Comparative Biochemistry and Physiology, Part B 184 (2015) 44–51
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb
Regulation of the fatty acid synthase promoter by liver X receptor α through direct and indirect mechanisms in goat mammary epithelial cells Jun Li, Jun Luo ⁎, Jiangjiang Zhu, Yuting Sun, Dawei Yao, Hengbo Shi, Wei Wang Shaanxi Key Laboratory of Molecular Biology for Agriculture, College of Animal Science and Technology, Northwest A&F University, Yangling 712100 Shaanxi, PR China
a r t i c l e
i n f o
Article history: Received 1 December 2014 Received in revised form 20 February 2015 Accepted 23 February 2015 Available online 1 March 2015 Keywords: Goat Liver X receptor FASN promoter Milk fat synthesis Transcriptional activity
a b s t r a c t Fatty acid synthase (FASN) is a central enzyme of milk fat synthesis in the ruminant mammary gland. However, the mechanisms regulating goat FASN transcription remain elusive. The objective of this study was to investigate the mechanisms by which liver X receptor α (LXRα) regulates the FASN promoter in goat mammary epithelial cells (GMECs). In this study, T0901317 (T09), an agonist for LXRα, significantly enhanced the mRNA expression and promoter activity of FASN. Cloning of the dairy goat FASN promoter revealed the presence of one LXR response element (LXRE) and two sterol regulatory elements (SREs). Deletion or mutation of the FASN promoter LXRE reduced, but did not eliminate the transcriptional response of FASN to T09. While the LXRE and the SREs were both disrupted, basal transcription was severely reduced and there was no response to T09 treatment. This suggested that a complete response required one LXRE and two SREs. Knockdown of LXRα by siRNA did not alter the basal or T09-induced transcriptional activity of FASN. However, when sterol regulatory binding protein 1 (SREBP1) was knocked down, T09 significantly increased FASN transcription by wild-type GMECs, but had no effect on cells with LXRE-mutant promoters. The results suggested that LXR regulates FASN promoter activity through direct interaction with the LXRE as well as through increasing SREBP1 abundance. The present study provides insight into the transcriptional regulatory mechanisms controlling de novo fatty acid synthesis in GMECs. © 2015 Elsevier Inc. All rights reserved.
1. Introduction Fat composition is one of the most important components of the nutritional or dietetic quality of goat milk (Kompan and Komprej, 2012). The concentration of total fat and the composition of fatty acids in mammalian milk are variable and respond to nutritional factors in the goat diet (Harvatine et al., 2014). Fatty acid synthase (FASN) is a central enzyme in the de novo fatty acid biosynthesis pathway; it is especially critical for the production of short- and medium-chain fatty acids in the mammary gland of ruminants, which affects the nutrition and flavor of goat milk. Expression of the FASN gene is controlled primarily at the transcriptional level (Sul and Wang, 1998). Sterol regulatory element-binding protein 1 (SREBP1) plays a critical role in the transcriptional regulation of a number of genes involved in the synthesis of milk fat in bovine mammary epithelial cells, including FASN and steroyl-CoA desaturase (SCD1) (Peterson et al., 2004; Harvatine and Bauman, 2006). SREBP1 regulates FASN expression through direct interaction with the FASN promoter through two sterol regulatory elements (SREs) in mice (Latasa et al., 2000). ⁎ Corresponding author at: College of Animal Science and Technology, Northwest A&F University, No.3 Taicheng Road, Yangling, Shaanxi, PR China. Tel./fax: +86 29 87080898. E-mail address: [email protected] (J. Luo).
http://dx.doi.org/10.1016/j.cbpb.2015.02.005 1096-4959/© 2015 Elsevier Inc. All rights reserved.
Besides SREBP1, liver X receptor (LXR) is also involved in the control of lipogenesis. LXR has been identified by two isoforms: LXRα and LXRβ. LXRα is expressed most highly in the lipogenic tissues, liver and adipose tissue, whereas the LXRβ subtype is ubiquitously expressed and its expression is quite low (Song et al., 1995). LXR is a nuclear receptor responsive to oxysterols or synthetic agonists, such as T0901317 (T09) (Ducheix et al., 2011). By forming heterodimers with the retinoid X receptor (RXR), both LXRα and LXRβ bind to LXR response elements (LXREs) in the promoters of target genes (Fievet and Staels, 2009). In human preadipocytes, LXRα activation with T09 increases FASN, acetyl-CoA carboxylase (ACC), and SCD1 mRNA expression (Darimont et al., 2006). LXRα agonist stimulation of lipid synthesis in the liver is dependent on SREBP1c (Liang et al., 2002; Chen et al., 2004; Cha and Repa, 2007). These findings suggest that LXRα could have roles in lipogenic gene regulation, maintaining the expression of some genes and activating others. Additionally, the SREBF1 promoter contains an LXRE (Lengi and Corl, 2010), and SREBF1 mRNA is increased following the activation of LXRα by T09 treatment (Darimont et al., 2006; McFadden and Corl, 2010). Thus, many lipogenic genes can be directly activated by LXRα (via LXREs) and SREBP1 (via SREs), and lipogenic genes can also be indirectly activated by LXRα in the absence of an LXRE in the gene promoter through the induction of SREBP1 transcription.
J. Li et al. / Comparative Biochemistry and Physiology, Part B 184 (2015) 44–51
In dairy cows, SREBP1 is considered to be a primary regulator of milk fat synthesis in the mammary gland, and knockdown of SREBP1 reduces lipogenic gene expression in bovine mammary epithelial cells (Ma and Corl, 2012). Additionally, LXRα is considered to be a potentially important regulator of milk fat synthesis, since the expression of LXRα is increased during the transition from pregnancy to lactation (Mani et al., 2009; Mani et al., 2010). Stimulation of bovine mammary epithelial cells with T09 increases the expression of lipogenic genes and de novo fatty acid synthesis, suggesting the potential regulation of milk fat synthesis by LXRα (McFadden and Corl, 2010; Oppi-Williams et al., 2013). Lengi and Corl (2010) reported that the effect of T09 on SREBF1c was mediated through an LXRE in the bovine SREBF1c promoter (Lengi and Corl, 2010). Oppi-Williams et al.(2013) reported that an LXR agonist increased the expression of FASN independently of SREBP1 in bovine mammary epithelial cells (MAC-T cells), possibly indicating the direct regulation of FASN transcription by LXRα (Oppi-Williams et al., 2013). In dairy goats, Wang et al. (2012) reported that the expression of FASN and SREBF1 was induction by T09 in goat mammary epithelial cells (GMECs) in a dose- and time-dependent manner (Wang et al., 2012). The promoter of the rodent FASN gene contains one LXRE and two SREs, which may allow for both direct and indirect transcriptional regulation by LXR (Joseph et al., 2002). Although much is known about the regulation of milk fat synthesis by LXRα and SREBP1 in cows, the mechanisms regulating the transcription of FASN in milk fat synthesis by the dairy goat mammary gland are still not well understood. Therefore, our objective was to characterize the regulation of the dairy goat FASN promoter through the LXRE and SREs of the promoter in response to LXRα activation in GMECs. 2. Materials and methods 2.1. Cloning of the FASN promoter region The sequence of FASN promoter was amplified by PCR from genomic DNA of Xinong Saanen dairy goat. The primers were designed based on the sequence of cow FASN promoter (Genbank accession: AF285607). The primers are as follows: forward, GAAGGAAAAGAAAATCCCACAA AGT, reverse, GTCTCGTGGGACTCGAACATACA. Amplified products were inserted into the pMD19-T vector (Takara, Japan) and sequenced (Invitrogen, Shanghai, China), and then subcloned into the luciferase reporter vector pGL3-Basic (Promega, Madison, WI) using the MluI and BglII restriction site. 2.2. Bioinformatics analysis of the FASN promoter The pattern search for AliBata 2.1 (http://www.gene-regulation. com/pub/programs.html) and TFSEARCH (http://www.cbrc.jp/ research/db/TFSEARCH.html) was used to predict the transcription factor binding sites. The response elements were also identified within the promoter of goat FASN using sequence homology to the wellcharacterized mouse, rat, and human FASN promoters. The 5′ flanking sequence of the dairy goat FASN gene was compared to that of cow
