Protoplasma (2015) 252:231–243 DOI 10.1007/s00709-014-0676-2

ORIGINAL ARTICLE

Regulation of some salt defense-related genes in relation to physiological and biochemical changes in three sugarcane genotypes subjected to salt stress Wasinee Poonsawat & Cattarin Theerawitaya & Therapatt Suwan & Chareerat Mongkolsiriwatana & Thapanee Samphumphuang & Suriyan Cha-um & Chalermpol Kirdmanee

Received: 12 April 2014 / Accepted: 28 June 2014 / Published online: 11 July 2014 # Springer-Verlag Wien 2014

Abstract Sugarcane (Saccharum officinale L.; Poaceae) is a sugar-producing plant widely grown in tropic. Being a glycophytic species, it is very sensitive to salt stress, and salinity severely reduces growth rate and cane yield. The studies investigating the regulation of salt defense metabolite-related genes in relation to final biochemical products in both susceptible and tolerant genotypes of sugarcane are largely lacking. We therefore investigated the expression levels of sugarcane shaggy-like kinase (SuSK), sucrose transporter (SUT), proline biosynthesis (pyrolline-5-carboxylate synthetase; P5CS), ion homeostasis (NHX1), and catalase (CAT2) mRNAs, and contents of Na+, soluble sugar, and free proline in three sugarcane genotypes (A19 mutant, K88-92, and K92-80) when subjected to salt stress (200 mM NaCl). The relative expression levels of salt defense-related genes in salt-stressed plantlets of sugarcane cv. K88-92 were upregulated in relation to salt exposure times when compared with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as housekeeping gene. In addition, final biochemical products, i.e., low Na+, sucrose enrichment, and free proline accumulation, were evidently demonstrated in salt-stressed plantlets. Chlorophyll b, total chlorophyll, total carotenoid concentrations, and maximum quantum yield of PSII (Fv/Fm) in positive Handling Editor: Bhumi Nath Tripathi W. Poonsawat : T. Suwan : C. Mongkolsiriwatana Division of Genetics, Faculty of Liberal Arts and Science, Kasetsart University, Kampangsan Campus, Nakhon Pathom 73140, Thailand C. Theerawitaya : T. Samphumphuang : S. Cha-um (*) : C. Kirdmanee National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA), 113 Thailand Science Park, Pahonyothin Road, Khlong Nueng, Khlong Luang, Pathum Thani 12120, Thailand e-mail: [email protected]

check (K88-92) were maintained under salt stress, leading to high net photosynthetic rate (Pn) and growth retention (root length, fresh weight, and leaf area). In contrast, photosynthetic abilities in negative check, K92-80, and A19 mutant lines grown under salt stress declined significantly in comparison to control, leading to a reduction in Pn and an inhibition of overall growth characters. The study concludes that the genetic background of sugarcane cv. K88-92 may further be exploited to play a key role as parental clone for sugarcane breeding program for salt-tolerant purposes. Keywords Ion homeostasis . Metabolite-related genes . Proline accumulation . Sucrose enrichment . Photosynthetic abilities . Growth performance

Introduction Sugarcane (Saccharum officinalum Linn.) is a commercial crop that accumulates 13–16 % (=0.7 M) sucrose in the culms (Moore 1995) and accounts for over 70 % of sugar produced worldwide (Lakshmanan et al. 2005). Brazil and India are the largest cane producer countries (accounting for 33 and 22.3 % of world’s total sugarcane planted area), followed by China, Thailand, Pakistan, Mexico, Colombia, and Australia (FAOSTAT 2007). All over the world, sugarcane has been cultivated in 22 million hectare with an average cane yield of 70.9 t ha−1 and sugar yield of 68 million ton per year (Waclawovsky et al. 2010). It propagates by stem cutting, containing at least one bud, and is a perennial crop allowing three to six harvests before renewed plantation (Moore 1995). Tropical sugarcane production is sustainable and environmental friendly in terms of sugar yield (carbon efficiency), bio-

232

ethanol yield, and biomass per hectare (Waclawovsky et al. 2010). Soil salinity is one of the major abiotic stresses that inhibit plant growth and development resulting in loss of crop productivity (Sairam and Tyagi 2004). Sugarcane, a glycophytic species, is very sensitive to salt stress, and salinity severely reduces growth rate and cane yield (Lingle and Wiegand 1997; Plaut et al. 2000; Azevedo et al. 2011). In the past, several studies have demonstrated plant physiological changes, i.e., chlorophyll degradation, membrane injury, decreased water content, diminution in chlorophyll fluorescence, and photosynthesis reduction, leading to impairment of productivity and quality of sugar in salt-stressed plants of sugarcane (Akhtar et al. 2003; Cha-um and Kirdmanee 2009; Pagariya et al. 2011, 2012; Patade et al. 2012a, 2014). Wahid and Ghazanfar (2006) found less Na+ and enriched K+ in salttolerant sugarcane cv. CP-4333 grown under salt stress. However, few studies have investigated the relative expression of various genes involved in salt tolerance in sugarcane. For example, the expression of SuSK (sugarcane shaggy-like kinase) gene in salt-stressed (200 mM NaCl for 24 h) sugarcane cv. Co86032 is relatively regulated (Patade et al. 2011). Patade et al. (2012b) reported increase in transcriptional levels of P5CS in sugarcane cv. Co86032 exposed to 200 mM NaCl for 24 h. Pagariya et al. (2012) identified 137 salinity tolerant candidate cDNAs (with 20 % being novel genes), including upregulation of SOD, CAT, and ascorbate peroxidase (APX) transcripts, and enhanced CAT activity in salt-stressed sugarcane cv. Co62175 (under 1–3 % NaCl for 20–30 days). In contrast, the activities of APX and CAT2 declined in sugarcane cv. Co86032 grown under 100 mM NaCl for 30 days (Patade et al. 2014). Recently, Medeiros et al. (2014) reported that transcriptional expression levels of cyt-APX2, mitMnSOD (superoxide dismutase), and CAT3 are downregulated in salt-stressed (100 mM NaCl for 11 days) sugarcane cv. RB92579, whereas the activities of APX and SOD were enhanced. In addition, differentially delayed root proteins (related to growth, development, carbohydrates, and energy metabolism), reactive oxygen species metabolization, protein protection, and membrane stabilization in sugarcane cv. RB867515 in response to salt stress (200 mM NaCl for 2 h) have been well established using proteomic technology (Pacheco et al. 2013). Recently, K-88-92 (PL310×UT95-5) and K92-80 (K84-200×K76-4) have been identified as salttolerant (positive check) and salt-susceptible genotypes (negative check) (Cha-um et al. 2012). In addition, the mutant genotype, i.e., A3(AE1-18), derived from LK92-11 gammairradiation has been categorized as salt tolerance as well as A9(AE1-103), A13(AE1-126), and A18(AE2-15) as moderate salt tolerance (Cha-um et al. 2013). However, the studies investigating regulation of salt defense metabolite-related genes in relation to final biochemical products in both susceptible and tolerant genotypes of sugarcane are still lacking.

W. Poonsawat et al.

Therefore, we conducted a study (a) to determine the relative expression of sugarcane shaggy-like kinase (SuSK), sucrose transporter (SUT), pyrolline-5-carboxylate synthetase (P5CS), Na+/H+ antiporter (NHX1), and catalase (CAT2) mRNAs; (b) to assay Na+, soluble sugar, and free proline contents; and (c) compare physiological and growth characteristics in three sugarcane genotypes with different salt-tolerant abilities when subjected to salt stress.

