucrin and loricrin promoter activities; and finally, O-GlcNAcylated Sp-1 is an inactive form in terms of involucrin promoter activation. Keratinocyte differentiation is a process by which skin barrier is produced [11]. Many of the differentiation-related proteins are increased in amount in a spatiotemporal manner, thereby contributing to the production of cornified cell structures [17]. However, there are many proteins involved in keratinocyte differentiation, whose amount is not changed. For example, p38 MAPK and ERK are heavily involved in signal transduction from environmental stimuli such as calcium and vitamin D, although the total protein levels are not altered [18–20]. That is, phosphor forms of these signal transducers are actively involved in protein-protein interaction, thereby transmitting the environmental signals to the nucleus in the center of the cell [21]. These examples clearly indicate the importance of posttranslational modification in the modulation of proteins’ activities. O-GlcNAcylation is one of the posttranslational modifications, emerging as a regulatory mechanism in various cellular activities [22]. Classically, glycosylation is known to take place at cell surface
proteins by N-glycosylation and O-glycosylation. For N-glycosylation, N-acetylglucosamine (GlcNAc) is attached to the asparagine residue by N-linkage. For O-glycosylation, N-acetylgalactosamine (GalNAc) is attached to the serine or threonine residues by Olinkage [23]. Interestingly, different type of glycosylation has been discovered, which is occurred in cytoplasm and nuclear proteins. This glycosylation is O-GlcNAcylation, in which GlcNAc is attached to the serine or threonine residues by O-linkage in monomeric form [1]. In this study, we demonstrated that O-GlcNAcylation takes place dynamically in keratinocyte differentiation. Especially, we showed that O-GlcNAcylation of Sp-1, an important transcription factor involved in keratinocyte differentiation, was decreased in a temporal manner, and that Sp-1 activity was inversely proportional to O-GlcNAcylation. It is thought that increasing OGA in late stage of keratinocyte differentiation was responsible for the decrease of O-GlcNAcylated Sp-1. In line with this, OGA overexpression increased activity of Sp-1 in terms of involucrin and loricrin promoter activation, suggesting O-GlcNAcylated Sp-1 may be inactive for gene expression. Similarly, negative role for OGlcNAcylation on Sp-1 activity has been demonstrated in other system. For example, O-GlcNAc-deficient form of Sp-1 enhances expression of p75 neurotrophin receptor (p75NTR) in human embryonic kideny 293T cells, demonstrating that O-GlcNAcylation of Sp1 negatively regulates p75NTR expression [24]. O-GlcNAcylation affects protein’s activity via the change of three dimensional structure. For example, O-GlcNAcylation can affect the phosphorylation of target protein. Yang et al. reported that O-GlcNAcylation
Please cite this article in press as: Sohn K-C, et al. Regulation of keratinocyte differentiation by O-GlcNAcylation. J Dermatol Sci (2014), http:// dx.doi.org/10.1016/j.jdermsci.2014.04.010
G Model DESC 2679 No. of Pages 6
6
K.-C. Sohn et al. / Journal of Dermatological Science xxx (2014) xxx–xxx
of p53 leads to the conformational change that prevents the phosphorylation of serine residue at near sites of O-GlcNAcattached serine [25]. Thus, conformational change by O-GlcNAcylation can somehow provide the clues on the activity regulation of Sp-1 in keratinocytes. When Sp-1 is O-GlcNAcylated, it may not be suitable for the DNA binding. Instead, removal of O-GlcNAc from Sp-1 may confer the conformational change, leading to binding to the DNA. This idea is partly supported by the fact that OGlcNAcylation of Sp-1 B-c domain inhibits the hydrophobic interaction between Sp-1 and TATA-binding-protein-associated factor (TAF110) [26]. In other evidence, cooperative binding of Sp1/Oct1 and/or Sp-1/Elf-1 to target promoters are suppressed by elevated O-GlcNAc modification, suggesting that O-GlcNAc weakens the DNA binding of Sp-1 and its cooperative binding partners by inhibiting stable interaction on DNA templates [27]. Alternatively, there is a possibility that O-GlcNAcylation prevents phosphorylation of Sp-1, thereby inhibiting the activation of Sp-1 . The precise regulatory mechanism, however, remains to be determined. In summary, we demonstrate that O-GlcNAcylation is an important regulatory mechanism in keratinocyte differentiation, and that Sp-1 is one of transcription factors regulated by this posttranslational modification. Our findings provide new insights into the regulatory mechanism underlying keratinocyte differentiation. Acknowledgment This study was supported by the grants from the National Research Foundation of Korea (NRF-2008-331-E00227) and (2013R1A1A2059090). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jdermsci.2014.04.010. References [1] Torres CR, Hart GW. Topography and polypeptide distribution of terminal Nacetylglucosamine residues on the surfaces of intact lymphocytes. Evidence for O-linked GlcNAc. J Biol Chem 1984;259:3308–17. [2] Kreppel LK, Blomberg MA, Hart GW. Dynamic glycosylation of nuclear and cytosolic proteins. Cloning and characterization of a unique O-GlcNAc transferase with multiple tetratricopeptide repeats. J Biol Chem 1997;272:9308–15. [3] Gao Y, Wells L, Comer FI, Parker GJ, Hart GW. Dynamic O-glycosylation of nuclear and cytosolic proteins: cloning and characterization of a neutral, cytosolic b-N-acetylglucosaminidase from human brain. J Biol Chem 2001;276:9838–45.