45
(Bos taurus, AF285607), human (Homo sapiens, AF250144) and rat (Rattus norvegicus, X54671) using the BioXM 2.6 software (Nanjing Agricultural University, Nanjing, China). 2.3. Deletion analysis and plasmid construction To generate 5′ deletion plasmid derivatives −1524, −1044, −838, −591, −397, −293, and −14, PCR primers were designed to hybridize at the corresponding positions and coupled with the common downstream primer at + 129 (Table 1). The primers were introduced with MluI and BglII restriction sites at their terminal ends, such that the PCR products were digested at the corresponding restriction sites and cloned into the pGL3-Basic vector which digested with the same enzymes. All of the plasmids were confirmed by DNA sequencing. 2.4. Site-directed mutagenesis The mutation of elements was performed with the overlap extension PCR using the promoter fragment (− 838 to + 129 bp) vector as a template. The primers were designed in Table 2. Mutations were introduced in the LXR recognition site at − 677 to − 662 bp to generate a mutant plasmid. The SRE mutants were performed using the same methods. The mutations were introduced in the SREs (− 158 to −148 bp, −78 to −70 bp) to generate the mutant plasmids. Successful mutagenesis was confirmed by DNA sequencing. 2.5. Small interfering RNA For expression silencing, the siRNA targeting the goat LXRα (GenBank accession no. NM_001285751) and SREBF1 gene (GenBank accession no. JN790254) was designed and synthesized by Invitrogen Corp. (USA). The SREBF1 siRNA sequence was as follows: 5′-GCUCCU CACUUGAAGGCUUTT-3′, and the LXRα siRNA sequence was: 5′-CCGG GAAGACUUUGCCAAATT-3′. Scrambled siRNA, is a functional nontargeting siRNA which used as a negative control. 2.6. Cell culture and transfection The isolation of primary GMECs was described previously (Wang et al., 2010; Lin et al., 2013a; Shi et al., 2014). GMECs were cultured in a basal DMEM/F12 medium containing 10% fetal bovine serum (FBS), 5 μg/ml insulin, 100 U/ml penicillin and 100 mg/ml streptomycin, and 10 ng/ml epidermal growth factor 1 (EGF-1, Gibco) at 37 °C in a humidified atmosphere with 5% CO2. To promote lactogenesis, GMECs were cultured in a lactogenic medium for 48 h prior to initial experiments as reported previously (Peterson et al., 2004; Kadegowda et al., 2009). The lactogenic medium was prepared as the basal medium, supplemented with 2 μg/ml prolactin (Sigma-Aldrich, USA) and 1 μg/ml hydrocortisone (Sigma-Aldrich, USA). For luciferase assay, the cells were seeded in 48-well culture plates and cultured overnight or until 80%–90% confluent. Cells were cotransfected with 0.3 μg of the indicated pGL3 reporter vector and
Table 1 Primers for deletion of goat FASN promoter constructs. Primer name 5′deletion primers
F1 F2 F3 F4 F5 F6 F7 Reverse
Primer sequence (5′ → 3′)
Binding region
ATTACGCGTGAAGGAAAAGAAAATCCCA ATTACGCGTTGTTTTCAGTCTGGAAAGTC ATTACGCGTAAGAGGTGTCCGTGCATAGG ATTACGCGTGCCCGGCCCATCACCCTATC ATTACGCGTTGACCCTCAGAGTGACCGAAGT ATTACGCGTGCACGGAACGGAAGTTGG ATTACGCGTGGAGCCAGAGAGACAGTAGC GGAAGATCTGGGTTCCCGACTCACAACT
−1524 bp * −1044 bp −838 bp −591 bp −397 bp −293 bp −14 bp +129 bp
The “*” symbol indicates the number of bases upstream (−) and downstream (+) from the start site of transcription.
46
J. Li et al. / Comparative Biochemistry and Physiology, Part B 184 (2015) 44–51
Table 2 Primers used in site-directed mutagenesis. Primer name
Primer sequence (5′ → 3′)
SRE1 SRE1-mut LXRE LXRE-mut SRE2 SRE2-mut
CGGCGCGCCGCATcACccCACTGG CGGCGCGCCGCATAACTTCACTGG TGCTGCAGTGAccGACAGTaAccCCG TGCTGCAGTGATAGACAGTGATACCG CAGCCAAGCTGTCAGcccATGTGGCGTGTC CAGCCAAGCTGTCAGTTTATGTGGCGTGTC
10 ng of renilla luciferase control vector (pRL-TK, Promega) per well, using FuGENE HD transfection reagent (Roche, USA). At 12 h after transfection, medium was discarded and replaced with 300 μl per well of fresh growth medium or growth medium containing 1 μM of the LXRα agonist T09 (Sigma-Aldrich, St. Louis, MO, USA) for 24 h. Then, the cells were measured by luciferase assays. For siRNA transfection experiment, briefly, the cells were seeded in 48-well culture plates and cultured overnight. FASN promoter reporter constructs were transfected using FuGENE HD transfection reagent (Roche, USA). After incubation for 12 h, then the cells were transfected with 50 nmol siRNA using Lipofectamine™ RNAiMAX (Invitrogen, USA), and after 12 h, the cells were treated with 1 μM T09 for 24 h. The cells were collected for analysis by luciferase assays. All transfections were carried out in triplicate and repeated at least thrice in independent experiments. 2.7. Luciferase assays After 48 h of incubation transfection, cells were harvested for assaying luciferase activity. Transfected cells were washed using phosphate buffer saline (PBS), lysed with passive lysis buffer, and assayed for firefly and renilla luciferase activities in a luminometer using the Dual-Luciferase Reporter Assay System according to the manufacturer's instructions (Promega, Madison, USA). The luciferase readings of each sample were first normalized against the pRL-TK levels. 2.8. RNA extraction and real time-quantitative PCR (RT-qPCR) Total RNA was extracted from GMECs using RNAprep Pure Cell/Bacteria Kit (Tiangen, China), and first-strand cDNA was synthesized using PrimeScriptTM RT Reagent Kit (Takara, Japan). RT-qPCR was performed using the SYBR®Premix Ex TaqTM II Kit (Takara, Japan) in a Bio-Rad CFX96TM. The primers of FASN, SREBP-1, LXRα, ubiquitously expressed
Fig. 2. Deletion analysis of the goat FASN promoter. Goat FASN promoter fragments 1524LUC, 1044-LUC, 838-LUC, 591-LUC, 397-LUC, 293-LUC, and 14-LUC were generated as described under Materials and methods. GMECs were transfected with equimolar amounts of a series of 5′-deletion fragments. After transfection for 12 h, GMECs were treated with 1 μM T09. After a 24 h treatment, cells were harvested for luciferase reporter assay. Results are presented as normalized relative luciferase activity (n = 5). *, p b 0.05; **, p b 0.01.
transcript (UXT), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and PCR reactions used in the study were reported previously (Lin et al., 2013b; Shi et al., 2013). Ideally, expression of genes used as internal controls should not be affected by specific treatments or physiological state. RT-qPCR is extremely sensitive but requires data normalization to account for analytical errors. So, GAPDH and UXT were selected as internal controls (Kadegowda et al., 2009; Bonnet et al., 2013). The final data were normalized using the geometric mean of UXT and GAPDH. The data were analyzed using the relative quantification (2−△△Ct) method (Livak and Schmittgen, 2001). The amplification efficiency of each primer pair was reported (Shi et al., 2013). Each sample was performed at least in triplicate.