Materials and methods Plant materials and water deficit treatments Disease-free shoots of three cultivars of sugarcane, (A19)AE1-17 derived from LK92-11 exposed to 20 Gy γirradiation and positive check (K88-92) and negative check (K92-80) derived from meristem cutting (Cha-um et al. 2012), were propagated on MS (Murashige and Skoog 1962) supplemented with 8.88 μM benzyl adenine, 3 % sucrose, and 0.25 % Phytagel® for 6 weeks. Roots from single shoot were induced on MS medium supplemented with 2.46 μM indole butyric acid (IBA) for 2 weeks. Plantlets were cultured in vitro under 25±2 °C ambient temperature, 60±5 % RH, and 120± 5 μ mol m−2 s−1 photosynthetic photon flux density (PPFD) provided by fluorescent lamps with a 16 h day−1 photoperiod. Then, the sugarcane plantlets were transferred to MS sugar-free liquid medium using vermiculite as supporting material. The number of air exchanges in the culture vessel was adjusted to 2.32 μmol CO2 h−1 by punching a hole on plastic cap (⌀ 1 cm) and covering with microporous filters (0.2 μm pore size). The plantlets were subsequently cultured in a plant growth chamber under 25±2 °C ambient temperature, 60±5 % RH, 16 h day−1 photoperiod of 120±5 μ mol m−2 s−1 PPFD, and CO2 enrichment at 1,000±100 μmol mol−1 (Cha-um et al. 2004). Sodium chloride in the culture medium was adjusted to 0 (control) and 200 mM (salt stress) for 0, 3, and 7 days. Transcriptional expression levels, ion contents, soluble sugar concentration, free proline content, photosynthetic pigments, chlorophyll fluorescence, net photosynthetic rate, and growth performances of salt-stressed plantlets were measured. mRNA extraction and cDNA preparation Sugarcane plantlets were collected at 0, 1, 3, and 7 days after salt stress and immediately frozen at −80 °C, prior to total RNA extraction. Total RNA in sugarcane plantlets was pooled and extracted by the guanidine hydrochloride method (Sambrook et al. 1989). Ground tissues of sugarcane plantlets were homogenized in guanidinium thiocyanate solution (0.75 M Na citrate at pH 7.0, 10 % sarcosyl and 2 M βmercaptoethanol), Na acetate (pH 4.0), and phenolchloroform solution. After chilling on ice for 15 min, the homogenate was

Regulation of some salt defense-related genes

centrifuged at 10,000×g for 20 min at 4 °C. The aqueous phase was separated and mixed with 1× vol isopropanol, then kept at −20 °C for 1 h before centrifuging at 10,000×g for 15 min at 4 °C. The pellet was completely dissolved in 0.3 mL guanidinium thiocyanate solution and precipitated with ethanol. Contaminant DNA in the RNA preparations was then treated with RQ1 RNase-Free DNase (Promega), and total RNA was purified by phenolchloroform extraction. Firststranded DNA was synthesized with 3 μg total RNA per sample, using ImPromp-II ™ Reverse Transcriptase (Promega) and oligo-dT15 primer.

233

Then, the samples were washed by deionized water to remove surface contaminating Na+. The tissues were ground into a powder in liquid nitrogen, extracted with boiling distilled water, and centrifuged at 10,000×g for 10 min. The supernatant was dried and dissolved in distilled water. Cellular Na+, K+, and Ca2+ concentrations were determined using HPLC (Waters Associates, Millford, MA, USA) coupled with 432 Conductivity Detector and WATER IC-PACK™ ion exclusion column. Mobile phase composes of 3 mM nitric acid and 0.1 mM EDTA with a flow rate of 0.5 mL min−1. Free proline assay

Semi-quantitative PCR The PCR reaction was performed using a Veriti® Thermal Cycler (Applied Biosystems, CA, USA). Primer sequences were sugarcane shaggy-like kinase (F) 5′AGACGGAGGC CATTTATCCT3′ and (R) 5′-GTGCTGGACCTTGCACAG TA-3′ (SuSK; accession number FG804674), sucrose transporter 1 (F) 5′AGACGGAGGCCATTTATCCT3′ and (R) 5′GTGCTGGACCTTGCACAGTA-3′ (SuSUT1; accession number GD254044), pyrroline-5-carboxylate synthetase (F) 5′-TCTTTATGGAGGGCCTGTTG-3′ and (R) 5′CACTAT CAACTTGGCGCAGA-3′ (SuP5CS; Accession number GD254039), Na+/H+ antiporter (F) 5′-TGTCTTTGGGCTAC TGACGA and (R) 5′-CTCGCTAGGAGCAAATGGAG-3′ (SuNHX1; accession number GD254038), catalase (F) 5′ACTTCCCCTCCAGGTACGAC-3′ and (R) 5′-AGACCA GTTGGAGAGCCAGA-3′ (SuCAT2; accession number GD254035), and glyceraldehydes-3-phosphate dehydrogenase (F) 5′TTGGGGCAGAGATAACAACC-3′ and (R) 5′ TGAGGCTGGTGCTGACTATG-3′ (GAPDH; accession number NM_001112230.2). The PCR reaction was performed with 70–100 ng total RNA, 10 pM primer, and EmeraldAmp® GT PCR Master Mix (Takara, Japan). The PCR was run using the conditions: 94 °C for 3 min, 18–37 cycles of 94 °C for 30 s, 56–67 °C for 30 s, 72 °C for 30 s, and 72 °C for 5 min. The conditions and cycle numbers were determined in order to avoid saturation of DNA amplification. The DNA obtained was subjected to agarose gel electrophoresis and stained with ethidium bromide. The signal intensity of the stained bands was photographed with a Gel Doc image analysis system (Bio-Rad, Hercules), and the data were analyzed using GeneTools™ (Syngene, Cambridge, UK) analysis software. Expression level (folds) in each gene was normalized by glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as housekeeping gene.

Free proline in the plant tissues was extracted and analyzed according to the method of Bates et al. (1973). Fifty milligrams of fresh material was ground with liquid nitrogen in a mortar. The homogenate powder was mixed with 1 mL aqueous sulfosalicylic acid (3 %, w/v) and filtered through no. 1 filter paper (Whatman, England). The extracted solution was reacted with an equal volume of glacial acetic acid and ninhydrin reagent (1.25 mg ninhydrin in 30 mL glacial acetic acid and 20 mL 6 M H3PO4) and incubated at 95 °C for 1 h. The reaction was terminated by placing the container in an ice bath. The reaction mixture was mixed vigorously with 2 mL toluene. After cooling to 25 °C, the chromophore was measured at 520 nm by spectrophotometer (HACH DR/4000; Model 48000, HACH Company, Loveland, Colorado, USA) using L-proline as a calibration standard. Total soluble sugars determination Total soluble sugars (sucrose, glucose, and fructose) in the plant tissues were analyzed according to the modified method of Karkacier et al. (2003). In a precooled mortar, 100 mg tissue was ground with liquid nitrogen, extracted with 1 mL nanopure water, vigorously shaken for 15 s, sonicated for 15 min, and then centrifuged at 12,000 rpm for 15 min. The supernatant was filtered through a 0.45-μm membrane filter (VertiPure™, Vertical®) and stored at −20 °C prior to the measurement of total soluble sugars content using HPLC. A volume of 40 μL crude extracts was automatically injected into a Waters HPLC fitted with a Waters 600 pump using a MetaCarb 87C column equipped with a guard column. Deionised water was used as the mobile phase at a flow rate of 0.5 mL min−1. Online detection was performed using a Waters 410 differential refractrometer detector, and the data were analyzed by Empower® software. Sucrose, glucose, and fructose (Fluka, USA) were used as the standards.

