Regulation of methionine biosynthesis in the Enterobacteriaceae.

Prog.Biophys.molec.Biol.,Vol.56, pp. 145-185,1991. Printed in GreatBritain.All rightsreserved.

007945107/91$0.00+.50 © 1991PergamonPresspie

REGULATION OF METHIONINE BIOSYNTHESIS IN THE ENTEROBACTERIACEAE§ lAIN G . OLD,* SIMON E. V. PI-IILLIPS,t I~TER G . SrOCKLEV:I: a n d ISABELLE SAINT GrRONS*

* Unit~ de Bact~riologie Mol~culaire et M~dicale, D~partement de Bact~riologie et Mycologie, Institut Pasteur, 28 rue du Dr. Roux, 75724 Paris Cedex 15, France tDepartment of Biochemistry and Molecular Biology; ~Department of Genetics, University of Leeds, Leeds, LS2 9JT, U.K.

CONTENTS INTRODUCTION

145

METHIONINE 1. The Structure and Properties of Methionine 2. The Transport of Methionine

146 146 146

III.

THE ENZYMESAND CORRESPONDINGGENES 1. The Common Pathway to Methionine, Diaminopimelate, Lysine, Threonine, Isoleucine and Valine (a) Aspartate to fl-aspartyl phosphate (b) fl-Aspartyl phosphate to aspartate semialdehyde (c) Aspartate semialdehyde to homoserine 2. The Biosynthesis of Methionine: from Homoserine to Homocysteine (a) Homoserine to O-succinylhomoserine (b) O-succinylhomoserine to cystathionine (c) Cystathionine to homocysteine 3. The Biosynthesis of Methionine:from Serine to 5'-Methyltetrahydrofolate (a) Serine to 5,10-methylenetetrahydrofolate (b) 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate 4. The Terminal Step in Methionine Biosynthesis (a) The two homocysteine transmethylases (b) The vitamin B~2-dependent homocysteine transmethylase (c) The vitamin B 12-independent homocysteine transmethylase 5. Synthesis of the Corepressor: Methionine to S-adenosylraethionine 6. Methion yl- Transfer RNA S ynthetase

147 147 147 150 150 150 150 151 152 152 153 153 153 154 154 156 158 158

IV.

REGULATIONBY METHIONINEAND VITAMINB~2: GENETIC STUDIES 1. Repression by Methionine (a) metJ encodes an aporepressor protein (b) S-adenosylmethionine is the corepressor 2. Repression by Vitamin B 12 (a) A r61efor MetH as a regulatory protein? (b) Possible r61esfor metF and btuB in vitamin B12-mediated regulation 3. metR, a New Methionine Regulatory Gene

159 159 160 160 161 162 162 163

THE METHIONINEREPRESSORAND INTERACTIONWITH ITS OPERATORS 1. Identification and Isolation of the Methionine Repressor MetJ 2. Methionine Operators 3. Interaction of the MetJ Repressor with its Operators 4. Three-Dimensional Structure of the Methionine Repressor

165 165 165 167 169

CONCLUSIONS ACKNOWLEDGEMENTS REFERENCES

176 176 176

I. II.

V.

VI.

I. I N T R O D U C T I O N In the last ten years, a breakthrough has been made in the understanding of the regulation of methionine biosynthesis. This was due mainly to the use of powerful molecular biology § This review is dedicated to the memory of F. Kelly and J. M. Costrejean, two contributors to the aspartokinase story. JpB s6:3-A

145

early

146

I.G. OLDet al.

and X-ray crystallographic techniques which allowed the elucidation of the structure and regulation of the met genes. The regulation of the biosynthesis of the amino acid methionine was the first to be studied, along with tryptophan (Cohen and Jacob, 1959). Regulation was found to be repressor mediated. A complex regulatory scheme is in fact involved which includes repression by holorepressor (metJ gene product + S-adenosylmethionine), repression by vitamin B 12 (perhaps with the involvement of the metH gene product), and activation through the metR gene product. There is no evidence for classical attenuation in the met transcriptional units. Lesions in the met J, metK, metR, metH, metF and btuB genes all affect the control of the met regulon. Immediate regulation is effected by feedback control of the activity of the first specific enzyme (MetA) of the met pathway by methionine and Sadenosylmethionine. The biochemical, regulatory and evolutionary aspects of methionine biosynthesis in the Enterobacteriaceae has been reviewed recently (Saint Girons et al., 1988). In this review we have concentrated on recent progress, notably in the elucidation of the terminal step of methionine biosynthesis and its regulation with the discovery of a positive regulatory mechanism. Furthermore, the determination of the tertiary structure of the met repressor, Met J, has allowed a new class of DNA binding proteins to be defined. Genetical and biochemical approaches support the model of interactions of fl strands of the met repressor with met operator targets. II. M E T H I O N I N E 1. The Structure and Properties of Methionine

Methionine, a sulphur-containing amino acid of molecular weight 149.21, was first isolated from protein in the first quarter of this century (Mueller, 1922). This amino acid is unique in that it acts not only as a substrate for protein elongation, but also, in the form of Nformyl-methionine, as the initiator of protein synthesis (Marcher and Sanger, 1964; Adams and Capecci, 1966). Moreover, methionine is the precursor of the polyamine spermidine (Tabor et al., 1958; Mandel and Borek, 1963) and a derivative, S-adenosylmethionine, acts as a universal cell methylating agent (Soil, 1971; Paik and Kim, 1971). The carbon skeleton of methionine is derived from aspartate, the sulphur atom from cysteine, and the methyl group from serine. It is the L-isomer of methionine which is incorporated into protein: growth of E. coli on the D-isomer causes growth limitation (Greene, 1973). Methionine is found at a concentration of 146 #mol/g for dried E. coli B/r cells which represents 2.87% of the amino acid composition (Ingraham et al., 1983). In terms of building blocks, methionine is the most expensive amino acid to synthesize, requiring one oxaloacetate, one l-C, one NH 3, one S, seven ATPs and eight NADPHs. This can be contrasted with two other aspartate-derived amino acids: threonine which requires only one oxaloacetate, one NH 3, two ATPs and three NADPHs; and lysine which requires only one oxaloacetate, one pyruvate, two NH3, two ATPs and four NADPHs (Ingraham et al., 1983). 2. The Transport of Methionine

In E. coil amino acid transport systems fall into two fundamentally different groups--shock-sensitive and shock-resistant systems (Berger and Heppel, 1974). Shock resistant systems, such as the major proline permease of S. typhimurium, contain a single protein component located in the inner membrane whereas the shock-sensitive systems contain three to five protein components, including a periplasmic substrate binding protein and typically derive their energy from the hydrolysis of ATP (Cairney et al., 1984; Ames, 1986; Hahn et al., 1988; Cottam and Ayling, 1989). There are at least two different transport systems for L-methionine in E. coli and S. typhimurium and until recently their nomenclature was somewhat confusing. In E. coil the gene(s) encoding the high and low affinity systems are designated metD and metP, respectively (Kadner, 1974; Kadner and Watson, 1974). In S. typhimurium the gene(s) encoding the high affinity system had been designated metP, but is now, like that of E. coil, known as metD (Ayling et al., 1979; Shaw and Ayling, 1991). The high affinity system in E. coli requires ATP or a related substance as the energy source and

Methionine biosynthesis

147

methionine transport in S. typhimurium is inhibited by arsenate suggesting that the high affinity transport systems belong to the shock-sensitive category (Kadner and Winkler, 1975; Cottam and Ayling, 1989). However, it should be noted that methionine transport activity was only slightly reduced by osmotic shock (Cottam and Ayling, 1989). The high affinity methionine transport systems also transport D-methionine and that of S. typhimurium has been demonstrated to uptake methionine analogues including methionine sulphoxide, methionine sulphoximine and ~-methylmethionine (Kadner, 1977; Ayling, 1981). The S. typhimurium high affinity system may also be involved in the uptake of Lglutamine (Ayling, 1981; Poland and Ayling, 1984). S. typhimurium strains defective in the high affinity system are unable to utilize D-methionine but L-methionine is still transported by at least one low affinity system, whose major function may be leucine transport (Ayling and Bridgeland, 1972; Ayling et al., 1979). A suppressor mutation has been described which will restore the ability to use o-methionine and partly restores the high affinity transport system (Poland and Ayling, 1984). Methionine uptake is regulated by the methionine pool. E. coli mutants with increased methionine pools have decreased rates of uptake and methionine starvation in an auxotrophic strain results in a large increase in the rate of methionine uptake (Kadner, 1975). Although the E. coil metD system also transports D-methionine, the uptake of this isomer is strongly inhibited by L-methionine (Kadner, 1977). As the presence of D-methionine does not inhibit L-methionine uptake, the E. coli cell seems able to preferentially transport the isomeric form incorporated in protein. The genes for the high affinity methionine uptake system are located at 5 and 6 minutes on the E. coil and S. typhimurium genetic maps respectively (Bachmann, 1990; Sanderson and Roth, 1988). At least one of the genes of the S. typhimurium system has been cloned recently and encoded polypeptides of 34 kDa and 40 kDa have been identified. Complementation analysis of methionine transport mutants suggests that there are at least three genes in the S. typhimurium metD operon (Shaw and Ayling, 1991). III. THE ENZYMES AND CORRESPONDING GENES The pathway of methionine biosynthesis in the Enterobacteriaceae is quite complex with divergent and convergent pathways (Fig. 1). In E. coli and S. typhimurium, the genes involved in methionine biosynthesis are scattered throughout the respective chromosomes (Bachmann, 1990; Sanderson and Roth, 1988). The met J, B, L and Fgenes are clustered at 89 minutes on the E. coli genetic map (Liljestrand-Golden and Johnson, 1984) but only metB and metL form an operon (Duchange et al., 1983; Greene and Smith, 1984). The gene-enzyme correspondence is listed in Table 1. Methionine is a member of the aspartate family of amino acids which also includes lysine and threonine. Threonine is the precursor of isoleucine and valine, while diaminopimelate, the immediate precursor of lysine, is also a building block of peptidoglycan (Umbarger, 1978; Patte, 1983). There is a common pathway which converts aspartate to the two branch point intermediates aspartate semialdehyde and homoserine (Cohen, 1983). The pathway of threonine, methionine and lysine biosynthesis in the Enterobacteriaceae is shown in Fig. 1. 1. The Common Pathway to Methionine, Diaminopimelate, Lysine, Threonine, Isoleucine and Valine

(a) Aspartate to fl-aspartyl phosphate In E. coil the conversion of aspartate and ATP to fl-aspartyl phosphate and ADP is catalyzed by three distinct isofunctional enzymes. These are aspartokinase I (E.C. 2.7.2.4), aspartokinase II and aspartokinase III, the products of the thrA, metL and lysC genes respectively. The enzymes differ in several aspects, primarily by the fact that ThrA and MetL are also homoserine dehydrogenases--whereas LysC possesses only aspartokinase activity (Patte et al., 1967; Cohen and Dautry-Varsat, 1980). Both the aspartokinase and homoserine dehydrogenase activities of ThrA are inhibited by threonine (Cohen et al., 1965). However neither the aspartokinase nor the homoserine dehydrogenase activites of the E. coli or S.

148

I.G. OLD et al. Sulphate (extemal)

Aspartate

•

4 4 • th,-A m.L ~sC

Sulphate(internal) •

~-Asparlyl phosphate

APS 4

asd

•

Aspartatesemlaldehyde• • • • • • • Lyslne

PAPS 4 Sulphlte

4 • t~A .~tz Homoserlne • • Threonlne• • ~1

Sulphide ~ ,~

4

0 succlnyl homoserlne Cystelne , ~

•

O-aceiylserine

Isoleucine

mttB

Vallne

Cystathionine

t Serlne

met~

MeIhylTHF

MelhyI.n.THF

glyA ~II Serlne

I~

• ~,~tC Homocystelne • • mete rattY/ IP

THF

[

Methlonln. •

•

]

.~tG

•

metK metX

S adenosylmethlonlne

MethlonyllRNA

4" PROTEIN

Spermldlne Transmethylatlons

Fro. 1. The divergentand convergentpathways to and from the amino acid methioninein E. coli and S. typhimurium. The carbon skeletonof methionineis derivedfrom aspartate, the sulphur atom from sulphate, and the methylgroup from serine. Methionineis unique as an amino acid in that it acts not only as a substrate for protein elongation, but also, as N-formylmethionine,for protein initiation. Methionine is also the precursor of the polyaminespermidineand of the universal cell methylating agent, S-adenosylmethionine.The relevantreactionsand enzymescorrespondingto the genesshown are discussedin the text. Abbreviations:APS, adenosine5'-phosphosulphate;PAPS, Y-phosphoadenosine 5'-phosphosulphate;THF, tetrahydrofolate;methyleneTHF,5,10-methylenetetrahydrofolate glutamate;.methylTHF,5-methyltetrahydrofolateglutamate. Note: The product of the raetH gene can use the monoglutamate or polyglutamateforms of 5-methyltetrahydrofolatewhereas the product of the mete gene can only use the polyglutamateform (N> 3) as a substrate.

typhimurium MetL enzymes are retroinhibited (Patte et al., 1967; Falcoz-KeUy et al., 1969; Cafferata and Freundlich, 1969). The third aspartokinase, LysC, is feedback-inhibited by lysine (Stadtman et al., 1961). 0.2 mM lysine, a concentration comparable to the intracellular lysine pool, will inhibit LysC activity by 50% (Truffa-Bachi and Cohen, 1966). The synthesis of each of the three aspartokinases is subject to repression by their end products. In the case of thrA, the first gene of the threonine operon (Th6ze and Saint Girons, 1974), there is mutivalent repression by a combination of threonine plus isoleucine through an attenuation mechanism and by the product of the ileR gene (Gardner, 1979; Lynn and Gardner, 1983; Johnson and Somerville, 1983; Weiss et al., 1986). For m e t L there is repression by methionine (see Sections IV and V); and for lysC, repression by lysine (Stadtman et al., 1961; Richaud et al., 1980). Aspartokinase I and II are both composed of subunits of 89 kDa, but whereas ThrA is a tetramer, MetL is a dimer (Truffa-Bachi et al., 1968; Falcoz-Kelly et al., 1969, 1972). Limited proteolysis of aspartokinase I homoserine dehydrogenase I, and analysis of nonsense mutations of the corresponding gene, has shown that the aspartokinase activity is resident in an N-terminal domain, while the homoserine dehydrogenase activity lies in a C-terminal domain (V6ron et al., 1972; Th6ze and Saint Girons, 1974). A third central domain has been implicated in subunit interactions (Fazel et al., 1983). The nucleotide sequences of thrA, and m e t L have been determined; thrA and m e t L are 2460 bp and 2427 bp long and encode polypeptides of 89,020 Da and 88,726 Da respectively (Cossart et al., 1979; Katinka et al., 1980; Zakin et al., 1983). As aspartokinase II activity is not detectable in E. coil K12, MetL was purified from a

Lysine Threonine

-

-

-

1ysc thrA

metJ metK metL metp metR metx ad dyA

-

-

metF metG metH

metB mete metD metE

metA

-

-

Methionine + S-adenosylmethionine i

Gene symbol

91 0

89 64 89 ? 86 65 16 55

89 46 91

89 65 5 86

91

position E. coli

Map

GENE-PROTEIN Co RRESPONDENCE Map

0

87 63 87 Methionine 84 ? 75 53

87 44 89

87 64 6 84

89

position S. typhimurium

Methionine metJ ? Lysine, Threonine, Methionine Glycine, Adenine, Guanine, Thymine, Lysine metR pyrR Lysine Threonine + Isoleucine ileR

Methionine m&J Methionine metJ Methionine metJ

Methionine metJ Methionine metJ Methionine Methionine metJ Vitamin B,, metH, metF Homocysteine metR Methionine m&J Vitamin B,, metH Methionine Homoscysteine metR

Methionine metJ

Regulations

The position of the genes on the E. coli and S. typhimurium genetic maps (Bachmann, 1990; Sanderson and Rothe, 1988) are indicated. Regulation of the genes is indicated as follows: first the amino acid or vitamin or purine/pyrimidine bases which, when present in the growth medium, plays a rBle in gene expression is indicated. Second, the protein which plays a regulatory rBle is represented by the name of its gene.

Aspartokinase III Aspartokinase I- Homoserine dehydrogenase I

Cystathionine-y-synthase Cystathionine+lyase High affinity methionine transport Vitamin B,,-independent homocysteine transmethylase 5,10-Methylenetetrahydrofolate reductase Methionyl tRNA synthetase Vitamin B,,-dependent homocysteine transmethylase Methionine aporepressor Methionine adenosyltransferase Aspartokinase II- Homoserine dehydrogenase II Low affinity methionine transport Methionine activator Methionine adenosyltransferase Aspartate semialdehyde dehydrogenase Glycine hydroxymethyl transferase

Homoserine succinyltransferase

Enzyme name

Specific inhibitor

TABLEI.

150

I.G. OLDet al.

genetically derepressed thrA metJ strain (Patte et al., 1967). The protein has been shown to possess the same triglobular structure as ThrA (Belfaiza et al., 1984). LysC only possesses aspartokinas¢ activity, but the amino acid sequence deduced from the nucleotide sequence indicates that it also contains part of the central domain seen in ThrA and MetL (Cassan et al., 1986). Comparisons of enzymatic activities, molecular weights, amino acid compositions, proteolytic domains and immunological reactivities have led to the hypothesis that aspartokinase-homoserine dehydrogenase I and II evolved from common ancestors (TruffaBachi et al., 1975). A model has been proposed describing the evolution of this family of enzymes in which lysC could have evolved from thrA after the fusion of the AK HDH coding sequences (Cassan et al., 1986; Zakin et al., 1983; reviewed in Saint Girons et al., 1988). In E. coli metL forms an operon along with metB with the AUG translational initiation codon of metL only two nucleotides downstream from the TAA stop codon of metB (Duchange et al., 1983). There is also a m e t B L operon in S. typhimurium (Mark Urbanowski and George Stauffer, unpublished results). (b) fl-aspartyl phosphate to aspartate semialdehyde The conversion of fl-aspartyl phosphate, NADPH, and H + to aspartate semialdehyde, NADP and Pi, is catalyzed by aspartate semialdehyde dehydrogenase (E.C. 1.20.2.1 l) the product of the asd gene. The synthesis of aspartate semialdehyde dehydrogenase is repressed independently by threonine, methionin¢ and lysine, although derepression is greatest in conditions of lysine limitation (Cohen and Patte, 1963; Boy and Patte, 1972; Patte, 1983). There is also evidence for regulation of the synthesis of Asd by glucose-6-phosphate (Boy and Patte, 1979). The enzyme has been purified by using lysine limiting conditions or genetically derepressed strains (Hegeman et al., 1970; BieUmann et al., 1980). The active enzyme is a homodimer of 80 kDa, and the N-terminal amino acid sequence has been determined. The active site for the E. coil enzyme has been identified as the amino acid sequence Phe-Val-Oly~Gly-Asn-Cys-Thr-Val-Ser (Biellmann et al,, 1980; Haziza et al., 1982b). The asd gene has been cloned and sequenced and the site of its promoter has been determined (Richaud et al., 1981; Haziza et al., 1982a,b). The deduced amino acid sequence suggests a polypcptide of 40 kDa in agreement with the calculated molecular weight of the purified protein. There is no evidence for an attenuation signal in the asd regulatory region (Haziza et al., 1982b). (c) Aspartate semialdehyde to homoserine The conversion of aspartate semialdehyde, NADPH and H + to homoserine, and NADP +, is catalyzed by two different enzymes. These are homoserine dehydrogenas¢ I (E.C. 1.1.1.3) and homoserin¢ dehydrogenas¢ II, the products of the thrA and metL genes respectively. As mentioned in Section III. 1.(a) the ThrA and MetL proteins are bifunctional enzymes which possess both aspartokinase and homoserine dehydrogenase activity. Unlike E. cell K12, MetL in E.coli B has been found to possess no homoserine dehydrogenase activity (Patte et al., 1967) which is due to the C-terminal domain being inactive, rather than absent. 2. The Biosynthesis of Methionine: From Homoserine to Homocysteine

The methionine biosynthetic pathway is complex with convergent and divergent pathways. The carbon skeleton is derived from aspartate, the sulphur atom from cysteine and the methyl group from serin¢ (reviewed in Cohen and Saint Girons, 1987; Kredich, 1987; Stauffer, 1987; Fig. 1). The genes and enzymes involved in the conversion of homoserine to homocysteine are described in the following paragraphs. (a) Homoserine to O-succinylhomoserine The conversion of homoscrin¢ and succinyl CoA to O-succinylhomoserine is the first specific step of the methionine biosynthetic pathway (Fig. 1). It is catalyzed by homoserine transsuccinylase (E.C. 2.3.1.46), the product of the met,4 gene. Homoserine transsuccinylase


151

has been partially purified approximately 30-fold (Lee et al., 1966; Ron and Shani, 1971). The molecular weight of MetA was estimated to be around 65 kDa, therefore as the cloned metA gene was shown to encode a 40 kDa polypeptide in minicells the MetA enzyme would appear to be a dimer (Flavin, 1975; Michaeli and Ron, 1984a). In both E. coil and S. typhimurium homoserine transsuccinylase is feedback sensitive. In vitro, the enzyme is only inhibited at high concentrations of methionine or Soadenosylmethionine alone, whereas relatively low concentrations are required for inhibition by a combination of the metabolites. Inhibition is seen at much lower methionine concentrations in vivo, probably because in the whole cell system methionine is also converted to S-adenosylmethionine which, with methionine, causes synergistic inhibition (Rowbury and Woods, 1961; Lee et al., 1966; Rowbury and Woods, 1966). The S. typhimurium regulatory mutants designated as metlhave been found to possess a homoserine transsuccinylase which is resistant to both methionine and amethylmethionine---which mimics methionine as an inhibitor--but not to S-adenosylmethionine (Lawrence et al., 1968; Lawrence, 1972). These metI strains excrete methionine and it is suggested that these mutants have low methionine biosynthetic enzyme levels because of partial repression due to the overproduction of the amino acid (Lawrence, 1972). The S. typhimurium met1 mutation has been mapped to metA, suggesting that the catalytic and regulatory sites are both part of the homoserine transsuccinylase polypeptide. There is a report of homoserine transsuccinylase being subject to end product inhibition by Osuccinylhomoserine (Savin et al., 1972), while the analogue ~-methylmethionine is a potent feedback inhibitor of the enzyme (Rowbury, 1968) and certain E. coli strains produce microcins which act as competitive inhibitors of homoserine transsuccinylase (Perez-Diaz and Clowes, 1980). Growth of E. coli, S. typhimurium and Enterobacter aerogenes (previously known as Aerobacter aerogenes) at elevated temperatures of up to 45°C results in a decrease in growth rate due to a limitation in the availability of exogenous methionine. The temperature sensitivity has been demonstrated to be due to the extreme temperature sensitivity of the Enterobacteriaceal homoserine transsuccinylase (Ron, 1975). The inhibition of the MetA enzyme has been shown to be reversible (Ron and Davis, 1971; Ron and Shani, 1971). Therefore this may be a mechanism to limit growth at temperatures which could prove lethal to the cell, by blocking a range of metabolic functions while preserving viability. E. aerogenes is more sensitive to elevated temperature than E. coli, with growth of the former inhibited by 70% following a temperature shift from 32°C to 41 °C whereas E. coli is only slightly inhibited at the higher temperature. The relative temperature resistance of E. coli has been transferred to E. aerogenes by transduction of the E. coli metA gene (Ron et al., 1990). A possible linkage between methionine metabolism and heat shock has been noted (Matthews and Neidhardt, 1988) and it has been shown that the cellular level of homoserine transsuccinylase increases dramatically when heat shock response is induced (Ron et al., 1990). This heat shock response occurs only in strains with a functional sigma -32 factor, and there is a region of high homology with known sigma -32 promoters upstream of the two known metA promoters (see below; Ron et al., 1990). Therefore it would appear that homoserine transsuccinylase is a heat shock protein. The metA gene is located at 90.6 minutes on the E. coli genetic map between rrnE and aceA, and the gene order appears to be the same in S. typhimurium (Bachmann, 1990; N~gre et al., 1991; Ayling and Chater, 1968; Sanderson and Roth, 1988). The metA gene has been cloned and the regulatory region and coding sequence have been sequenced (Micheali et al., 1981, 1984; Duclos et al., 1989). The metA gene is 927 nucleotides long and encodes a polypeptide of 35,673 Da (Duclos et al., 1989). S1 nuclease analysis has demonstrated that the metA gene has two transcriptional start sites located 74 nucleotides apart. Both these promoters are expressed in vivo, one being regulated by intracellular methionine levels, whilst the other is constitutive (Michaeli et al., 1984). (b) O-succinylhomoserine to cystathionine The conversion of O-succinylhomoserine and cysteine to cystathionine, and succinate, is catalyzed by cystathionine-~-synthase. Two different enzymes are found in bacteria: that