2.9. Statistical analysis The results represented the mean ± SD of at least three independent experiments. The results were analyzed for significant differences using Student's t-test (unpaired and two-tailed) or two-way ANOVA. Differences between treatment (T09) and control (DMSO) at each deletion or mutation promoter were determined using the Student's t-test. Data examining mRNA abundance of genes by RT-qPCR were also analyzed using Student's t-test. SiRNA (−/+) and T0901317 (−/+) treatment were compared using two-way ANOVA. p b 0.05 was considered statistically significant.
Fig. 1. The mRNA expression and promoter activity of FASN are regulated by LXR agonist T09 in GEMCs. (A) T09 up-regulated FASN and SREBP1 mRNA levels. GMECs were treated with T09 for 24 h, then FASN and SREBP1 mRNA levels were quantified by RT-qPCR (n = 3). (B) T09 activates FASN promoter activity in GMECs. GMECs were transiently transfected with a luciferase reporter containing sequence from −1524 to +129 bp of goat FASN promoter for 12 h. Then, cells were treated with 1 μM T09 for 24 h. Results are presented as normalized relative luciferase activity (n = 5). **, p b 0.01.
J. Li et al. / Comparative Biochemistry and Physiology, Part B 184 (2015) 44–51
A
B
47
48
J. Li et al. / Comparative Biochemistry and Physiology, Part B 184 (2015) 44–51
3. Results 3.1. The FASN promoter is induced by the LXRα agonist T0901317 RT-qPCR analysis confirmed that FASN expression was strongly induced in GMECs in response to treatment with the LXRα agonist T09 (Fig. 1A). Treatment of GMECs with T09 also led to the significant increase mRNA expression of SREBF1 (Fig. 1A). Next, the goat FASN promoter sequence was cloned (GenBank accession no. KP749922). Analysis by luciferase reporter assay showed that T09 strongly induced FASN promoter (−1524 to +129 bp) activity by 3-fold (Fig. 1B). 3.2. The FASN promoter contains one LXRE and two SREs, and deletion of the regions containing these elements reduces the transcriptional response to LXRα activation The above results indicated that the region between − 1524 and + 129 of the goat FASN promoter contains sequences responsive to LXRα. To locate cis-elements responsible for this regulation, sequential deletion constructs of FASN promoter-Luc were employed to determine the promoter regions responsive to LXRα activation. Luciferase reporter assays showed that constructs with deletions of the FASN promoter sequence from − 1524 to − 838 bp and the intact promoter without deletions were equally activated by treatment with LXRα agonist (p b 0.01). Deletion of the sequence between − 838 and − 293 bp led to a reduction in the magnitude of the response to LXRα agonist, but the response remained significant compared with the dimethyl sulfoxide (DMSO) vehicle control treatment (p b 0.05). Further deletion of the promoter region sequence from − 293 to − 14 bp resulted in the complete loss of the transcriptional response to LXRα agonist (Fig. 2). Together, these observations indicate that sequences located between − 838 and − 591 bp as well as between − 293 and − 14 mediate the response of the FASN promoter to LXRα activation. Sequence analysis of the goat FASN promoter revealed elements (LXRE and SRE) responsive to the transcription factors LXRα and SREBP1c. There were one LXRE (−670 to −653) and two SREs (−151 to − 141 and − 73 to − 55) identified in the goat FASN promoter, as shown in Fig. 3A. An alignment of the FASN promoters from goat, cow, human, and rat is shown in Fig. 3B. Although the degree of sequence homology among ruminants, human, and rat is low across the whole promoter, the LXRE and SREs were highly conserved (Fig. 3B). 3.3. Mutation of LXRE and SRE in the FASN promoter alters basal and LXRα agonist-induced transcription Activation of LXRα by T09 regulates lipogenic genes with promoters that contain LXRE(s) and SRE(s) in the rodent liver and human adipose tissue (Pawar et al., 2003; Chen et al., 2004; Darimont et al., 2006). The presence of an LXRE and two SREs in the goat FASN promoter suggests that both of these two classes of transcription factors contribute to the regulation of FASN expression. To definitively demonstrate that the effects of LXRα activation on the FASN promoter are mediated by the combined action of the LXRE and two SREs, we analyzed FASN promoter constructs carrying specific mutations in these elements (Fig. 4 left). Disruption of the LXRE did not reduce basal transcription, but severely reduced the response to LXRα activation (Fig. 4 right). Mutation of the LXRE decreased LXR-induced transcription by 45% (p b 0.05) without significantly affecting basal transcription (p N 0.05), while mutation of the SREs decreased the basal transcription activity by 80%, but did not prevent the significant transcriptional response to T09 treatment
Fig. 4. Mutations in the goat FASN promoter suppress transcriptional activity in response to T09 in GMECs. Cells were transfected with either wild-type (−838 to +129 bp) or mutated promoter constructs, and then cultured with or without 1 μM T09 for 24 h. Firefly luciferase activity was measured and normalized to renilla luciferase activity for each sample (n = 5). *, p b 0.05; **, p b 0.01.
(p b 0.01). However, when the LXRE and the SREs were both disrupted, basal transcription was severely reduced and there was no response to T09 treatment (Fig. 4 right). These results indicate that LXRα activation regulates the FASN promoter via LXRE and SREs. Taken together, these results suggest that while the SRE sites might not be necessary for activation of the FASN promoter by LXRα, they may contribute to maximal promoter activation. 3.4. The effects of SREBP1 or LXRα knockdown on FASN promoter activity in response to T09 To further characterize the effects of SREBP1 and LXRα in regulating the transcription of FASN, siRNAs directed against LXRα and SREBP1 were used to knockdown the gene expression of these transcription factors. There are methodological limitations that we merely examined the mRNA abundance of genes by RT-qPCR for lacking suitable antibodies for goat. Reducing LXRα mRNA abundance in GMECs by 90% (Fig. 5A) did not alter either the basal mRNA level (Fig. 4B) or the promoter activity (Fig. 5C) of FASN, which was significantly increased by 4-fold following treatment with T09 (Fig. 5C), suggesting that normal levels of LXR are not required for basal or T09-induced transcription of FASN. Knockdown of SREBF1 by 94% (Fig. 6A) reduced the mRNA abundance (Fig. 6B) and basal transcriptional activity of FASN (Fig. 6C). When SREBF1 was reduced, T09 increased the promoter activity of FASN by 3-fold (Fig. 6C), potentially indicating that the FASN promoter is directly regulated by LXRα. In cells transfected with the LXRE-mutant promoter, T09 significantly increased the promoter activity of FASN (p b 0.05), and this response to T09 was abolished by SREBP1 knockdown with siRNA (Fig. 6C). 4. Discussion In the present study, we cloned the FASN promoter of dairy goat and investigated its transcriptional regulation by LXRα activation in GMECs for the first time. LXRα regulates FASN transcription through direct interaction with the FASN promoter and indirectly by inducing the SREBP1 gene expression. It will help to understand the regulation of milk fat synthesis by LXRα in lactating mammary gland of dairy goat. The mRNA expression of FASN was regulated by SREBP1 in bovine mammary epithelial cells (McFadden and Corl, 2010). The transcription factor SREBP1 is considered to be a global regulator of lipid metabolism, and knockdown of SREBP1 reduces lipogenic gene expression in bovine
Fig. 3. The goat FASN promoter contains an evolutionarily conserved LXRE and two SREs. (A) Analysis of FASN promoter region by bioinformatics. (B) Alignment of the human (Homo sapiens, AF250144), rat (Rattus norvegicus, X54671), bovine (Bos taurus, AF285607) and goat (Capra hircus, KP749922) FASN promoter sequences using BioXM 2.6. The arrow indicates published transcription start sites (+1) for the different species. The human, rat, and bovine sequences are from the database, whereas the goat sequence was generated during this study. Black shadow indicates agreement across all sequences.