[4] Vosseller K, Sakabe K, Wells L, Hart GW. Diverse regulation of protein function by O-GlcNAc: a nuclear and cytoplasmic carbohydrate post-translational modification. Curr Opin Chem Biol 2002;6:851–7. [5] Hart GW, Housley MP, Slawson C. Cycling of O-linked b-N-acetylglucosamine on nucleocytoplasmic proteins. Nature 2007;446:1017–22. [6] Hanover JA, Krause MW, Love DC. Bittersweet memories: linking metabolism to epigenetics through O-GlcNAcylation. Nat Rev Mol Cell Biol 2012;13:312– 21. [7] Vocadlo DJ. O-GlcNAc processing enzymes: catalytic mechanisms, substrate specificity, and enzyme regulation. Curr Opin Chem Biol 2012;16:488–97. [8] Chou TY, Dang CV, Hart GW. Glycosylation of the c-Myc transactivation domain. Proc Natl Acad Sci USA 1995;92:4417–21. [9] Cheng X, Cole RN, Zaia J, Hart GW. Alternative O-glycosylation/Ophosphorylation of the murine estrogen receptor b. Biochemistry 2000;39:11609–20. [10] Yang X, Su K, Roos MD, Chang Q, Paterson AJ, Kudlow JE. O-linkage of Nacetylglucosamine to Sp1 activation domain inhibits its transcriptional capability. Proc Natl Acad Sci USA 2001;98:6611–6. [11] Kalinin AE, Kajava AV, Steinert PM. Epithelial barrier function: assembly and structural features of the cornified cell envelope. Bioessays 2002;24:789–800. [12] Eckert RL, Crish JF, Efimova T, Dashti SR, Deucher A, Bone F, et al. Regulation of involucrin gene expression. J Invest Dermatol 2004;123:13–22. [13] Lee JS, Kim DH, Choi DK, Kim CD, Ahn GB, Yoon TY, et al. Comparison of gene expression profiles between keratinocytes, melanocytes and fibroblasts. Ann Dermatol 2013;25:36–45. [14] Shi G, Sohn KC, Li Z, Choi DK, Park YM, Kim JH, et al. Expression and functional role of Sox9 in human epidermal keratinocytes. PLoS One 2013;8:e54355. [15] Choi JM, Ahn MH, Chae WJ, Jung YG, Park JC, Song HM, et al. Intranasal delivery of the cytoplasmic domain of CTLA-4 using a novel protein transduction domain prevents allergic inflammation. Nat Med 2006;12:574–9. [16] Snow CM, Senior A, Gerace L. Monoclonal antibodies identify a group of nuclear pore complex glycoproteins. J Cell Biol 1987;104:1143–56. [17] Steinert PM, Marekov LN. The proteins elafin, filaggrin, keratin intermediate filaments, loricrin, and small proline-rich proteins 1 and 2 are isodipeptide cross-linked components of the human epidermal cornified cell envelope. J Biol Chem 1995;270:17702–11. [18] Mitev V, Miteva L. Signal transduction in keratinocytes. Exp Dermatol 1999;8:96–108. [19] Eckert RL, Efimova T, Balasubramanian S, Crish JF, Bone F, Dashti S. p38 mitogen-activated protein kinases on the body surface – a function for p38d. J Invest Dermatol 2003;120:823–8. [20] Yoon HK, Sohn KC, Lee JS, Kim YJ, Bhak J, Yang JM, et al. Prediction and evaluation of protein–protein interaction in keratinocyte differentiation. Biochem Biophys Res Commun 2008;377:662–7. [21] Cross TG, Scheel-Toellner D, Henriquez NV, Deacon E, Salmon M, Lord JM. Serine/threonine protein kinases and apoptosis. Exp Cell Res 2000;256:34–41. [22] Wells L, Hart GW. O-GlcNAc turns twenty: functional implications for posttranslational modification of nuclear and cytosolic proteins with a sugar. FEBS Lett 2003;546:154–8. [23] Spiro RG. Protein glycosylation: nature, distribution, enzymatic formation, and disease implications of glycopeptide bonds. Glycobiology 2002;12:43R–56R. [24] Kommaddi RP, Dickson KM, Barker PA. Stress-induced expression of the p75 neurotrophin receptor is regulated by O-GlcNAcylation of the Sp1 transcription factor. J Neurochem 2011;116:396–405. [25] Yang WH, Kim JE, Nam HW, Ju JW, Kim HS, Kim YS, et al. Modification of p53 with O-linked N-acetylglucosamine regulates p53 activity and stability. Nat Cell Biol 2006;8:1074–83. [26] Roos MD, Su K, Baker JR, Kudlow JE. O glycosylation of an Sp1-derived peptide blocks known Sp1 protein interactions. Mol Cell Biol 1997;17:6472–80. [27] Lim K. Chang HI. Elevated O-linked N-acetylglucosamine correlated with reduced Sp1 cooperative DNA binding with its collaborating factors in vivo. Biosci Biotechnol Biochem 2010;74:1668–72.