152

I.G. OLDet al.

found in the Enterobacteriaceae and other Gram-negative bacteria catalyzes the formation of cystathionine from O-succinylhomoserine and cysteine, while the second enzyme, which is found in Gram-positive bacteria, utilizes the O-acetyl derivative of homoserine (Kanzaki et al., 1986). Cystathionine-7-synthase (E.C. 4.2.99.9) is the product of the metB gene. The MetB enzyme has been purified from both S. typhimurium and E. coll. In both cases the enzyme was found to have a molecular weight of 160 kDa, and to be composed of four identical subunits each containing a tightly bound molecule of pyridoxal phosphate (Kaplan and Flavin, 1966; Tran et al., 1983; Holbrook et al., 1990). The reaction mechanism of the enzyme is thought to proceed via a pyridoxamine derivative of vinylglyoxylate (Brzovic et al., 1990). The metB gene is part of the metJBLF cluster at 89 minutes on the E. coil genetic map (Bachmann, 1990) and metB and metL form the only met operon in E. coil and S. typhimurium (Duchange et al., 1983; Greene and Smith, 1984; Mark Urbanowski and George Stauffer, unpublished results). In both E. coli and S. typhimurium the metB gene has been cloned along with metJ and metL (Zakin et al., 1982; Johnson and Liljestrand, 1983; Lijestrand-Golden and Johnson, 1984; Urbanowski and Stauffer, 1985). The E. coli gene is 1158 bp long and encodes a polypeptide of 41,503 kDa (Duchange et al., 1983). There is a single promoter for metB in both E. coli and S. typhimurium (Kirby et al., 1986a; Urbanowski et al., 1987). The Nterminal sequence of the E. coli cystathionine-7-synthase has also been determined (Tran et al., 1983). (c) Cystathionine to homocysteine The conversion of cystathionine to homocysteine, ammonia and pyruvate is catalyzed by cystathionine-fl-lyase (E.C. 4.4.1.8), the product of the metC gene. The E. coli gene has been cloned on a multicopy plasmid and the overproduced protein was used to purify the enzyme. This was reported to be composed of six identical subunits of 45 kDa, each one, like those of MetB, binding a molecule of pyridoxal phosphate (Dwivedi et al., 1982). Further studies suggest however, that the native enzyme is, like cystathionine-7-synthase, a tetramer (Bouthier de la Tour, 1987). The metC gene maps at 89.0 minutes on the E.coli genetic map (Bachmann, 1990; Krfger et al., 1990). The E. coli and S. typhimurium genes have been cloned: they are both 1185 nucleotides long and encode polypeptides of 43,032 Da and 42,874 Da respectively which exhibit 86% identity (Michaeli and Ron, 1984b; Belfaiza et al., 1986; Park and Stauffer, 1989a). Operator constitutive mutations have been isolated for E. coli and S. typhimurium which disrupt the MetJ repressor binding sites (Phillips et al., 1989; Park and Stauffer, 1989b; see Sections IV and V). The transcriptional start site of the S. typhimurium metC gene has been identified by S 1 mapping and lies 29 bp upstream of the ATG initiation codon (Park and Stauffer, 1989a). A mutation, metQ, has been described which allows E. coli K12 metC mutants to directly catalyze the formation of homocysteine from O-succinylhomoserine (Simon and Hong, 1983). This appeared to be similar to suppressor mutations which have been described for A. nidulans (Paszewski and Graski, 1975). The metQ mutation, in fact, defines a new gene which maps at 35.9 minutes on the E. coli map between uidAR and tyrS. The metQ gene is 1149 bp long and encodes a polypeptide of 41 kDa (J. Hong, personal communication). It has been demonstrated that the deduced MetC and MetB enzyme sequences exhibit 31% identity and therefore the metB and metC genes probably evolved from a common ancestor (Belfaiza et al., 1986; Martel et al., 1987). In view of the demonstrated similarity between MetB and MetC the apparent ability of cystathionine-7-synthase to replace cystathionine-fl-lyase in a metQ strain (Simon and Hong, 1983) may be more easily comprehended. Cystathionine-fl-lyase may also be able to carry out, albeit inefficiently, deamination of L-serine (Brown et al., 1990). 3. The Biosynthesis of Methionine: From Serine to 5'-Methyltetrahydrofolate The terminal step in methionine biosynthesis involves a crossroads in the methionine and folate pathways, and before considering the transmethylation of homocysteine, it is desirable

Methioninebiosynthesis

153

to look at the origin of the methyl group of methionine. This is derived from the fl-carbon atom of serine. (a) Serine to 5 ,10-methylenetetrahydrofolate The conversion of serine and tetrahydrofolateglutamate to glyeine and 5,10-methylene tetrahydrofolateglutamate is catalyzed by serine transhydroxymethylase (E.C. 2.1.2.1) the product of the glyA gene. This reaction produces one-carbon units which are utilized in the biosynthesis of methionine, purines and thymine. The glyA genes from both E. coli and S. typhimurium have been cloned and encode polypeptides of 46.5 and 47 kDa respectively (Plamann and Stauffer, 1983; Urbanowski et al., 1984). The E. coil gene is 1251 bp long and encodes a polypeptide of molecular weight 45,265 Da (Plamann et al., 1983). S1 mapping was used to determine the transcriptional start point of the E. coli olyA gene which lies 67 bp upstream of the ATG start codon (Plamann and Stauffer, 1983). For a review on glyA, see Stauffer (1987). The control of glycine transhydroxymethyltransferase synthesis is complex, with serine, glycine, methionine, thymine, guanine and adenine all apparently involved in a form of cumulative repression (Stauffer et al., 1974). It was shown that although glycine transhydroxymethyltransferase was partially controlled by methionine, the regulation was different from that controlling the met regulon (Greene and Radovich, 1975; Stauffer and Brenchley, 1977; Dev and Harvey, 1984a,b). The methionine component of the regulation has been identified as MetR, and the nucleotide component as PurR (Plamann and Stauffer, 1989; Steiert et al., 1990). (b) 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate The conversion of 5,10-methylenetetrahydrofolate plus FADH 2 to 5-methyltetrahydrofolate and FAD is catalyzed by 5,10-methylenetetrahydrofolate reductase (E.C. 1.7.99.5), the product of the metF gene. The enzyme has been purified 100-fold from E. coli and the reaction which it catalyzes is essentially irreversible (Foster et al., 1964b; Katzen and Buchanan, 1965). Therefore mete strains starved of vitamin B~2 accumulate 5-methyltetrahydrofolate. The plasmid-encoded E. coli gene product was identified in maxicclls as a 33 kDa polypeptide and the N-terminal dipeptide of the enzyme has been determined (Saint Girons et al., 1983; Shoeman et al., 1985c). The metF genes ofE. coli and S. typhimurium have been cloned; both are 888 bp long and they encode polypeptides of 33,065 Da and 33,135 Da respectively which exhibit 96% identity (Zakin et al., 1982; Saint Girons et al., 1983; Stauffer and Stauffer, 1988a). However, whereas in E. coli the metF gene lies only 500 nucleotides downstream of the metBL operon, in S. typhimurium there is a gap of at least 4.8 kb between the metL and metF genes suggesting evolutionary divergence between the two species (Duchange et al., 1983; Stauffer and Stauffer, 1988a). The transcriptional start points of the E. coli and S. typhimurium metF genes were determined by S1 mapping and both lie 70 bp upstream of the AUG initiation codon (Saint Girons et al., 1983; Stauffer and Stauffer, 1988a) 4. The Terminal Step in Methionine Biosynthesis The terminal step in methionine biosynthesis involves the transfer of a methyl group from 5-methyltetrahydrofolate to homocysteine to form methionine and tetrahydrofolate. Two alternative routes exist for the methylation of homocysteine: the one catalyzed by the metH gene product is vitamin B 12-dependent, while the other catalyzed by the metEgene product is independent of the cofactor. Generally, organisms that are able to synthesize or take up cobalamin utilize only the vitamin B 12-dePendent enzyme (e.g. mammals) while those which lack this ability contain the vitamin B12-independent transmethylase (e.g. plants, fungi and certain prokaryotes) (Flavin, 1975). Enterobacteria such as E. coli, S. typhimurium and E. aerogenes are unusual in that they contain both methylating systems (Foster et al., 1961, 1964b; Cauthen et al., 1966; Morningstar and Kisliuk, 1965). The enzymes are 5methyltetrahydropteroyltriglutamate-homocysteinemethyltransferase (E.C. 2.1.1.4) and 5-

154

I . G . OLO et al.

methyltetrahydrofolate-homocysteine (vitamin B12) methyltransferase (E.C. 2.1.1.13), respectively the products of the metE and metH genes (Smith, 1961,1971; Childs and Smith, 1969; Smith and Childs, 1966; Flavin, 1975). (a) The two homocysteine transmethylases The presence of a vitamin B12-requiring homocysteine transmethylase was first implied by the isolation, by penicillin enrichment, of E. coli W mutants which required either methionine or vitamin B~2. On the basis of these results it was proposed that vitamin B12 functioned as a coenzyme participating in the manufacture or transfer of labile methyl groups (Davis and Mingioli, 1950). This was later confirmed by the results of Gibson and Woods (1960). They found the enzyme extracts of E. coli mutants requiring methionine or vitamin B I 2 for growth (i.e. metE mutants) would not synthesize methionine unless the vitamin was added. It was also discovered that addition of cobalamin (vitamin B12) to extracts of strains which did not have a nutritional requirement for cobalamin would stimulate methionine biosynthesis (Gibson and Woods, 1960). It was noted that tetrahydrofolate (triglutamate) was also required as a cofactor for the conversion of homocysteine to methionine (Kisliuk and Woods, 1960). The monoglutamate form of tetrahydrofolate was found to act as competitive inhibitor of the triglutamate form in promoting methionine synthesis, but only in the absence of cobalamin (Jones et al., 1961). In the case of a strain which required cobalamin or methionine for growth, cobalamin was essential for growth even when tetrahydrofolate (triglutamate) was present. These observations were consistent with two independent pathways for methionine biosynthesis; one requiring vitamin Bx 2, and one independent of the vitamin (Foster et al., 1961, 1964b). (b) The vitamin B 12-dependent homocysteine transmethylase The vitamin B 1e-dependent homocysteine transmethylase has been intensely studied (for reviews of the early work see Weissbach and Taylor, 1970; Rudiger and Jaenicke, 1973; Taylor and Weissbach, 1973; Poston and Stadtman, 1975; Taylor, 1980). Several vitamin B12 analogues were tested in an in vitro methionine synthesis system (Guest et al., 1962). It was found that whereas deoxyadenosylcobalamin and sulphitocobalamin inhibited formation of the holoenzyme, methylcobalamin and hydroxocobalamin were more efficient than vitamin B x2 itself (cyanocobalamin). In the absence of a reducing system, only methylcobalamin, and to a much lesser extent hydroxocobalamin, were efficient at forming holoenzyme. In addition, it was shown that the methyl group of radiolabelled methylcobalamin was transferred to homocysteine (Guest et al., 1962). Therefore it was proposed that, either a methylcobalamin-enzyme complex was a transient intermediate in methionine biosynthesis, or that the apoenzyme combined with free methylcobalamin to carry out the reaction (Guest et al., 1962). Similar observations were made by Weissbach et al. (1963, 1964) working with both E. coli and animal liver cells. They demonstrated that the methyl groups from methyltetrahydrofolate and methylcobalamin were transferred to homocysteine, whereas no transfer of the methyl group from S-adenosylmethionine was detected. It was also demonstrated that the bacterial enzyme could bind both methylcobalarain, and a reduced derivative of vitamin B12 (Weissbach et al., 1963, 1964; Foster et al., 1964b). In addition to a requirement for methyl B~2 and 5-methyltetrahydrofolate, the vitamin B~2-dependent enzyme was noted to require several other cofactors, including FADH 2 and S-adenosylmethionine (Guest et al., 1960; Weissbach et al., 1963; Foster et al., 1964a). It was shown that the methyl group of S-adenosylmethionine could be removed and bound firmly by the transmethylase (Taylor and Weissbach, 1967a; Stavrianopoulos and Jaenicke, 1967). However, the methyl group from S-adenosylmethionine was only bound transiently by the enzyme before being replaced by a methyl group from 5-methyltetrahydrofolate (Taylor and Weissbach, 1969a). The Km for S-adenosylmethionine binding to freshly purified enzyme has been quoted as 10-7 M (Rudiger and Jaenicke, 1969). S-adenosylmethionine was found to activate the transmethylase by causing the initial methylation of the vitamin B12 moiety of


155

the inactive holoenzyme (Taylor and Weissbach, 1969b). The vitamin B12 binding site is located between amino acids 643 and 900 of the MetH enzyme sequence (Banerjee et al., 1989, 1990). Although the MetH apoenzyme is synthesized in the absence of vitamin B 12, the enzyme is only active when vitamin B12 is present as a cofactor (Takeyama et al., 1961; Kung et al., 1972). This mechanism of activating an already existing enzyme presumably allows the cells to respond immediately to the presence of cobalamin by activating previously synthesized MetH enzyme. Mutations in metH were first isolated by Childs and Smith (1969) from a metE mutant strain of S. typhimurium. Whereas the metE parental strain could grow when supplemented by either vitamin B12 or methionine, the metE metH double mutants had an absolute requirement for methionine. The metH mutations were found to be located some distance from metE on the S. typhimurium genetic map and were cotransducible with metA (Childs and Smith, 1969; Ayling and Chater, 1968). In E. coli, the metHgene is also closely linked to metA and has been precisely mapped at 90.9 minutes between icIR and lysC (Bachmann, 1990; N6gre et al., 1991). The molecular weight of the Enterobacteriaceal vitamin B12-dependent methionine synthetase proved to be an issue of contention for some time. MetH enzymes purified from E. coli B. and E. coli K12 were reported to have molecular weights of 140 kDa and 135 kDa, respectively (Taylor and Weissbach, 1967b; Stavrianopoulos and Jaenicke, 1967). Other workers reported molecular weights for MetH of 120 kDa (Urbanowski and Stauffer, 1986b); 123 kDa (Banerjee et al., 1989); 125 kDa (Galivan and Huennekens, 1970); 130 kDa (Old et al., 1988); 153 kDa (Frasca et al., 1988); and 255 kDa (Rudiger and Jaenicke, 1970). Other reports have suggested that the enzyme is a monomer of 186 kDa (Fuji and Huennekens, 1974) or a tetramer with two different subunit types of 49.5 kDa (Paessens and Rudiger, 1980). Some of the differences observed for the molecular weight of the MetH enzyme might be explained by the association of accessory proteins of 3 kDa, 19.4 kDa and 27 kDa which have been purified with the transmethylase (Galivan and Huennekens, 1970; Fuji and Huennekens, 1974). Galivan and Huennekens (1970) reported that in addition to their "M" component of 125 kDa, the enzyme contained an "S" component of 3 kDa, both of which were required for maximal activity of the enzyme. They suggested that, by analogy with the cobamide-dependent lysine mutases, the "S" component might maintain the enzyme in a more active conformation and prevent inactivation of the cobamide cofactor. It has been suggested however, that as FADH 2 was not used in the assay system that the "S" polypeptide was most probably merely serving as a component of an additional reducing system rather than as a subunit of the transmethylase (Barker, 1972). In E. coli flavodoxin, a small, acidic electron transfer protein with a flavin mononucleotide (FMN) prosthetic group, and S-adenosylmethionine are involved in the activation of pyruvate formate-lyase (Vetter and Knappe, 1971; Knappe and Schmitt, 1976). In the course of the reaction S-adenosylmethionine is recycled to yield methionine, adenine, and 5'deoxyribose. S-adenosylmethionine and flavodoxin are also involved in activation of the vitamin B12-dependent homocysteine transmethylase. In addition to their "M" component of 186 kDa Fuji and Huennekens (1974) isolated two flavoproteins "R" and "F" of 27 kDa and 19.4 kDa, which were apparently required for activation of the transmethylase. All three proteins were reported to be present in the cell in equimolar concentrations. It has been suggested that the high observed molecular weight (255 kDa) for the enzyme of Rudiger and Jaenicke (1970) might be explained by an association of the transmethylase with such oxidation-reduction proteins (Fuji and Huennekens, 1974, 1979). The gene which encodes the "F" flavodoxin has recently been cloned and sequenced. The fldA gene, which maps at 15.9 minutes on the E. coli chromosome, encodes a polypeptide of 19,736 kDa. The FIdA protein exhibits considerable homology with the so called "long" flavodoxins of bacteria such as Klebsiella pneumoniae and Anabaena variabilis (Osborne et al., 1991). The controversy about the molecular weight of the metH gene product ended when the

156

I.G. OLDet al.

metH genes were cloned and sequenced. Approximately one third of the S. typhimurium gene, and the complete E. coil gene have been sequenced (Urbanowski and Stauffer, 1986b, 1988; Old et al., 1988; 1990; Banerjee et al., 1989). The E. coil metH gene, is 3600 bp long and encodes a polypeptide of 132,628 Da (Old et al., 1990). Of all the met genes, metH is the odd man out: it is not directly regulated by the MetJ repressor, and may also function as a regulatory protein (Sections IV and V). Transcription of metH is also atypical: transcription of the metH gene of S. typhimurium was found to commence some 29 bp upstream of the G U G translational start point, with the - 10 and 35 regions promoters showing little homology to the - 10 and - 35 consensus sequence, consistent with the fact that the metH gene requires a positive regulator of transcription, MetR, for efficient expression (Urbanowski and Stauffer, 1988) (Section IV.3). The transcriptional start for E. coli was not determined experimentally but was assumed to be in the same region as that of S. typhimurium (Banerjee et al., 1989; Old et al., 1990). However recent studies have shown that the major transcriptional start site for E. coli is quite distinct from that of S. typhimurium, being located over 300 bp upstream of the GTG translational initiation codon (Marconi et al., 1991). This places the E. coli metH promoter within the coding region of iclR, a gene divergently transcribed from metH which encodes a repressor of the aceBAKoperon (Nrgre et al., 1991). A comparison of the relevant regions in E. coli and S. typhimurium is shown in Fig. 2. From the sequence homology it seems quite likely that both metH genes have two promoters, a major promoter located within iclR and a minor one located close to the GTG translational codon. -

(c) The vitamin B12-independent homocysteine transmethylase The vitamin B12-independent homocysteine transmethylase ("enzyme B" from E. coil 3/62) was first purified 15-fold by Foster et al. (1961). In a later study the E. coli K12 enzyme was purified 20-fold to at least 94% purity (Whitfield et al., 1970). The purified enzyme and denatured, carboxymethylated enzyme had molcular weights of 84 kDa and 50 kDa respectively, as determined by equilibrium centrifugation, and it was suggested that the enzyme was composed of subunits (Whitfield et al., 1970). However, in the E. coli gene-protein index a size of 90 kDa was reported for the MetE polypeptide (Neidhardt et al., 1983). The E. coli enzyme has an absolute requirement for Pi and Mg 2 + and for the triglutamate form of 5-methyltetrahydrofolate as a methyl donor (Foster et al., 1964b; Guest et al., 1964). The specificity exhibited by the E. coli MetE enzyme would appear to be universal as the vitamin B12-independent transmethylases from Bacillus subtilis (Salem and Foster, 1972), Candida utilis (Salem and Foster, 1972), Coprinus lagopus (Wilson, 1970); Neurospora crassa (Burton et al., 1969, and Saccharomyces cerevisiae (Botsford and Parks, 1967) are all unable to use the monoglutamate form of 5-methyltetrahydrofolate. Unlike the MetH enzyme there is no evidence for the formation of a methylated MetE enzyme. Instead it would appear that the 5-methyltetrahydrofolate (triglutamate) is stoichiometrically bound to the enzyme at the catalytic site (Whitfield and Weissbach, 1970). Early work on the vitamin B12-independent transmethylase has been reviewed by Woods et al. (1965) and Rudiger and Jaenicke (1973). MetE has been calculated to represent 5 % of the total soluble protein in derepressed cells, and 3% in wild type cells (Whitfield et al., 1970). It has been suggested that this may be a necessary result of the important r61e played by N-formylmethionine as the initiator of protein synthesis in E. coli. It should be noted that the vitamin B12-independent transmethylase is less than 2% as efficient as its vitamin Bt2-requiring counterpart, synthesizing 14 and 780 mol of methionine per min per mol of enzyme respectively (Whitfield et al., 1970; Taylor and Hanna, 1970). On the E. coil K12 genetic map, the metEgene has been assigned to 85.5 minutes, between pldA and udp (Aldea et al., 1988; Bachmann, 1990). The metE genes of E. coli and S. typhimurium have been cloned and their gene products identified as polypeptide of approximately 90 kDa (Chu et al., 1985; Old et al., 1988; Schulte et al., 1984), comparable to the size of 90 kDa reported for the MetE polypeptide (Neidhardt et al., 1983). The sequences of the metE genes have not yet been determined--only the regulatory region and first few

-35

-10

! :::::::::::

****

**** ATGTTGAACAAATCTCATGTTGCGTGGTGG

-10

1

"~

CGT GGAGCGT

:::::::::::::::::::::

rbs

metH

Met SerSerLysValGlu

TGTCGC43AGCGAGTGTGAGCAGCAAAGTTGAA

:

FIG. 2. Comparison of the metH-iclR control regions from E. coli K12 and S. typhimurium LT2. The relevant sequences (Urbanowski and Stauffer, 1988; Old et al., 1990; Galinier et al., 1900; N6gre et al., 1991) have been aligned. The direction of translation of the iclR and metH genes are indicated. The proposed ribosome binding sites "GGGAG" are marked by "rbs" and the MetR binding sites highlighted by asterisks. The - I0 and - 35 regions of the S. typhimurium and E. coli promoters are underlined and overlined respectively. The transcriptional start points which were determined by S1 mapping for both S. typhimurium and E. coil (Urbanowski and Stauffer, 1988; Marconi et al., 1991) are indicated by the tail(s) of the long arrows. Note that the metH transcriptional start point determined for E. coil lies within the iclR coding sequence.