J. Li et al. / Comparative Biochemistry and Physiology, Part B 184 (2015) 44–51
49
Fig. 5. The effect of LXRα knockdown on goat FASN promoter activity and endogenous expression of goat FASN mRNA in GEMCs. (A), (B) The effect of siLXRα on LXRα and FASN mRNA level. GEMCs were transfected with either scrambled or LXRα specific small RNA oligos (siScr and siLXRα, respectively), and total RNA were prepared 48 h later for analysis of LXRα and FASN mRNA levels by RT-qPCR (n = 3). (C) The effect of siLXRα on FASN transcriptional activity in response to T09. GMECs were transfected with the FASN reporter plasmid pGL- (−838/ +129)-LUC and either siScr or siLXRα for 24 h, and then cultured with or without 1 μM T09 for 24 h. Cells were assayed for luciferase activities (n = 5). **, p b 0.01. A, B: significant difference among treatments (p b 0.01).
Fig. 6. The effect of SREBP1 knockdown on wild type or LXRE-mut of FASN promoter activity in response to T09. (A), (B) The effect of siSREBP1 on SREBP1 and FASN mRNA level. GEMCs were transfected with either scrambled or SREBP1 specific small RNA oligos (siScr and siSREBP1, respectively), and total RNA were prepared 48 h later for analysis of SREBP1 and FASN mRNA levels by RT-qPCR (n = 3). (C) The effect of siSREBP1 on wild type of LXRE-mut promoter activity in response to T09. Cells were co-transfected with either wild-type (−838 to +129 bp) or LXRE-mut constructs and either siScr or siLXRα for 24 h, and then cultured with or without 1 μM T09 for 24 h. Firefly luciferase activity was measured and normalized to renilla luciferase activity for each sample (n = 5). *, p b 0.05; **, p b 0.01. A,B: significant difference among treatments in WT group(p b 0.01); a, b: significant difference among treatments in LXRE-mut group (p b 0.05).
50
J. Li et al. / Comparative Biochemistry and Physiology, Part B 184 (2015) 44–51
mammary epithelial cells (Ma and Corl, 2012; Oppi-Williams et al., 2013). Transcription of SREBF1 is regulated by LXR (Fievet and Staels, 2009), as disruption of the LXRE site in the SREBF1 promoter does not reduce basal transcription, but does prevent T09-stimulated SREBF1 expression in bovine mammary epithelial cells (Lengi and Corl, 2010). Both SREBP1 and LXRα are considered important regulators of lipogenic gene expression in dairy cows and the mRNA abundance of both genes is increased with the onset of lactation (Mani et al., 2009; Mani et al., 2010). Additionally, Wang et al. (2012) have reported that T09 treatment significantly increased the mRNA abundance of SREBF1 and FASN in GMECs (Wang et al., 2012). In present study, we found that SREBF1 and FASN mRNA abundance were increased by LXRα activation in GMECs, which is consistent with the results of bovine and goat mammary epithelial cells. Although these studies have shown LXRα and SREBP1 plays a role in regulating milk lipogenic gene expression and fatty acid synthesis in dairy cows and goats, the mechanism regulating the expression of lipogenic genes associated with milk fat synthesis in the mammary gland is still not well understood. Thus, in this study, we focused on the mechanisms of FASN promoter regulation by LXRα activation in GMECs. In our experiments, the LXRα agonist T09 was tested at only one concentration. The dose of T09 was selected based on previous dose titrations and represents the dose that induces a near maximal response of FASN expression in GMECs (Wang et al., 2012). In the current study, treatment with LXRα agonist increased FASN expression by GMECs, demonstrating that the dose of T09 chosen was effective, and showing functional regulation of FASN by LXRα in GMECs, similar to that previously reported (Wang et al., 2012). In this study, promoter deletion analysis showed that cells transfected with plasmids harboring FASN promoter fragments representing the promoter regions between − 1524/+ 129, − 1044/ + 129, and − 838/+ 129 bp retained the transcriptional response of FASN to LXRα activation. This may be because each of these FASN promoter fragments contained LXRE, which is bound by activated LXRα to promote FASN transcription. However, the FASN promoter fragment spanning the region from − 591 to − 14 bp, which did not contain the LXRE sequence, still responded to LXRα activation, suggesting that two SREs located within each of these promoters fragment may also contribute to the response to LXRα activation. Next, we performed site-directed mutagenesis experiments to further demonstrate the roles of the FASN promoter LXRE and SREs in the transcriptional response of FASN to LXRα activation. Joseph and colleagues (2002) also investigated the roles of the LXR in the rat FASN promoter and found that site-directed mutagenesis of the LXRE and SRE (− 65 bp) sites essentially eliminated the LXRinduced expression of FASN (Joseph et al., 2002). While our data also support the conclusion that the LXRE and two SRE sites of the FASN promoter are important under basal conditions and upon LXRα activation, in our studies, abrogation of the LXRE site reduced but did not eliminate the transcriptional response of FASN to LXRα agonist treatment. We also discovered that mutation of both SRE sites also likely contributes to the basal and LXRα agonist-induced mRNA expression of FASN. Taken together, these results indicate that LXRα regulates FASN expression through direct interaction with the FASN promoter and indirectly by inducing the expression of SREBP1. However, in the current study, reducing LXRα mRNA abundance using siRNA in GMECs did not alter the promoter activity of FASN. This result was consistent with previous observations in mammary epithelial cells of bovine, in which knockdown of LXRα did not alter the mRNA expression of genes related to de novo lipogenesis, including FASN (Oppi-Williams et al., 2013). It is known that transcription of the FASN gene is under the control of both LXRα and SREBP1 (Lopez et al., 1996; Magana and Osborne, 1996; Demeure et al., 2009; McFadden and Corl, 2010), with present work in GMECs demonstrating that LXRα activation strongly increases FASN gene expression (Fig. 1). However, in this study, FASN promoter