Na+, K+, and Ca2+ assay Photosynthetic abilities Na+, K+, and Ca2+ were assayed following the modified method of Tanaka et al. (1999) and Hossain et al. (2006). In brief, whole tissues of salt-stressed plantlets were collected.

Chlorophyll a (Chla), chlorophyll b (Chlb), and total chlorophyll (TC) contents in the leaf tissues were

234

analyzed following the method of Shabala et al. (1998) and total carotenoid (Cx+c) concentrations were assayed according to Lichtenthaler (1987). One hundred milligrams of leaf material was collected and placed in a 25-mL glass vial along with 10 mL of 95.5 % acetone and blended using a homogenizer. The glass vials were sealed with Parafilm® to prevent evaporation and then stored at 4 °C for 48 h. Chla and Chlb concentrations were measured using a UV-visible spectrophotometer at 662 and 644 nm wavelengths. The Cx+c concentration was also measured by UV–vis spectrophotometer (HACH DR/4000; Model 48000, HACH Company, Loveland, Colorado, USA) at 470 nm. A solution of 95.5 % acetone was used as a blank. Chlorophyll fluorescence emission in terms of maximum quantum yield of PSII (Fv/Fm), photon yield of PSII (ΦPSII), photochemical quenching (qP), and nonphotochemical quenching (NPQ) from the adaxial surface of the leaf was measured using a fluorescence monitoring system (FMS2, Hansatech Instrument Ltd., Norfolk, UK) in the pulse amplitude modulation mode as previously described by Loggini et al. (1999). A leaf, adapted to dark conditions for 30 min using leaf-clips, was initially exposed to the modulated beam of far-red light, and initial (F0) and maximum (Fm) fluorescence were measured. The variable fluorescence yield (Fv) was calculated by the equation, Fm −F0 (Maxwell and Johnson 2000). Net photosynthetic rate (Pn) was calculated by comparing the different concentrations of CO2 inside (Cin) and outside (Cout) the glass vessel containing the sugarcane plantlets. The CO2 concentrations at steady state were measured by Gas Chromatography (Model GC-17A, Shimadzu Co. Ltd., Japan). The Pn of in vitro cultivated plantlets was calculated according to the method of Fujiwara et al. (1987). Growth performances Shoot height (SH), root length (RL), leaf area (LA), fresh weight (FW), and dry weight (DW) of sugarcane plantlets were measured 7 days after exposure to NaCl stress. Seedlings were dried at 80 °C in a hot-air oven for 2 days and then incubated in desiccators before the measurement of dry weight. The leaf area of sugarcane plantlets was measured using a Root/Leaf Area Meter DT-scan (Delta-Scan Version 2.03, Delta-T Devices, Ltd, Cambridge, UK). Experiment design and statistical analysis The experiment was arranged as 3×2 factorial in a completely randomized block design (CRBD) with six replicates (n=6).

W. Poonsawat et al.

The mean values obtained were compared using Tukey’s HSD and analyzed with SPSS software.

Results and discussion mRNA expression levels Transcriptional profile expressions of SoSuSK, SoSUT1, SoP5CS, SoNHX1, SoCAT2, and GAPDH were evidently demonstrated in stressed and non-stressed plantlets (Fig. 1). However, expression of SoP5CS was very low, especially in K92-80 (salt-sensitive cultivar), but was evidently expressed in A19 mutant genotype (Figs. 1 and 2). The relative expression levels of these genes were enhanced in relation to exposure periods and peaked in K88-92 (salt-tolerant genotype) grown under 200 mM NaCl for 7 days (Fig. 2). In contrast, expression levels of SoSuSK, SoSUT1, SoP5CS, and SoNHX1 declined in salt-stressed plantlets of sugarcane cv. K92-80 (Fig. 2a–d). In A19 mutant genotype, SoSuSK and SoNHX1 mRNA expression were unchanged, while SoSUT1 and SoCAT2 were downregulated, when subjected to salt stress for 7 days (Fig. 2). In the present study, transcriptional expression level of GAPDH was investigated as housekeeping mRNA. In general, β-actin and GAPDH have been well established as normalization for relative gene(s) expression in sugarcane grown under salt stress (Patade et al. 2012b; Medeiros et al. 2014). In K88-92 salt-tolerant genotype, relative expression of SoSuSK in salt-stressed plantlets (200 mM NaCl for 3 and 7 days) was upregulated. These observations are corroborated by findings of Patade et al. (2011) who reported upregulation in mRNA expression level of SuSK in salt-stressed plants (200 mM NaCl for 4 h in leaf tissues and for 8 h in the shoot tissues) of sugarcane cv. Co 86032. The expression level of SoSUT1 gene was increased relating to salt stress in sugarcane cv. K8892, whereas it declined in cvs. K92-80 and A19 mutant. However, it was in sharp contrast to declined SUT1 expression level observed in salt-stressed plants of sugarcane cv. Co 86032, exposed to salt stress for 16 and 24 h (Patade et al. 2012b). The observed increase in relative expression of SoP5CS in A19 and K88-92 genotypes grown under salt stress for 7 days is in conformity with similar findings in sugarcane cv. Co 86032 subjected to 200 mM NaCl for 4–24 h (Patade et al. 2012b). Earlier, Mahajan et al. (2013) observed 1.41– 2.37-fold increase in the activity of P5CS protein in ten cultivars of sugarcane grown under saline soil for 75 days. In the present study, SoNHX1 was only upregulated in sugarcane cv. K88-92 subjected to salt stress for 7 days, and it corroborated the observations made in cv. Co 86032 exposed to salt stress (Patade et al. 2012b). In our study, SoCAT2 gene expression was increased in sugarcane cv. K88-92 grown

K92-80-N7

K92-80-C7

K92-80-N3

K92-80-C0

K92-80-C3

235 K88-92-N7

K88-92-C7

K88-92-N3

K88-92-C3

K88-92-C0

A19-N7

A19-C7

A19-N3

A19-C3

A19-C0

Regulation of some salt defense-related genes

SuSK

level in cv. A19 was upregulated as major salt defense mechanism. Na+, K+, and Ca2+ content

SUT1 P5CS NHX1 CAT2 GAPDH

Fig. 1 Transcriptional levels of sugarcane shaggy-like kinase (SuSK), sucrose transporter (SUT1), pyrolline-5-carboxylate synthetase (P5CS), Na+/H+ antiporter (NHX1), and catalase (CAT2) in plantlets of sugarcane genotypes grown under 0 (C) and 200 mM NaCl (N) for 0, 3, and 7 days compared with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) used as housekeeping gene