-35

.................

S. typhimurium TCCGCCAGCACGCTTTGTGCCAGTATGGCTCGTTA

TCTCTTT

E. coli

Met Se rSerLysValGlu

metH

~GT/~TTTGTAGACTGATg.~GGCC.~TTGCGCCGCCATCCGGc/~AGCGAcA~CGTGGGCACGCTGGC~GcTG/~CATGTCTcATGTTGCCcGTTGT

......................................................................

rbs TCGCTTTTA•CACAGATG•GTTTATGCCAGTATGGTTTGTTGAATTTTTATTAAATCTGGGTTGAGCGT•GT•GGGAGCAAGTGTGAGCAGCAAAGTGGAA :: : : : : : : ::: ":: : : : : : : : : : : : : ::: :: : : : : : : :::::::::

S.typhimurium

E. coli

.......................................................

TTC/~TTA--Ti~.TGC~GAGTTCcTG/~cTGATCGGATGAGTGACATCAcAGGATGCCCGATAC~GCTGCGcTATcAGGCCTACGcTTTGGGAGcC~C

:

::::

::

S.typhimurium

:::::::

::

ATTG-TTAGCTAATGCAATAGTTACTGAACTGATCCGATGAGTTA : ::: :::::::: :::: :::::::::::

4" iclR

GGGTGCAGTGGTAGCGGCAGGTTTTCTCCCGcGTTTcGCGGGAACAGGGGCAACCATGGCAGACTCCTTTTTCTGTATCGTGGAAATCATTTTGCTTTTA ProAlaThrThrAlaAlaProLysArgGlyArgLysAlaProValProAlaValMet

ProAlaThrAlaValAlaProLysArgGlyArgLysAlaProIleProAlaValMet TGGTGCGGTGGCAACGGCGGGTTTTCTGCCGCGTTTCGCGGGAATGGGTGCGACCATGACAGTCTCTTTTTTCTGTATCGTGGAAATCATTTTCATTTTT ::::: :::: : :::: :::::::: :::::::::::::::: :: :: : : : : : : ::: ::: : : : : : : : : : : : : : : : : : : : : : : : : : :

4~ iciR

CCTGTTGCGC•AGTTCGGTCAGCGCGACCGTGCCGTTGGACTCGGCAATCcACTccAGCAGCTTCAGAcCGcGAGTTAATGACTGAAccTGcCcGGTTAC G•nG•nA•aLeuG•uThrLeuA•ava•ThrG•yA•nSerG•uAlaI•eTrpG•uLeuLeuLy•LeuG•yArgThrLeuSerG•nva•G•nG•yThrva•

CTTGTTGCGCCAGTTCCGTGAGTGCCACACTG•CATTGGATTCGGCAATCCACTCCAGTAATTTCAGGCCACGCGTTAAAGACTGAACCTGT••AGTCGC : :::::::::::::: :: :: :: :: :::: ::::: ::::::::::::::::: : :::::: :: :: : : : : :

E.coli

S.typhimurium

E.coli

S.typhimurium

E.coli

G~nG~nA~aLeuG~uThrLeuA~ava~serG~AsnSerG~uA~a~eTrpG~uLeuLeuLysLeuG~yArgThrLeuSerG~nVa~G~nG~yThrA~a

m"

o =_

158

I.G. OLOet al.

codons of the E. coli and S. typhimurium metE genes have been published (Shoeman et al., 1988; Maxon et al., 1989; Plamann and Stauffer, 1987). 5. Synthesis of the Corepressor: Methionine to S-Adenosylmethionine This step is not, strictly speaking, part of the pathway of methionine biosynthesis, but is nevertheless included because of the important r61e of S-adenosylmethionine in the control of the met regulon. Until 1989, the conversion of methionine and ATP to S-adenosylmethionine, Pi and PPi was known to be catalyzed by methionine adenosyltransferase (E.C. 2.5.1.6.), the product of the metKgene (Cantoni and Durell, 1957; Greene et al., 1973). The recent discovery of the metX gene, which is homologous to metK, solved the pending question of the existence of a second methionine adenosyl transferase in E. coil (Satishchandran et al., 1990b). Unlike S. cerevisiae, E. coli is unable to transport S-adenosylmethionine, therefore no SAM-requiring mutants have been obtained. A spontaneous ethionine-resistant temperature-sensitive metK mutant was isolated which proved to have a thermolabile methionine adenosyltransferase suggesting that this locus encoded the enzyme (Hafner et al., 1977). The gene was mapped to the site of the other known metK mutants between the speC and speB genes which are involved in polyamine biosynthesis (Hafner et al., 1977). The gene order in the 64minute region was shown to be serA, speB, speA, metK, speC, and a metKcomplementing plasmid also contained the speA and speC genes (Boyle et al., 1984; Satishchandran et al., 1990a). The synthesis of S-adenosylmethionine has been more completely blocked by combining a temperature-sensitive metK mutation with one in metA (Kimchi and Ron, 1987). At the nonpermissive temperature, these double mutants could grow on methionine, but not cystathionine--which only supports poor growth because of poor entry. This result demonstrated that it is possible to reduce intracellular levels of Sadenosylmethionine sufficiently to prevent growth of E. coli. Methionine adenosyltransferase from E. coli has been purified to homogeneity and was found to have a molecular weight of 180 kDa and to be composed of four identical subunits (Markham et al., 1980). The E. coil metK gene is 1152 bp long and encodes a polypeptide of 41,941 Da. The deduced amino acid sequence was confirmed by sequencing the N-terminal end of the protein (Markham et al., 1984). The reactive sulphydryl groups of the enzyme have been identified and antigenic studies performed (Markham and Satishchandran, 1988; Kotb et al., 1990). Several E. coil metK mutants have been described which have lower than normal levels of S-adenosylmethionine synthetase and increased levels of the methionine biosynthetic enzymes (Greene et al., 1970, 1973). A metK-independent pathway for S-adenosylmethionine synthesis has been described for S. typhimurium (Hobson, 1976) and as even a metK: :Tn5 E. coli strain proved to have some residual enzyme activity (Mulligan et al., 1982), it seemed likely that E. coli also possessed two different methionine adenosyltransferases, as is the case in S. cerevisiae (Cherest et al., 1978; Thomas and Surdin-Kerjan, 1987). As mentioned above, a second methionine adenosyltransferase has been reported for E. coil (Satishchandran et al., 1990b). The gene encoding the enzyme has been denoted metX and the gene has been localized to within 4 kb of metKin the gene order speA-metK-metX-speC (Satishchandran et al., 1989). The two methionine adenosyltransferases are antigenically related but can be distinguished by immunodiffusion in their native states. Differential expression of the two genes is seen--the metX gene is only expressed in rich media while metK is only expressed in minimal media (Satischandran et al., 1989). 6. Methionyl- Transfer RNA Synthetase In a prokaryote like E. coli whose growth is extremely rapid, protein synthesis is subject to a double constraint of efficiency in terms of speed and of precision of translation of the mRNA. This precision depends in particular upon the specific esterification of tRNAs by the amino acids which correspond to their anticodons, a function carried out by the 20 different tRNA synthetases. The methionine requiring mutants designated metG were shown to have a methionyl-tRNA synthetase with a reduced affinity for methionine (Smith and Childs, 1966;


159

Gross and Rowbury, 1969). The E. coli enzyme is a homodimer with subunits of 76 kDa with each subunit containing an active site, with fixation of the tRNA being cooperative (Blanquet et al., 1974; Hyafil et al., 1976; Blanquet et al., 1976; Dessen et al., 1978). Upon submitting the native enzyme to limited proteolysis a monomeric, fully active C-terminal deleted fragment of 64 kDa was obtained (Cassio and Waller, 1971). This fragment has been crystallized and the three dimensional structure determined to high resolution (Waller et al., 1971; Zelwer et al., 1982; Brunie et al., 1987; 1990). A dimer of MetG with molecular weight 152 kDa has also been crystallized (Koch and Bruton, 1974). The metG gene has been mapped at approximately 46 and 44 minutes on the E. coil and S. typhimurium genetic maps (Bachmann, 1990; Sanderson and Roth, 1988). The E. coil metG gene has been cloned and sequenced (Barker et al., 1982; Dardel et al., 1984, 1989). The metG gene is 2031 bp long and encodes a polypeptide of 76,127 Da (Dardel et al., 1984). The gene is transcribed from two distinct promoters separated by 510 bp (Dardel et al., 1990). Regulation of met G is of considerable interest in that it may involve autoregulation by a non-canonical form of attenuation. The expression of metG is independent of the met biosynthetic genes (Ahmed, 1973). The use of methioninyl-adenylate, an efficient inhibitor of the enzyme, demonstrated that metG gene expression is controlled by the level of aminoacylated tRNA met (Cassio, 1975). By the use of metG-lacZ fusions it has been shown that a reduction in tRNA methionylation increases the transcription of metG. However, trans-overproduction of active methionyl t-RNA synthetase causes a reduction in synthesis of methionyl t-RNA synthetase (Dardel et al., 1990). The authors propose a model for metG autoregulation based on the observation that the "long" metG mRNA contains (1) a sequence resembling a Rho-independent terminator, and (2) a sequence which can fold into a cloverleaf structure with considerable homology to tRNA met, which includes the methionine CAU "anticodon". The model proposes an interaction between the enzyme and the clover leaf structure which would facilitate folding of the terminator stem; therefore an intracellular excess of free methionyl t-RNA synthetase could trigger premature termination of its own transcription (Dardel et al., 1990). The suppression of methionyl tRNA synthetase mutants ofS. typhimurium was found to be due to mutations in the metK or metJ methionine regulatory genes which resulted in methionine overproduction (Chater et al., 1970). In E. coli a second class of metG revertants has been described which exhibit normal repression of the methionine biosynthetic enzymes. This repression was found to be reIA dependent supporting the proposal that ppGpp was a general positive regulator for amino acid biosynthesis (Stephens et al., 1975; Somerville and Ahmed, 1977). IV. R E G U L A T I O N BY M E T H I O N I N E AND VITAMIN B I 2 : GENETIC STUDIES In this section we shall focus particularly on a newly discovered activator, MetR, and the regulation of the terminal step of methionine biosynthesis while, the met repressor M e t J will be analyzed in detail in Section V. Regulatory mutants for methionine biosynthesis in the Enterobacteriaceae were selected by their resistance to the methionine analogues norleucine, ethionine, and ct-methylmethionine (Cohen and Jacob, 1959; Lawrence et al., 1968). These analogue-resistant mutants were found to map to three loci--metA (metI), metK and metJ. The metlmutants isolated in S. typhimurium have already been described (Section III) while the metJ and metK mutants will be discussed below. In addition, mutations affecting the regulation of the terminal step of methionine biosynthesis have been found to map to the metR, metH and metF genes and to btuB, a gene encoding an outer membrane protein involved in the uptake of vitamin Bx2. 1. Repression by Methionine The study of the control of amino acid biosynthesis was initiated with the observation that the presence of extracellular methionine in the growth medium will repress the met biosynthetic enzymes (Cohn et al., 1953; Wijesundera and Woods, 1960). The methionine biosynthetic genes, metA, metB, metC, metE and metF are all repressed by the addition of

160

I.G. OLDet al.

methionine to the growth medium (Smith, 1971). The level of repression varies for the different met genes: 300-fold for metA, 40-fold for metB, 6- to 12-fold for metC, 60-fold for metE, and 20-fold for m e t F (Katzen and Buchanan, 1965; Rowbury and Woods, 1966; Chater, 1970; Kung et al., 1972; Savin et al., 1972; Flavin, 1975). These differences can be explained by the fact that the met genes are not arranged in a single operon, but scattered throughout the chromosome (Bachmann, 1990; Sanderson and Roth, 1988). Methionine has also been shown to regulate the synthesis of the enzymes of the common pathway which are involved in homoserine s y n t h e s i s - - m e t L (Rowbury et al., 1968; Patte et al., 1967) and also S-adenosylmethionine s y n t h e s i s - - m e t K (Holloway et al., 1970; Su and Greene, 1971; Markham et al., 1984). It is also one of several substances involved in the control of serine hydroxymethyltransferase synthesis by repressing olyA (Stauffer et al., 1974; Stauffer and Brenchley, 1977). Furthermore, methionine partially represses synthesis of the gene products involved in high affinity methionine transport (Kadner, 1975; Ayling et al., 1979). Although methionine has been observed to affect MetH enzyme activity (Kung et al., 1972; Ahmed, 1973), this regulatory effect appears to be an indirect result of repression of the synthesis of MetR, activator of MetH synthesis (see Section IV.3). (a) metJ encodes an aporepressor protein Mutants selected for on the basis of ethionine resistance were found to map to the metJ gene. These strains were all found to overproduce methionine, to be derepressed for the met biosynthetic enzymes, and be resistant to repression by exogenous methionine. The levels of tRNA met and methionyl-tRNA synthetase were found to be unaltered in m e t J mutants whereas S-adenosylmethionine synthetase levels were derepressed (Gross and Rowbury, 1969; Ahmed, 1973; Clandinin and Ahmed, 1973). The m e t J gene product was demonstrated to be a protein by the isolation of the amber-suppressible m e t J mutations (Minson and Smith, 1972). It was shown to be trans-acting by the fact that metJ ÷ is dominant to metJ in both E. coli and S. typhimurium partial diploids strains (Chater, 1970; Su and Greene, 1971; Ahmed, 1973). Therefore it seemed likely that the m e t J gene product acted as a repressor protein. (b) S-adenosylmethionine is the corepressor Early evidence that S-adenosylmethionine rather than methionine was the corepressor of the MetJ aporepressor came from the observation that m e t K mutants were defective in methionine, but not vitamin B 12-mediated repression of the MetE and Met F enzymes (Kung et al., 1972). Mutants selected by resistance to the methionine analogue norleucine were found to map to the metKlocus. It should be noted that as S-adenosylmethionine synthetase is an essential enzyme and S-adenosylmethionine cannot be transported by E. coli the selection of m e t K mutants by their resistance to ethionine could only yield those mutants which have residual S-adenosylmethionine synthetase activity (Holloway et al., 1970; Tabor and Tabor, 1972; Kimchi and Ron, 1987). The m e t K ethionine-resistant mutants were found to form two different classes. Firstly there were those which excreted methionine, were derepressed for the met biosynthetic enzymes and were not repressed by methionine: and secondly those which did not excrete methionine had normal enzyme levels, and were subject to repression by methionine (Greene et al., 1970, 1973; Lawrence, 1972; Hobson, 1974). The first class of mutants suggested that S-adenosylmethionine, or a derivative, rather than methionine itself was the corepressor of the met regulon (Hobson and Smith, 1973). This theory was confirmed, for the m e t F gene, by elegant in vitro experiments which can measure the rate of synthesis of the first dipeptide or tripeptide from any gene--providing the Nterminal di- or tripeptide is known (Shoeman et al., 1985b). The ability of purified aporepressor protein to inhibit MetF dipeptide synthesis was found to depend on the concentration of exogenous S-adenosylmethionine with a maximum effect at a concentration of 50 #M S-adenosylmethionine (Shoeman et al., 1985c). This dipeptide assay system was also used to demonstrate the same effect for the repression of the met J, metB and metL genes (Shoeman et al., 1985a). In addition, in vitro binding assays demonstrated that whereas


161

S-adenosylmethionine and purified aporepressor protein would bind cooperatively to the metF operator region, methionine did not stimulate repressor binding (Saint Girons et al.,

1986). From these experiments it can be concluded that S-adenosylmethionine, rather than methionine itself, is the corepressor of the met regulon. 2. Repression by Vitamin

B12

In addition to being regulated by methionine, two of the genes involved in the terminal step of methionine biosynthesis, metE and metF, are regulated by vitamin B12. The observation that B12 would repress the synthesis of"methionine synthetase" was first made by Rowbury and Woods (1961). They also reported that serine and homocysteine repressed enzyme formation, and suggested that the regulatory effects were probably due to the formation of methionine (Rowbury and Woods, 1961). The specific reduction of MetE and MetF enzyme activities by vitamin B~2 was first described for E. coli B and S. typhimurium (Milner et al., 1969; Whitehouse and Smith, 1973). The fact that the vitamin B~2-mediated repression was specific to MetF and MetE suggested that this repression was not due to increased synthesis of methionine by the vitamin B12-dependent transmethylase. This was confirmed by assaying the intracellular levels of methionine. However, a correspondence was seen between the formation of the MetH holoenzyme from the apoenzyme and various vitamin B12 derivatives, and the vitaminB~ 2-mediated repression of metE. It was suggested that the MetH holoenzyme was a component of the repression system for metE and metF (Milner et al., 1969; Whitehouse and Smith, 1973). These results were largely confirmed by the experiments of Dawes and Foster (1971) who demonstrated that the vitamin B~ 2-mediated repression was due to repression of synthesis of the enzymes rather than inhibition of their activity (Dawes and Foster, 1971). The use of gene fusions has confirmed that metF and metE gene expression is repressed by vitamin B12 (Mulligan et al., 1982). Repression of the transcription of metF by 0.5 nm vitamin B12 has also been observed in a maxicell system (Emmett and Johnson, 1986). It has been demonstrated that the metFgene product is required for vitamin B~2-mediated repression of metE (Mulligan et al., 1982). The observation that not only the vitamin B12-independent homocysteine transmethylase (MetE) but also 5-methyltetrahydrofolate reductase (MetF) is repressed by vitamin B~2 is not surprising. As the MetH enzyme is over 50-fold more efficient than MetE, when cobalamin becomes available, the excess MetF activity becomes superfluous. It should be noted that whereas MetE enzyme activity is reduced 99% by growth in the presence of cobalamin, MetF enzyme activity is only reduced 78% (Milner et al., 1969) indicating that synthesis of the metF gene product is still necessary. It has been found that in the absence of cobalamin, the rate limiting enzyme in the terminal step of methionine biosynthesis is MetE, whereas in the presence of cobalamin it is MetF, rather than the vitamin B~2-dependent transmethylase, MetH (Dawes and Foster, 1971). It was also noted that the presence of 10- a Mvitamin B ~2 in the growth medium caused the elevation of MetH enzyme activity by 3.5-fold in a metJ ÷ strain and by 2-fold in a metJ derivative, similar results being obtained for E. coil and S. typhimurium (Kung et al., 1972; Urbanowski and Stauffer, 1986b). Somewhat different results were obtained by Ahmed (1973) using E. coil K12. It was observed that when the strain was grown in a medium containing 7.5 x 10-aM vitamin B~2, the activity of the MetH enzyme was increased 37-fold over the basal level, an effect which appeared to be due to de novo synthesis of the enzyme (Ahmed, 1973). However, experiments using metH'-lacZ ÷ fusions for E. coli and S. typhimurium indicate that vitamin B~2 does not cause any significant increase in transcription of m e t H (Urbanowski et al., 1987; Old et al., 1990). Therefore it would appear that the vitamin B~2 effect is most likely due to the formation of a stable holoenzyme rather than by induction of MetH synthesis by vitamin B~2 (Kung et al., 1972). The btuB gene is also regulated by vitamin B 12 (Kadner, 1978), and one possible candidate for the repressor protein was the MetH gene product. However, the use of b t u B - l a c Z fusions demonstrated that inactivation of the m e t H gene had no effect on vitamin B12-mediated repression of btuB (Fletcher et al., 1986). In addition a btu regulatory gene, btuR has been JPB 56:3-B

162

I.G. OLDet al.

described which represses transcription from a btuB-lacZ fusion, but not from metE-lacZ (Lundrigan et al., 1987). Therefore there are two different regulatory systems for the vitamin B12-mediated repression of the btu and met systems. (a) A r61e for MetH as a regulatory protein? The observation that metH mutants of S. typhimurium and E. coli B were unable to sustain vitamin B12-mediated repression of MetE was first made by Kung et al. (1972). Further evidence that repression by vitamin B12 and methionine were by independent mechanisms, and for the involvement of the MetH holoenzyme, was obtained using various metH, metJ and metK mutants of S. typhimurium, and E. coli B and K12 strains (Kung et al., 1972). Whereas in the metH mutant strains vitamin B 12 caused no repression, there was repression by methionine; in the metK and metJ strains the reverse effect was seen. It was also noted that, at a vitamin B ~z concentration of 7.5 × 10- ~° M, the vitamin Bt z-dependent transmethylase was totally converted to holoenzyme and the repression of the MetE and MetF enzymes was almost maximal. In addition, the repression of both enzymes and the formation of the holoenzyme were both initiated at the same vitamin Blz concentration (Kung et al., 1972). These results clearly indicated that the reduction in MetF and MetE activity was dependent on the formation of the MetH holoenzyme, and led to the hypothesis that the MetH holoenzyme was also a regulatory protein (Kung et al., 1972). In a later study, several Tn5induced met regulatory mutations were isolated by screening for high level fl-galactosidase activity from a metE-lacZ fusion strain in the presence of vitamin B ~2 (Mulligan et al., 1982). Two of these Tn5 insertions were found to be totally dependent on exogenous methionine for growth. These mutations were found to be 15% linked to malE::TnlO, and to be unable to mediate vitamin B 12-mediated repression of metE. Therefore the mutations were assigned to the metH locus. Whitehouse and Smith (1973) screened S. typhimurium metH mutants for their ability to repress MetF enzyme activity. This led to the interesting discovery that the S. typhimurium metH mutants fell into two regulatory classes, A and B. Whereas group A metH mutants repressed MetF activity by 60-100% when compared to a metH + strain, the group B metH mutants displayed a total absence of repression. It was suggested that class A might be a result of metH mutations resulting in a holoenzyme which is unable to catalyze methionine biosynthesis but still able to bind vitamin B~2 whereas class B could be the result of mutations which destroy both properties (Whitehouse and Smith, 1973). An interesting temperature-sensitive metH mutation, metH464, has been isolated from S. typhimurium (Childs and Smith, 1969; Whitehouse and Smith, 1973). metH464 has been noted to give rise to ethionine-resistant revertants, which retain the original metH mutation and appear to have two suppressor mutations, in metJ (supI) and another undefined locus (suplI) (Whitehouse and Smith, 1974). The authors proposed that MetH may require an interaction with MetJ in order to act as a regulatory protein, and that the suppression of the mutation resulted from interaction with an altered MetJ repressor. Alternatively the authors suggested that the supI and suplI mutations might interact to introduce an independent pathway of methionine biosynthesis (Whitehouse and Smith, 1974). Experiments using metE-lacZ and metF-lacZ fusions support the hypothesis that metH-mediated repression requires a functional metJgene product (Plamann et al., 1988; Stauffer and Stauffer, 1988b). The actual mechanism of vitamin B~2-mediated repression by metH is still to be elucidated and remains one of the more interesting enigmas of the system. (b) Possible r61es for metF and btuB in vitamin B~2-mediated regulation The involvement of metF in the regulation of the terminal step of methionine biosynthesis was implied by the results of Whitfield et al. (1970), who found that the highest yield of MetE protein was obtained in a strain lacking 5,10-methylenetetrahydrofolate reductase activity. This enzyme is the product of the metFgene. In addition, several Tn5-induced met regulatory mutations have been isolated by screening for high level fl-galactosidase activity from a metE-lacZ fusion strain in the presence of vitamin B12 (Mulligan et al., 1982). An insertion was found which gave the same phenotype as the metH:'Tn5 insertions, but in addition,