activity was unaltered by the reduction of LXRα mRNA abundance by siRNA treatment, indicating that basal transcription of FASN is maintained by other transcription factors, such as SREBP1. Another possible explanation is that LXRβ may be sufficient to maintain normal FASN promoter activity when LXRα mRNA abundance is reduced. Both the α and β isoforms of LXR dimerize with RXR and bind LXREs (Baranowski, 2008), indicating that complete knockdown of both isoforms may be required to determine the full effect of LXR on FASN transcription in GMECs. In the present experiment, we performed siRNA treatment to knockdown the SREBF1 mRNA level of GMECs and then treated the cells with T09. This indicates that any effects of T09 on the FASN promoter in cells treated with SREBF1 siRNA are likely to be due to LXRα directly binding the promoter and not to SREBP1 activity. Luciferase reporter assays demonstrated that T09 strongly induced FASN promoter activity in the SREBP1 knockdown cells. This observation suggests that the ability of LXRα to regulate FASN expression is not entirely dependent on its ability to induce SREBP-1 expression. The promoter activity of FASN was decreased by SREBP1 knockdown, but recovered with LXRα activation. Our results were consistent with previous observations in bovine mammary epithelial cells, in which FASN mRNA expression was reduced by SREBP1 knockdown and increased by T09 treatment (Ma and Corl, 2012; Oppi-Williams et al., 2013). In cells transfected with an LXREmutant promoter, T09 also induced FASN promoter activity. However, this induction was not observed in the SREBP1 knockdown cells. Taken together, the results suggest that both transcription factors are significant regulators of FASN transcription, with SREBP1 being necessary for maintaining basal levels and LXRα being capable of inducing higher expression of FASN upon activation. In this study, the basal activity of FASN promoter was increased in series 5′ deletions. This indicated that repressor elements may exist far upstream of the transcription start site. This result consists with 5′ deletions of human FASN promoter (Chirala, 1996). However, the identity of the transcription repressors that are recruited by the FASN promoter remains to be elucidated. Therefore, identifying the inhibitory mechanisms down regulating the FASN gene may help improve milk fatty acid synthesis in the mammary gland. The limitation of mRNA data is apparently in our current study. In bovine mammary epithelial cells, knockdown of SREBP1 by siRNA showed similar silencing efficiency at the mRNA and protein level (Oppi-Williams et al., 2013). Clearly, protein expression analyses will be required in the further study once suitable antibodies are obtained. In conclusion, the activation of LXRα using a synthetic ligand results in strongly increased promoter activity of FASN in GMECs. The promoter of the goat FASN gene contains one LXRE and two SREs. LXRα regulates FASN transcription through direct interaction with the FASN promoter and indirectly by inducing the SREBF1 gene expression. The SREs are the predominant regulatory elements of the FASN promoter that influence FASN transcription, particularly under resting conditions, and the FASN promoter LXRE responsible for the stimulation of FASN transcription by LXRα activation. Controlling the activation of LXRα in the lactating mammary gland of dairy goat may give dairy producers the ability to modify milk fat production to meet consumer demand. Acknowledgments This work was jointly supported by the Transgenic New Species Breeding Program of China (2014ZX08009-051B), the Special Fund for Agro-scientific Research in the Public Interest (201103038), and the National Natural Science Foundation of China (31072013). References Baranowski, M., 2008. Biological role of liver X receptors. J. Physiol Pharmacol. 59, 31–55. Bonnet, M., Bernard, L., Bes, S., Leroux, C., 2013. Selection of reference genes for quantitative real-time PCR normalisation in adipose tissue, muscle, liver and mammary gland from ruminants. animal 7, 1344–1353.
J. Li et al. / Comparative Biochemistry and Physiology, Part B 184 (2015) 44–51 Cha, J.-Y., Repa, J.J., 2007. The liver X receptor (LXR) and hepatic lipogenesis. The carbohydrate-response element-binding protein is a target gene of LXR. J. Biol. Chem. 282, 743–751. Chen, G., Liang, G., Ou, J., Goldstein, J.L., Brown, M.S., 2004. Central role for liver X receptor in insulin-mediated activation of Srebp-1c transcription and stimulation of fatty acid synthesis in liver. Proc. Natl. Acad. Sci. U. S. A. 101, 11245–11250. Chirala, S.S., 1996. Human fatty-acid synthase gene. Evidence for the presence of two promoters and their functional interaction. J. Biol. Chem. 271, 13584–13592. Darimont, C., Avanti, O., Zbinden, I., Leone-Vautravers, P., Mansourian, R., Giusti, V., Mace, K., 2006. Liver X receptor preferentially activates de novo lipogenesis in human preadipocytes. Biochimie 88, 309–318. Demeure, O., Duby, C., Desert, C., Assaf, S., Hazard, D., Guillou, H., Lagarrigue, S., 2009. Liver X receptor alpha regulates fatty acid synthase expression in chicken. Poult. Sci. 88, 2628–2635. Ducheix, S., Lobaccaro, J.M., Martin, P.G., Guillou, H., 2011. Liver X receptor: an oxysterol sensor and a major player in the control of lipogenesis. Chem. Phys. Lipids 164, 500–514. Fievet, C., Staels, B., 2009. Liver X receptor modulators: effects on lipid metabolism and potential use in the treatment of atherosclerosis. Biochem. Pharmacol. 77, 1316–1327. Harvatine, K.J., Bauman, D.E., 2006. SREBP1 and thyroid hormone responsive spot 14 (S14) are involved in the regulation of bovine mammary lipid synthesis during diet-induced milk fat depression and treatment with CLA. J. Nutr. 136, 2468–2474. Harvatine, K.J., Boisclair, Y.R., Bauman, D.E., 2014. Liver x receptors stimulate lipogenesis in bovine mammary epithelial cell culture but do not appear to be involved in dietinduced milk fat depression in cows. Physiol. Rep. 2, e00266. Joseph, S.B., Laffitte, B.A., Patel, P.H., Watson, M.A., Matsukuma, K.E., Walczak, R., Collins, J.L., Osborne, T.F., Tontonoz, P., 2002. Direct and indirect mechanisms for regulation of fatty acid synthase gene expression by liver X receptors. J. Biol. Chem. 277, 11019–11025. Kadegowda, A., Bionaz, M., Piperova, L., Erdman, R., Loor, J., 2009. Peroxisome proliferatoractivated receptor-γ activation and long-chain fatty acids alter lipogenic gene networks in bovine mammary epithelial cells to various extents. J. Dairy Sci. 92, 4276–4289. Kompan, D., Komprej, A., 2012. The Effect of Fatty Acids in Goat Milk on Health. Latasa, M.-J., Moon, Y.S., Kim, K.-H., Sul, H.S., 2000. Nutritional regulation of the fatty acid synthase promoter in vivo: sterol regulatory element binding protein functions through an upstream region containing a sterol regulatory element. Proc. Natl. Acad. Sci. 97, 10619–10624. Lengi, A.J., Corl, B.A., 2010. Short communication: identification of the bovine sterol regulatory element binding protein-1c promoter and its activation by liver X receptor. J. Dairy Sci. 93, 5831–5836. Liang, G., Yang, J., Horton, J.D., Hammer, R.E., Goldstein, J.L., Brown, M.S., 2002. Diminished hepatic response to fasting/refeeding and liver X receptor agonists in mice with selective deficiency of sterol regulatory element-binding protein-1c. J. Biol. Chem. 277, 9520–9528. Lin, X., Luo, J., Zhang, L., Zhu, J., 2013a. MicroRNAs synergistically regulate milk fat synthesis in mammary gland epithelial cells of dairy goats. Gene Expr. 16, 1–13. Lin, X.Z., Luo, J., Zhang, L.P., Wang, W., Shi, H.B., Zhu, J.J., 2013b. MiR-27a suppresses triglyceride accumulation and affects gene mRNA expression associated with fat metabolism in dairy goat mammary gland epithelial cells. Gene 521, 15–23.