Please cite this article in press as: Sohn K-C, et al. Regulation of keratinocyte differentiation by O-GlcNAcylation. J Dermatol Sci (2014), http:// dx.doi.org/10.1016/j.jdermsci.2014.04.010
Journal of Dermatological Science xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Journal of Dermatological Science journal homepage: www.jdsjournal.com
Regulation of keratinocyte differentiation by O-GlcNAcylation Kyung-Cheol Sohn a , Eun Jin Lee a , Jung-Min Shin a , Eun-Hwa Lim a , Yoonoo No b , Ji Yeoun Lee b , Tae Young Yoon b , Young Ho Lee c, Myung Im a , Young Lee a , Young-Joon Seo a , Jeung-Hoon Lee a , Chang Deok Kim a, * a
Department of Dermatology and Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, Republic of Korea Department of Dermatology, School of Medicine and Medical Research Institute, Chungbuk National University, Cheongju, Republic of Korea c Department of Anatomy, School of Medicine, Chungnam National University, Daejeon, Republic of Korea b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 12 July 2013 Received in revised form 4 April 2014 Accepted 21 April 2014
Background: O-linked b-N-acetylglucosamine (O-GlcNAc) modification is one of the posttranslational modification, emerging as an important regulatory mechanism in various cellular events. Objective: We attempted to investigate whether O-GlcNAcylation is involved in keratinocyte differentiation. Methods: Immunohistochemistry and Western blot were performed to demonstrate O-GlcNAcylation in keratinocyte differentiation. Results: During calcium-induced keratinocyte differentiation, overall O-GlcNAcylation was decreased in a temporal manner. We focused our attention on transcription factor Sp-1, which is implicated in keratinocyte differentiation. Total Sp-1 level did not change during keratinocyte differentiation. However, O-GlcNAcylated Sp-1 was decreased in a keratinocyte differentiation-dependent manner. Interestingly, transcriptional activity of Sp-1, in terms of involucrin and loricrin promoter activities, was markedly increased by overexpression of O-GlcNAcase (OGA). In addition, membrane permeable non-OGlcNAcylated Sp-1 did show transcriptional activity, while membrane permeable O-GlcNAcylated Sp-1 did not, suggesting O-GlcNAcylated Sp-1 is an inactive form in keratinocyte differentiation. Conclusion: Our results reveal that O-GlcNAcylation is a dynamic regulatory mechanism for keratinocyte differentiation. ã 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Keywords: Keratinocyte differentiation O-GlcNAcylation Sp-1
1. Introduction O-linked b-N-acetylglucosamine (O-GlcNAc) modification of protein is a monosaccharide modification abundant on serine and threonine residues [1]. This O-GlcNAcylation is catalyzed by the enzyme O-GlcNAc transferase (OGT) that transfer GlcNAc from UDP-GlcNAc to the target protein in a way similar to the phosphorylation by kinase. Conversely, O-GlcNAc can be removed from the protein by O-GlcNAcase (OGA) like phosphatase in phosphorylation system [2,3]. So far, large number of proteins have been identified to be O-GlcNAcylated. These include cytoskeletal components, metabolic enzymes, signaling molecules, transcription factors and epigenetic regulators [4–7]. OGlcNAcylation can modulate protein’s activity; for example
* Corresponding author at: Department of Dermatology, School of Medicine, Chungnam National University, 266 Munhwa-ro, Jung-gu, Daejeon, 301-747, Republic of Korea. Tel.: +82 42 580 8346; fax: +82 42 255 5098. E-mail addresses: [email protected], [email protected] (C.D. Kim).
transcription factors such as estrogen receptor, c-myc and Sp-1 are O-GlcNAcylated, which in turn affects the stability and transcriptional activities [8–10]. Keratinocyte differentiation is a process by which skin barrier is produced. During this process, gene expression is drastically changed in a spatiotemporal manner. For instance, the cornified envelope proteins such as involucrin, loricrin and filaggrin are highly increased, while the cytokeratin 5 and 14 are decreased [11]. Besides, various signaling cascades are activated and/or repressed, although the total levels for signaling proteins are not changed. The activation of intracellular signaling network leads to the activation of downstream effectors including transcription factors such as AP1, Ets and Sp-1 [12]. As mentioned before, interestingly, Sp-1 is posttranslationally modified by O-GlcNAcylation [10], we hypothesized that O-GlcNAcylation may be one of regulatory mechanisms governing the keratinocyte differentiation. In this study, we investigate whether O-GlcNAcylation is involved in keratinocyte differentiation, and provide evidence that O-GlcNAcylation is a dynamic regulatory mechanism for keratinocyte differentiation.