Methioninebiosynthesis

163

when transferred to a metA strain, prevented growth on homocysteine. The mutant was therefore assigned to the metFlocus, and P1 mapping confirmed this allocation. The reason that m e t F regulatory mutants have not previously been isolated using analogues might be explained by the fact that lacking 5-methyltetrahydrofolate,methionine synthesis would be blocked (Mulligan et al., 1982). The involvement of m e t F in the regulation of the terminal step of methionine biosynthesis can be explained in two ways. Either the MetF enzyme might be directly involved in the repression, or it might signify a requirement for the product, 5-methyltetrahydrofolate. The second possibility is appealing as it readily fits with the model of the MetH holoenzyme as a regulatory protein--the formation of MetH holoenzyme requires, amongst other components, MetH apoenzyme, vitamin B12, and 5-methyltetrahydrofolate. The btuB gene product has also been implicated in the vitamin B 12 repression system. Out of several Tn5-induced met regulatory mutants isolated by screening for high level flgalactosidase activity from a m e t E - l a c Z fusion strain in the presence of vitamin B12, two were able to grow when supplemented with 0.1 #g/ml but not 0.1 ng/ml vitamin B~2 (Mulligan et al., 1982). The mutations were found to be 57% linked to arg by P1 transduction and to be resistant to colicin El, and were therefore assigned to the btuB locus (Mulligan et al., 1982). The btuB gene product is an outer membrane protein which is a component of the vitamin Bs 2 uptake system. The involvement of btuB in the regulation of the terminal step of methionine biosynthesis can be explained by the inability of btuB mutants to accumulate sufficient intracellular vitamin B~2 to cause repression of m e t E and metF. 3. metR, A N e w Methionine Regulatory Gene A new methionine regulatory gene, metR, was discovered in the late 1980s (Urbanowski et al., 1987). In the 1960s approximately 200 new met mutants were produced using chemical mutagenesis and their genetic deficiencies were identified (Smith, 1961; Smith and Childs, 1966). The 52 m e t E mutants which were isolated defined two different complementation groups, suggesting at the time that the MetE enzyme was a heterooligomer (Smith and Childs, 1966). No further progress was made until 1987 when an E. coli methionine auxotroph was isolated which had a phenotype similar to that of a m e t F mutant or a m e t E m e t H double mutant (Urbanowski et al., 1987). Whereas the mutant strain had wild type metF, metE and m e t H genes, MetH enzyme activity and fl-galactosidase activity from a m e t E - l a c Z fusion were very low: 180 and 9%o respectively of that of the parental strain (Urbanowski et al., 1987). These results implied that the methionine auxotrophy of the strain was due to an inability to synthesize sufficient homocysteine transmethylase enzymes to allow growth. It was found that metE + or m e t H + multicopy number plasmids could overcome a mutation in the newly identified metR gene by overexpression of the homocysteine transmethylases (Urbanowski et al., 1987). The m e t R mutation was shown to be linked to metE, but lay outside the m e t e structural gene. The S. typhimurium and E. coli metR genes have been cloned and the gene products identified as polypeptides of 34 kDa (Urbanowski et al., 1987; Plamann and Stauffer, 1987; Aldea et al., 1988; Maxon et al., 1989). Both genes have been sequenced and the MetR polypeptides are approximately 80% identical (Plamann and Stauffer, 1987; Maxon et al., 1990). The E. coli m e t R gene is 951 bp long and encodes a polypeptide of 35,628 Da (Maxon et al., 1990). The MetR protein is a homodimer and was proposed to contain a leucine zipper motif characteristic of many eukaryotic DNA binding proteins (Maxon et al., 1990). In S. typhimurium, the metR and m e t E genes are divergently transcribed from overlapping promoters and only 250 and 25 nucleotides separating their AUG initiation codons and transcriptional start sites respectively (Plamann and Stauffer, 1987). The arrangement is similar in E. coli, with two transcriptional start sites found for m e t R (Cai et al., 1989a). A m e t R - l a c Z fusion was used to demonstrate that metR is repressed 70- to 80-fold by MetJ (Urbanowski and Stauffer, 1987). In addition to being negatively regulated by the m e t J gene product, the m e t R gene was found to be negatively autoregulated. Conversely MetR appears to have no r61e in the regulation of the m e t J gene. MetR activates both m e t E and m e t H expression and homocysteine appears to be the coactivator of the MetR activator protein for

164

I. (~. OLD et al.

metE, although not for metH (Urbanowski and Stauffer, 1987, 1989b; Cai et al., 1989b). Homocysteine was found to increase transcription of mete 4-fold, while unexpectedly, metH transcription was reduced 3-fold. It has been suggested that this regulatory mechanism may apply when the bacterium is in an environment lacking vitamin B12, the substrate for the MetH enzyme. The loss of MetH enzyme activity would lead to methionine starvation and the biosynthetic enzymes would become derepressed, thus accumulating homocysteine. The increased concentration of homocysteine could act as a signal for the cell to change to the vitamin B12-independent transmethylase (Urbanowski and Stauffer, 1989b). E. coli metR mutants have been isolated which result in increased metH expression (Byerly et al., 1990) and it has been predicted that the mutation lies in a region of the gene lies between amino acids 88 to 182 of the polypeptide, which is thought to contain the homocysteine binding site (Maxon et al., 1990). O-succinylhomoserine, cystathionine, Y-methyltetrahydrofolate and methionine had no effect on the vitamin B 12-mediated regulation of metE and metH (Urbanowski and Stauffer, 1989b). It is interesting to note that vitamin B~2 was observed to enhance the expression of metR (Urbanowski and Stauffer, 1987). However it has not been demonstrated whether this is an indirect effect of vitamin B~2-mediated repression of metE or a direct stimulation, presumably by the MetH holoenzyme. The metE/R system is similar to previously described activator systems such as cys8, lysA/R and iivC/Y (Jones-Mortiner, 1968; Stragier and PaRe, 1983; Wek and Hatield, 1988). In the lysine system, overexpression of LysA can complement a mutation in the regulatory gene, lysR (Stragier and Patte, 1983). Like mete and metR, lysR is divergently transcribed to lysA, and like metR, lysR is autoregulated, and also acts at the level of transcription. A LysR-diaminopimelate complex activates lysA transcription, while LysR itself represses lysR synthesis with or without diaminopimelate (Stragier and Patte, 1983; Stragier et al., 1983a,b). In fact the metE/R system appears to be a member of a large class of regulatory proteins (Beck and Warren, 1988, Henikoff et al., 1988). The regulatory effects of the MetR activator allows for a very sensitive control of the terminal step of methionine biosynthesis in different environmental conditions. The regions upstream of the E. coli and S. typhimurium metH open reading frames contain no examples of MetJ binding sites and it has been reported that the MetJ represser and Sadenosylmethionine have no effect on the synthesis of MetH in vitro (Urbanowski and Stauffer, 1988; Old et al., 1990; Cai et al., 1989a). Therefore it seems likely that the regulatory effects of methionine and MetJ are an indirect effect of repression of synthesis of MetR, the trans-acting activator of mete and metH, which is repressed 70-fold by methionine/MetJ (Urbanowski and Stauffer, 1987). The MetR activator binding site of the metE and metJ genes have been determined. DNAase I footprinting studies of the metE/R intergenic region inS. typhimurium and E. coil showed that the region protected by the activator contains a sequence of dyad symmetry (5' TGAA . . . . TTCA 3') (Urbanowski and Stauffer, 1988, 1989a; Cai et al., 1989a). A similar sequence (5' TGAA . . . . CTCA 3') is found upstream from metH initiation codon of S. typhimurium and E. coil which appears to be the MetR binding site ofmetH (Urbanowski and Stauffer, 1988; Old et al., 1990; Marconi et al., 1991). Single base pair changes introduced in the MetR binding site of the S. typhimurium metH gene resulted in two classes of spatially grouped mutations. The first class caused reduced activation of metH-lacZ fusions which corresponded to reduced MetR binding while the second class caused reduced activation, but no corresponding reduction in activator binding. This suggests that the MetR recognition site consists of two regions, one required for binding and the other for activation (Byefly et al., 1991). In addition to the r61e which the metR gene product plays as an activator involved in regulation of the terminal step of methionine biosynthesis, it has also been implicated in regulation of the S. typhimurium glyA and metA genes. Activation of glyA by MetR requires homocysteine and activation is over only a narrow, 3-fold range (Plamann and Stauffer, 1989). Like glyA, metA is also activated by MetR over a rather narrow range of about 3-fold. However, homocysteine plays an inhibitory r61e in the MetR-mediated activation of a metA-lacZ fusion, decreasing expression 3-fold. Gel mobility shift assays and DNAse I


165

protection studies have confirmed that MetR protein binds to a region of the metA operator which shows homology with the MetR binding sites of metE and metH (Mares et al., 1990). V. THE M E T H I O N I N E REPRESSOR AND I N T E R A C T I O N WITH ITS OPERATORS 1. Identification and Isolation of the Methionine Repressor, M e t J

The E. coli and S. typhimurium metJ genes are 312 and 315 bp long and encode polypeptides of 11,996 and 12,100 Da respectively (Saint Girons et al., 1984; Smith and Greene, 1984; Urbanowski and Stauffer, 1985). The metJ genes from both E. coli and S. typhimurium have been sequenced: metJis transcribed divergently from metB with a complex 300 bp regulatory region between the two initiation codons (Saint Girons et al., 1984; Urbanowski and Stauffer, 1985). The regulation of metJ has been studied in vivo by the use of metJ-lacZ fusions and in vitro using a dipeptide assay, which indicated that both the E. coli and S. typhimurium metJ genes are autoregulated (Saint Girons et al., 1984; Shoeman et al., 1985a; Urbanowski and Stauffer, 1986a). Three metJ promoters have been identified in both E. coli and S. typhimurium: two of these are regulated by methionine while the third is constitutive (Urbanowski and Stauffer, 1986a; Urbanowski et al., 1987; Kirby et al., 1986a). It should be noted that PJ1, PJ2 and PJ3 of E. coil correspond to PJ1, PJo and PJ2, of S. typhimurium, respectively. No metB + clones were detected by complementation analysis of the Clarke and Carbon (1976) clone bank although it has been demonstrated that the metJBLF gene cluster lies on pLC 36-19 (Triggs-Raine et al., 1988). This can be explained by the close proximity of the repressor gene metJ to metB. When present on a muti-copy number plasmid the overexpression of MetJ can cause methionine auxotrophy by almost completely repressing the synthesis of the biosynthetic enzymes. This fact has been used as a selection method for metJ mutants which become methionine prototrophs (Smith and Greene, 1984). The concentration of MetJ in wild type cells has been calculated to represent 0.01% of the total soluble protein which corresponds to 600 dimeric molecules per cell (Saint Girons et al., 1986). Therefore, even in conditions where the overexpression of MetJ is sufficient to cause methionine auxotrophy, the concentration of repressor is still extremely low. In order to facilitate MetJ purification, a very high-copy metJ ÷ plasmid was constructed by removal of the top gene, which regulates plasmid replication (Cesareni et al., 1982). The overproduced MetJ protein from a strain carrying this plasmid was calculated to represent approximately 0.2% of the total cellular protein, and was considered to be a useful source for purification using radiochemically pure MetJ protein as a tracer (Smith et al., 1985). The purified MetJ protein was used in sedimentation experiments to demonstrate that the native protein is a dimer (Smith et al., 1985). As the quantity of protein recovered by inactivating top was still insufficient for physicochemical studies, the gene was cloned under the control of ptac, a powerful, hybrid trp-lac promoter (Saint Girons et al., 1986). The MetJ protein overexpressed from this plasmid represented 2% of the total soluble protein, a 200-fold overexpression of the protein. 2. Methionine Operators

The consensus operator sequence for the MetJ repressor is a palindrome (5'AGACGTCT-3') first noted in a sequence comparison of metB and metC (Belfaiza et al., 1986). Variations of the sequence AGACGTCT have been found in two to five copies for the regulatory regions of the E. coli metA, metBJ, metC, metE/R and metF genes and the S. typhimurium metBJ, metC, metE/R, and metF genes (Saint Girons et al., 1988; Plamann and Stauffer, 1987; Shoeman et al., 1988), The two exceptions are metK and metH which, although regulated by methionine, do not seem to possess the consensus sequence (Markham et al., 1984; Urbanowski and Stauffer, 1988; Old et al., 1990). The presumed repressor binding sites for the E. coli and S. typhimurium met genes are aligned in Fig. 3. It should be noted that in the case ofmetCwith only two binding sites, there is little deviation from the consensus sequence, whereas metF with 5 binding sites shows

166

I.G. OLD et al. E.coli Consensus:AGACGTCT

AGACGTCT

AGACGTCT

AGACGTCT

metA

AGctaTCT 62.5%

gGAtGTCT 75%

AaACGTaT 75%

AagCGTaT 62.5%

metB

AtACGcaa 50%

AGAaGTtT 75%

AGAtGTCc 75%

AGAtGTaT 75%

tGACGTCc 75%

metC

AGACaTCc 75%

AGACGTaT 87.5%

mete

gGAtGaaT 50%

AaACtTgc 50%

cGcCtTCc 50%

metF

cttCaTCT 50%

ttACaTCT 62.5%

gGACGTCT 87.5%

AaACGgaT 62.5%

AGAtGTgc 62.5%

metR

AGgatTtT 50%

AGcCGTCc 75%

AGAtGTtT 75%

AcACaTCc 62.5%

S.typhimurium Consensus:AGACGTCT

AGACGTCT

AGACGTCT

AGACGTCT

AGACGTCT

metB

AtACGcaa 50%

AGAaGTtT 75%

AGAtGTCc 75%

AGAtGTaT 75%

tGACGTCT 87.5%

metC

AGACaTCc 75%

AGACGgtT 75%

mete

gGAtGTgT 75%

AaACaTCc 62.5%

AGACGTCT 100%

metF

cGtCaTtT 50%

ttACaTCT 62.5%

gGACGTCT 87.5%

AaACGgaT 62.5%

AGAtGTtT 75%

metR

AGACGTCT 100%

gGAtGTtT 62.5%

AcACaTCc 62.5%

AtAaaTgT 50%

AGACGTCT

FIG. 3. Operator consensus sequences: the met box sequences from the followingsequenced met genes have been aligned and a consensus box deduced: E. coli metA (Michaeli et al., 1984);metB (Duchange et al., 1983);metC (Belfaiza et al., 1986);mete (Cai et al., 1989a);metF (Saint Girons et al., 1983)and metR genes (Cai et al., 1989a); and the S. typhimurium metB (Urbanowski et al., 1987); metC. (Park and Stauffer, 1989a); mete (Plamann and Stauffer, 1987), metF (Stauffer and Stauffer, 1988a) and metR (Plamann and Stauffer, 1987).The minimum size of the operator is two met boxes, that is 16 bp. The sequences of the operators are shown together with their percentage homology to the consensus (indicated under each met box). Upper case letters denote residues homologous to those of the consensus. Note that in E. coli generally the homology to the consensus is best in the shorter operators and towards the centre of the longer ones. considerably more variation. The S. t y p h i m u r i u m m e t E / R regulatory region was noted to contain three sequences corresponding to MetJ binding sites, one a perfect m a t c h with the consensus sequence A G A C G T C T ( P l a m a n n and Stauffer, 1987). Although the m e t J and m e t B genes would appear to share the same repressor binding sites, they show different ratios of repression by m e t h i o n i n e - - 3 - f o l d and 40-fold respectively. This m a y be explained by the fact that m e t J has three different promoters. In addition, the physical location of the binding sites means that the m e t B p r o m o t e r is less accessible to R N A polymerase than those for m e t J (Kirby et al., 1986b; U r b a n o w s k i and Stauffer, 1986a). D N A s e I and i r o n - E D T A footprinting studies, using purified MetJ protein and the m e t J B regulatory region, revealed that the consensus sequence was in the protected region (Smith et al., 1985; K i r b y et al., 1986b). In order to confirm that this was the MetJ binding site, o p e r a t o r constitutive mutations were constructed for m e t F by the use of m u t D and chemical mutagens. The mutations causing m e t F o p e r a t o r constitutivity--five in E. coli and four in S.


167

typhimurium--all mapped to the five 8 bp repeats of the putative operator sequence (Belfaiza et al., 1987; Stauffer and Stauffer, 1988b). Similar studies have been carried out with the S. typhimurium metB and metE genes and the results support AGACGTCT being the consensus met operator (Urbanowski et al., 1987; Plamann et al., 1988). Site-directed mutagenesis has recently been used to create an additional 35 metFoperator mutations. Whereas reducing the homology of each of the five binding sites to the consensus sequence, AGACGTCT, derepresses metF, a single base change which makes one of the repeats a perfect match with the consensus sequence increases the repression of metF (Davidson and Saint Girons, 1989). On the basis of this evidence, the repeated "met-box" sequence AGACGTCT can be unequivocally assigned as the MetJ binding site. 3. Interaction of the M e t J Repressor with its Operators

In order to analyze sequence recognition, a nitrocellulose filter-binding assay has been developed to monitor complex formation in vitro between repressor and DNA fragments, derived from plasmid polylinkers, carrying various embedded potential operator sequences (Phillips et al., 1989; He et al., submitted). These experiments have shown that DNA fragments containing two consecutive consensus met-boxes, i.e. a synthetic 16 base pair met operator, are tightly bound by repressor in the presence of saturating corepressor (Sadenosylmethionine), whereas those containing only a single met-box are not. Scatchard analysis of the binding data for this 16 base pair operator suggests that binding is cooperative with respect to protein concentration. Nuclease footprinting and gel retardation assays suggested that the observed co-operativity was due to the binding of an array of repressor dimers centred on the 16 base operator site, but extending into the adjoining nonoperator DNA. These in vitro data are consistent with two experiments in vivo. In the first, the smallest naturally occuring operator, metC, was fused to lacZ, and the level of repression of a series of operator mutants determined (Phillips et al., 1989). The results showed that point mutations rendering the sequence closer to the consensus increased the level of repression, consistent with the idea that consensus met-boxes are effective operators. In the second experiment in vivo, the metF operator was also fused to lacZ and a similar series of operator point mutants analyzed (see above; Davidson and Saint Girons, 1989). The results showed that the arrangement of all five met-boxes in tandem repeats is important for effective repression, since point insertions within the operators lowered repression ratios 100-fold. These observations are entirely consistent with the data in vitro, and also suggest multiple cooperative binding of repressor arrays. Dimeric regulatory proteins which recognize sequences with 2-fold symmetry do so by binding such that the protein 2-fold symmetry axis coincides with that of the DNA. The organization of met operators results in an ambiguity in determining precisely which DNA sequence would be aligned with the repressor dimers in the complex. This is because tandem repetition of the 8 base pair met-box sequence generates operators having two distinct types of 2-fold axes, one at the centres of met-boxes and the other at the junctions between them (Fig. 4). In an attempt to distinguish between these two possibilities, a number of synthetic operator sequences have been cloned into DNA polylinker fragments, and assayed for repressor affinity using filter-binding. To reduce complicating effects due to formation of cooperative arrays, the synthetic operators were cloned between flanking sequences designed to inhibit binding to adjoining non-operator sites. These flanking sequences were derived from inspection of the natural met-box sequence conservation table. An 8 base pair "antimet-box" sequence (CCGGCAGG) was designed, where each position is occupied by the least frequently occurring base in natural met-boxes. Synthetic operator sequences of the type anti-met-box:met-box:met-box: anti-met-box (see Table 2 for example) were cloned into polylinker fragments, and assayed for binding. The affinities of these constructs are higher for consensus operators centred on the 2-fold axis between met-boxes, i.e. AGACGTCTAGACGTCT, than those centred on the other 2-fold, i.e. GTCTAGACGTCTAGAC. Chemical footprinting showed that repressor binding only protects 18 base pairs of these operators from digestion, indicating that binding to the flanking anti-met-box sequences had been inhibited.

168

I . G . OLD et al.

Alignment I

I met-box 1 I met-box 2 I met-box 3 I &GACGTCTAGACGTCTAGACGTCTAGACGTCT I I I ISl I I I~I I I I$I I I I@I I I I$I I I I~I TCTGCAGATCTGCAGATCTGCAGATCTGCAGA JJJJJJJJJJJJ~JJJJJJJJJJJJ JJJJJJJJJJJJ~JJJJJJJJJJJJ

met-box 4

I I I$I

I

I I I

JJJJJJJJJJJJ~JJJJJJJJJJJJ

Alignment 2

AGACGTCTAGACGTCTAGACGTCTAGACGTCT

I I I I$I

I I I@I I I I$I

I I I,~I

I I ISI

I I I@I I I I$1

1 1 1

TCTGCAGATCTGCAGATCTGCAGATCTGCAGA

JJJJJJJJJJJJ~JJJJJJJJJJJJ JJJJJJJJJJJJ~JJJJJJJJJJJJ FIG. 4. Schematic representations of the model for multiple repressor binding to met-boxes. Four perfect consensus met boxes are shown, to which are bound MetJ dimers (J J J J J) at sites centred 8 base pairs apart in two possible alignments: (1) dimer 2-fold axes coincident with axes between met boxes, (2} dimer 2-fold axes coincident with 2-fold axes within met boxes. Axes between the met boxes are shown by ~b and within the met boxes by §. Dimer two-fold axes are shown by 1~and the 2-fold axes between dimers by O. In both eases the repressors form a left-handed superhelix wrapped around the DNA, with rise of eight base pairs and rotation of approximately 90 ° from one dimer to the next (assuming 10-fold B-DNA).