51
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408. Lopez, J.M., Bennett, M.K., Sanchez, H.B., Rosenfeld, J.M., Osborne, T., 1996. Sterol regulation of acetyl coenzyme A carboxylase: a mechanism for coordinate control of cellular lipid. Proc. Natl. Acad. Sci. 93, 1049–1053. Ma, L., Corl, B.A., 2012. Transcriptional regulation of lipid synthesis in bovine mammary epithelial cells by sterol regulatory element binding protein-1. J. Dairy Sci. 95, 3743–3755. Magana, M.M., Osborne, T.F., 1996. Two tandem binding sites for sterol regulatory element binding proteins are required for sterol regulation of fatty-acid synthase promoter. J. Biol. Chem. 271, 32689–32694. Mani, O., Sorensen, M.T., Sejrsen, K., Bruckmaier, R.M., Albrecht, C., 2009. Differential expression and localization of lipid transporters in the bovine mammary gland during the pregnancy-lactation cycle. J. Dairy Sci. 92, 3744–3756. Mani, O., Körner, M., Sorensen, M.T., Sejrsen, K., Wotzkow, C., Ontsouka, C.E., Friis, R.R., Bruckmaier, R.M., Albrecht, C., 2010. Expression, localization, and functional model of cholesterol transporters in lactating and nonlactating mammary tissues of murine, bovine, and human origin. Am. J. Physiol. Regul. Integr. Comp. Physiol. 299, R642–R645. McFadden, J.W., Corl, B.A., 2010. Activation of liver X receptor (LXR) enhances de novo fatty acid synthesis in bovine mammary epithelial cells. J. Dairy Sci. 93, 4651–4658. Oppi-Williams, C., Suagee, J.K., Corl, B.A., 2013. Regulation of lipid synthesis by liver X receptor alpha and sterol regulatory element-binding protein 1 in mammary epithelial cells. J. Dairy Sci. 96, 112–121. Pawar, A., Botolin, D., Mangelsdorf, D.J., Jump, D.B., 2003. The role of liver X receptor-alpha in the fatty acid regulation of hepatic gene expression. J. Biol. Chem. 278, 40736–40743. Peterson, D.G., Matitashvili, E.A., Bauman, D.E., 2004. The inhibitory effect of trans-10, cis12 CLA on lipid synthesis in bovine mammary epithelial cells involves reduced proteolytic activation of the transcription factor SREBP-1. J. Nutr. 134, 2523–2527. Shi, H., Luo, J., Zhu, J., Li, J., Sun, Y., Lin, X., Zhang, L., Yao, D., Shi, H., 2013. PPAR gamma regulates genes involved in triacylglycerol synthesis and secretion in mammary gland epithelial cells of dairy goats. PPAR Res. 2013, 310948. Shi, H., Shi, H., Luo, J., Wang, W., Haile, A.B., Xu, H., Li, J., 2014. Establishment and characterization of a dairy goat mammary epithelial cell line with human telomerase (hTMECs). Anim. Sci. J. 85, 735–743. Song, C., Hiipakka, R.A., Kokontis, J.M., Liao, S., 1995. Ubiquitous receptor: structures, immunocytochemical localization, and modulation of gene activation by receptors for retinoic acids and thyroid hormonesa. Ann. N. Y. Acad. Sci. 761, 38–49. Sul, H.S., Wang, D., 1998. Nutritional and hormonal regulation of enzymes in fat synthesis: studies of fatty acid synthase and mitochondrial glycerol-3-phosphate acyltransferase gene transcription. Annu. Rev. Nutr. 18, 331–351. Wang, Z., Luo, J., Wang, W., Zhao, W., Lin, X., 2010. Characterization and culture of isolated primary dairy goat mammary gland epithelial cells. Chin. J. Biotechnol. (Sheng wu gong cheng xue bao) 26, 1123. Wang, W., Luo, J., Zhong, Y., Lin, X.-Z., Shi, H.-B., Zhu, J.-J., Li, J., Sun, Y.-T., Zhao, W.-S., 2012. Goat liver X receptor α, molecular cloning, functional characterization and regulating fatty acid synthesis in epithelial cells of goat mammary glands. Gene 505, 114–120.
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb
Regulation of the fatty acid synthase promoter by liver X receptor α through direct and indirect mechanisms in goat mammary epithelial cells Jun Li, Jun Luo ⁎, Jiangjiang Zhu, Yuting Sun, Dawei Yao, Hengbo Shi, Wei Wang Shaanxi Key Laboratory of Molecular Biology for Agriculture, College of Animal Science and Technology, Northwest A&F University, Yangling 712100 Shaanxi, PR China
a r t i c l e
i n f o
Article history: Received 1 December 2014 Received in revised form 20 February 2015 Accepted 23 February 2015 Available online 1 March 2015 Keywords: Goat Liver X receptor FASN promoter Milk fat synthesis Transcriptional activity
a b s t r a c t Fatty acid synthase (FASN) is a central enzyme of milk fat synthesis in the ruminant mammary gland. However, the mechanisms regulating goat FASN transcription remain elusive. The objective of this study was to investigate the mechanisms by which liver X receptor α (LXRα) regulates the FASN promoter in goat mammary epithelial cells (GMECs). In this study, T0901317 (T09), an agonist for LXRα, significantly enhanced the mRNA expression and promoter activity of FASN. Cloning of the dairy goat FASN promoter revealed the presence of one LXR response element (LXRE) and two sterol regulatory elements (SREs). Deletion or mutation of the FASN promoter LXRE reduced, but did not eliminate the transcriptional response of FASN to T09. While the LXRE and the SREs were both disrupted, basal transcription was severely reduced and there was no response to T09 treatment. This suggested that a complete response required one LXRE and two SREs. Knockdown of LXRα by siRNA did not alter the basal or T09-induced transcriptional activity of FASN. However, when sterol regulatory binding protein 1 (SREBP1) was knocked down, T09 significantly increased FASN transcription by wild-type GMECs, but had no effect on cells with LXRE-mutant promoters. The results suggested that LXR regulates FASN promoter activity through direct interaction with the LXRE as well as through increasing SREBP1 abundance. The present study provides insight into the transcriptional regulatory mechanisms controlling de novo fatty acid synthesis in GMECs. © 2015 Elsevier Inc. All rights reserved.
1. Introduction Fat composition is one of the most important components of the nutritional or dietetic quality of goat milk (Kompan and Komprej, 2012). The concentration of total fat and the composition of fatty acids in mammalian milk are variable and respond to nutritional factors in the goat diet (Harvatine et al., 2014). Fatty acid synthase (FASN) is a central enzyme in the de novo fatty acid biosynthesis pathway; it is especially critical for the production of short- and medium-chain fatty acids in the mammary gland of ruminants, which affects the nutrition and flavor of goat milk. Expression of the FASN gene is controlled primarily at the transcriptional level (Sul and Wang, 1998). Sterol regulatory element-binding protein 1 (SREBP1) plays a critical role in the transcriptional regulation of a number of genes involved in the synthesis of milk fat in bovine mammary epithelial cells, including FASN and steroyl-CoA desaturase (SCD1) (Peterson et al., 2004; Harvatine and Bauman, 2006). SREBP1 regulates FASN expression through direct interaction with the FASN promoter through two sterol regulatory elements (SREs) in mice (Latasa et al., 2000). ⁎ Corresponding author at: College of Animal Science and Technology, Northwest A&F University, No.3 Taicheng Road, Yangling, Shaanxi, PR China. Tel./fax: +86 29 87080898. E-mail address: [email protected] (J. Luo).
http://dx.doi.org/10.1016/j.cbpb.2015.02.005 1096-4959/© 2015 Elsevier Inc. All rights reserved.