http://dx.doi.org/10.1016/j.jdermsci.2014.04.010 0923-1811/ ã 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Please cite this article in press as: Sohn K-C, et al. Regulation of keratinocyte differentiation by O-GlcNAcylation. J Dermatol Sci (2014), http:// dx.doi.org/10.1016/j.jdermsci.2014.04.010
G Model DESC 2679 No. of Pages 6
2
K.-C. Sohn et al. / Journal of Dermatological Science xxx (2014) xxx–xxx
2. Materials and methods
2.5. Cloning and creation of adenovirus
2.1. Ethics statement
Total RNA was isolated from cultured keratinocytes using Easyblue RNA extraction kit (Intron, Daejeon, Korea). 2 mg of total RNA was reverse transcribed with moloney-murine leukemia virus (MMLV) reverse transcriptase (ELPIS biotech, Dajeon, Korea). Aliquot of RT mixture was subjected to PCR cycles with primer set for Sp-1 (50 -ACTGAAGCTTATGAGCGACCAAGATCACTC-30 and 50 -ACTGCTCGAGTCAGAAGCCATTGCCACTGA-30 ), OGT (50 -ACTGGGATCCATGGCGTCTTCCGTGGGCAA-30 and 50 0 ACTGGCGGCCGCTTATGCTGACTCAGTGACTT-3 ), and OGA (50 ACTGGCGGCCGCATGGTGCAGAAGGAGAGTCA-30 and 50 -ACTGCTCGAGTCACAGGCTCCGACCAAGTA-30 ). The Sp-1, OGT and OGA cDNAs were subcloned into pENTR/CMV vector, and replication-incompetent adenoviruses were created using Virapower adenovirus expression system (Invitrogen, Carlsbad, CA) according to the method previously described [14].
All human skin samples were obtained under the written informed consent of donors, in accordance with the ethical committee approval process of the Institutional Review Board of Chungnam National University School of Medicine. 2.2. Reagents and antibodies The following primary antibodies were used in this study: Sp-1, hemagglutinin (HA), involucrin (Santa Cruz Biotechnology, Santa Cruz, CA), RL2, (Abcam, Cambridge, MA) Flag, OGT, OGA, actin (Sigma–Aldrich, St. Louis, MO). Secondary antibodies were purchased from Santa Cruz Biotechnology and Koma Biotech (Seoul, Korea). Calcium chloride and isopropylthiogalactoside (IPTG) were purchased from Sigma–Aldrich.
2.6. Production of membrane permeable recombinant protein 2.3. Immunohistochemistry Paraffin section of skin specimen was stained with appropriate antibodies, and visualized with Chemmate envision detection kit (Dako, Carpinteria, CA). 2.4. Cell culture Primary epidermal keratinocytes were cultured according to the method previously reported [13]. Keratinocytes were maintained in keratinocyte-serum free medium (K-SFM) supplemented with epidermal growth factor (EGF) and bovine pituitary extract (Life Technologies Corporation, Grand Island, NY). To induce differentiation, 1.2 mM calcium was added and further incubated for the indicated time points. 293A cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Life Technologies Corporation).
The Sp-1 cDNA was subcloned into pET-Hph(1), a protein transduction domain vector [15], and the OGT cDNA was subcloned into pMALc2x vector (New England Biolabs, Ipswich, MA). These vectors were introduced into E. Coli strain BL21(DE3) together or alone, then transformed bacteria were induced with 0.3 mM IPTG. Recombinant proteins were purified using Ni-NTA agarose (Qiagen, Hilden, Germany). 2.7. Western blot analysis Cells were lysed in Proprep solution (Intron, Daejeon, Korea). Samples were run on SDS-polyacrylamide gels, transferred onto nitrocellulose membranes and incubated with appropriate antibodies. Blots were then incubated with peroxidase-conjugated secondary antibodies, visualized by enhanced chemiluminescence (Intron).
Fig. 1. O-GlcNAcylation in keratinocyte differentiation. (A) Normal human epidermal keratinocytes (NHEKs) were differentiated using 1.2 mM calcium for the indicated time points. For determination of O-GlcNAcylation, cellular extracts were subjected to Western blot using anti-O-GlcNAc antibody RL2. Overall O-GlcNAcylation is decreased in keratinocyte differentiation. The protein levels for OGT and OGA were also detected by Western blot. Involucrin was used as a differentiation marker, and actin was used for loading control. (B) Immunohistochemical analysis of O-GlcNAcylation in epidermis. RL2 positive staining is slightly decreased in upper layer. OGT is observed in all layers, and intense OGA staining is seen in upper layer. Scale bar = 100 mm.
Please cite this article in press as: Sohn K-C, et al. Regulation of keratinocyte differentiation by O-GlcNAcylation. J Dermatol Sci (2014), http:// dx.doi.org/10.1016/j.jdermsci.2014.04.010
G Model DESC 2679 No. of Pages 6
K.-C. Sohn et al. / Journal of Dermatological Science xxx (2014) xxx–xxx
3
Fig. 2. O-GlcNAcylation of Sp-1 in keratinocyte differentiation. (A) Keratinocytes were induced to differentiation using 1.2 mM calcium. Protein level of Sp-1 during keratinocyte differentiation was verified by Western blot. (B) Immunohistochemical staining shows the nuclear Sp-1 staining in all epidermal layers. (C) Keratinocytes were treated with 1.2 mM calcium for the indicated time points. Cellular extracts were immunoprecipitated with anti-Sp-1 antibody, and then immunoblotted with RL2 antibody. O-GlcNAcylated Sp-1 is decreased in keratinocyte differentiation. Scale bar = 100 mm.