These experiments do not, however, resolve the ambiguity in the true site for a repressor dimer, since the stoichiometry of the complex has not been determined. Gel retardation assays with these constructs showed a single retarded protein-DNA complex in the range of protein concentration where binding is specific. The simplest interpretation of these data, i.e. that the complex formed consists of a single repressor dimer bound to the operator, is incorrect. The crystal structure of the repressor-operator complex (see below) shows that the complex consists of two repressor dimers bound cooperatively to the operator site, in an arrangement corresponding to alignment two in Fig. 4. Chemical and enzymatic footprinting, together with binding interference assays, have been used to probe repressor-operator complexes in solution at concentrations approaching those found in oivo. The results of such experiments are consistent with the formation of a complex similar to that observed in the crystal structure. In particular phosphate ethylation interference data identify particular operator phosphate groups which are tightly bound by the repressor. This correlation with the crystal structure is the most compelling evidence supporting the structural interpretation. Other evidence, however, such as protection of guanines from methylation by dimethyl sulphate in the major groove, is also consistent. The effect of sequence variation throughout the operator has been assessed by synthesis of a systematic set of variant operators in which each position in a two met-box 16 base pair operator has been changed to all other possible base-pairs while retaining the symmetry (Table 2). Binding assays with these operators produced a rank order of operator affinities consistent with the protein-DNA contacts observed in the crystal structure. A number of mutant repressor proteins have been prepared, using site-directed mutagenesis, to probe the rrles of various amino acid residues in operator binding (Table 3). These mutant repressors have been assayed for operator binding both in vivo, using lacZ fusions, and in vitro using gel retardation of DNA fragments carrying operator sequences. Mutations were made at residues contacting the DNA directly, and at those involved in the protein-protein contact between adjacent repressors. Again, results are consistent with the structural interpretation, and show the importance of the protein-protein contact. Effective repression depends on the cooperativity arising from the latter contacts.


169

TABLE 2. IN VITRO BINDINGDATA FOR SYSTEMATICMUTANTSOF A CONSENSUSTWO MET-BOx OPERATOR

[MetJ] for half-maximal b i n d i n g (nM)

Operator Sequence anti I met-boxl Consensus

anti met-boxl

met-box{

met-box

CCGGCAGG

AGACGTCT

AGACGTCT

CCTGCCGG

I0

1

CCGGCAGG

gGACGTCc

gGACGTCc

CCTGCCGG

240

2

CCGGCAGG

tGACGTCa

tGACGTCa

CCTGCCGG

760

3

CCGGCAGG

cGACGTCg

cGACGTCg

CCTGCCGG

760

4

CCGGCAGG

AcACGTgT

AcACGTgT

CCTGCCGG

960

5

CCGGCAGG

AaACGTtT

AaACGTtT

CCTGCCGG

1200

6

CCGGCAGG

AtACGTaT AtACGTaT

CCTGCCGG

319

7

CCGGCAGG

AGgCGcCT AGgCGcCT

CCTGCCGG

119

8

CCGGCAGG

AGtCGaCT

AGtCGaCT

CCTGCCGG

1200

9

CCGGCAGG

AGcCGgCT

AGcCGgCT

CCTGCCGG

306

10

CCGGCAGG

AGAgcTCT

AGAgcTCT

CCTGCCGG

59

ii

CCGGCAGG

AGAtaTCT

AGAtaTCT

CCTGCCGG

480

12

CCGGCAGG

AGAatTCT

AGAatTCT

CCTGCCGG

480

Polylinker

AATTCCCG

GGGATCCG

TCGACCTG

CAGCCAAG

960

Mutants

Figures quoted are estimated repressor concentrations required for 50% complex formation in a gel retardation assay. The polylinker sequence without the insert is shown as a control for non-specific binding. Bases differing from the consensus are shown in lower case (McNally et al., unpublished data).

Equilibrium dialysis experiments with structural analogues of S-adenosylmethionine have shown that S-adenosylhomocysteine competes with S-adenosylmethionine for the corepressor site. However, it does not act as a corepressor. S-adenosylhomocysteine differs from Sadenosylmethionine by loss of a methyl group from the sulphur atom, which also eliminates the positive charge. S-adenosylhomocysteine binding could be important in vivo since the Sadenosylmethionine and S-adenosylhomocysteine concentrations could regulate the number of free corepressor sites on MetJ repressors. The r61e of arrays of repressor bound to extended operators, with sequences varying from the consensus, is not clear. In vitro dissociation experiments have shown that array formation dramatically extends the lifetime of repressor-operators complexes. Indeed, for arrays of approximately four repressor dimers, the half-life of complexes at 37°C is so long, when challenged by changes in DNA or S-adenosylmethionine concentration, that it is hard to see how derepression is triggered in vivo. 4. Three-Dimensional Structure of the Methionine Repressor

The E. coli MetJ repressor has been crystallized in a number of forms in the presence and absence of S-adenosylmethionine and operator, and its three-dimensional structure determined (Table 4). Although it is similar in size to other small dimeric prokaryotic repressors, such as E. coli TrpR repressor, which recognize their operators via the conserved "helix-turn-helix" (HTH) motif (Pabo and Sauer, 1984; Harrison and Aggarwal, 1990) and it even possesses some sequence homology to the HTH motif near the C-terminus (Rafferty et al., 1988), its three-dimensional fold is different from those of the other known repressor JPB 56:3-C

I. G. OLD et al.

170

TABLE3. IN VIVO AND IN VITRO ANALYSISOF OPERATORBINDINGBY MUTANTS OF METJ CREATEDUSINGSITE-DIRECTEDMUTAGENESIS In vivo repression

Protein

ratio

Wild type

1.0

In vitro [Met J] for half-maximal binding (rim monomer)

36 (16)

Contacts to 06 of G2 Lys23~Glu Lys23~ Ala

132.0 4.8

290 1800

Contacts to N7 of A3 Thr25 ~ Val Thr25 ---,Gin

110.0 134.0

2200 1240

Inter-dimer interface Thr37~Ala

99.0

280

To examine the effects of mutations in vivo, fl-galactosidase assays were performed, using a met J-strain carrying the m e t F - l a c Z reporter construct, in the presence and absence of the relevant mutated metJ gene carried on an expression plasmid. The data are the ratios of the fl-galactosidase activities in each case compared to wild type, i.e. derepression of transcription of the m e t F - l a c Z fusion by mutant repressors leads to increased gene expression. In vitro data were obtained using cell extracts, containing roughly 40% of total protein by weight mutant MetJ, in gel retardation assays with a radiolabelled DNA fragment encompassing a cloned 32 bp antimetbox-metbox-metbox-antimetbox operator. The approximate MetJ protein concentrations which resulted in retardation of 50% of input DNA are listed. The value in brackets for the wild type protein was obtained for protein purified to homogeneity (He et al., unpublished results). G2 and A3 are the second and third bases of the met-box respectively.

TABLE4. CRYSTALSTRUCTUREDETERMINATIONAND REFINEMENTDATAFOR METJ REPRESSORDERIVATIVES

Space group Precipitant Resolution (A) R-factor

ApoMetJ 1

ApoMetJ 2

MetJ-SAM~

1

II

I

MetJ-SAM 1 II

MetJ-SAM-19met4

P21 PEG600

P2t Ammonium sulphate 2.2 0.28

P21 PEG600

P3221 Mgz÷

P6222 MPD

1.8 0.17

1.9 0.18

2.8 0.22

1.7 0.21

In all crystal forms the asymmetric unit consists of at least one repressor dimer: i.e. the dimers do not possess perfect 2-fold symmetry. ApoMetJ I and MetJ-SAM I crystal forms are isomorphous, and crystallizeunder similar conditions. (SAM= S-adenosylmethionine.) l(Rafferty et al., 1989). 2(Rafferty et al., 1988)--crystallization only. Structure determination still in progress (S. Strathdee and W. S. Somers, unpublished results). 3K. Phillips and W. S. Somers, unpublished results. 4(Rafferty et al., 1989)---noteadded in proof; Somers, 1990; Phillips, 1991). See Fig. 7 for 19-meroligonucleotide operator sequence.

structures. The overall structure of the repressor-corepressor complex is s h o w n in Fig. 5a a n d b. It consists of a 15 residue extended chain from the N - t e r m i n u s , followed by a fl-hairpin (residues 15-20) labelled "loop" in the figure, which leads into a s i n g l e / / - s t r a n d (residues 20-29). This s t r a n d a n d the related strand from the second s u b u n i t , form a n antiparallel flr i b b o n which lies o n one face of the molecule, centred o n the dimer 2-fold axis. The s t r a n d links to the long s-helix A (residues 3 0 ~ 5 ) , which lies o n the outside of the dimer, followed by a loop region a n d helix B (residues 52-66), which runs t h r o u g h the centre of molecule a n d forms part of the s u b u n i t interface. A n extended loop follows this helix, a n d leads into the final helix C (residues 86-94), a t u r n a n d a short c a r b o x y t e r m i n a l region. The crossing of the fl-strands m e a n s that the two s u b u n i t s are interlocked, a n d could n o t be separated if the molecule was rigid. The 15-20 loop is very flexible, a n d often poorly defined in electron density maps. The observed structure is consistent with the previous o b s e r v a t i o n that a


(a)

(b)

FIG. 5.

171

172

I.G. OLD et al.

(c)

Fro. 5. (a) Ribbon representation of the structure of the MetJ repressor viewed along the molecular 2-fold axis, with ~-helices shown as coiled ribbons, t-strands as flat arrows and S-adenosylmethionine (SAM) as ball and stick. One subunit is shaded lightly, with the major elements of secondary structure labelled and the chain termini marked N and C. The flexible loop formed by residues 15-20 is also indicated. The second subunit is darkly shaded, with termini indicated by the N' and C'. The view is along the molecular 2-fold axis, with the crossed t-strands nearest the reader and the SAM molecules on the far side. (b) Similar to (a) but viewed from the opposite direction along the two-fold axis, with the SAM molecules uppermost. (c) The DNA binding motif, bound to the operator, viewed as in (b). Residues 1-9 and 59-104, and the SAM molecules, have been omitted for clarity. The DNA is shown as ball and stick, with filled bonds for the sugar-phosphate backbone, and open bonds for the remainder of the ribose rings and the bases. The central region of the DNA fragment shown is a metbox, and the bases have been labelled along one strand. The central 2-fold axis of the met-box coincides with the repressor molecular 2-fold. The t-strands lie in the central major groove, which faces the reader, while the minor grooves lie to the upper left and lower right. The diagrams were drawn using a program originally written by J. Priestle (Priestle, 1988), modified by D. R. Flower.

s p o n t a n e o u s p o i n t m u t a t i o n Ala60---}Thr leads to a n o n - f u n c t i o n a l r e p r e s s o r (LiljestrandG o l d e n a n d J o h n s o n , 1984). This residue is p a c k e d in the interface between the B helices, a n d the m u t a t i o n w o u l d h i n d e r d i m e r i z a t i o n . S - a d e n o s y l m e t h i o n i n e b i n d s to the d i m e r at two i n d e p e n d e n t s y m m e t r y - r e l a t e d sites n e a r the 2-fold axis, on the o p p o s i t e surface to t h a t c o n t a i n i n g the t - r i b b o n . Its p u r i n e ring is b u r i e d d e e p in a h y d r o p h o b i c p o c k e t next to the B helix, while the m e t h i o n i n e m o i e t y lies at the p r o t e i n surface. This explains w h y m e t h i o n i n e does n o t b i n d to the repressor, while Sa d e n o s y l h o m o c y s t e i n e b i n d s with a b o u t half the affinity o f that for S - a d e n o s y l m e t h i o n i n e . T h e positively c h a r g e d trivalent s u l p h u r of the l a t t e r lies at the C - t e r m i n a l end of helix B, which carries a net negative c h a r g e due to the helix d i p o l e (Hol et al., 1978). T h e r e is no m a j o r c o n f o r m a t i o n a l c h a n g e a s s o c i a t e d with c o r e p r e s s o r b i n d i n g , a n d the structure of the a p o r e p r e s s o r w o u l d be i n d i s t i n g u i s h a b l e from t h a t in Fig. 5, except for the absence of the c o r e p r e s s o r . Small c o n f o r m a t i o n a l changes occur at the N - t e r m i n u s , a n d the side chain of P h e 65, which occupies the h y d r o p h o b i c p o c k e t in the absence o f c o r e p r e s s o r . This c o n t r a s t s with the t r p repressor, where t r y t o p h a n b i n d i n g causes large c o n f o r m a t i o n a l changes in the d i s p o s i t i o n of the D N A r e a d i n g heads, resulting in'higher affinity for the o p e r a t o r ( Z h a n g et al., 1987; reviewed in Luisi a n d Sigler, 1990). A t e m p e r a t u r e - s e n s i t i v e m u t a n t of E. coli has


173

been reported (Collier and Johnson, 1990), where Leu56 of Met J, which is in contact with the corepressor in the hydrophobic pocket, is replaced by Gin. This mutation results, at the nonpermissive temperature, in a lag in the derepression of the methionine regulon to methionine deprivation. The crystal structures of the repressor have been determined in different crystal forms under varying conditions to ensure that the lack of observed conformation change associated with corepressor binding is not an artefact of particular crystal lattices or solvent environments. In all cases studied so far, no significant conformation changes have been found, so the corepressor effect does not appear to stem from a structural transition. The corepressor does not contact the D N A in the repressor-operator complex (see below), and its function remains unclear. One possibility is a longe-range electrostatic effect based on the presence of the positive charge on the sulphur atom of S-adenosylmethionine but not Sadenosylhomocysteine. The crystal structure of a repressor-corepressor-operator complex has also been determined (Table4), using a synthetic self-complementary 19-mer oligonucleotide fragment with the sequence 5 ' - T T A G A C G T C T A G A C G T C T A - 3 ' . The operator consists of two consensus met-boxes, flanked by T - A base pairs and one unpaired 5'-T. The choice of flanking bases was made on crystallographic considerations and is not related to repressor specificity. The structure was determined at lower resolution (2.8A) than the other forms, but is sufficiently accurate to allow protein side-chains to be located. The overall structure (Fig. 6) shows two repressor dimers binding to a single duplex oligonucleotide. Each repressor binds with its antiparallel fl-ribbon inserted into the major groove, centred on a met-box, such that the dimer and met-box 2-fold axes coincide (Fig.5c).

FIG. 6. The structure of the repressor-operatorcomplexwith repressor dimers labelled and shaded as for Fig. 5. Two repressor dimers bind to the same oligonucleotidefragment,one at the lower right and the other at upper left. Theyare related by a central crystallographic2-foldaxis, shownas (•), which passes through the centre of the oligonucleotidebetweenmet-boxes.Non-crystallographic2-foldaxes passing through each repressor dimer coincidewith the local 2-foldaxes passing through the centres of the met-boxes (see Fig. 5c). The antiparallel/J-ribbons occupy the major groove of the DNA at upper left and lower right, while the A helices of adjacent dimers form a long, antiparallel protein-protein contact above the minor groove in the centre of the diagram. The corepressor molecules lie on the outer surfaceof the complex,distant fromthe DNA. The bends in the DNA helix axis are not veryclear in this view,but slight distortion in the formof a reversed"S" can be discerned.

The two repressors make a tight protein-protein contact along antiparallel A-helices, related by the 2-fold axis passing between the met-boxes. The arrangement corresponds to a lefthanded superhelix of repressors wrapped around the DNA, with the intermolecular contacts between A helices accounting for the observed co-operativity of binding. The central 10 base

174

I.G. OLO et al.

pairs of the DNA are in 10.66-fold B conformation without significant bending, so that the relative rotation from one repressor to the next is 90°. The arrangement is such that an extended oligomeric array would repeat exactly after 4 met-boxes (32 base pairs), with the DNA having completed three right-handed helical turns, and the repressor array one lefthanded turn. The DNA is bent towards each repressor at the centre of each met-box to maximize contacts to the protein, the helix axis being deflected by about 25 ° at these points. This results in the major groove narrowing around the fl-ribbons, with non-esterified oxygen atoms of the phosphate backbone making hydrogen-bonded contacts to main-chain amide NH groups on the outer edges of the fl-strands. The minor groove is consequently wider than average on the opposite side of the duplex. Binding of antiparallel fl-ribbons to the grooves of DNA or RNA had been predicted to be feasible from model building studies (Carter and Kraut, 1974; Church et al., 1977). The corepressor molecules bind to the outer surface of the complex, and are distant from the DNA. Base sequence specificity in the complex is mediated both by direct hydrogen-bonded contacts from protein side-chains to edges of the base pairs, and tight interactions between the protein and the phosphate backbone. The latter are apparently used to detect sequencedependent DNA conformation or flexibility. Two side-chains on each fl-strand make direct hydrogen bonded contacts, Thr25 donating a hydrogen bond to N7 of A3, and Lys23 to 06 of G2 (Fig. 7). With all the symmetry-related interactions, this gives a total of eight hydrogen

Base contacts

K23 T25

T25 K23

K23 T25

T25 K23

T-x--To --Ax-- G2 --As -- C4-- Gs -- T6-- C7-- To-- Ao-- Gxo-Ax x- Cxz- Gx3-Tx4- Cxs-Tx •-Ax7

I

I

I

I

A--T--C--T--

loop

B helix

Phosphate

I ,I G~

I

I

I ,I

C--A--G--A--T--

B helix +loop

I

I

C--TIn

B helix +loop

I ~1

I

G-- C~A--

I

I

I

G--A--T--T

B helix

loop

contacts

FIG. 7. Base sequence and numbering scheme for the operator oligonucleotide used in the crystal structure determination of the repressor-operator complex. • indicate local 2-fold axes. A simplified description of the protein-DNA contacts is shown, with direct hydrogen bonds to base pairs in the major groove shown above the line, and contacts to backbone phosphate groups below. Major phosphate contacts are made by the N-terminus of the B helix, and the flexible loop (residues 15-18).

bonds to bases for the complex. There are also some water-mediated contacts, but these are less specific and are not well defined at this resolution. MetJ repressor does not recognize its operator via water-mediated interactions as proposed for trp repressor (Otwinowski et al., 1988). It is notable that in the systematic symmetric operator mutation experiments based on consensus met-boxes, the lowest affinity operators were produced by mutations G 2 ~ A and A 3 ~ T (Table 2), both of which would disrupt hydrogen bonds, and that A3 is the most conserved base in the natural operator sequences. Repressor mutants made using sitedirected mutagenesis also show that replacement of either Lys23 or Thr25 results in large losses in affinity (Table 3). There are also a large number of contacts to the phosphate backbone, some of which are summarized in Fig. 7. Although there are some basic Arg and Lys side-chains involved, the most important contacts seem to be made by main-chain amide NH groups, and some small polar side-chains such as Ser. In particular, a contact is made between the N-terminus of helix B and the phosphate between A1 and G2 (or symmetry-related ones). It is this phosphate that shows by far the strongest ethylation interference effect. The interaction is similar to that commonly seen between helices and phosphate groups in nucleotide and


175

nucleic acid binding proteins, and is favoured by the helix dipole (Hol et al., 1978). It can be seen in Figs 5c and 6. As the repressor is a relatively rigid structure with the B helices passing through its core, and the geometry of the interaction requires the phosphate group to be accurately positioned at the end of the helix, the strength of the contact might be expected to be sensitive to the conformation of the DNA backbone. The other major backbone contact is between the flexible 15-20 loop and the phosphate between C7 and T8. Here again mainly main-chain amide NH groups are involved, but the interaction is not as sensitive to the exact positioning of the phosphate. A comparison of Figs 5b and 5c shows that this loop changes conformation considerably on DNA binding. In fact, it is the only region of the repressor that changes structure significantly in response to complex formation. When the full symmetry is taken into consideration, it can be seen that the two phosphates that interact strongly with the repressor lie in opposing strands between the same base pairs, with the B helix of one repressor contacting one, and the loop of an adjacent repressor contacting the other. These backbone contacts are concentrated immediately adjacent to the TA dinucleotide step lying between met-boxes, in a region where the base pairs themselves cannot be contacted by the protein as it faces the minor groove at this point. Despite this lack of specific contacts between the repressor and the base pairs, systematic mutation of the consensus operator shows a loss in affinity if the TA step is replaced by any other sequence (Table 2). The largest drop in affinity occurs if the step is changed to a purine-pyrimidine step (AT or GC), with a smaller reduction for the other pyrimidine-purine step CG. Pyrimidine-purine steps in a B-DNA duplex have a lower overlap from one base pair to the next than other base steps, resulting in less favourable stacking energy. In fact, the TA step is the least stable of all dinucleotide steps, and these considerations led Klug et al., (1979) to propose a structure for the alternating polymer poly(AT), where the helical twist angle relating one base pair to the next was lower than average at the AT steps, and higher at the TA steps. This is energetically favourable as it optimizes the stacking energy at AT steps, at the expense of losing the very low stacking energy at the TA steps. The crystal structure determination of a dodecamer oligonucleotide containing the sequence ATATAT (Yoon et al., 1988) also shows this effect. The central CTAG region between the met-boxes in the repressor-operator complex has twist angles of 28 ° for the CT and AG steps, but 44 ° at the TA step, where the average twist would be expected to be about 34° . The result of these twist variations is that the flanking phosphate groups are displaced by 2A from their expected positions in regular B-DNA, and these are exactly those phosphates bound highly specifically by the B-helix of the repressor. The twist variations are probably partly due to the relaxed conformation of that particular DNA sequence, and partly to distortion by protein binding facilitated by the instability of the TA step. Replacement of the TA step by any other sequence would hinder the adoption of this conformation by the DNA, and result in reduced affinity. This appears to be a case of "indirect readout" (Otwinowski et al., 1988), where base sequence can be sensed by a protein from the conformational preferences of the DNA, without actually contacting the base pairs directly. The central bases of the met-box, C4 and G5, are neither contacted directly by side chains, nor are their phosphate groups tightly bound. They are the least sensitive to mutation, but affinity is still affected if they are changed. This is probably due to conformational effects, since the 25 ° bend in helix axis around the protein is centred on these bases. Such a bend towards the major groove requires positive roll angles between adjacent base pairs (Travers, 1989), and the CG base step favours this conformation, as do the flanking AC and GT steps. The major features of the recognition of the met-box sequence by MetJ repressor can therefore be summarized as follows: A1 and T8 are detected from the conformational properties of TA steps, G2, C7, A3 and T6 by direct hydrogen bonds to the base pairs, and C4 and G5 by their ability to allow the DNA to bend closely around the protein and maximize the contacts. This is undoubtedly a simplification of the situation in practice. The protein-protein contact between adjacent antiparallel A helices is quite extensive, burying 436 A 2 of solvent accessible area (Lee and Richards, 1971) in the interface between repressor dimers. This corresponds to a strong interaction, sufficient to account for the

176

I.G. OLD et

al.

observed co-operativity of binding. The contact consists of complementary hydrophobic surfaces, formed by Val and Leu residues, with an additional network of water-mediated hydrogen bonds involving Thr, Gin and Asp residues near the central 2-fold axis of the operator (Fig. 6). Proteins carrying site directed mutations in the interface show greatly reduced binding affinity for operators with two or more met-boxes (Table 3). VI. C O N C L U S I O N S The MetJ repressor structure is the first example of a hitherto unknown DNA binding motif, which we term the "Ribbon-helix-helix" (RHH) motif (Phillips, 1991). The essential features of this motif are shown in Fig. 5c: a two stranded antiparaUel fl-ribbon that lies in the major groove of the DNA with main chain amide NH groups contacting the phosphate backbone and side chains making specific contacts to the base pairs, two outer A helices to form cooperative interactions to adjacent proteins along the DNA, and two inner B helices that form the subunit interface and lock the motif down tightly to the phosphate backbone at their N-termini. Following the determination of the MetJ repressor structure, the structure of the Arc repressor from bacteriophage P22 was solved by N M R spectroscopy (Breg e t al., 1990) using the MetJ coordinates as a guide to resonance assignments. This small repressor has only 53 residues, and low sequence homology to Met J, but its structure is almost identical to residues 15 to 72 of the latter, corresponding to little more than an isolated RHH motif. Arc repressor does not bind a corepressor, and lacks the additional N and C terminal regions of MetJ. Along with P22 Mnt repressor (Knight e t al., 1989), which is homologous to Arc but larger, they represent a new family of DNA binding proteins. The available evidence points to Arc and Mnt repressors binding to their operators as dimers ofdimers analogous to the observed complex of MetJ with two met-boxes shown in Fig. 6. Unlike Met J, they do not appear to form longer arrays, and have operators limited to about 20 base pairs in length. The three-dimensional structure determination of MetJ repressor, and it complexes, coupled with the dissection of its binding and repression activity, has led to a fuller understanding of this component of the methionine regulatory system at the molecular level. Preliminary crystallographic experiments are already under way for MetH and MetR, together with biophysical studies in solution, and we look forward to a complete molecular description of transcriptional regulation in the system. The powerful combination of structural techniques with molecular biology and genetics, is leading us towards a truly molecular understanding of living systems. ACKNOWLEDGEMENTS ISG is particularly grateful to Dr. G. N. Cohen for his invaluable instruction and encouragement throughout the years; she thanks her colleagues of the "Unit6 de Biochimie Cellulaire" who participated in the work described here. We would like to thank Y.-Y. He, J. Hong, T. McNally, G. D. Markham, I. Manfield, R. G. Matthews, J. Parkinson, I. Parsons, K. Phillips, E. Ron, W. S. Somers, G. Stauffer, S. Strathdee and H. Weissbach for kindly providing unpublished information during the preparation of this review. We thank D. R. Flower for assistance with the ribbon diagrams of the MetJ structure. The work presented here could not have been done without research grants from the Centre National de la Recherche Scientifique, the Institut Pasteur, the Institut National de la Sant6 et de la Recherche Nationale, the Comit6 des Applications de la Recherche and the Science and Engineering Research Council. SEVP holds a SERC Senior Fellowship. IGO held successive fellowships from the SERC, EMBO and the EEC. REFERENCES ADAMS,J. M. and CAPECCI,M. R. (1966)N-formylmethionyl-s-RNAas the initiatorof proteinsynthesis.Proc. natn. Acad. Sci. U.S.A.