Besides SREBP1, liver X receptor (LXR) is also involved in the control of lipogenesis. LXR has been identified by two isoforms: LXRα and LXRβ. LXRα is expressed most highly in the lipogenic tissues, liver and adipose tissue, whereas the LXRβ subtype is ubiquitously expressed and its expression is quite low (Song et al., 1995). LXR is a nuclear receptor responsive to oxysterols or synthetic agonists, such as T0901317 (T09) (Ducheix et al., 2011). By forming heterodimers with the retinoid X receptor (RXR), both LXRα and LXRβ bind to LXR response elements (LXREs) in the promoters of target genes (Fievet and Staels, 2009). In human preadipocytes, LXRα activation with T09 increases FASN, acetyl-CoA carboxylase (ACC), and SCD1 mRNA expression (Darimont et al., 2006). LXRα agonist stimulation of lipid synthesis in the liver is dependent on SREBP1c (Liang et al., 2002; Chen et al., 2004; Cha and Repa, 2007). These findings suggest that LXRα could have roles in lipogenic gene regulation, maintaining the expression of some genes and activating others. Additionally, the SREBF1 promoter contains an LXRE (Lengi and Corl, 2010), and SREBF1 mRNA is increased following the activation of LXRα by T09 treatment (Darimont et al., 2006; McFadden and Corl, 2010). Thus, many lipogenic genes can be directly activated by LXRα (via LXREs) and SREBP1 (via SREs), and lipogenic genes can also be indirectly activated by LXRα in the absence of an LXRE in the gene promoter through the induction of SREBP1 transcription.
J. Li et al. / Comparative Biochemistry and Physiology, Part B 184 (2015) 44–51
In dairy cows, SREBP1 is considered to be a primary regulator of milk fat synthesis in the mammary gland, and knockdown of SREBP1 reduces lipogenic gene expression in bovine mammary epithelial cells (Ma and Corl, 2012). Additionally, LXRα is considered to be a potentially important regulator of milk fat synthesis, since the expression of LXRα is increased during the transition from pregnancy to lactation (Mani et al., 2009; Mani et al., 2010). Stimulation of bovine mammary epithelial cells with T09 increases the expression of lipogenic genes and de novo fatty acid synthesis, suggesting the potential regulation of milk fat synthesis by LXRα (McFadden and Corl, 2010; Oppi-Williams et al., 2013). Lengi and Corl (2010) reported that the effect of T09 on SREBF1c was mediated through an LXRE in the bovine SREBF1c promoter (Lengi and Corl, 2010). Oppi-Williams et al.(2013) reported that an LXR agonist increased the expression of FASN independently of SREBP1 in bovine mammary epithelial cells (MAC-T cells), possibly indicating the direct regulation of FASN transcription by LXRα (Oppi-Williams et al., 2013). In dairy goats, Wang et al. (2012) reported that the expression of FASN and SREBF1 was induction by T09 in goat mammary epithelial cells (GMECs) in a dose- and time-dependent manner (Wang et al., 2012). The promoter of the rodent FASN gene contains one LXRE and two SREs, which may allow for both direct and indirect transcriptional regulation by LXR (Joseph et al., 2002). Although much is known about the regulation of milk fat synthesis by LXRα and SREBP1 in cows, the mechanisms regulating the transcription of FASN in milk fat synthesis by the dairy goat mammary gland are still not well understood. Therefore, our objective was to characterize the regulation of the dairy goat FASN promoter through the LXRE and SREs of the promoter in response to LXRα activation in GMECs. 2. Materials and methods 2.1. Cloning of the FASN promoter region The sequence of FASN promoter was amplified by PCR from genomic DNA of Xinong Saanen dairy goat. The primers were designed based on the sequence of cow FASN promoter (Genbank accession: AF285607). The primers are as follows: forward, GAAGGAAAAGAAAATCCCACAA AGT, reverse, GTCTCGTGGGACTCGAACATACA. Amplified products were inserted into the pMD19-T vector (Takara, Japan) and sequenced (Invitrogen, Shanghai, China), and then subcloned into the luciferase reporter vector pGL3-Basic (Promega, Madison, WI) using the MluI and BglII restriction site. 2.2. Bioinformatics analysis of the FASN promoter The pattern search for AliBata 2.1 (http://www.gene-regulation. com/pub/programs.html) and TFSEARCH (http://www.cbrc.jp/ research/db/TFSEARCH.html) was used to predict the transcription factor binding sites. The response elements were also identified within the promoter of goat FASN using sequence homology to the wellcharacterized mouse, rat, and human FASN promoters. The 5′ flanking sequence of the dairy goat FASN gene was compared to that of cow
45
(Bos taurus, AF285607), human (Homo sapiens, AF250144) and rat (Rattus norvegicus, X54671) using the BioXM 2.6 software (Nanjing Agricultural University, Nanjing, China). 2.3. Deletion analysis and plasmid construction To generate 5′ deletion plasmid derivatives −1524, −1044, −838, −591, −397, −293, and −14, PCR primers were designed to hybridize at the corresponding positions and coupled with the common downstream primer at + 129 (Table 1). The primers were introduced with MluI and BglII restriction sites at their terminal ends, such that the PCR products were digested at the corresponding restriction sites and cloned into the pGL3-Basic vector which digested with the same enzymes. All of the plasmids were confirmed by DNA sequencing. 2.4. Site-directed mutagenesis The mutation of elements was performed with the overlap extension PCR using the promoter fragment (− 838 to + 129 bp) vector as a template. The primers were designed in Table 2. Mutations were introduced in the LXR recognition site at − 677 to − 662 bp to generate a mutant plasmid. The SRE mutants were performed using the same methods. The mutations were introduced in the SREs (− 158 to −148 bp, −78 to −70 bp) to generate the mutant plasmids. Successful mutagenesis was confirmed by DNA sequencing. 2.5. Small interfering RNA For expression silencing, the siRNA targeting the goat LXRα (GenBank accession no. NM_001285751) and SREBF1 gene (GenBank accession no. JN790254) was designed and synthesized by Invitrogen Corp. (USA). The SREBF1 siRNA sequence was as follows: 5′-GCUCCU CACUUGAAGGCUUTT-3′, and the LXRα siRNA sequence was: 5′-CCGG GAAGACUUUGCCAAATT-3′. Scrambled siRNA, is a functional nontargeting siRNA which used as a negative control. 2.6. Cell culture and transfection The isolation of primary GMECs was described previously (Wang et al., 2010; Lin et al., 2013a; Shi et al., 2014). GMECs were cultured in a basal DMEM/F12 medium containing 10% fetal bovine serum (FBS), 5 μg/ml insulin, 100 U/ml penicillin and 100 mg/ml streptomycin, and 10 ng/ml epidermal growth factor 1 (EGF-1, Gibco) at 37 °C in a humidified atmosphere with 5% CO2. To promote lactogenesis, GMECs were cultured in a lactogenic medium for 48 h prior to initial experiments as reported previously (Peterson et al., 2004; Kadegowda et al., 2009). The lactogenic medium was prepared as the basal medium, supplemented with 2 μg/ml prolactin (Sigma-Aldrich, USA) and 1 μg/ml hydrocortisone (Sigma-Aldrich, USA). For luciferase assay, the cells were seeded in 48-well culture plates and cultured overnight or until 80%–90% confluent. Cells were cotransfected with 0.3 μg of the indicated pGL3 reporter vector and
Table 1 Primers for deletion of goat FASN promoter constructs. Primer name 5′deletion primers
F1 F2 F3 F4 F5 F6 F7 Reverse
Primer sequence (5′ → 3′)
Binding region
ATTACGCGTGAAGGAAAAGAAAATCCCA ATTACGCGTTGTTTTCAGTCTGGAAAGTC ATTACGCGTAAGAGGTGTCCGTGCATAGG ATTACGCGTGCCCGGCCCATCACCCTATC ATTACGCGTTGACCCTCAGAGTGACCGAAGT ATTACGCGTGCACGGAACGGAAGTTGG ATTACGCGTGGAGCCAGAGAGACAGTAGC GGAAGATCTGGGTTCCCGACTCACAACT
−1524 bp * −1044 bp −838 bp −591 bp −397 bp −293 bp −14 bp +129 bp
The “*” symbol indicates the number of bases upstream (−) and downstream (+) from the start site of transcription.