2.8. Luciferase reporter assay
3. Results
For creation of involucrin-luc reporter adenovirus (Ad/Invluc) and loricrin-luc reporter adenovirus (Ad/Lor-luc), genomic DNA isolated from keratinocytes was used as a template for PCR. Primer sequences were as follows: involucrin promoter, 50 CTCCATGTGTCATGGGATATG and 50 -TCAACCTGAAAGACAGAAGAG; loricrin promoter, 50 -TACCAAGCAATCCTCTCACCTTGG and 50 -TGAGGAGAGAAGATGCTGGC. The resultant PCR fragments cover from 2467 to +1239 base pairs of involucrin transcription site, and from 2033 to +12 base pairs of loricrin transcription site (http://www.ensembl.org/Multi/blastview). The promoter fragments were subcloned into pGL3 vector (Promega, Madison, WI), then moved to pENTR vector and adenoviruses were created. Keratinocytes were seeded in 6-well plate, then transduced with involucrin reporter adenovirus together with Sp-1 and/or OGT expressing adenoviruses. In some experiments, cells were first transduced with involucrin reporter adenovirus then incubated with recombinant proteins. Luciferase activity was measured using the dual luciferase reporter assay system (Promega, Madison, WI).
The easiest way to determine the O-GlcNAcylation in whole cell condition is Western blot analysis using a specific antibody that can recognize the O-GlcNAc epitope. To examine the global change in O-GlcNAcylation during keratinocyte differentiation, we treated the cultured normal human epidermal keratinocytes (NHEKs) with 1.2 mM calcium (Supplementary Fig. 1), and performed Western blot analysis using anti-O-GlcNAc antibody (RL2) [16]. Overall OGlcNAcylation decreased during keratinocyte differentiation, OGT level did not change significantly, however OGA level was highly increased at late stage of differentiation (Fig. 1A, Supplementary Fig. 2). Similarly, it looked like that overall O-GlcNAcylation decreased slightly in upper layer of normal skin tissue. OGT is observed in all epidermal layers, and OGA level was increased in upper layer (Fig. 1B). We decided to find the putative transcription factors that can be modulated by O-GlcNAcylation during keratinocyte differentiation. Since Sp-1 has a role in keratinocyte differentiation [12] and also it is O-GlcNAcylated [10], we chose Sp-1 for a further study. First, we confirmed whether Sp-1 can be O-GlcNAcylated. We transiently transfected 293A cells with plasmids for Sp-1 together with OGT or OGA, then performed immunoprecipitation. Consistent with previous data [10], Sp-1 was dynamically O-GlcNAcylated by overexpression of OGT. In contrast, overexpression of OGA resulted in remarkable decrease of O-GlcNAcylated Sp-1 (Supplementary Fig. 3).
2.9. Statistical analysis Data were evaluated statistically using Student’s t-test. Statistical significance was set at P < 0.01.
Please cite this article in press as: Sohn K-C, et al. Regulation of keratinocyte differentiation by O-GlcNAcylation. J Dermatol Sci (2014), http:// dx.doi.org/10.1016/j.jdermsci.2014.04.010
G Model DESC 2679 No. of Pages 6
4
K.-C. Sohn et al. / Journal of Dermatological Science xxx (2014) xxx–xxx
We examined the Sp-1 level during keratinocyte differentiation by Western blot analysis. Sp-1 was detected in nuclear fraction (Supplementary Fig. 4), and Sp-1 level did not change remarkably after calcium treatment of NHEKs (Fig. 2A). Consistent with this data, immunohistochemical analysis showed that Sp-1 was expressed in all epidermal layers (Fig. 2B, Supplementary Fig. 5). These results suggest that activity of Sp-1 is modulated by the posttranslational modification, rather than the change of gene expression. Indeed, we found that O-GlcNAcylated Sp-1 was decreased during keratinocyte differentiation by immunoprecipitation (Fig. 2C, Supplementary Fig. 6). We created recombinant adenoviruses expressing HA-tagged Sp-1 (Ad/HA-Sp-1), Flag-tagged OGT (Ad/Flag-OGT) and Flagtagged OGA (Ad/Flag-OGA). After transduction into NHEKs, all exogenous gene products were detected by Western blot. When OGT was overexpressed overall O-GlcNAcylation was increased, while OGA overexpression decreased overall O-GlcNAcylation in keratinocytes, confirming their functionalities (Fig. 3A). To investigate whether O-GlcNAcylation affects the transcriptional activity of Sp-1, NHEKs were transduced with involucrin reporter adenovirus (Ad/Inv-luc) and/or loricrin reporter adenovirus (Ad/ Lor-luc), together with Sp-1, OGT and OGA expressing adenoviruses. Overexpression of Sp-1 increased dramatically the involucrin and loricrin promoter activities. When OGT was cooverexpressed, transcriptional activity of Sp-1 was not affected. While, overexpression of OGA significantly increased Sp-1-induced involucrin promoter activity. With respect to loricrin promoter