55, 147.

AHMED, A. (1973) Mechanism of repression of methionine biosynthesisin E. coll. I. The role of methionine,

S-adenosylmethionineand methionyl-transferribonucleicacid in repression. Molec.

gen. Genet.

123, 299.

ALDEA,M., MAPLES,V. F. and KUSI-INER,S. R. (1988)Generationof a detailedphysicaland geneticmap of the ilvmetE-udp

region of the Escherichia

coil

chromosome.J.

tool. Biol.

200, 427.


177

AMES, G. F. L. (1986) Bacterial periplasmic transport systems: structure, mechanism and evolution. Ann. Rev. Biochem. 55, 397. AYUNG, P. D. (1981) Methionine sulfoxide is transported by high-affinity methionine and glutamine transport systems in Salmonella typhimurium. J. Bacteriol. 148, 514. AYLIN6, P. D. and BRID6ELAND,E. S. (1972) Methionine transport in wild-type and transport defective mutants of Salmonella typhimurium. J. gen. Microbiol. 73, 127. AYLING,P. D. and CItATER,K. F. (1968) The sequence of four structural and two regulatory methionine genes in the Salmonella typhimurium linkage map. Genet. Res. 12, 341. AVLING, P. D., MoJIcA-A. T. and KLOPOTOWSKI,T. (1979) Methionine transport in Salmonella typhimurium: Evidence for at least one low affinity transport system. J. gen. Microbiol. 114, 227. BACHMANN,B. (1990) Linkage Map of Escheriehia coli K-12 Edition 8. Microbiol. Rev. 54, 130. BANEPOEE,R. V., JOHNSTON,N. L., SOBESKI,J. K., DAT'rA,P. and MATTHEWS,R. G. (1989) Cloning and sequence analysis of the Escherichia coli metH gene encoding cobalamin-dependent methionine synthase and isolation of a tryptic fragment containing the cobalamin-binding domain. J. biol. Chem. 264, 13885. BANEIUEE,R. V., HARDER,S. R., RAGSDALE,S. W. and MATTHEWS,R. G. (1990) Mechanism of reductive activation of cobalamin-dependent methionine synthase: an electron paramagnetic resonance spectroelectrocbemical study. Biochemistry 29, 1129. BARKER,D. G., EBEL,J. P., JAKES,R. and BRETON,C. J. (1982) Methionyl-tRNA synthetase from E. coli: primary structure of the active crystallized tryptic fragment. Eur. J. Biochem. 127, 449. BARKER,H. A. (1972) Corrinoid-dependent enzymatic reactions. Ann. Rev. Genet. 6, 55. BECK, C. F. and WARREN,R. A. J. (1988) Divergent promoters, a common form of gene organization. Microbiol. Rev. 52, 318. BELFAIZA, J., FAZEL, A., Mi)LLER, K. and COHEN, G. N. (1984) E. coli aspartokinase II-homoserine dehydrogenase II polypeptide chain has a triglobular structure. Biochem. biophys. Res. Commun. 123, 16. BELEAIZA,J., PARSOT,C., MARTEL,A., BOUTHIERDELATOUR,C., MARGARITA,D., COHEN,G. N. and SAINTGIRONS, I. (1986) Evolution in biosynthetic pathways: Two enzymes catalyzing consecutive steps in methionine biosynthesis originate from a common ancestor and possess a similar regulatory region. Proc. natn. Acad. Sci. U.S.A. 83, 867. BELFAlZA, J., GUILLOU, Y., MARGARITA,D., PERRIN, D. and SAINT GmONS, I. (1987) Operator-constitutive mutations of the E. coil metF gene. J. Bacteriol. 169, 670. BEGGER, E. A. and HEPPEL, L. A. (1974) Different mechanisms of energy coupling for shock-sensitive and shock-resistant amino acid permeases of Escherichia coll. J. biol. Chem. 249, 7747. BIELLMANN,J. F., EID, P., HIRTH, C. and J6RNVALL,H. (1980) Aspartate-~-semialdedhyde dehydrogenase from Escherichia coll. Purification and general properties. Eur. J. Biochem. 104, 53. BLANQUET,S., FAYAT,G. and WALLER,J. P. (1974) The mechanism of action ofmethionyl-tRNA synthetase from E. coll. Fur. J. Biochem. 44, 343. BLANQUET,S., DESSEN,P. and IWATSUBO,M. (1976) Anticooperative binding of bacterial and mammalian initiator tRNA Met to methionyl-tRNA syntbetase. J. tool. Biol. 103, 765. BOTSFORD,J. L. and PARKS, L. W. (1967) Role of S-adenosylmethionine in methionine biosynthesis in yeast. J. Bacteriol. 94, 966. BOUTHIERDE LA TOUR, C. (1987) Contribution ~i r6tude de deux enzymes bact6riennes: la peptidyltransf6rase ribosomale et la b6ta-cystathionase. Th6se de Doctorat de l'Universit6., Universit6 Paris 6. BoY, E. and PATTE,J. C. (1972) Multivalent repression of aspartic semialdehyde dehydrogenase in E. coil K12. J. Bacteriol. 112, 84. BoY, E. and PATTE, J. C. (1979) Role of glucose-6-phospbate in the regulation of aspartate semialdehyde dehydrogenase in E. coll. FEMS Microbiol. Lett. 6, 189. BOYLE,S. M., MARKHAM,G. D., HAENER,E. W., WRXGnT,J. M., TABOR,H. and TAaOR,C, W. (1984) Expression of the cloned genes encoding the putrescine biosynthetic enzymes and methionine adenosyltransferase of Escherichia coil (speA, speB, speC and metK). Gene 30, 129. BREG,J. N., VANOPHEUSDEN,J. H. J., BURGERING,M. J. M., BOELENS,R. and KAPTEI~, R. (1990) Structure of Arc repressor in solution: evidence for a family of fl-sheet DNA binding proteins. Nature 346, 586. BROWN, E. A., D'ARI, R. and NEWMA~q,E. B. (1990) A relationship between L-Refinedegradation and methionine biosynthesis in Escherichia coil K-12. J. gen. Microbiol. 136, 1017. BRUNIE, S., MELLOT, P., ZELWER, C., RISLER, J. L., BLANQUET,S. and FAYAT, G. (1987) Structure-activity relationships of methionyl-tRNA syntbetase: graphics modelling and genetic engineering. J. tool. Graphics 161, 820. BRUNIE, S., ZELWER,C. and RISLER,J. L. (1990) Crystallographic study at 2.5 A resolution of the interaction of methionyl-t-RNA synthetase from Escherichia coli with ATP. J. tool. Biol. 216, 411. BRZOVIC, P., HOLBROOK, L., GREENE, R. and DUNN, M. F. (1990) Reaction mechanism of Escherichia coil cystathionine y-synthase: Direct evidence for a pyridoxamine derivative of vinylglyoxylate as a key intermediate in pyridoxal phosphate dependent y-elimination and y-replacement reactions. Biochemistry 29, 442. BURTON,E., SELHUB,J. and SAKAMI,W. (1969) The substrate specificity of 5-methyltetrahydropterolytriglutamate homocysteine transmethylase. Biochem. J. 111, 793. BVERLY,K. A., URBANOWSKI,M. L. and STAUFFER,G. V. (1990) Escherichia coil metR mutants that produce a MetR activator protein with an altered homocysteine response. J. Bacteriol. 172, 2839. BYERLV, K. A., URaANOWSK1,M. L. and STAUFFER,G. V. (1991) The MetR binding site in the metH gene of Salmonella typhimurium; DNA sequence constraints on activation. J. Bacteriol. 173, 3547. CAFFERATA,R. L. and FREUNDL~CH,M. (1969) Evidence for a methionine-controlled homoserine dehydrogenase in Salmonella typhimurium. J. Bacteriol. 97, 193. CAI, X.-Y., MAXON,M., REDFIELD,B., GLASS,R., BROT,N. and WEISSBACH,H. (1989a) Methionine synthesis in Escherichia coil: Effect of the MetR protein on metE and metH expression. Proc. natn. Acad. Sci. U.S.A. 86, 4407.

178

I.G. OLD et al.

CAI, X.-Y., REDFIELD,B., MAXON,M., WEISSBACH,H. and BROT,N. (1989b) The effect of homocysteine on MetR regulation of metE, metR and metH expression in vitro. Biochem. biophys. Res. Commun. 163, 79. CAIRNEY, J., HIGGINS, C. F. and BOOTH, I. R. (1984) Proline uptake through the major transport system of Salmonella typhimurium is coupled to sodium ion. J. Bacteriol. 160, 22. CANTONI, G. and DURELL,J. (1957) Activation of methionine for transmethylation. The methionine activating enzyme: studies of the mechanism of the reaction. J. biol. Chem. 225, 1033. CARTER,C. W. J. and KRAUT,J. (1974) A proposed model for the interaction of polypeptides with RNA. Proc. natn. Acad. Sci. U.S.A. 71, 283. CASSAN,M., PARSOT,C., COHEN,G. N. and PATTE,J. C. (1986) Nucleotide sequence of the lysC gene encoding the lysine-sensitive aspartokinase III ofEscherichia coli K12: Evolutionary pathway leading to three isofunctional enzymes. J. biol. Chem. 261, 1052. CASSIO,D. (1975) Role of methionyl-transfer ribonucleic acid in the regulation of methionyl-transfer ribonucleic acid synthetase from Escherichia coli K12. J. Bacteriol. 123, 589. CASsio, D. and WALLER,J. P. (1971) Modifications of methionyl-tRNA synthetase by proteolytic cleavage and properties of the trypsin modified enzymes. Eur. J. Biochem. 20, 283. CAUTHEN, S. E., FOSTER, M. A. and WOODS, D. D. (1966) Methionine synthesis by extracts of Salmonella typhimurium. Biochem. J. 98, 630. CF~ARENI,G., MUESING,M. A. and POLISKY,B. (1982) Control of ColE1 DNA replication: the top gene production negatively affects transcription from the replication primer promoter. Proc. natn. Acad. Sci. U.S.A. 79, 6313. CHATER,K. F. (1970) Dominance of the wild-type alleles of methionine regulatory genes in S. typhimurium. J. oen. Microbiol. 63, 95. CHATER, K. F., LAWRENCE,D. A., ROWBURY,R. J. and GROSS,T. S. (1970) Suppression of methionyl transfer synthetase mutants of S. typhimurium by methionine regulatory mutants. J. gen. Microbiol. 63, 121. CHEREST,H., SURDIN-KERJAN,Y., EXJNGER,F. and LACROUTE,F. (1978) S-adenosyl methionine requiring mutants in Saccharomyces cerevisiae: Evidence for the existence of two methionine adenosyl transferases. Mol. gen. Genet. 163, 153. CHILDS,J. D. and SMITH,D. A. (1969) New methionine structural gene in Salmonella typhimurium. J. Bacteriol. 100, 377. CHU, J., SHOEMAN,R., HART, J., COLEMAN,T., MAIZAITIS,A., KELLER,N., BROT, N. and WEISSBACH,H. (1985) Cloning and expression of the metE gene in E. coll. Archs Biochem. Biophys. 239, 467. CHURCH,G. M., SUSSMAN,J. L. and KIM, S.-H. (1977) Secondary structural complementarity between DNA and proteins. Proc. hath. Acad. Sci. U.S.A. 74, 1458. CLANDININ,i . T. and AHMED,A. (1973) Mechanism of repression of methionine biosynthesis in Escherichia coll. II. The effect of metJ mutations on the free amino acid pool. Mol. gen. Genet. 123, 325. CLARKE,L. and CARBON,J. (1976) A colony bank containing synthetic ColE1 hybrid plasmids representative of the entire E. coli genome. Cell 9, 91. COHEN, G. and SAINTGIRONS,I. (1987) Biosynthesis of threonine, lysine and methionine. In Escherichia coli and Salmonella typhimurium p. 429 (ed. F. C. NEIDHARDT),American Society for Microbiology, Washington. COHEN, G. N. (1983) The common pathway to lysine, methionine and threonine. In Amino Acids: Biosynthesis and Genetic Regulation, p. 191 (eds. K. M. HERRMANNand R. L. SOMERVILLE),Addison-Wesley Publishing Company, Massachusetts. COHEN, G. N. and DAUTRY-VARSAT,A. (1980) The aspartokinases-homoserine dehydrogenases of Escherichia coll. In Multifunctional Proteins, p. 49 (eds. H. BISSWANGERand E. SCHMINCKE-O1"r),Wiley & Sons, New York. COHEN,G. N. and JACOB,E. (1959) Sur la r6pression de la synth6se des enzymes intervenant dans la formation du tryptophane chez E. coli. C. R. Acad. Sci., Paris 248, 3490. COHEN, G. N. and PATTE,J. C. (1963) Some aspects of the regulation of amino acid biosynthesis in a branched pathway. Cold Spring Harbor Symp. Quant. Biol. 513. COHEN,G. N., PATTE,J. C., TRUFFA-BACH1,P., SAWAS,C. and DOUOOROFF,M. (1965) M~canismes de R~gulation des Activitds Cellulaires chez les Microorganismes. CNRS, Paris. COHN, M., COHEN,G. N. and MONOD,J. (1953) L'effect inhibiteur sp6cifique de la m6thionine dans la formation de la m6thionin¢ synthase chez Escherichia coll. C. R. Acad. Sci. Paris 236, 746. COLLIER,C. O. and JOHNSON,J. R. (1990) The Escherichia coil K-12 metJ193 allele contains a point mutation which alters the hydrophobic pocket responsible for in vitro binding of S-adenosylmethionine: Effects on cell growth and induction of met regulon expression. J. Bacteriol. 172, 3918. COSSART,P., KATINKA,M., YAN1V,M., SAINTGIRONS,I. and COHEN,G. N. (1979) Construction and expression of a hybrid plasmid containing the Escherichia coil thrA and thrB genes. Mol. gen. Genet. 175, 39. COTTAM,A. N. and AYLING,P. D. (1989) Genetic studies of mutants in a high-affinity methionine transport system in Salmonella typhimurium. Mol. gen. Genet. 215, 358. DARDEL, F. (1989) Clonage, structure et 6tude de l'expression du g6ne de la m6thionyl-tARN synth6tase dEscherichia coli. Doctorat de l'Univorsit6, Universit6 Paris 6. DARDEL,F., FAYAT,G. and BLANQUET,S. (1984) Molecular cloning and primary structure of the Escherichia coil methionyl-tRNA synthetase gene. J. Bacteriol. 160, 1115. DARDEL, F., PANVERT, M. and FAYAT, G. (1990) Transcription and regulation of the Escherichia coli methionyl-tRNA synthetase gene. Mol. gen. Genet. 223, 121. DAVIDSON,B. E. and SAINTGIRONS,I. (1989) The Escherichia coil regulatory protein MetJ binds to five 8 base pair repeats in the metF operator. Mol. Microbiol. 3, 1639. DAVIS, B. D. and MINGIOLI, E. S. (1950) Mutants of Escherichia coil requiring methionine or vitamin B12. J. Bacteriol. 60, 17. DAWES,J. and FOSTER,M. A. (1971) Vitamin B12 and methionine synthesis in Escherichia coli. Biochim. biophys. Acta 237, 455. DESSEN, P., BLANQUET,S., ZACCI,G. AND JACROT, B. (1978) Anticooperative binding of initiator tRNA M*t to methionyl-tRNA synthetase from Escherichia coil: Neutron scattering studies. J. tool. Biol. 126, 293.


179

DEe, I. K. and HARVEY,R. J. (1984a) Regulation of synthesis of serine hydroxymethyltransferase in chemostat cultures of Escheriehia coli. J. biol. Chem. 259, 8394. DEV, I. K. and HARVEY, R. J. (1984b) Role of methionine in the regulation of the synthesis of serine hydroxymethyltransferase in E. coll. J. biol. Chem. 259, 8402. DUCHANGE,N., ZAKIN,M. M., FERRARA,P., SAINTGIRONS,I., PARK,I., TRAN,V. S., PY, M. C. and COHEN,G. N. (1983) Structure of the metJBLFcluster in E. coli KI2. Sequence of the metB structural gene and of the 5' and 3' flanking regions of the metBL operon. J. biol. Chem. 258, 14868. DUCLOS,B., CORTAY,J. C., BLEICHER,F., RON, E. Z., RICHAUD,C., SAINTGIRONS,I. and CozzoNE, A. J. (1989) Nucleotide sequence of the metA gene encoding homoserine trans-succinylase in Escherichia coll. Nucleic Acids Res. 17, 2856. DWIVEDI,C. M., RAGIN,R. C. and UREN,J. R. (1982) Cloning, purification and characterization of fl-cystathionase from Escherichia coll. Biochemistry 21, 3064. EMMETT,M. R. and JOHNSON,J. R. (1986) Control ofmetFgene expression in maxicell preparations of Escherichia coil K-12: Reversible action of metJ protein and effect of vitamin B12. J. Bacteriol. 168, 1491. FALCOZ-KELLY, F., VAN RAPENBUSCH,R. and COHEn, G. N. (1969) The methionine-sensitive homoserine dehydrogenase and aspartokinase activities of Escherichia coli K12. Preparation of the homogeneous protein catalyzing the two activities. Molecular weight of the enzyme and of its subunits. Eur. J. Biochem. 8, 146. FALCOZ-KELLY,F., JANIN, F. J., SAARI,J. C., VI~RON,M., TRUFFA-BACHI,P. and CO~N, G. N. (1972) Revised structure of aspartokinase I-homoserine dehydrogenase I of Escheriehia coil K12. Eur. J. Biochem. 28, 507. FAZEL,A., MOLLER,K., LEBRAS,G., GAREL,J. R., V]~RON,M. and COHEN,G. N. (1983) A triglobular model for the polypeptide chain of aspartokinase I-homoserine dehydrogenase I of Escherichia cell K12. Biochemistry 22, 158. FLAVIN, M. (1975) Methionine biosynthesis. In Metabolic Pathways, p. 407 (ed. D. M. GREENBERG),Academic Press, New York. FLETCHER,A. J. P., PUGSLEY,A. P. and GLASS,R. E. (1986) Investigation of the regulation of the Escherichia coli btuB gene using operon fusions. J. gen. Mirobiol. 132, 2643. FOSTER, M. A., T~EmNA, G. and WOODS, D. D. (1961) Two enzymatic mechanisms for the methylation of homocysteine by Escherichia coli. Biochem. J. 81, 1. FOSTER, M. A., DILWORTH, M. J. and WOODS, D. D. (1964a) Cobalamin and the synthesis of methionine by Eseheriehia coli. Nature 201, 39. FOSTER, M. A., TER.mmNA, G., GUEST, J. R. and WOODS, D. D. (1964b) Two enzymatic mechanisms for the methylation of homocysteine by extracts of Eseherichia coll. Biochem. J. 97, 476. FRASCA,V., BANE~T.~,R. V., DUNHAM,W. R., SANVS,R. H. and MATI~WS, R. G. (1988) Cobalamin dependent methionine synthase from Escheriehia coli B: Electron paramagnetic resonance spectra of the inactive form and the active methylated form of the enzyme. Biochemistry 27, 8458. Fum, K. and HUENNEKENS,F. M. (1974) Activation of methionine synthetase by a reduced triphosphopyridine nucleotide-dependent flavoprotein system. J. biol. Chem. 7.49, 6745. Fum, K. and HUENNEK~NS,F. M. (eds.) (1979) Biochemical Aspects of Nutrition, p. 173, Japan Scientific Societies, Tokyo. GALINIER, A., N~RE, D., CORTAY,J. C., MARCONDmR,S., MALOY, S. R. and CozzoNE, A. J. (1990) Sequence analysis of the iclR gene encoding the represser of the acetate operon in Salmonella typhimurium. Nucleic Acids Res. 18, 3656. GALIVAN,J. and HL~NNEK~NS,F. M. (1970) Resolution of the methionine synthetase system from E. coli K-12. Biochem. biophys. Res. Commun. 38, 46. GARDNER,J. (1979) Regulation of the.threonine operon: tandem threonine and isoleucine condons in the control region and translation control of transcriptional termination. Prec. natn. Aead. Sci U.S.A. 76, 1716. GIBSON,F. and WOODS,D. D. (1960) The synthesis of methionine by suspensions ofEscherichia coli. Biochem. J. 74, 160. GREENE,R. C. (1973) Methionine limitation in Escherichia coil K-12 by growth on the sulphoxides of D-methionine. J. Bacteriol. 116, 230. GREENE,R. C. and RADOVICH,C. (1975) Role of methionine in the regulation of serine hydroxymethyltransferase in E. coll. J. Bacteriol. 124, 269. GREENE,R. C. and SMITH,A. A. (1984) Insertion mutagenesis of the metJBLFcluster ofE. coli K12: evidence for a metBL operon. J. Bacteriol. 159, 767. GREENE, R. C., SU, C. H. and HALLOWAY,C. J. (1970) S-adenosylmethionine synthetase deficient mutants of Escherichia coil K 12 with impaired control of methionine synthesis. Biochem. biophys. Res. Commun. 38, 1120. GREENE, R. C., HUNTER,J. S. V. and COCH, E. H. (1973) Properties of metK mutants of Escherichia coil K-12. J. Bacteriol. 115, 57. GROSS,T. S. and ROWBURY,R. J. (1969) Methionyl transfer RNA synthetase mutants of S. typhimurium which have normal control of the methionine biosynthetic enzymes. Biochim. biophys. Acta 184, 233. GUEST,J. R., HELLEINER,C. W., CROSS,M. and WOODS,D. D. (1960) Cobalamin and the synthesis of methionine by ultrasonic extracts of Escherichia coll. Biochem. J. 76, 396. GUEST, J. R., FRIEDMAN,S., WOODS,D. D. and SmTH, E. L. (1962) A methyl analogue of cobamide coenzyme in relation to methionine synthesis by bacteria. Nature 195, 340. GUEST, J. R., FRIEDMAN,S., FOSTER,M. A., TEJERINA,G. and WOODS,D. D. (1964) Transfer of the methyl group from N5-methyltetrahydrofolate to homocysteine in Eseherichia coll. Biochem. J. 92, 497. HAFNER, E. W., TABOR, C. W. and TABOR, H. (1977) Isolation of a metK mutant with a temperature-sensitive S-adenosylmethionine synthetase. J. Bacteriol. 132, 832. HAl-IN, D. R., MYERS, S., KENT, C. R. and MALOY,S. R. (1988) Regulation of proline utilization in Salmonella typhimurium: molecular characterization of the put operon, and DNA sequence of the put control region. Molec. gen. Genet. 213, 125. HARRISON,S. C. and AGGARWAL,A. K. (1990) DNA recognition by proteins with the helix-turn-helix motif. Ann. Rev. Biochem. 59, 933.