under salt stress for 3 and 7 days. However, there are contrasting reports regarding expression of CAT genes and CAT activity. For example, in tobacco, CAT2 gene expression and CAT activity were increased by salt stress (150 mM NaCl for 5 days), especially in the root tissues (Savouré et al. 1999). In contrast, CAT2 gene expression declined in salt-stressed plants of sugarcane cv. Co 86032 (Patade et al. 2012b). CAT3 transcriptional level in sugarcane cultivars RB92579 and RB872552 was downregulated by 2.52- and 1.24-fold, respectively, when exposed to 100 mM NaCl for 11 days (Medeiros et al. 2014). CAT activity in salt-stressed plants of sugarcane cv. Co 86032 was increased by 1.41-fold in relation to salt stress (150 mM NaCl for 15 days) (Patade et al. 2012b). Likewise, CAT activities in salt-stressed plants of sugarcane cv. Co 62175 (moderate salt tolerant) were enhanced relating to a degree of salt stress, salt exposure period, and their interaction (Pagariya et al. 2012). In tillering stage (75 days after sowing), CAT activities in salt-tolerant genotype cv. CoM-265 (11.70 % reduction over the control) were maintained better than those in salt-susceptible cv. CoC-671 (29.98 % reduction over the control) when subjected to 7 −8 dS m−1 salt stress for 5 days (Satbhai and Naik 2014). In addition, CAT activity in salt-stressed cultured cells (100 mM NaCl for 30 days) of sugarcane cv. Co 86032 was significantly declined (Patade et al. 2014). The differences in the expression of CAT transcripts and activity of CAT suggest a complexity in regulation of genes and the nature of response (Medeiros et al. 2014). In recent study, transcriptional expression of SuSK, SUT1, P5CS, NHX1, and CAT2 in cv. K88-92 salt tolerance grown under salt stress was upregulated as the salt defense mechanisms. Similarly, the increased expression levels of SuSK, P5CS, and NHX1 in cv. Co86-032 were established (Patade et al. 2011, 2012b). On the other hand, only P5CS (proline biosynthesis-related gene) expression

In general, Na+ in salt-stressed plantlets of sugarcane was increased in relation to salt exposure time and different genotypes (Table 1). For example, Na+ enrichment in sugarcane cultivars—A19 mutant and K92-80 (salt-sensitive cultivar)— was evidently found, whereas Na+ accumulation in K88-92 (salt-tolerant cultivar) was enhanced during early salt exposure (200 mM NaCl for 3 days; 20.38-folds of the control) and then stabilized in late salt stress (200 mM NaCl for 7 days). The low level of Na+ in K88-92 plantlets positively related to SoNHX1 expression (Fig. 2d). Similarly, the Na+ in saltstressed (8–12 dS m−1 NaCl for 3 days) sugarcane genotype CP-4333 (salt tolerant) was lower than that in cv. HSF-240 (Wahid and Ghazanfar 2006). In the root tissues, Na+ was enriched in salt-stressed plants (100 mM NaCl for 11 days) of sugarcane genotype RB872552 and was greater than that in cv. RB92597 (Medeiros et al. 2014). Moreover, Na+ accumulation in the leaf tissues of salt-stressed plants (7 dS m−1 soil EC for 240 days) was greater in salt-sensitive cultivars Si94050 (4.70 fold of the control) and Co85036 (4.09 fold of the control), compared to gradual increase in salt-tolerant cultivars C92038 (1.81-fold of the control) and Co85004 (2.17-fold of the control) (Gomathi and Thandapani 2005). In addition, Na+ content in salt-sensitive cultivar, H65-7052, was enhanced by 1.14- and 1.57-fold after 15 and 60 days of exposure to 12 dS m−1 EC), whereas in salt-tolerant cultivar, H69-8235, it was only 1.32-fold of the control (Plaut et al. 2000). After 3 days of salt treatment, K+ in K92-80 and A19 plantlets was declined by 23.76 and 40.77 % (significant at p≤0.01), respectively, while in K88-92, K+ content was maintained (Table 1). Ca2+ in salt-stressed plantlets (200 mM NaCl for 3 days) of sugarcane genotypes A19, K88-92, and K92-80 increased by 1.18-, 4.24-, and 3.73-folds over the control, respectively. In addition, Ca2+ in plantlets grown under salt stress for the long period (7 days) was 1.79-, 2.53-, and 3.99folds greater over the control, respectively. The Na–K ratio in salt-susceptible genotype K92-80 grown under 200 mM NaCl for 3 and 7 days was peaked to 4.91 and 12.47, respectively (Table 1). In contrast, Na–K ratio was very low in sugarcane genotypes A19 (1.64) and K88-92 (1.01) grown under 200 mM NaCl for 7 d. K+ decline in salt-stressed plantlets of sugarcane cv. K9280 was antagonistic to Na+ enrichment, leading to increased Na+–K+ ratio at the cellular level. On the other hand, K+ in salt-stressed plantlets of sugarcane cv. K88-92 was maintained, resulting in low Na+–K+ ratio. Earlier, similar observations regarding a decline in K+ in the stem of salt-stressed plants (7 dS m−1 EC for 240 days) of salt-tolerant genotypes

W. Poonsawat et al.

12

(a)

0 mM NaCl 10

Relative expression level (SUT1/GAPDH)

Relative expression level (SuSK/GAPDH)

236

200 mM NaCl

a

8 6

b b

b

4

b

b

2 0 A19-3d

K88-92-3d

K92-80-3d

A19-7d

K88-92-7d

K92-80-7d

12 200 mM NaCl

8

a 6 4

ab bc

c

Relative expression level (NHX1/GAPDH)

Relative expression level (P5CS/GAPDH)

(c)

0 mM NaCl 200 mM NaCl

8 6

a

a b

2

b

b

b

0 A19-3d

K88-92-3d

K92-80-3d

A19-7d

b

b b

2 0 A19-3d

K88-92-3d

K92-80-3d

A19-7d

K88-92-7d

K92-80-7d

K88-92-7d

K92-80-7d

(d)

12 0 mM NaCl 10

200 mM NaCl

8 6

a 4

b b

b

2

b c

0 A19-3d

K88-92-3d

Cultivars Relative expression level (CAT2/GAPDH)

b

b

bc

Cultivars

12

4

a

bc

Cultivars

10

(b)

0 mM NaCl 10

K92-80-3d

A19-7d

K88-92-7d

K92-80-7d

Cultivars a

12 0 mM NaCl 10

(e)

200 mM NaCl

8

b

6

b

b

b b

4 2 0 A19-3d

K88-92-3d

K92-80-3d

A19-7d

K88-92-7d

K92-80-7d

Cultivars Fig. 2 Expression profile of a sugarcane shaggy-like kinase (SuSK), b sucrose transporter (SUT1), c pyrolline-5-carboxylate synthetase (P5CS), d Na+/H+ antiporter (NHX1), and e catalase (CAT2) in mRNA-related genes in plantlets of three sugarcane genotypes grown under 0 (C) and

200 mM NaCl (N) for 3 and 7 days, compared with glyceraldehyde-3phosphate dehydrogenase (GAPDH) used as housekeeping gene. Data presented as mean ± SE (n=3)

C92038 and Co85004 (by 12.86 and 14.16 %) and in saltsensitive genotypes Si94050 and Co85036 (by 45.12 and 46.15 %) have been reported (Gomathi and Thandapani 2005). Likewise, K+ level in salt-stressed plants of sugarcane cvs. RB92579 and CP-4333 was significantly decreased, while it was maintained in cvs. RB872552 and HSF-240 (Wahid and Ghazanfar 2006; Medeiros et al. 2014). In general, Ca2+ was enhanced when sugarcane plantlets were subjected to 200 mM NaCl for 7 days, especially in cv. K92-80 (3.99-fold over the control). In A19 mutant, Ca2+ was increased by 1.17- and 1.79-fold over the control in salt-

stressed plantlets exposed to salt stress for 3 and 7 days, respectively. In sugarcane genotypes H65-7052 (saltsensitive) and H69-8235 (salt-tolerant), Ca2+ in salt-stressed plant was increased under low Na (EC 4 dS m−1), but declined under high Na (EC 12 dS m−1) (Plaut et al. 2000). Moreover, Ca2+ level declined in both salt-tolerant (C92038 and Co85004, 37.24 and 12.84 % reduction over the control) and salt-sensitive (Si94050 and Co85036, by 65.52 and 57.69 % reduction over the control) when exposed to salt stress (Gomathi and Thandapani 2005). In contrast, Ca2+ in shoot and root tissues of salt-stressed plants (120 mM NaCl