activity, overexpression of OGT markedly inhibited Sp-1-induced loricrin promoter activity, somewhat different as compared with involucrin promoter. In contrast, OGA overexpression significantly increased Sp-1-induced loricrin promoter activity, similar to involucrin promoter (Fig. 3B). Based on these results, we suggest that late increase of OGA may be an important regulatory mechanism governing Sp-1 activity during keratinocyte differentiation. To further confirm this idea, we made the recombinant proteins that can penetrate cell membrane. To this end, we used a wellestablished protein transduction domain (PTD) system [15]. And, to make O-GlcNAcylated form of Sp-1, we transformed E. Coli with two different vectors; one for PTD-Sp-1, the other for OGT (Fig. 4A). Using two vector system in one E. Coli, we successfully made both non-O-GlcNAcylated and O-GlcNAcylated recombinant Sp-1 proteins (Fig. 4B). After purification, we incubated 293A cells with recombinant proteins, and confirmed that PTD-conjugated proteins can penetrate cell membrane without any change of OGlcNAcylation status (Fig. 4C). Finally, we transduced NHEKs with involucrin reporter adenovirus, then incubated with cell permeable recombinant proteins. Interestingly, when non-O-GlcNAcylated Sp-1 was introduced into the keratinocyte, involucrin promoter activity was significantly increased, however, O-GlcNAcylated Sp-1 failed to increase involucrin promoter activity (Fig. 4D). These data support the idea that O-GlcNAcylated Sp-1 is an inactive form, and Sp-1 activity is regulated by OGlcNAcylation during keratinocyte differentiation.
Fig. 3. Effect of O-GlcNAcylation on transcriptional activity of Sp-1. (A) Adenoviruses expressing HA-tagged Sp-1 (Ad/HA-Sp-1), Flag-tagged OGT (Ad/Flag-OGT) and Flagtagged OGA (Ad/Flag-OGA) were transduced into normal human epidermal keratinocytes (NHEKs) at the indicated multiplicity of infection (MOI) for 6 h. Cells were replenished with fresh medium and incubated for 2 d. Exogenously expressed genes were verified using Western blot. (B) NHEKs were transduced with 1 MOI of involucrin
Please cite this article in press as: Sohn K-C, et al. Regulation of keratinocyte differentiation by O-GlcNAcylation. J Dermatol Sci (2014), http:// dx.doi.org/10.1016/j.jdermsci.2014.04.010
G Model DESC 2679 No. of Pages 6
K.-C. Sohn et al. / Journal of Dermatological Science xxx (2014) xxx–xxx
5
Fig. 4. Effect of cell permeable recombinant Sp-1 proteins on involucrin promoter activity. (A) E. Coli vector for making the protein transduction domain (PTD)-containing Sp1 (upper). Vectors for O-GlcNAcylation in E. Coli (lower). (B) BL21(DE3) bacterial cells were transformed with Sp-1 vector alone and/or together with OGT vector. Bacterial cell extracts were prepared, and Western blot against anti-Sp-1 antibody shows that recombinant Sp-1 proteins were well produced in both cases (left). Western blot against antiRL2 antibody shows that O-GlcNAcylated Sp-1 was well produced in two vector-transformed group only (right). (C) 293A cells were incubated with purified recombinant proteins (1.0 mg/ml) for overnight. Cell extracts were then prepared and recombinant Sp-1 proteins were pull-downed using Ni-NTA agarose that can bind to His-tag of recombinant Sp-1 proteins. Western blot shows that both non-O-GlcNAcylated Sp-1 (Sp-1) and O-GlcNAcylated Sp-1 (Sp-1-O-GlcNAc) penetrate cell membrane. Control (CTL) cells were incubated in parallel without recombinant proteins. (D) Keratinocytes were transduced with involucrin reporter adenovirus at the indicated multiplicity of infection (MOI) for 6 h. Cells were replenish with fresh medium containing cell permeable recombinant proteins (0.4 mg/ml), and incubated overnight. Involucrin promoter activity was measured by luciferase. Data are expressed as fold induction SD (n = 3). *P < 0.01. Sp-1: non-O-GlcNAcylated Sp-1, Sp-1-G: O-GlcNAcylated Sp-1.