180

I.G. OLD et al.

HAZIZA, C., CASSAN,M. and PATTE,J. C. (1982a) Identification of the promoter of the asd gene of E. coli using in vitro fusion with the lac operon. Biochimie 64, 227. HAZlZA,C., STRAGmR,P. and PATTE,J. C. (1982b) Nucleotide sequence of the asd gene of Escherichia coil: absence of a typical attenuation signal. E M B O J. 1, 379. HEGEMAN,G. D., COHEN,G. N. and MORGAN,R. (eds.) (1970) Aspartate semialdehyde dehydrogenase from E. coil K12. Meth. Enzymol. 708. HENIKOFF, S., HAUGHN, G. W., CALVO,J. M. and WALLACE,J. C. (1988) A large family of bacterial activator proteins. Proc. natn. Acad. Sci. U.S.A. 85, 6602. HOBSON,A. (1974) The regulation of methionine and S-adenosylmethionine biosynthesis and utilization in mutants of Salmonella typhimurium with defects in S-adenosylmethionine synthetase. Molec. gen. Genet. 131, 263. HOBSON,A. C. (1976) The synthesis of S-adenosylmethionine by mutants with a defect in S-adenosylmethionine synthetase. Molec. gen. Genet. 144, 87. HOBSON,A. C. and SMITH,D. A. (1973) S-adenosylmethionine synthetase in methionine regulatory mutants of S. typhimurium. Molec. #en Genet. 126, 7. HOL, W. G. J., VANDUIJNEN,P. T. and BERDENDSEN,H. J. C. (1978) The g-helix dipole and the properties of proteins. Nature 273, 443. HOLBROOK,E. L., GREENE,R. C. and KREUGER,J. H. (1990) Purification and properties of cystathionine T-synthase from overproducing strains of Escherichia coli. Biochemistry 29, 435. HOLLOWAY, C. T., GREENE, R. C. and Su, C.-H. (1970) Regulation of S-adenosyl methionine synthetase in Escherichia coli. J. Bacteriol. 104, 734. HYAFIL, F., JACQUES,Y., FAYAT, G., FROMANT, M., DESSEN, P. and BLANQUET,S. (1976) Methionyl-tRNA synthetase from E. coli: active stoichiometry and stopped-flow analysis of methionyl-adenylate formation. Biochemistry 15, 3678. INGRAHAM,J. L., MAALOE,O. and NEIDHARDT,F. C. (1983) Growth of the Bacterial Cell, Sinaur Associaties Inc., Sunderland, MA. JOHNSON,D. I. and SOMERVILLE,R. L. (1983) Evidence that repression mechanisms can exert control over the thr, leu and ilv operons of Escherichia coli K-12. J. Bacteriol. 155, 49. JOHNSON,J. R. and L1LJESTRAND,C. A. (1983) Plaque assay for lambda transducing phage carrying the E. coli metB gene. Molec. gen. Genet. 190, 527. JONES, K. M., GUEST,J. R. and WOODS, D. D. (1961) Folic acid and the synthesis of methionine by extracts of Escherichia coll. Biochem. J. 79, 566. JONES-MORTINER,M. C. (1968) Positive control of sulphate reduction in E. coli. The nature of the pleiotropic cysteineless mutants of E. coli KI2. Biochem. J. 110, 597. KADNER, R. (1974) Transport systems for L-methionine in Escherichia coli. J. Bacteriol. 117, 232. KADNER,R. (1975) Regulation of methionine transport activity in Escherichia coli. J. Bacteriol. 122, 110. KADNER,R. (1977) Transport and utilisation of D-methionine and other methionine sources in Escherichia coli. J. Bacteriol. 129, 207. KADNER,R. J. (1978) Repression of synthesis of the vitamin B12 receptor in Escherichia coli. J. Bacteriol. 136, 1050. KADNER,R. J. and WATSON,W. J. (1974) Methionine transport in E. coil: Physiological and genetic evidence for two uptake systems. J. Bacteriol. 119, 401. KADNER,R.J. and WINKLER,H. H. (1975) Energy coupling for methionine transport in E. coli. J. Bacteriol. 123, 985. KANZAKI,H., KOBAYASHI,M., NAGASAWA,T. and YAMADA,H. (1986) Distribution of two kinds of cystathionine gamma-synthase in various bacteria. F E M S Microbiol. Lett. 33, 65. KAPLAN, M. and FLAVlN, M. M. (1966) Cystathionine-~ synthase of Salmonella. Structural properties of a new enzyme in bacterial methionine biosynthesis. J. biol. Chem. 241, 5781. KATINKA,M., COSSART,P., SIBILLI,L., SAINTGIRONS,I., CHALVIGNAC,M. A., LEBRAS,G., COHEN,G. N. and YANIV, M. (1980) Nucleotide sequence of the thrA gene of Escherichia coll. Proc. natn. Acad. Sci. U.S.A. 77, 5730. KATZEN, H. M. and BUCHANAN,J. M. (1965) Enzymatic synthesis of the methyl group of methionine. VII. Repression~ierepression, purification and properties of 5-10 methylenetetrahydrofolate reductase from Escherichia coll. J. biol. Chem. 240, 825. KIMCHI, B. and RON, E. Z. (1987) A mutant of Escherichia coil temperature sensitive in the synthesis of S-adenosylmethionine. F E M S Microbiol. Lett. 43, 101. KIRBY, T. W., HINDENBACH,B. R. and GREENE,R. C. (1986a) Regulation of in vivo transcription of the metJBLF cluster of E. coil K12 J. Bacteriol. 165, 671. KIRBY,T. W., HINDENBACH,B. R. and GREENE,R. C. (1986b) Studies on the binding of the E. coil MetJ regulatory protein to a DNA region between the metJ and metB genes. Fedn Proc. 44, 1416. KISLIUK, R. L. and WOODS,D. D. (1960) Interrelationships between folic acid and cobalamin in the synthesis of methionine by extracts of Escherichia coli. Biochem. J. 75, 467. KLUG, A., JACK, A., VISWAMITRA,M. A., KENNARD,O., SHAKKED, Z. and STEITZ,T. A. (1979) A hypothesis on a specific sequence-dependent conformation of DNA and its relation to the binding of the lac-repressor protein. J. molec. Biol. 131, 669. KNAPPE, J. and SCHMITr, T. (1976) A novel reaction of S-adenosyl-L-methionine correlated with the activation of pyruvate-formate lyase. Biochem. biophys. Res. Commun. 71, 1110. KNIGHT,K. L., BOWIE,J. U., VERSHON,A. K. KELLEY,R. O. and SAUER,R. T. (1989) The Arc and Mnt repressors: a new class of sequence specific DNA-binding protein. J. biol. Chem. 264, 3639. KOCH, G. L. E. and BRUTON,C. J. (1974) The subunit structure of methionyl-t-RNA synthetase from Escherichia coli. F E B S Lett. 40, 180. KOTB, M., GELLER,A. M., MARKHAM,G. D., KREDICH,N. M., DELAROSA,J. and BEACHEY,E. n. (1990) Antigenic conservation of primary structural regions of S-adenosylmethionine synthetase. Biochim. biophys. Acta 1040, 137. KREDICH,N. M. (1987) Biosynthesis of cysteine. In Escherichia coli and Salmonella typhimurium, p. 419 (ed. F. C. NEIDHARDT),American Society for Microbiology, Washington.


181

KROGER, M., WAHL,R. and RICE, P. (1990) Compilation of DNA sequences of Escherichia coli (update 1990). Nucleic Acids Res. 18, 2549. KUNG, H. F., SPEARS, C., GREENE, R. C. and WEISSaACH,H. (1972) Regulation of the terminal reactions in methionine biosynthesis by vitamin B12 and methionine. Archs Biochem. Biophys. 150, 23. LAWRENCE, D. (1972) Regulation of the methionine feedback-sensitive enzyme in mutants of Salmonella typhimurium. J. Bacteriol. 109, 8. LAWRENCE, D., SMITH, D. A. and ROWBURY, R. J. (1968) Regulation of methionine synthesis in Salmonella typhimurium: mutants resistant to inhibition by analogues of methionine. Genetics 58, 473. LEE, B. and RICHARDS,F. M. (1971) The interpretation of protein structures: estimation of static accessibility. J. molec. Biol. 55, 379. LEE, C. W., RAVEL,J. M. and StoVE, W. (1966) Multimetabolic control of a biosynthetic pathway by sequential metabolites. J. biol. Chem. 231, 5479. LILJESTRAND-GOLDEN,C. and JOHNSON,J. R. (1984) Physical organization of the metJB component of the E. coil K 12 metJBLF gene cluster. J. Bacteriol. 157, 413. LuIsl, B. F. and SIGLER,P. B. (1990) The stereochemistry and biochemistry of the trp repressor-operator complex. Biochem. biophys. Acta 1048, 113. LUNDRIGAN,M. D., DEVEAUX,L. C., MANN, B. J. and KADNER,R. J. (1987) Separate regulatory systems for the repression of metE and btuB by vitamin B12 in Escherichia coll. Molec. gen. Genet. 206, 401. LYNN, S. P. and GARDNER,J. F. (1983) The threonine operon of E. coll. In Amino Acids: Biosynthesis and Genetic Reoulation, p. 173 (eds. K. M. HERRMANNand R. L. SOMERVILLE),Addison-Wesley Publishing Company, Massachusetts. MANDEL, L. R. and BOREK,E. (1963) The biosynthesis of methylated bases in ribonucleic acid. 2, 555. MARCHER,K. and SANGER,F. (1964) N-formylmethionyl-S-RNA. J. molec. Biol. 8, 835. MARCONI,R., WIGBOLDUS,J., WEISSBACH,H. and BROT,N. (1991) Transcriptional start and MetR binding sites on the Escherichia coli metH gene. Biochem. biophys. Res. Commun., in press. MARES,R., URBANOWSKI,M. L. and STAUFFER,G. V. (1990) Regulation of the Salmonella typhimurium metA gene by the MetR protein and homocysteine. Annual Meeting of the American Society for Microbiology, p. 189. MARKHAM, G. D. and SATISHCHANDRAN,C. (1988) Identification of the reactive sulfhydryl groups of S-adenosylmethionine synthetase. J. biol. Chem. 263, 8666. MARKHAM,G. D., HAFNER,E. W., TABOR,C. W. and TABOR,H. (1980) S-adenosyl-methionine synthetase from Escherichia coll. J. biol. Chem. 255, 9082. MARKHAM,G. D., DE PARISIS,J. and GATMAITAN,J. (1984) The sequence of metK, the structural gene for Sadenosylmethionine in Escherichia coll. J. biol. Chem. 259, 14505. MARTEL,A., BOUTHIERDELATOUR,C. and LE GOFFIC,F. (1987) Pyridoxal 5'phosphate binding site of Escherichia coil beta cystathionase and cystathionine gamma synthase: comparison of their sequences. Biochem. biophys. Res. Commun. 147, 565. MATTHEWS,R. G. and NEIDHARDT,F. C. (1988) Abnormal induction of heat shock proteins in an Escherichia coli mutant deficient in adenosylmethionine synthetase activity. J. Bacteriol. 170, 1582. MAXON, M. E., REDFIELD,B., CAI. X.-Y., SHOEMAN,R., FUJITA,K., FISHER,W., STAUFFER,G., WEISSBACH,H. and BROT, N. (1989) Regulation of methionine synthesis in Escherichia coil: Effect of the MetR protein on the expression of the mete and metR genes. Proc. natn. Acad. Sci. U.S.A. 86, 85. MAXON, M. E., WIGBOLDUS,J., BROT,N. and WEISSBACH,H. (1990) Structure-function studies on Escherichia coli MetR protein a putative prokaryotic leucine zipper protein. Proc. natn. Acad. Sci. U.S.A. 87, 7076. M1CHAELI,S. and RON, E. Z. (1984a) Expression of the metA gene of E. coli K12 in recombinant plasmids. FEBS Lett. 23, 125. MICHAELI, S. and RON, E. Z. (1984b) The metC gene of Escherichia coil: Isolation and studies of relatedness in Enterobacteriaceae. FEMS Microbiol. Lett. 22, 31. MICHAELI,S., RON,E. Z. and COHEN,G. (1981) Construction and physical mapping of plasmids containing the metA gene of Escherichia coil K12. Molec. gen. Genet. 182, 349. MICHAELI,S., MEVARECH,M. and RON, E. Z. (1984) Regulatory region of the metA gene of E. coil K 12. J. Bacteriol. 160, 1158. MILNER, L., WHITFIELD,C. and WEISSBACH,H. (1969) Effect of L-methionine and vitamin B12 on methionine biosynthesis in Escherichia coli. Archs Biochem. Biophys. 133, 413. MINSON, A. C. and SMITEI,D. A. (1972) Methionine regulatory defects in Salmonella typhimurium arising from amber-suppressible mutations. J. oen. Microbiol. 70, 471. MORNINGSTAR,J. F. and KISLIUK,R. L. (1965) Interrelations between two pathways of methionine biosynthesis in Aerobacter aerogenes. J. gen. Microbiol. 39, 43. MUELLER,J. H. (1922) A new sulphur-containing amino acid isolated from casein. Proc. HatH. Acad. Sci. U.S.A. 19, 161. MULLIGAN,J. T., MARGOLIN,W., KRUEGER,J. H. and WALKER,G. C. (1982) Mutations affecting regulation of methionine biosynthetic genes isolated by use of met-lac fusions. J. Bacteriol. 151, 609. N~GRE, D., CORTAY,J.-C., OLD, I. G., GALINIER,A., RICI4AUD,C., SAINT GIRONS, I. and COZZONE,A. (1991) Overproduction and characterization of the iclR gene product of Escherichia coli K-12 and comparison with that of Salmonella typhimurium. Gene 97, 29. NEIDHARDT,F. C., VAUGHAN,V., PHILLIPS,T. A. and BLOCH,P. L. (1983) Gene-protein index ofEscherichia coli K12. Microbiol. Rev. 47, 231. OLD, I. G., HUNTER,M. G., WILSON,D. T. R., KNIGHT,S. M., WEATHERSTON,C. A. and GLASS,R. E. (1988) Cloning and characterisation of the genes for the two homocysteine transmethylases of Escherichia coll. Molec. oen. Genet. 211, 78. OLD,1. G., MARGARITA,D., GLASS,R. E. and SAINt"GIRONS,I. (1990) Sequence of the metHgene of Escherichia coil K-12 and comparison with the corresponding sequence from Salmonella typhimurium LT2. Gene 87, 15. OSBORNE,C., CnEN, L. M. and MAYrHEWS,R. G. (1991) Isolation, cloning, mapping and nucleotide sequencing of the gene encoding flavodoxin in Escherichia coll. J. Bacteriol. 173, 1729.

182

I.G. OLD et al.

OTWINOWSKI,Z., SCHEVITZ,R. W., ZHANG,R.-G., LAWSON,C. L., JOACHIMIAK,A., MARMORSTEIN,A., LUISl,B. F. and SIGLER,P. B. (1988) Crystal structure of trp represser/operator complex at atomic resolution. Nature 335, 321. PASO, C. O. and SAWER,R. T. (1984) Protoin-DNA recognition. Ann. Reg. Biochem. 53, 293. PAESSENS,A. and RUDIGER,H. (1980) Purification and chemical characterization of the vitamin B12-dependent 5-methyltetrahydrofolate-homocysteine methyltransferase from Escheriehia cell B. Fur. J. Biochem. 112, 47. PAIK, W. K. and KIM, S. (1971) Protein methylation. Science 174, 114. PARK,Y. M. and STAUFFER,G. V. (1989a) DNA sequence of the metC gene and its flanking regions from Salmonella typhimurium LT2 and homology with the corresponding sequence of Escherichia coll. Melee. gen. Genet 216, 164. PARK, Y. M. and STAUFFER,G. V. (1989b) Salmonella typhimurium metC operator-constitutive mutations. FEMS Microbiol. Lett. 60, 137. PASZEWSK1,A. and GRABSKI,J. (1975) Enzymatic lesions in methionine mutants of Aspergillus nidulans; Role and regulation of an alternative pathway for cysteine and methionine synthesis. J. Bacteriol. 124, 893. PATTE,J. C. (1983) Diaminopimelate and lysine. In Amino Acids: Biosynthesis and Genetic Regulation, p. 213 (eds. K. M. HERRMANNand R. L. SOMERVILLE),Addison-Wesley Publishing Company, Massachusetts. PATTE, J. C., LE BRAS, G. and COHEN, G. N. (1967) Regulation by methionine of the synthesis of a third aspartokinasc and a second homoserine dehydrogenase in Escherichia cell K12. Biochim. biophys. Acta 136, 245. PEREZ-DIAZ, J. C. and CLOWES, R. C. (1980) Physical characterization of plasmids determining synthesis of a microcin which inhibits methionine synthesis in Escherichia coli. J. Bacteriol. 141, 1015. PHILLIPS, S. E. V. (1991) Specific ]/-sheet interactions. Curr. Opinion Struct. Biol. 1, 89. PHILLIPS, S. E. V., MANSPmLO,I., PARSONS,I., DAVIDSON,B. E., RAFFERTY,J. B., So,mRS, W. S., MARGARITA,D., COHEN, G. N., SAINTGIRONS,I. and STOCKLEY,P. G. (1989) Cooperative tandem binding of met represser of Escherichia coli. Nature 341, 711. PLAMANN,L. S.and STAUFFER,G. V. (1987) Nucleotide sequence of the Salmonella typhimurium metR gene and the metR-metE control region. J. Bacteriol. 169, 3932. PLAMANN, L. S., URBANOWSKI,M. L. and STAUFFER,G. V. (1988) Salmonella typhimurium metE operatorconstitutive mutations. Gene 73, 201. PLAMANN,M. D. and STAUFFER,G. V. (1983) Characterization of the E. coil gene for serine hydroxymethyltransferase. Gene 22, 9. PLAMANN,M. D. and STAUFFER,G. V. (1989) Regulation of Escherichia coil glyA gene by the metR gene product and homocysteine. J. Bacteriol. 171, 4958. PLAMANN,M. D., STAUFFER,L. T., URBANOWSKi,M. L. and STAUFFER,G. V. (1983) Complete nucleotide sequence of E. coil 91yA gene. Nucleic Acids Res. 11, 2065. POLAND, J. and AYLING, P. D. (1984) Methionine and glutamine transport systems in o-methionine utilising revertants of Salmonella typhimurium. Molec. oen. Genet. 194, 219. POSTON, J. M. and STAI~TMAN,T. C. (1975) Cobamides as cofactors: Methylcobamides and the synthesis of methionine, methane and acetate. In Cobalamin: Biochemistry and Pathophysiolooy p. 113 (ed. B. M. BABIOR) John Wiley & Sons, New York, London, Sydney, Toronto. PR1ESTLE,J. P. (1988) RIBBON: a stereo cartoon drawing program for proteins. J. appl. Cryst. 21, 572. RAFFERTY,J. B., PHILLIPS,S. E. V., ROJAS,C., BOULOT,G., SAINTGreeNS, I., GUILLOU,Y. and COHEN,G. (1988) Crystallization of the Met represser from Escherichia coil J. molec. Biol. 200, 217. RAFFERTY,J. a., SOMERS,W. S., SAINTGIRONS,I. and PHILLIPS,S. E. V. (1989) Three dimensional crystal structures of the Escherichia cell Met represser with and without corepressor. Nature 341, 705. RICHAUD, F., PHUC, N. H., CASSAN,M. and PATTE, J. C. (1980) Regulation of aspartokinase III synthesis in Escherichia coil: isolation of mutants containing lysC-lac fusions. J. Bacteriol 143, 513. RICHAUD,F., RICHAUD,C., HAZIZA,C. and PATTE,J. C. (1981) Isolement et purification de g6nes d'E. cell K12 impliqu6s dane la biosynth6se de la lysine. C. R. Hebd. Sdances Acad. Sci. Paris, Sbr. III 293, 507. RON, E. and SHANI,M. (1971) Growth rate of Escherichia coil at elevated temperatures: limitation by methionine. J. Bacteriol. 107, 391. RON, E. Z. (1975) Growth rate of Enterobacteriaceae at elevated temperatures: limitation by methionine. J. Bacteriol. 124, 243. RON, E. Z. and DAVIS, B. D. (1971) Growth rate of Escherichia coli at elevated temperatures: Limitation by methionine. J. Bacteriol. 107, 391. RON, E. Z., ALAJEM, S., BIRAN, D. and GROSSMAN,N. (1990) Adaptation of Escherichia coli to elevated temperatures--the metA gene product is a heat shock protein. Anton Leeuwenhoek Int. J. Gen. Med. Microbiol. 58, 169. ROWBURY,R. J. (1968) The inhibitory action of ~-methylmethionine on Escherichia coli. J. gen. Microbiol. 52, 223. RowBuRY, R. J. and WOODS,D. D. (1961) Further studies on the repression of methionine biosynthesis in E. coll. J. gen. Microbiol. 24, 129. ROWBURY,R. J. and WOODS,D. D. (1966) The regulation of cystathionine formation in E. coli. J. gen. Microbiol. 42, 155. ROWBURY,R. J., LAWRENCE,D. A. and SMITH,A. A. (1968) Regulation of the methionine-specific aspartokinase and homoserine dehydrogenase of Salmonella typhimurium. J. oen. Microbiol. 54, 337. RUDIGER,H. and JAENICKE,L. (1969) On the role of S-adenosylmethionine in the vitamin B12 dependent met hionine biosynthesis. Eur. J. Biochem. 10, 557. RUDIGER,H. and JAENICKE,L. (1970) Methionine synthetase. Existence and interconversion of two enzyme species. Eur. J. Biochem. 16, 92. RUDIGER,H. and JAENICKE,L. (1973) The biosynthesis of methionine. Molec. Cell. Biochem. 1, 157. SAINTGIRONS,I., DUCHANGE,N., ZAKIN,M. M., PARK, I., MARGARITA,D., FERRARA,P. and COHEN,G. N. (1983) Nucleotide sequence of metF, the E. coil structural gene for 5-10 methylene tetrahydrofolate reductase and its control region. Nucleic Acids Res. 11, 6723.