Regulation of some salt defense-related genes

237

Table 1 Sodium ion (Na+), potassium ion (K+), calcium ion (Ca2+), and Na–K ratio in plantlets of sugarcane genotypes grown under 0 (control) and 200 mM NaCl (salt stress) for 0, 3, and 7 days Variety

NaCl (mM)

Na+ (mg g−1 DW)

K+ (mg g−1 DW)

Ca2+ (mg g−1 DW)

Na–K ratio

Day 0 (A19)AE1-17 K88-92 K92-80

0 0 0

0.00 0.29 0.82

48.24 26.10 34.99

2.95 2.04 2.15

0.00 0.01 0.02

0 200

0.00f 15.86c – 1.40e 28.53b (20.38) 1.92d 46.68a (24.31)

47.14a 27.92b (40.77 %) 27.86b 27.58b (1.01 %) 12.46c 9.50d (23.76 %)

3.96c 4.66b (1.18) 0.63e 2.67d (4.24) 2.49d 9.28a (3.73)

0.00 0.57

0.33f 42.62b (129.15) 1.67d 26.50c (15.87) 0.82e 69.57a (84.84)

32.23a 26.00b (19.33 %) 33.02a 26.31b (20.32 %) 13.30c 5.58d (58.05 %)

2.33d 4.18b (1.79) 0.43f 1.09e (2.53) 2.84c 11.33a (3.99)

0.01 1.64

Day 3 (A19)AE1-17

K88-92

0 200

K92-80

0 200

Day 7 (A19)AE1-17

0 200

K88-92

0 200

K92-80

0 200

0.05 1.03 0.15 4.91

0.05 1.01 0.06 12.47

Different letters in each column show significant difference at p≤0.01 by Tukey’s HSD. Figures in parentheses represent Na+ and Ca2+ enrichment (folds) or K+ reduction percentage of salt-stressed plantlets over control in each cultivar

for 50 days) of salt-tolerant cv. CPF-213 was maintained, whereas it declined sharply (by 35.23 %) in salt-susceptible cv. L-116 (Akhtar et al. 2003). Free proline accumulation Free proline content in salt-stressed plantlets was enriched depending on salt exposure times and sugarcane genotypes. In early salt stress (200 mM NaCl for 3 days), free proline content was significantly increased in K88-92 (salttolerant) and K92-80 (salt-sensitive), whereas it was unchanged in A19 mutant genotype (Fig. 3a). It was significantly enhanced in all genotypes of sugarcane plantlets grown under salt stress for 7 days (Fig. 3a). In K88-92 (salt-tolerant genotype), free proline content was positively related to the expression level of SoP5CS mRNA, which was highly expressed in salt-stressed plantlets in both early and late salt exposure times (Fig. 2c). After 7-day stress, the accumulation was greater in K88-92 and A19 than in K92-80, and it related to SoP5CS expression level. In A19 mutant genotype, free proline was peaked at late salt exposure time (7 days) in relation to transcriptional

expression of SoP5CS. In contrast, free proline enrichment in K92-80 genotype may be biosynthesized via ornithine route or may be regulated by SoP5CR (Δ1-pyrroline-5carboxylate reductase) as alternative key enzyme in proline biosynthesis pathway. Previously, the relationship between P5CS activity and free proline enrichment in salt-stressed plants of sugarcane cvs. Co740 (2.02-fold P5CS/1.25 fold free proline increase), Co62175 (2.14-fold P5CS/1.22 folds free proline increase), and CoM-0265 (2.37 fold P5CS/1.26 fold free proline) has been demonstrated (Mahajan et al. 2013). Free proline accumulation in salt-tolerant genotypes—CoM265, CP66-346, C92038, and Co85044—grown under salt stress was greater than that in salt-susceptible cultivars—CoC671, CP65-357, Si94050, and Co85036 (Gomathi et al. 2010; Gandonou et al. 2011; Satbhai and Naik 2014). In contrast, free proline enrichment in salt-susceptible genotypes—Co86032, CoS01434, and CoS97261—has also been demonstrated (Saxena et al. 2010; Karpe et al. 2012). Alternatively, salt exposure period has been found as another factor that regulates free proline enrichment under salt stress (Pagariya et al. 2011, 2012).

238

W. Poonsawat et al.

Fig. 3 Proline (a) and total soluble sugar contents (b) in the leaf of three sugarcane genotypes grown under 0 and 200 mM NaCl for 3 and 7 days. Data presented as mean ± SE (n=6)

Proline content (µmolg–1 FW)

4.0 3.5 a

3.0 b

2.5

c

2.0 1.5 1.0

a

a

ab

0.5

b

b

d

b

d

d

0.0 NaCl (mM)

0

Genotypes

A19

Salt exposure time (d)

Soluble sugar enrichment Sucrose was only detected in cv. K88-92 (Table 2), and it related to SoSUT1 upregulation, especially in salt-stressed

200

0

200

K88-92

0

200

K92-80

3

0 A19

200

0

200

K88-92

0

200

K92-80

7

plantlets (Fig. 2b). Sucrose content in salt-stressed plantlets of K88-92 was enriched by 2.32- and 4.38-fold when exposed to salt stress for 3 and 7 days, respectively (Table 2). In early salt stress (3 days), glucose level in

Table 2 Sucrose (Suc), glucose (Gluc) and fructose (Fruc) in plantlets of sugarcane genotypes grown under 0 (control) and 200 mM NaCl (salt stress) for 0, 3, and 7 days Variety

NaCl (mM)

Suc (μg g−1 DW)

Gluc (μg g−1 DW)

Fruc (μg g−1 DW)

Day 0 (A19)AE1-17

0

0.00

13.45

9.33

K88-92 K92-80 Day 3 (A19)AE1-17

0 0

6.18 0.00

17.41 15.42

4.74 5.09

0 200

K88-92

0 200

K92-80

0 200

0.00c 0.00c – 6.31b 14.62a (2.32) 0.00c 0.00c –

13.64d 27.21c (1.99) 16.12d 33.22b (2.06) 14.40d 47.69a (3.31)

6.45c 16.07b (2.49) 0.00d 6.20c – 16.53b 34.37a (2.08)

0.00c 0.00c – 12.41b 54.39a

10.24e 84.13a (8.22) 15.96d 33.56c

3.72e 57.50a (15.46) 12.87d 27.18b

(4.38) 0.00c 0.00c –

(2.10) 31.75c 44.62b (1.41)

(2.11) 22.65c 26.63b (1.18)

Day 7 (A19)AE1-17

0 200

K88-92

0 200

K92-80

0 200

Different letters in each column show significant difference at p≤0.01 by Tukey’s HSD. Figures in parentheses represent soluble sugar enrichment (folds) of salt-stressed plantlets over control in each cultivar

Regulation of some salt defense-related genes

239

y = 0.0124x + 0.1943 R² = 0.8637

0.80 0.60 0.40 0.20

0.00

0

10

20

30

40

50

Na+ (mg g-1 DW)

(c)

100 y = 1.2305x + 22.814 R² = 0.9764

80 60 40 20 0

0

10

20 +

30

Na (mg g-1 DW)

40

50

Proline content (µmolg-1 FW)

(a)