4. Discussion The results presented here highlight previously unrecognized role of O-GlcNAcylation in keratinocyte differentiation. Specifically, we demonstrated that global O-GlcNAcylation is decreased during keratinocyte differentiation; transcription factors Sp-1 is an authentic O-GlcNAcylated protein; O-GlcNAcylated Sp-1 is decreased in a keratinocyte differentiation-dependent manner; OGlcNAcase (OGA) increased Sp-1-induced involucrin and loricrin promoter activities; and finally, O-GlcNAcylated Sp-1 is an inactive form in terms of involucrin promoter activation. Keratinocyte differentiation is a process by which skin barrier is produced [11]. Many of the differentiation-related proteins are increased in amount in a spatiotemporal manner, thereby contributing to the production of cornified cell structures [17]. However, there are many proteins involved in keratinocyte differentiation, whose amount is not changed. For example, p38 MAPK and ERK are heavily involved in signal transduction from environmental stimuli such as calcium and vitamin D, although the total protein levels are not altered [18–20]. That is, phosphor forms of these signal transducers are actively involved in protein-protein interaction, thereby transmitting the environmental signals to the nucleus in the center of the cell [21]. These examples clearly indicate the importance of posttranslational modification in the modulation of proteins’ activities. O-GlcNAcylation is one of the posttranslational modifications, emerging as a regulatory mechanism in various cellular activities [22]. Classically, glycosylation is known to take place at cell surface
proteins by N-glycosylation and O-glycosylation. For N-glycosylation, N-acetylglucosamine (GlcNAc) is attached to the asparagine residue by N-linkage. For O-glycosylation, N-acetylgalactosamine (GalNAc) is attached to the serine or threonine residues by Olinkage [23]. Interestingly, different type of glycosylation has been discovered, which is occurred in cytoplasm and nuclear proteins. This glycosylation is O-GlcNAcylation, in which GlcNAc is attached to the serine or threonine residues by O-linkage in monomeric form [1]. In this study, we demonstrated that O-GlcNAcylation takes place dynamically in keratinocyte differentiation. Especially, we showed that O-GlcNAcylation of Sp-1, an important transcription factor involved in keratinocyte differentiation, was decreased in a temporal manner, and that Sp-1 activity was inversely proportional to O-GlcNAcylation. It is thought that increasing OGA in late stage of keratinocyte differentiation was responsible for the decrease of O-GlcNAcylated Sp-1. In line with this, OGA overexpression increased activity of Sp-1 in terms of involucrin and loricrin promoter activation, suggesting O-GlcNAcylated Sp-1 may be inactive for gene expression. Similarly, negative role for OGlcNAcylation on Sp-1 activity has been demonstrated in other system. For example, O-GlcNAc-deficient form of Sp-1 enhances expression of p75 neurotrophin receptor (p75NTR) in human embryonic kideny 293T cells, demonstrating that O-GlcNAcylation of Sp1 negatively regulates p75NTR expression [24]. O-GlcNAcylation affects protein’s activity via the change of three dimensional structure. For example, O-GlcNAcylation can affect the phosphorylation of target protein. Yang et al. reported that O-GlcNAcylation
Please cite this article in press as: Sohn K-C, et al. Regulation of keratinocyte differentiation by O-GlcNAcylation. J Dermatol Sci (2014), http:// dx.doi.org/10.1016/j.jdermsci.2014.04.010
G Model DESC 2679 No. of Pages 6
6
K.-C. Sohn et al. / Journal of Dermatological Science xxx (2014) xxx–xxx
of p53 leads to the conformational change that prevents the phosphorylation of serine residue at near sites of O-GlcNAcattached serine [25]. Thus, conformational change by O-GlcNAcylation can somehow provide the clues on the activity regulation of Sp-1 in keratinocytes. When Sp-1 is O-GlcNAcylated, it may not be suitable for the DNA binding. Instead, removal of O-GlcNAc from Sp-1 may confer the conformational change, leading to binding to the DNA. This idea is partly supported by the fact that OGlcNAcylation of Sp-1 B-c domain inhibits the hydrophobic interaction between Sp-1 and TATA-binding-protein-associated factor (TAF110) [26]. In other evidence, cooperative binding of Sp1/Oct1 and/or Sp-1/Elf-1 to target promoters are suppressed by elevated O-GlcNAc modification, suggesting that O-GlcNAc weakens the DNA binding of Sp-1 and its cooperative binding partners by inhibiting stable interaction on DNA templates [27]. Alternatively, there is a possibility that O-GlcNAcylation prevents phosphorylation of Sp-1, thereby inhibiting the activation of Sp-1 . The precise regulatory mechanism, however, remains to be determined. In summary, we demonstrate that O-GlcNAcylation is an important regulatory mechanism in keratinocyte differentiation, and that Sp-1 is one of transcription factors regulated by this posttranslational modification. Our findings provide new insights into the regulatory mechanism underlying keratinocyte differentiation. Acknowledgment This study was supported by the grants from the National Research Foundation of Korea (NRF-2008-331-E00227) and (2013R1A1A2059090). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jdermsci.2014.04.010. References [1] Torres CR, Hart GW. Topography and polypeptide distribution of terminal Nacetylglucosamine residues on the surfaces of intact lymphocytes. Evidence for O-linked GlcNAc. J Biol Chem 1984;259:3308–17. [2] Kreppel LK, Blomberg MA, Hart GW. Dynamic glycosylation of nuclear and cytosolic proteins. Cloning and characterization of a unique O-GlcNAc transferase with multiple tetratricopeptide repeats. J Biol Chem 1997;272:9308–15. [3] Gao Y, Wells L, Comer FI, Parker GJ, Hart GW. Dynamic O-glycosylation of nuclear and cytosolic proteins: cloning and characterization of a neutral, cytosolic b-N-acetylglucosaminidase from human brain. J Biol Chem 2001;276:9838–45.
