Molecular Bram Research, 14 (1992) 35-42 (~) 1992 Elsevier Science Publishers B.V. All rights reserved 0169-328X/92/$05.00

35

BRESM 70419

Regulation of nerve growth factor and nerve growth factor receptor production by N M D A in C6 glioma cells Takehiko A m a n o a, Tohru Yamakuni a, Noriko Okabe a, Reiko Kuwahara a, Fumiko Ozawa b and Fumio Hishinuma b aDepartment of Neurosctence and bLaboratory of Molecular Genettcs, Mttsubtsht Kaset Institute of Life Sciences, Tokyo (Japan) (Accepted 24 December 1991) Ke~ words: C6 ghoma cell NGF, Nerve growth factor receptor; N-Methyl-D-aspartate, Qulsqualate: Kainate, mRNA; Northern blot hybndlzatlon

The synthests of nerve growth factor (NGF) and nerve growth factor receptor (NGFR) were studied in a C6 ghoma cell line by Northern blot hybridization. In response to a glutamate agonist N-methyl-D-aspartlc acid (NMDA), NGF mRNA increased by up to 2-fold after 4-12 h of culture. The non-NMDA receptor agomsts, quisqualate and kamate, did not reduce any increase of NGF mRNA, and kalnate actually produced a decrease. The increase in NGF mRNA m response to NMDA was dose-dependent at 1, 5 and 10/~M. NGF receptor (NGFR) mRNA showed changes m expression which were similar to those for NGF mRNA, but were less marked. The specific glutamate antagomst 2-aminophosphonovalenc acid (APV) blocked the increase of NGF mRNA produced by NMDA. In the absence of Ca2÷, an increase of NGF mRNA was still observed but m the presence of 1 mM ethylglycol-bls-(fl-ammoethyl ether) N,N'-tetraacetlc acxd (EGTA), NGF mRNA production abohshed. The mechanism producing an increase m NGF mRNA by NMDA may be medmted by cychc AMP since mtracellular cychc AMP and NGF mRNA levels both increased following treatment with NMDA or dlbutyryl cychc AMP. INTRODUCTION The role of nerve growth factor ( N G F ) in the develo p m e n t and maintenance of the p e r i p h e r a l and central nervous system has been well d o c u m e n t e d 14'w. In the brain, N G F m R N A has been localized in the neurons of the h i p p o c a m p u s and neocortex 13'17. In addition, astrocytes isolated from rat and mouse brains have been shown to synthesize N G F by a two-site enzyme immunoassay and N o r t h e r n blot hybridization 9'22. Thus, both neurons and glia cells m a y be involved in the production of N G F in the central nervous system. Gall and Isackson r e p o r t e d that limbic seizures caused a rapid and p r o n o u n c e d increase in the expression of N G F m R N A in the granule cells of the rat h i p p o c a m p u s suggesting that the spread of seizure activity triggered changes in N G F m R N A throughout much of the forebrain 1°. On the o t h e r hand, Steward et al. r e p o r t e d that intense neuronal activity in the rat h i p p o c a m p u s led to a rapid and dramatic increase in the m R N A for glial fibrillary acidic protein is. These studies suggest that astroglial gene expression might be regulated by neuronal activity. Zafra et al. found that N G F m R N A increased in cultured h i p p o c a m p a l neurons incubated for 4 h with the glutamate r e c e p t o r agonist kainate at 10/~M 23. R e c e n t

research has also indicated that cultured astrocytes possess n o n - N M D A glutamate receptors which p r o d u c e depolarizing m e m b r a n e potentials in response to quisqualate and kainate 2'6'2°. F u r t h e r m o r e , Sastry et al. found that substances released during tetanic stimulation of the neocortex induced neurite outgrowth and longterm potentiation in the guinea pig hippocampus 16. These studies suggest that activity-dependent interactions between neurons and glia cells m a y occur in the m a m m a lian brain via neurotransmitters. In this study, the production of N G F in response to stimulation of the glutamate r e c e p t o r was studied in a clonal C 6 B u l glioma cell line to clarify the trophic interaction between neurons and glia cells using N G F and N G F r e c e p t o r ( N G F R ) probes.

MATERIALS AND METHODS The rat C6Bul ghoma cell hne was used in this study 1. Cultures were performed m Dulbecco' modified Eagle's medium (DME) with 5% semlfetal calf serum (Nakashlbetu serum center, Mltsublshl Kasel) and 5% horse serum (Glbco) m 100 mm Falcon dishes containing 10 ml of medium. The medmm was changed every other day and confluent cultures were used for the experiments. Incubation of the cells with drugs was conducted using stock solution that were dduted approximately 1000 × with phosphate-buffered sahne (PBS) Control cultures were incubated with PBS alone

Correspondence T. Amano. Department of Neurosclence, Mxtsublshl Kasel Institute of Life Sciences, 11 Mmamlooya, Machldashl, Tokyo 194, Japan

36

NC,~:R

Following incubation, the cells were collected with a rubber policeman, centrifuged and washed twice with PBS, and then processed for R N A purification Cychc 2',Y-adenosine nucleotide (cAMPt levels were determined by the r a & o l m m u n o a s s a y of H o n m a et al ~2

1.5

1.5

+

RNA purtficatlon R N A was punfied by the guanidium lsothlocyanate/cesium chloride m e t h o d 4, or by the method of Chomcynskl 5 Poly(A) R N A was purified on an ohgo(dT) cellulose column (Collaboratwe Research, type 3) Electrophoresls was conducted using 1 3% agarose gels containing 2 2 M formaldehyde 7 Hybndizatlon was c a m e d out in 50% formamlde for 24 h (5 x 106/cpm/ml) with a-32p-labelled N G F or N G F R c D N A were used as the probe The N G F probe was synthesized on a basis of the sequence of mouse m R N A codlng for residues 74-90 excluding the third base of the last Leu 3'TI'TGTGACCTTGAGTATGACGTGGTGCTGAGTGTGGAA G C A G T I ' C C G C A A - 5 ' (refs 7, 22) For the N G F R labelling, an antlsense c D N A probe, ( 5 ' - A C A A G G C C C A C G A C C A C A G C A G C C A A G A T G G A G C A A T A G A C A G G A A T G A G - 3 ' ) was used 8 Labelhng was conducted using [cc-3zP]deoxyadenoslne with a terminal deoxynucleotldyltransferase on the 3' end 7 After electrophoresis, the R N A was blotted onto nitrocellulose m e m b r a n e s and baked at 80°C for 5 h. Hybridization was conducted with the above N G F c D N A and

NGFR/NGF

J

/

f

i

1.0

_T_

1.0

-I7-

Fig 2 Comparison of relative a m o u n t of N G F R and N G F m R N A by Northern blot hybrl&zatlon as shown in Fig I Quantitative m e a s u r e m e n t of each band was conducted by an Image analyzer (Fuji Film Co,) The ordinate ln&cates the relative a m o u n t of m R N A n = 5 *P < 0 05 us control (Student's t-test)

N G F R c D N A To confirm the ~alidlty of Northern blot analysis, autoradlograms obtained with both N G F and N G F R probes were compared with those for a single N G F probe In some experiments Autoradiography was performed with an intensifying screen Radioactivity on the nitrocellulose m e m b r a n e s was measured using an Image analyzer (Fuji Film Co )

NGF

Regulation of nerve growth factor and nerve growth factor receptor production by NMDA in C6 glioma cells.

The synthesis of nerve growth factor (NGF) and nerve growth factor receptor (NGFR) were studied in a C6 glioma cell line by Northern blot hybridizatio...
603KB Sizes 0 Downloads 0 Views