1.00

soluble sugar were demonstrated with high correlation coefficiency, especially in early salt stress (R2 =0.86 and R2 = 0.97, respectively) (Fig. 4). In general, soluble sugar content in salt-stressed plantlets of sugarcane genotypes is enhanced in relation to salt exposure times. For example, leaf soluble sugar in salt-stressed plants (100 mM NaCl for 11 days) of sugarcane genotypes RB92579 and RB872552 was gradually increased (Medeiros et al. 2014). Total soluble sugar and reducing sugar levels in saltstressed calli (150 mM NaCl for 15 days) of sugarcane cv. Co86032 were increased by 1.17- and 4.69-fold, respectively, over the control (Pagariya et al. 2012). Likewise, reducing sugar content in moderately salt-tolerant cv. Co62175 of sugarcane was enhanced, relating to day after salt treatment and salt exposure time (Pagariya et al. 2012). In the leaf tissues, soluble sugar content in salt-tolerant genotype CP66-346 grown under salt stress was increased in relation to salt concentration in the growing medium (Gandonou et al. 2011). At harvesting stage, reducing sugar level in salt-stressed stalks of salt-sensitive sugarcane cultivars—Si94050 (4.90-fold of control) and Co85036 (3.85-fold of the control)—was enriched higher than that in salt-tolerant genotypes—C92038 (2.83-

Total soluble sugar (µmolg-1 FW)

Total soluble sugar (µmolg-1 FW)

Proline content (molg-1 FW)

salt-stressed plantlets of sugarcane genotypes K88-92 and K92-80 was peaked at 33.22 and 47.69 μg g−1 DW (being 2.06- and 3.31-fold of the control), respectively. In addition, glucose content in the long period of salt stress (7 days) was enriched by 84.13 μg g−1 DW (8.22-fold of the control) in A19 mutant genotype (Table 2). Fructose content was undetected in controlled plantlets of sugarcane genotype K88-92. In early salt stress, fructose level in salt-stressed plantlets of sugarcane genotypes A19 and K92-80 was peaked at 16.07 and 34.37 μg g−1 DW (2.49- and 2.08-fold of the control), respectively. Moreover, fructose content in the long period of salt stress (7 days) was enriched by 57.50 μg g−1 DW (15.46-fold of the control) in A19 mutant genotype (Table 2). Total soluble sugar content in sugarcane plantlets of genotypes A19 and K88-92 was increased relating to salt exposure periods and peaked in salt-stressed plantlets (200 mM NaCl for 7 days) of genotype A19 (Fig. 3b). In contrast, soluble sugar level in K92-80 genotype was exhibited in early salt stress (3 days) and then declined in late exposure period (7 days) (Table 2). Positive relationships between Na+ and proline and between Na+ and

(b)

4

y = 0.036x + 0.4919 R² = 0.5956

3

2

1

0

0

10

20

30

40

50

60

70

80

Na+ (mg g-1 DW)

(d)

200

150

y = 0.9544x + 50.426 R² = 0.3236

100

50

0

0

10

20

30

40

50

60

70

80

Na+ (mg g-1 DW)

Fig. 4 Relationships between (a, c) Na+ and free proline content and (b, d) Na+ and total soluble sugar (TSS) content in three sugarcane genotypes grown under 0 (control) and 200 mM NaCl (salt stress) for 3 and 7 days. Data presented as mean ± SE (n=6)

240

W. Poonsawat et al.

fold of the control) and Co85004 (2.52-fold of the control) (Gomathi and Thandapani 2005). Likewise, leaf sucrose, total soluble sugar, and reducing sugar contents in salt-stressed plants of sugarcane genotypes C92038, Co85004, Si94050, and Co85036 were enriched (Gomathi and Thandapani 2004). Photosynthetic abilities Chla contents in salt-stressed plantlets (200 mM NaCl for 7 days) of sugarcane genotypes A19 mutant, K88-92, and K92-80 declined by 28.81, 23.40, and 59.89 %, respectively, when compared to the control (Table 3). Chlb, TC, and total carotenoids in A19 and K92-80 genotypes were significantly declined when subjected to 200 mM NaCl for 7 days, whereas those in K88-92 genotype were maintained (Table 3). The degradations of Chlb (13.04 %), TC (19.02 %), and total carotenoids (8.77 %) in salt-stressed plantlets of sugarcane genotype K88-92 were lesser than in other sugarcane cultivars, especially in cv. K92-80 (a negative check), where 54.26, 58.01, and 55.56 % degradation were recorded. Maximum quantum yield of PSII (Fv/Fm) in salt-stressed plantlets of sugarcane genotypes A19 mutant and K92-80 was significantly dropped (12.44 and 23.80 % diminution, respectively), while that in cv. K88-92 (positive check) was unchanged (only 3.72 % diminution) (Table 4). Moreover, ΦPSII, qP, and net photosynthetic rate (Pn) in sugarcane genotypes were significantly decreased when exposed to salt stress (Table 4). In contrast, NPQ in salt-stressed plantlets was significantly increased (Table 4). Photosynthetic pigments (chlorophylls and carotenoids) in sugarcane leaves are very sensitive to Na+, especially in saltsensitive cultivar such as HSF-240 (Wahid and Ghazanfar 2006) and K84-200 (Cha-um and Kirdmanee 2009). In the present study, the photosynthetic pigments, including Chla, Chlb, TC, and Cx+c, in salt-stressed plantlets were degraded, whereas in positive check (K88-92 salt-tolerant) these were

maintained. Similar results have been reported in salt-tolerant genotype CP-4333 of sugarcane where chlorophyll and carotenoids are retained better than those in salt-sensitive genotype (HSF-240) (Wahid and Ghazanfar 2006). Chla, Chlb, and TC contents in salt-stressed plants (EC 8 dS m−1 for 150 days) of sugarcane genotypes UP49 and CoS95255 (salt tolerant) were maintained better than in cultivars CoS01434 and CoS97261 (Saxena et al. 2010). Total chlorophyll level in salt-tolerant CoM-265 grown under 7–8 dS m−1 for 5 days declined by only 8.84 % compared to 30.50 % decline in salt-sensitive CoC-617 (Satbhai and Naik 2014). In addition, chlorophyll degradation in cv. Co62175 of sugarcane depended on salt exposure time and was more sensitive in the long-term salt treatment (2 % NaCl for 30 days) than in the short period (Pagariya et al. 2011). Consequently, diminution percentages of F v /F m and Φ PSII in salt-tolerant cultivars C92038, Co85004, and K88-92 were lesser than those in saltsensitive genotypes Si94050, Co85036, and K84-200 (Gomathi et al. 2010; Cha-um et al. 2013). Low chlorophyll degradation and chlorophyll fluorescence diminution in saltstressed plants of salt-sensitive genotypes RB867515 (200 mM NaCl for 3 days), Co94012, Co94008 (8 dS m−1 for 150 days), and RB92579 (100 mM NaCl for 11 d) resulted in high Pn. In contrast, these parameters were sharply declined in plant grown under salt stress, leading to significantly reduced Pn (Vasantha et al. 2010; Pacheco et al. 2013; Medeiros et al. 2014). Growth performances SH and DW in salt-stressed plantlets of sugarcane genotypes were significantly decreased (Table 5). The reduction in shoot growth of salt-stressed plantlets was 42.67 % in K92-80 (negative check) and 27.49 % in A19 mutant when exposed to 200 mM NaCl for 7 days. In contrast, only 13.75 % reduction in plant height was observed in