[4] Vosseller K, Sakabe K, Wells L, Hart GW. Diverse regulation of protein function by O-GlcNAc: a nuclear and cytoplasmic carbohydrate post-translational modification. Curr Opin Chem Biol 2002;6:851–7. [5] Hart GW, Housley MP, Slawson C. Cycling of O-linked b-N-acetylglucosamine on nucleocytoplasmic proteins. Nature 2007;446:1017–22. [6] Hanover JA, Krause MW, Love DC. Bittersweet memories: linking metabolism to epigenetics through O-GlcNAcylation. Nat Rev Mol Cell Biol 2012;13:312– 21. [7] Vocadlo DJ. O-GlcNAc processing enzymes: catalytic mechanisms, substrate specificity, and enzyme regulation. Curr Opin Chem Biol 2012;16:488–97. [8] Chou TY, Dang CV, Hart GW. Glycosylation of the c-Myc transactivation domain. Proc Natl Acad Sci USA 1995;92:4417–21. [9] Cheng X, Cole RN, Zaia J, Hart GW. Alternative O-glycosylation/Ophosphorylation of the murine estrogen receptor b. Biochemistry 2000;39:11609–20. [10] Yang X, Su K, Roos MD, Chang Q, Paterson AJ, Kudlow JE. O-linkage of Nacetylglucosamine to Sp1 activation domain inhibits its transcriptional capability. Proc Natl Acad Sci USA 2001;98:6611–6. [11] Kalinin AE, Kajava AV, Steinert PM. Epithelial barrier function: assembly and structural features of the cornified cell envelope. Bioessays 2002;24:789–800. [12] Eckert RL, Crish JF, Efimova T, Dashti SR, Deucher A, Bone F, et al. Regulation of involucrin gene expression. J Invest Dermatol 2004;123:13–22. [13] Lee JS, Kim DH, Choi DK, Kim CD, Ahn GB, Yoon TY, et al. Comparison of gene expression profiles between keratinocytes, melanocytes and fibroblasts. Ann Dermatol 2013;25:36–45. [14] Shi G, Sohn KC, Li Z, Choi DK, Park YM, Kim JH, et al. Expression and functional role of Sox9 in human epidermal keratinocytes. PLoS One 2013;8:e54355. [15] Choi JM, Ahn MH, Chae WJ, Jung YG, Park JC, Song HM, et al. Intranasal delivery of the cytoplasmic domain of CTLA-4 using a novel protein transduction domain prevents allergic inflammation. Nat Med 2006;12:574–9. [16] Snow CM, Senior A, Gerace L. Monoclonal antibodies identify a group of nuclear pore complex glycoproteins. J Cell Biol 1987;104:1143–56. [17] Steinert PM, Marekov LN. The proteins elafin, filaggrin, keratin intermediate filaments, loricrin, and small proline-rich proteins 1 and 2 are isodipeptide cross-linked components of the human epidermal cornified cell envelope. J Biol Chem 1995;270:17702–11. [18] Mitev V, Miteva L. Signal transduction in keratinocytes. Exp Dermatol 1999;8:96–108. [19] Eckert RL, Efimova T, Balasubramanian S, Crish JF, Bone F, Dashti S. p38 mitogen-activated protein kinases on the body surface – a function for p38d. J Invest Dermatol 2003;120:823–8. [20] Yoon HK, Sohn KC, Lee JS, Kim YJ, Bhak J, Yang JM, et al. Prediction and evaluation of protein–protein interaction in keratinocyte differentiation. Biochem Biophys Res Commun 2008;377:662–7. [21] Cross TG, Scheel-Toellner D, Henriquez NV, Deacon E, Salmon M, Lord JM. Serine/threonine protein kinases and apoptosis. Exp Cell Res 2000;256:34–41. [22] Wells L, Hart GW. O-GlcNAc turns twenty: functional implications for posttranslational modification of nuclear and cytosolic proteins with a sugar. FEBS Lett 2003;546:154–8. [23] Spiro RG. Protein glycosylation: nature, distribution, enzymatic formation, and disease implications of glycopeptide bonds. Glycobiology 2002;12:43R–56R. [24] Kommaddi RP, Dickson KM, Barker PA. Stress-induced expression of the p75 neurotrophin receptor is regulated by O-GlcNAcylation of the Sp1 transcription factor. J Neurochem 2011;116:396–405. [25] Yang WH, Kim JE, Nam HW, Ju JW, Kim HS, Kim YS, et al. Modification of p53 with O-linked N-acetylglucosamine regulates p53 activity and stability. Nat Cell Biol 2006;8:1074–83. [26] Roos MD, Su K, Baker JR, Kudlow JE. O glycosylation of an Sp1-derived peptide blocks known Sp1 protein interactions. Mol Cell Biol 1997;17:6472–80. [27] Lim K. Chang HI. Elevated O-linked N-acetylglucosamine correlated with reduced Sp1 cooperative DNA binding with its collaborating factors in vivo. Biosci Biotechnol Biochem 2010;74:1668–72.
Please cite this article in press as: Sohn K-C, et al. Regulation of keratinocyte differentiation by O-GlcNAcylation. J Dermatol Sci (2014), http:// dx.doi.org/10.1016/j.jdermsci.2014.04.010