183

SAINTGIRONS,I., DUCHANGE,N., COHEN,G. N. and ZAKIN,M. M. (1984) Structure and autoregulation of the metJ regulatory gene in E. coil J. biol. Chem. 259, 14282. SAINT GIRONS, I., BELFAIZA,J., GUILLOU,Y., PERRIN, D., Gtaso, N., BL~tZU, O. and COttoN, G. N. (1986) Interactions of the E. coil methionine repressor with the metF operator and with its corepressor, Sadenosylmethionine. J. biol. Chem. 261, 10936. SAINT GmONS, I., PAgSOT, C., ZArdN, M. M., B,gazu, O. and COHEN,G. N. (1988) Methionine biosynthesis in Enterobacteriaceae: Biochemical, regulatory, and evolutionary aspects. CRC Crit. Rev. Biochem. 23, $1. SALEM,A. R. and FOSTER,M. A. (1972) The microbial biosynthesis of methionine. Biochem. J. 127, 845. SANDEgSON,K. E. and RoTH, J. R. (1988) Linkage map of Salmonella typhimurium Edition VII. Microbiol. Rev. 52, 485. SA~SrICaANtmAN,C., TAYLOR,J. C. and MAsrd-t~, G. D. (1989) Identification of duplicated genes encoding Sadenosylmethionine synthetases which are differentially regulated in Escherichia coll. Meeting on Molecular Genetics of Bacteria and Phages. SATISHCnANORAN,C., MARrd-~M,G. D., MOORE,R. C. and BOYLE,S. M. (1990a) Locations of the speA, speB, speC, and metK genes on the physical map of Escherichia coll. J Bacteriol. 172, 4748. SATISHCnAr,rO~N,C., TAYLOR,J. C. and MARKHAM,G. D. (1990b) Novel Escherichia coli K-12 mutants impaired in S-adenosylmethionine synthesis. J. Bacteriol. 172, 4489. SAVIN,M. A., FLAVIN,M. and SLAUGHTER,C. (1972) Regulation of homocysteine biosynthesis in S. typhimurium. J. Bacteriol. 111, 547. SCmILT~, L. L., STALr~a~R,L. T. and STAUFFER,G. V. (1984) Cloning and characterization of the Salmonella typhimurium mete gene. J. Bacteriol. 158, 928. SHAW, N. A. and AVLING, P. D. (1991) Cloning of high-affinity methionine transport genes from Salmonella typhimurium. FEMS Microbiol. Lett. 78, 127. ShOrAN, R., COLEMAN,T., REOFmLO,B., G ~ N E , R. C., SMITH,A. A., SAINTGmONS, I., BROT,N. and WElSSBACH, H. (1985a) Regulation of methionine biosynthesis in E. coil: Effect of metJ gene product and S-adenosyi methionine on the in vitro expression of the metB, metL and metJ genes. Biochem. biophys. Res. Commun. 133, 731. SHOEMAN,R., REDFIELD,B., COLEMAN,T., BROT,N., WE1SSBACH,H., GREENE,R. C., SMITH,A. A., SAINTGIRONS,I., ZAKIN,M. M. and COr~N, G. N. (1985b) Regulation of the methionine regulon in Escherichia coll. BioEssays 3, 210. SHOEMAN, R., REDFIELD,B, COLEMAN,T., GREENE, R. C., SMITH, A. A., BROT, N. and WEISSBACH,H. (1985c) Regulation of methionine synthesis in E. coil: Effect of metJ gene product and S-adenosylmethionine on the expression of the metF gene. Proc. natn. Acad. Sci. U.S.A. 82, 3601. SHOEMAN,R., MAXTON,M. E., REDFIELD,B., COLEMAN,T., JACQUES,N., BROT,N. and WEISSBACH,H. (1988) The methionine regulon in Escherichia coll. Mechanisms of control of gene expression. UCLA symposium on molecular and cellular biology. 3. SIMON,M. and HONG,J.-S. (1983) Direct homocysteine from O-succinylhomoserine in E. coil: an alternate pathway that bypasses cystathionine. J. Bacteriol. 153, 558. SMITH, A. A. and GREENE, R. C. (1984) Cloning of the methionine regulatory gene, met J, of E. coil KI2 and identification of its product. J. biol. Chem. 259, 14279. SMITH, A. A., GREENE,R. C., KIRBY,T. W. and HINDENBACH,B. R. (1985) Isolation and characterization of the product of the methionine-regulatory gene metJ of E. coil K12. Proc. natn. Acad. Sci. U.S.A. 82, 6104. SMITH,D. A. (1961) Some aspects of the genetics of methionineless mutants of Salmonella typhimurium. J. gen. Microbiol. 24, 335. SMITH, D. A. (1971) S-amino acid metabolism and its regulation in Escherichia coil and Salmonella typhimurium. Adv. Genet. 16, 141. SMITH,D. A. and CHILDS,J. D. (1966) Methionine genes and enzymes of Salmonella typhimurium. Heredity 21,265. SOLL, D. (1971) Enzymatic modification of transfer RNA. Science 173, 293. SOMERS,W. S. (1990) Crystal structure of methionine repressor of E. coil and its complexes with operator. Ph.D. Thesis., University of Leeds, U.K. SOMERVILLE,C. R. and ArirvmD, A. (1977) rel-dependent methionine requirement in revertants of a methionyitransfer RNA synthetase mutant of Escherichia coll. J. molec. Biol. 111, 77. STADTMAN,E. R., COHEN, G. N., LEBRAS,G. and DE ROBICHON-SZULMAJSTER,H. (1961) Feedback inhibition and repression of aspartokinase activity in Escherichia coil and Saccharomyces cerevisiae. J. biol. Chem. 236, 2033. STAUFI~R,G. V. (1987) Biosynthesis of serine and glycine. In Escherichia coli and Salmonella typhimurium, p. 412 (ed. F. C. NEImlARDT),American Society for Microbiology, Washington. STAUFFER,G. V. and BRENCrlLEV,J. E. (1977) Influence ofmethionine biosynthesis on serine transhydroxymethylase regulation in S. typhimurium LT2. J. Bacteriol. 129, 740. STAUFFER,G. V. and STAUFFER,L. T. (1988a) Cloning and nudeotide sequence of the Salmonella typhimurium LT2 metF gene and its homology with the corresponding sequence of Escherichia coll. Molec. gen. Genet. 212, 246. STAUFFER,G. V. and STAUFFER,L. T. (1988b) Salmonella typhimurium LT2 metF operator mutations. Molec. #en. Genet. 214, 32. STAUFFER,G. V., BAKER,C. A. and BRENCHLEY,J. E. (1974) Regulation of serine transhydroxymethylase activity in S. typhimurium. J. Bacteriol. 120, 1017. STAVRIANOPOULOS,J. and JAENICKE,L. (1967) Reaktionssehritte der Methionine-synthese bei Escherichia coll. Eur. J. Biochem. 3, 95. STEIERT,J. G., ROLFES,R. J., ZALKIN,H, and STAUFFER,G. V. (1990) Regulation of the Escherichia coil glyA gene by the purR gene product. J. Bacteriol. 172, 3799. STEPHENS,J., ARTZ, S. W. and AMES,B. N. (1975) Guanosine 5'-diphosphate Y-diphosphate (ppGpp): Positive effector for histidine operon transcription and general signal for amino acid deficiency. Proc. nam. Acad. Sci. U.S.A. 73, 4389.

184

I.G. OLD et al.

STRAGIER, P. and PATTE, J. C. (1983) Regulation of diamino-pimelate decarboxylase synthesis in E. coil III. Nucleotide sequence and regulation of the lysR gene. J. molec. Biol. 168, 333. STRAGIER,P., DANOS,O. and PATTE,J. C. (1983a) Regulation of diamino-pimelatc decarboxylase synthesis in E. coll. II. Nucleotide sequence of the lysA gene and its regulatory region. J. molec. Biol. 168, 321. STRAGIER,P., RICHAUD,F., BORNE,F. and PATTE,J. C. (1983b) Regulation of the diamino-pimelate decarboxylasc synthesis in E. colt. I. Identification of lysR encoding an activator of the lysA gene. J. molec. Biol. 168, 307. Su, C.-H. and GREENE,R. C. (1971) Regulation of methionine biosynthesis in Escherichia coil: Mapping of the metJ locus and properties of a metJ+ /metJ - diploid. Proc. natn. Acad. Sci. U.S.A. 68, 367. TABOR,H. and TABOR,C. W. (1972) Biosynthesis of 1,4-diarninobutane, spermidine, spermine and related amines. Adv. Enzymol. 36, 203. TABOR, H., ROSENTHAL,S. M. and TABOR, C. W. (1958) The biosynthesis of spermidine and spermine from putrescine and methionine. J. molec. Biol. 233, 907. TAKEYAMA,S., HATCH,F. T. and BUCHANAN,J. M. (1961) Enzymatic synthesis of the methyl group of methionine II. Involvement of vitamin B12. J. biol. Chem. 236, 1102. TAYLOR,R. T. (1980) B 12-dependent methionine biosynthesis. In B~2, p. 307 (ed. D. DOLPHIN),John Wiley & Sons, New York, London, Sydney, Toronto. TAYLOR, R. T. and HANNA, M. L. (1970) E. coli B 5-methyltetrahydrofolate-homocysteine cohalamin methyltransferase: catalysis by a reconstituted methyl 14C-cobalamin holoenzyme and the function of S-adenosylmethionine. Archs Biochem. Biophys. 137, 453. TAYLOR,R. T. and WEISSBACH,H. (1967a) Isolation of methyl B 12 from Escherichia coli B N5-methyl-H4-folatehomocysteine vitamin-B,2 transmethylase. Biochem. biophys. Res. Commun. 27, 398. TAYLOR, R. T. and WEISSBACH,H. (1967h) N5-methyltetrahydrofolate-homo-cysteine transmethylase. Partial purification and properties. J. biol. Chem. 242, 1502. TAYLOR,R. T. and WEISSBACH,H. (1969a) Escherichia coil B NS-methyl tetrahydrofolate-homocysteine cobalamin methyltransferase. Activation with S-adenosyl-L-methionine and the mechanism for methyl group transfer. Archs Biochem. Biophys. 129, 745. TAYLOR, R. T. and WEISSBACH, H. (1969b) Escherichia colt B N5-methyl-tetrahydrofolate-homocysteine methyltransferase: Sequential formation of bound methylcobalamin with S-adenosyl-L-methionine and N5 -methyl-tetrahydrofolate. Archs Biochem. Biophys. 129, 728. TAYLOR,R. T. and WEISSBACH,H. (1973) N5-methyltetrahydrofolate-homocysteine transmethylase. Enzymes 19, 121. THI~ZE,J. and SAINTGIRONS,I. (1974) Threonine locus of Escherichia coil K-12: Genetic structure and evidence for an operon. J. Bacteriol. 118, 990. THOMAS, D. and SURDIN-KERJAN,Y. (1987) SAM1, the structural gene for one of the S-adenosylmethionine synthetases in Saccharomyces cerevisiae. J. biol. Chem. 262, 16704. TRAN, V. S., SCHAEFFER,E., BERTRAND,O., MARIUZZA,R. and FERRARA,P. (1983) Purification, molecular weight and N-terminal sequence of cystathione-y synthase of Escherichia coll. J. biol. Chem. 258, 14872. TRAVERS,A. A. (1989) DNA conformation and protein binding. Ann. Rev. Biochem. 58, 427. TRIGGS-RAINE,B. L., DONEE,B. W., MULVEY,M. R., SORBY,P. A. and LOEWEN,P. C. (1988) Nucletotide sequence of katG, encoding catalase HP1 of Escherichia coll. J. Bacteriol. 170, 4415. TRUFFA-BACHI,P. and COHEN,G. N. (1966) La fl-aspartokinase sensible fi la lysine d'Escherichia coll. Purification et propri6t6s. Biochem. biophys. Acta 113, 531. TRUFEA-BACHI,P., VAN RAPENBUSCH,R., JANIN,J. and COHEN,G. N. (1968) The threonine-sensitive homoserine dehydrogenase and aspartokinase activities of Escherichia coli K 12. IV. Isolation, molecular weight, amino acid analysis and behaviour of the sulfhydryl groups of the protein catalyzing the two activities. Fur. J. Biochem. 5, 73. TRUFFA-BACHI,P., GuIso, N., COHEN,G. N., TI~ZE, J. N. and BURR,B. (1975) Evolution of biosynthetic pathways: Immunological approach. Proc. hath. Acad. Sci. U.S.A. 72, 1268. UMBARGER,H. E. (1978) Amino acid biosynthesis and its regulation. Ann. Rev. Biochem. 47, 533. URBANOWSKI,M. L. and STAUFFER,G. V. (1985) Cloning and initial characterization of the metJ and metB genes from Salmonella typhimurium LT2. Gene 35, 187. URBANOWSKI, M. L. and STAUFFER,G. V. (1986a) Autoregulation by tandem promoters of the Salmonella typhimurium LT2 metJ gene. J. Bacteriol. 165, 740. URBANOWSK1,M. L. and STAUFFER,G. V. (1986b) The metH gene from Salmonella typhimurium LT2: cloning and initial characterization. Gene 44, 211. URBANOWSKI, M. L. and STAUFFER,G. V. (1987) Regulation of the metR gene of Salmonella typhimurium. J. Bacteriol. 169, 5841. URBANOWSK1,M. L. and STAUFFER,G. V. (1988) The control region of the metH gene of Salmonella typhimurium LT2: an atypical met promoter. Gene 73, 193. URBANOWSKI,M. L. and STAUFFER,G. V. (1989a) Genetic and biochemical analysis of the MetR activator-binding site in the mete metR control region of Salmonella typhimurium. J. Bacteriol. 171, 5620. URBANOWSKI,M. L. and STAUFFER,G. V. (1989b) Role of homocysteine in metR-mediated activation of the mete and metH genes in Salmonella typhimurium and Escherichia coli. J. Bacteriol. 171, 3277. URBANOWSK1,M. L., PLAMANN,M. D., STAUFFER,L. T. and STAUFFER,G. V. (1984) Cloning and characterization of the gene for Salmonella typhimurium serine hydroxymethyltransferase. 27, 47. URBANOWKI,M. L., PLAMANN,L. S. and STAUFFER,G. V. (1987a) Mutations affecting the regulation of the metB gene of Salmonella typhimurium LT2. J. Bacteriol. 169, 126. URBANOWSKI,M. L., STAUFFER,L. T., PLAMANN,L. S. and STAUFFER,G. V. (1987b) A new methionine locus, metR, encodes a trans-acting protein required for activation of the metE and metH genes in E. coli and S. typhimurium. J. Bacteriol. 169, 1391. VI~RON,M., FALCOZ-KELLY,F. and COHEN,G. N. (1972) The threonine-sensitive homoserine dehydrogenase and aspartokinase activities of Escherichia coli K 12. VIII. The two catalytic activities are carried by two independent regions of the polypeptide chain. Fur. J. Biochem. 28, 520.


185

VETTER,H. and KNAPPE,J. (1971) Flavodoxin and ferredoxin ofEscherichia coli. Hoppe-Seyler's Physiol. Chem. 352, 433. WALLER, J. P., RISLER, J. L., MONTEILHET,C. and ZELWER, C. (1971) Crystalisation of the trypsin-modified methionyl-tRNA synthetase from Escherichia coll. F E B S Lett. 16, 186. WEISS, D. L., JOHNSON,D. I., WEITn, H. L. and SOMERVILLE,R. L. (1986) Structural analysis of the ileR locus of Escherichia coli K12. J. biol. Chem. 261, 9966. WEISSBACH,H. and TAYLOR,R. T. (1970) Roles of vitamin B 12 and folic acid in methionine synthesis. Vitam. Horm. 28, 415. WEISSaACH,H., PETERKOFSKY,A., REDFtELD,B. and DICKERMAN,H. (1963) Studies on the terminal reaction in the biosynthesis of methionine. J. biol. Chem. 238, 3318. WEISSBACH,H., REDFIELD,B. and DICKERMAN,H. (1964) Effect of vitamin B12 analogues on methionine formation from NS-mcthyltetrahydrofolic acid. J. biol. Chem. 239, 146. WEK, R. C. and HATFIELD,G. W. (1988) Transcriptional activation at adjacent operators in the divergentoverlapping ilv Y and ilvC promoters of Escherichia coll. J. molec. Biol. 203, 643. WHITEHOUSE,J. M. and SMITH,D. A. (1973) Methionine and vitamin B 12 repression and precursor induction in the regulation of homocysteine methylation in Salmonella typhimurium. Molec. lien. Genet. 120, 341. WmTEHOUSE,J. M. and SMITH,D. A. (1974) The involvement of methionine regulatory mutants in the suppression of B~2-dependent homocysteine t ransmethylase (metH) mutants of Salmonella typhimurium. Molec. gen. Genet. 129, 259. WHITEIELD, C. D., STEERS, E. J. and WEISSBACH,H. (1970) Purification and properties of 5-methyltetrahydropteroyltriglutamate-homocysteine transmethylase. J. biol. Chem. 245, 390. WH1TEIELD, D. and WEISSBACH, H. (1970) Binding of the folate substrate to 5-methyl-tetrahydropteroyltriglutamate-homocysteine transmethylase. J. biol. Chem. 245, 402. WIJESUNDERA,S. and WooDs, D. D. (1960) Suppression of methionine synthesis in E. coil by growth in the presence of this amino acid. J. oen. Microbiol. 22, 229. WILSON,R. H. (1970)The regulation by methionine of three inducible enzymes in Coprinus lagopus. Biochem. J. 118, 16. WooDS, D. D., FOSTER,M. A. and GUEST,J. R. (1965) Cobalamin-dependent and -independent methyl transfer in methionine biosynthesis. In Transmethylation and Methionine Biosynthesis (eds. S. K. SHAPIROand F. SCLENK), University of Chicago Press, Chicago, London. YOON,C., PRIVE,G. G., GOODSELL,D. S. and DICgZRSON,R. E. (1988) Structure of an alternating B-DNA helix and its relationship to A-tract DNA. Proc. hath. Acad. Sci. U.S.A. 85, 6332. ZAK1N, M. M., GREENE,R. C., DAUTRY-VARSAT,A., DUCHANGE,N., FERRARA,P., PY, M. C., MARGARITA,D. and COHEN, G. N. (1982) Construction and physical mapping of plasmids containing the metJBLF cluster of E. coil K12. Molec. yen. Genet. 187, 101. ZAKIN, M. M., DUCRANGE,N., FERRARA,P. and COHEN,G. N. (1983) Nucleotide sequence of the metL gene of Eseherichia coll. Its product, the bifunctional aspartokinase II-homoserine dehydrogenase II and the bifunctional product of the thrA gene, aspartokinase I-homoserine dehydrogenase I derive from a common ancestor. J. biol. Chem. 258, 3028. ZELWER,C., R1SLER,J. L. and BRUNIE,S. (1982) Crystal structure ofEscherichia coli methionyl-tRNA synthetase at 2.5 A. resolution. J. molec. Biol. 155, 63. ZHANG, R.-G., JOACHIMIAK,A., LAWSON,C. L., SCHEVITZ,R. W., OTWINOSKI,Z. and SIGLER,P. n. (1987) The crystal structure of trp repressor at 1.8 A resolution shows how binding tryptophan enhances DNA affinity. Nature 327, 591.

JPB 56:3-D

Methionine metabolism in BHK cells: the regulation of methionine adenosyltransferase.

Plasmodium knowlesi: in vitro biosynthesis of methionine.

Influence of methionine biosynthesis on serine transhydroxymethylase regulation in Salmonella typhimurium LT2.

Methionine biosynthesis in normal and transformed fibroblasts.

Growth rate of Enterobacteriaceae at elevated temperatures: limitation by methionine.

Regulation of methionine synthesis in Escherichia coli.

Plasmodium knowlesi: in vitro biosynthesis of methionine and thymidylic acid.

Redox regulation of methionine aminopeptidase 2 activity.

Regulation of polyamine biosynthesis.

Regulation of GTP biosynthesis.

Regulation of phosphatidylcholine biosynthesis.

High in vivo rates of methionine biosynthesis in transformed human and malignant rat cells auxotrophic for methionine.

The regulation and biosynthesis of antimycins.

Upstream regulation of mycotoxin biosynthesis.

Metabolism of methionine and biosynthesis of caffeine in the tea plant (Camellia sinensis L.).

Regulation of methionine transport activity in Escherichia coli.

Substrate-Tuned Catalysis of the Radical S-Adenosyl-L-Methionine Enzyme NosL Involved in Nosiheptide Biosynthesis.

Reconstitution and Substrate Specificity of the Radical S-Adenosyl-methionine Thiazole C-Methyltransferase in Thiomuracin Biosynthesis.

Biosynthesis of S-adenosyl-L-methionine in the rat pineal gland.

Regulation of thiamine biosynthesis in Saccharomyces cerevisiae.

2 in hepatitis C virus-expressing cells.

Role of growth hormone in the regulation of aldosterone biosynthesis.

Methionine biosynthesis is essential for infection in the rice blast fungus Magnaporthe oryzae.

Regulation of uridylic acid biosynthesis in the cyanobacterium Anabaena variabilis.