Table 3 Chlorophyll a (Chla), chlorophyll b (Chlb), total chlorophyll (TC), and total carotenoids (Cx+c) content in plantlets of sugarcane genotypes grown under 0 (control) and 200 mM NaCl (salt stress) for 7 days Cultivars

NaCl (mM)

Chla (μg g−1 FW)

Chlb (μg g−1 FW)

TC (μg g−1 FW)

Cx+c (μg g−1 FW)

(A19)AE1-17

0 200

K88-92

0 200

118b 84c (28.81 %) 94b 72c

106a 60b (43.40 %) 69b 60b

224b 144 cd (35.71 %) 163c 132 cd

9.7a 4.1bc (57.73 %) 5.7b 5.2b

K92-80

0 200

(23.41 %) 187a 75c (59.89 %)

(13.04 %) 94a 43c (54.26 %)

(19.02 %) 281a 118d (58.01 %)

(8.77 %) 5.4b 2.4c (55.56 %)

Different letters in each column show significant difference at p≤0.01 by Tukey’s HSD. Figures in parentheses represent percent degradation in photosynthetic pigments of salt-stressed plantlets in each cultivar

Regulation of some salt defense-related genes

241

Table 4 Maximum quantum yield of PSII (Fv/Fm), photon yield of PSII (ΦPSII), photochemical quenching (qP), non-photochemical quenching (NPQ), and net photosynthetic rate (Pn) in plantlets of three sugarcane genotypes grown under 0 (control) and 200 mM NaCl (salt stress) for 7 days Cultivars

NaCl (mM)

Fv/Fm

ΦPSII

qP

NPQ

Pn (μmol m−2 s−1)

(A19)AE1-17

0 200

K88-92

0

0.876a 0.767c (12.44 %) 0.859a

0.674a 0.455ef (32.49 %) 0.706a

0.748a 0.558d (25.40 %) 0.745a

0.093c 0.265a (2.85 fold) 0.088c

6.14bc 4.62d (31.43 %) 7.83a

0.827ab (3.72 %) 0.853a 0.650d (23.80 %)

0.615b (12.89 %) 0.511 cd 0.353 g (30.92 %)

0.662bc (11.14 %) 0.644c 0.409e (36.49 %)

0.138b (1.57 fold) 0.135b 0.256a (1.90 fold)

5.54c (29.25 %) 7.75a 4.21d (79.10 %)

200 K92-80

0 200

Different letters in each column show significant difference at p≤0.01 by Tukey’s HSD. Figures in parentheses represent percent diminution in photosynthetic abilities of salt-stressed plantlets in each cultivar

K88-92 (positive check) (Table 5). RL, FW, and LA in salt-stressed plantlets of sugarcane genotype K-88-92 were maintained (∼14.29, 21.03, and 15.72 % reduction over the control). In contrast, RL, FW, and LA were significantly inhibited in both A19 (47.27, 55.78, and 46.13 % reduction over the control) mutant and K92-80 (19.05, 24.54, and 73.63 % reduction over the control) genotypes (Table 5). The inhibition in SH, RL, FW, DW, and LA in saltstressed plantlets of sugarcane was evidently demonstrated, especially in salt-susceptible genotype K92-80. Similarly, SH and stalk yield of sugarcane genotype K84-200 grown under salinity field trial were declined by 19.04 and 37.36 %, respectively, whereas in K88-92, it was decreased by only 4.90 and 24.50 %, respectively (Cha-um et al. 2013). Shoot length, shoot dry weight, and LA in salt-tolerant cvs. CP-4333 and CPF-213 grown under salt stress were maintained better than those in salt-sensitive cvs. HSF-240 and L116 (Wahid

and Ghazanfar 2006; Akhtar et al. 2003). Leaf area is one of sensitive parameters in sugarcane irrigated with saline water (Saxena et al. 2010). Leaf area of saltsusceptible genotype H65-7052 grown under irrigated saline water was highly reduced than in salt-tolerant H69-8235 (Plaut et al. 2000). In conclusion, relative expression levels of SuSK, SUT1, P5CS, NHX1, and CAT2 in salt-tolerant cultivar K88-92 were upregulated in relation to low Na+ (ion homeostasis), sugar enrichment, and free proline accumulation (osmoregulation). Photosynthetic pigment and their activities in K88-92 grown under salt stress were maintained, leading to high Pn and growth retention. From the results, salt defense mechanisms in K88-92 (positive check) via ion homeostasis (Na+/H+-antiporter; NHX1), osmoregulation (proline-5-carboxylate synthetase; P5CS), signal transduction (sugarcane shaggy-like kinase; SuSK), and antioxidant systems (catalase; CAT2) as well as in A19 (mutant genotype) via only osmoregulation (P5CS)

Table 5 Shoot height (SH), root length (RL), fresh weight (FW), dry weight (DW), and leaf area (LA) in plantlets of sugarcane genotypes grown under 0 (control) and 200 mM NaCl (salt stress) for 7 days Cultivars

NaCl (mM)

SH (cm)

RL (cm)

FW (mg)

DW (mg)

LA (cm2)

(A19)AE1-17

0 200

K88-92

0 200

16.5a 12.0b (27.49 %) 16.0a 13.8b

5.5a 2.9c (47.27 %) 2.8c 2.4c

389a 172d (55.78 %) 271c 214 cd

43b 22d (48.84 %) 49a 40b

852b 459d (46.13 %) 789bc 665c

K92-80

0 200

(13.75 %) 15.0ab 8.6c (42.67 %)

(14.29 %) 4.2b 3.4c (19.05 %)

(21.03 %) 326b 246c (24.54 %)

(18.37 %) 50a 31c (38.00 %)

(15.72 %) 1039a 274e (73.63 %)

Different letters in each column show significant difference at p≤0.01 by Tukey’s HSD. Figures in parentheses represent percent reduction in growth performances of salt-stressed plantlets in each cultivar

242

were proposed. The genetic background of salt-tolerant cv. K88-92 may further be played a key role as parental line for sugarcane breeding program.

Acknowledgments The authors wish to thank Cluster and Program Management Office (CPMO), National Science and Technology Development Agency (NSTDA, Thailand) as a funding source (grant code P-12-01192) and a partial support in the form of a short-term research grant to TS under Young Scientist and Technologist Programme (YSTP). Conflict of interest The authors declare that they have no conflict of interest. There is no financial or other relationship that might be perceived as leading to a conflict of interest.

References Akhtar A, Wahid A, Rasul E (2003) Emergence, growth and nutrient composition of sugarcane sprouts under NaCl salinity. Biol Plant 46: 113–116 Azevedo RA, Carvalho RF, Cia MC, Gratão (2011) Sugarcane under pressure: an overview of biochemical and physiological studies of abiotic stress. Trop Plant Biol 4:42–51 Bates LS, Waldren RP, Teare ID (1973) Rapid determination of free proline for water-stress studies. Plant Soil 39:205–207 Cha-um S, Kirdmanee C (2009) Proline accumulation, photosynthetic abilities and growth characters of sugarcane (Saccharum officinarum L.) plantlets in response to iso-osmotic salt and waterdeficit stress. Agric Sci China 8:51–58 Cha-um S, Mosaleeyanon K, Supaibulwatana K, Kirdmanee C (2004) Physiological responses of Thai neem (Azadirachta siamensis Val.) to salt stress for salt-tolerance screening program. Sci Asia 30:17–23 Cha-um S, Chuencharoen S, Mongkolsiriwatana C, Ashraf M, Kirdmanee C (2012) Screening sugarcane (Saccharum sp.) genotypes for salt tolerance using multivariate cluster analysis. Plant Cell Tiss Org Cult 110:23–33 Cha-um S, Chantawong S, Mongkolsiriwatana C, Ashraf M, Kirdmanee C (2013) Field screening of sugarcane (Saccharum sp.) mutant and commercial genotypes for salt tolerance. Not Bot Horti Agrobo 41: 286–293 FAOSTAT (2007) Production of crops. Crops, World, Sugarcane Production Quantity. FAOSTAT: 3 Fujiwara K, Kozai T, Watanabe L (1987) Fundamental studies on environment in plant tissue culture vessel. (3) Measurement of carbon dioxide gas concentration in closed vessels containing tissue cultured plantlets and estimates of net photosynthetic rates of the plantlets. J Agric Meteorol 43:21–30 Gandonou CB, Bada F, Abrini J, Skali-Senhaji N (2011) Free proline, soluble sugars and soluble proteins concentration as affected by salt stress in two sugarcane (Saccharum sp.) cultivars differing in their salt tolerance. Int J Biol Chem Sci 5:2441–2453 Gomathi R, Thandapani PV (2004) Sugar metabolism and carbon partitioning of sugarcane genotypes under salinity stress condition. Sugar Tech 6:151–158 Gomathi R, Thandapani TV (2005) Salt stress in relation to nutrient accumulation and quality of sugarcane genotypes. Sugar Tech 7: 39–47 Gomathi R, Vasantha S, Thandapani V (2010) Mechanism of osmoregulation in response to salinity stress in sugarcane. Sugar Tech 12:305–311 Hossain GS, Waditee R, Hibino T, Tanaka Y, Takabe T (2006) Root specific expression of Na+/H+ antiporter gene from Synechocystis

W. Poonsawat et al. sp. PCC6803 confers salt tolerance of tobacco plant. Plant Biotechnol 23:275–281 Karkacier M, Ebras M, Uslu MK, Aksu M (2003) Comparison of different extraction and detection methods for sugars using amino-bonded phase HPLC. J Chromatogr Sci 41:331–333 Karpe A, Nikam AA, Chimote KP, Kalwade SB, Kawar PG, Babu H, Devarumath RM, Suprasanna P (2012) Differential responses to salinity stress of two varieties (CoC671 and Co86032) of sugarcane (Saccharum officinarum L.). Afr J Biotechnol 11:9028–9035 Lakshmanan P, Geijskes RJ, Aitken K, Grof CLP, Bonnett GD, Smith GR (2005) Sugarcane biotechnology: the challenges and opportunities. In Vitro Cell Dev Biol Plant 41:345–363 Lichtenthaler HK (1987) Chlorophylls and carotenoids: pigments of photosynthetic biomembranes. Meth Enzymol 148:350–380 Lingle SE, Wiegand CL (1997) Soil salinity and sugarcane juice quality. Field Crop Res 54:259–268 Loggini B, Scartazza A, Brugnoli E, Navari-Izzo F (1999) Antioxidant defense system, pigment composition, and photosynthetic efficiency in two wheat cultivars subjected to drought. Plant Physiol 119: 1091–1099 Mahajan ST, Naik RM, Dalvi US (2013) Assessment of biochemical markers in differentiating sugarcane genotypes for salt tolerance. Sugar Tech 15:116–121 Maxwell K, Johnson GN (2000) Chlorophyll fluorescence—a practical guide. J Exp Bot 51:659–668 Medeiros CD, Neto JRCF, Oliveira MT, Rivas R, Pandolfi V, Kido ÉA, Baldani JI, Santos MG (2014) Photosynthesis, antioxidant activities and transcriptional responses in two sugarcane (Saccharum officinarum L.). Acta Physiol Plant 36:447–459 Moore PH (1995) Temporal and spatial regulation of sucrose accumulation in the sugarcane stem. Aust J Plant Physiol 22:661–679 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473–497 Pacheco CM, Pestana-Calsa MC, Gozzo FC, Nogueira RJMC, Menossi M, Junior TC (2013) Differentially delayed root proteome responses to salt stress in sugar cane varieties. J Proteome Res 12:5681–5695 Pagariya MC, Harikrishman M, Kulkarni PA, Devarumath RM, Kawar PG (2011) Physio-biochemical analysis and transcript profiling of Saccharum officinarum L. submitted to salt stress. Acta Physiol Plant 33:1411–1424 Pagariya MC, Devarumath R, Kawar PG (2012) Biochemical characterization and identification of differentially expressed candidate genes in salt stressed sugarcane. Plant Sci 184:1–13 Patade VY, Rai AN, Suprasanna (2011) Expression analysis of sugarcane shaggy-like kinase (SuSK) gene identified through cDNA substractive hybridization in sugarcane (Saccharum officinarum L.). Protoplasma 248:613–621 Patade VY, Bhargava S, Suprasanna P (2012a) Effects of NaCl and isoosmotic PEG stress on growth, osmolytes accumulation and antioxidant defense in cultured sugarcane cells. Plant Cell Tiss Org Cult 108:279–286 Patade VY, Bhargava S, Suprasanna P (2012b) Transcript expression profiling of stress responsive genes in response to short-term salt or PEG stress in sugarcane leaves. Mol Biol Rep 39:3311–3318 Patade VY, Lokhande VH, Suprasanna P (2014) Exogenous application of proline alleviates salt induced oxidative stress more efficiently than glycine betaine in sugarcane cultured cells. Sugar Tech 16:22– 29 Plaut Z, Meinzer FC, Federman E (2000) Leaf development, transpiration and ion uptake and distribution in sugarcane cultivars grown under salinity. Plant Soil 218:56–69 Sairam PK, Tyagi A (2004) Physiology and molecular biology of salinity stress tolerance in plants. Curr Sci 86:407–421 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor

Regulation of some salt defense-related genes Satbhai RD, Naik RM (2014) Osmolytes accumulation, cell membrane integrity, and antioxidant enzymes in sugarcane varieties differing in salinity tolerance. Sugar Tech 16:30–35 Savouré A, Thorin D, Davey M, Hua XJ, Mauro S, van Montagu M, Inzé D, Verbruggen N (1999) NaCl and CuSO4 treatments trigger district oxidative defence mechanisms in Nicotiana plumbaginifolia L. Plant Cell Environ 22:387–396 Saxena P, Srivastava RP, Sharma ML (2010) Studies on salinity stress tolerance in sugarcane varieties. Sugar Tech 12:59–63 Shabala SN, Shabala SI, Martynenko AI, Babourina O, Newman IA (1998) Salinity effect on bioelectric activity, growth, Na+ accumulation and chlorophyll fluorescence of maize leaves: a comparative survey and prospects for screening. Aust J Plant Physiol 25:609–616

243 Tanaka K, Ohta K, Haddad PR, Fritz JS, Lee KP, Hasebe K, Ieuji A, Miyanaga A (1999) Acid-rain monitoring in East Asia with a portable-type ion-exclusion-cation-exchange chromatographic analyzer. J Chromatogr 850:311–317 Vasantha S, Venkataramana S, Rao PNG, Gomathi R (2010) Long-term salinity effect on growth, photosynthesis and osmotic characteristics in sugarcane. Sugar Tech 12:5–8 Waclawovsky AJ, Sato PM, Lembke CG, Moore PH, Souza GM (2010) Sugarcane for bioenergy production: an assessment of yield and regulation of sucrose content. Plant Biotechnol J 8:263–276 Wahid A, Ghazanfar A (2006) Possible involvement of some secondary metabolites in salt tolerance of sugarcane. J Plant Physiol 163:723– 730