46
J. Li et al. / Comparative Biochemistry and Physiology, Part B 184 (2015) 44–51
Table 2 Primers used in site-directed mutagenesis. Primer name
Primer sequence (5′ → 3′)
SRE1 SRE1-mut LXRE LXRE-mut SRE2 SRE2-mut
CGGCGCGCCGCATcACccCACTGG CGGCGCGCCGCATAACTTCACTGG TGCTGCAGTGAccGACAGTaAccCCG TGCTGCAGTGATAGACAGTGATACCG CAGCCAAGCTGTCAGcccATGTGGCGTGTC CAGCCAAGCTGTCAGTTTATGTGGCGTGTC
10 ng of renilla luciferase control vector (pRL-TK, Promega) per well, using FuGENE HD transfection reagent (Roche, USA). At 12 h after transfection, medium was discarded and replaced with 300 μl per well of fresh growth medium or growth medium containing 1 μM of the LXRα agonist T09 (Sigma-Aldrich, St. Louis, MO, USA) for 24 h. Then, the cells were measured by luciferase assays. For siRNA transfection experiment, briefly, the cells were seeded in 48-well culture plates and cultured overnight. FASN promoter reporter constructs were transfected using FuGENE HD transfection reagent (Roche, USA). After incubation for 12 h, then the cells were transfected with 50 nmol siRNA using Lipofectamine™ RNAiMAX (Invitrogen, USA), and after 12 h, the cells were treated with 1 μM T09 for 24 h. The cells were collected for analysis by luciferase assays. All transfections were carried out in triplicate and repeated at least thrice in independent experiments. 2.7. Luciferase assays After 48 h of incubation transfection, cells were harvested for assaying luciferase activity. Transfected cells were washed using phosphate buffer saline (PBS), lysed with passive lysis buffer, and assayed for firefly and renilla luciferase activities in a luminometer using the Dual-Luciferase Reporter Assay System according to the manufacturer's instructions (Promega, Madison, USA). The luciferase readings of each sample were first normalized against the pRL-TK levels. 2.8. RNA extraction and real time-quantitative PCR (RT-qPCR) Total RNA was extracted from GMECs using RNAprep Pure Cell/Bacteria Kit (Tiangen, China), and first-strand cDNA was synthesized using PrimeScriptTM RT Reagent Kit (Takara, Japan). RT-qPCR was performed using the SYBR®Premix Ex TaqTM II Kit (Takara, Japan) in a Bio-Rad CFX96TM. The primers of FASN, SREBP-1, LXRα, ubiquitously expressed
Fig. 2. Deletion analysis of the goat FASN promoter. Goat FASN promoter fragments 1524LUC, 1044-LUC, 838-LUC, 591-LUC, 397-LUC, 293-LUC, and 14-LUC were generated as described under Materials and methods. GMECs were transfected with equimolar amounts of a series of 5′-deletion fragments. After transfection for 12 h, GMECs were treated with 1 μM T09. After a 24 h treatment, cells were harvested for luciferase reporter assay. Results are presented as normalized relative luciferase activity (n = 5). *, p b 0.05; **, p b 0.01.
transcript (UXT), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and PCR reactions used in the study were reported previously (Lin et al., 2013b; Shi et al., 2013). Ideally, expression of genes used as internal controls should not be affected by specific treatments or physiological state. RT-qPCR is extremely sensitive but requires data normalization to account for analytical errors. So, GAPDH and UXT were selected as internal controls (Kadegowda et al., 2009; Bonnet et al., 2013). The final data were normalized using the geometric mean of UXT and GAPDH. The data were analyzed using the relative quantification (2−△△Ct) method (Livak and Schmittgen, 2001). The amplification efficiency of each primer pair was reported (Shi et al., 2013). Each sample was performed at least in triplicate.
2.9. Statistical analysis The results represented the mean ± SD of at least three independent experiments. The results were analyzed for significant differences using Student's t-test (unpaired and two-tailed) or two-way ANOVA. Differences between treatment (T09) and control (DMSO) at each deletion or mutation promoter were determined using the Student's t-test. Data examining mRNA abundance of genes by RT-qPCR were also analyzed using Student's t-test. SiRNA (−/+) and T0901317 (−/+) treatment were compared using two-way ANOVA. p b 0.05 was considered statistically significant.
Fig. 1. The mRNA expression and promoter activity of FASN are regulated by LXR agonist T09 in GEMCs. (A) T09 up-regulated FASN and SREBP1 mRNA levels. GMECs were treated with T09 for 24 h, then FASN and SREBP1 mRNA levels were quantified by RT-qPCR (n = 3). (B) T09 activates FASN promoter activity in GMECs. GMECs were transiently transfected with a luciferase reporter containing sequence from −1524 to +129 bp of goat FASN promoter for 12 h. Then, cells were treated with 1 μM T09 for 24 h. Results are presented as normalized relative luciferase activity (n = 5). **, p b 0.01.
J. Li et al. / Comparative Biochemistry and Physiology, Part B 184 (2015) 44–51
A
B
47
48
J. Li et al. / Comparative Biochemistry and Physiology, Part B 184 (2015) 44–51
3. Results 3.1. The FASN promoter is induced by the LXRα agonist T0901317 RT-qPCR analysis confirmed that FASN expression was strongly induced in GMECs in response to treatment with the LXRα agonist T09 (Fig. 1A). Treatment of GMECs with T09 also led to the significant increase mRNA expression of SREBF1 (Fig. 1A). Next, the goat FASN promoter sequence was cloned (GenBank accession no. KP749922). Analysis by luciferase reporter assay showed that T09 strongly induced FASN promoter (−1524 to +129 bp) activity by 3-fold (Fig. 1B). 3.2. The FASN promoter contains one LXRE and two SREs, and deletion of the regions containing these elements reduces the transcriptional response to LXRα activation The above results indicated that the region between − 1524 and + 129 of the goat FASN promoter contains sequences responsive to LXRα. To locate cis-elements responsible for this regulation, sequential deletion constructs of FASN promoter-Luc were employed to determine the promoter regions responsive to LXRα activation. Luciferase reporter assays showed that constructs with deletions of the FASN promoter sequence from − 1524 to − 838 bp and the intact promoter without deletions were equally activated by treatment with LXRα agonist (p b 0.01). Deletion of the sequence between − 838 and − 293 bp led to a reduction in the magnitude of the response to LXRα agonist, but the response remained significant compared with the dimethyl sulfoxide (DMSO) vehicle control treatment (p b 0.05). Further deletion of the promoter region sequence from − 293 to − 14 bp resulted in the complete loss of the transcriptional response to LXRα agonist (Fig. 2). Together, these observations indicate that sequences located between − 838 and − 591 bp as well as between − 293 and − 14 mediate the response of the FASN promoter to LXRα activation. Sequence analysis of the goat FASN promoter revealed elements (LXRE and SRE) responsive to the transcription factors LXRα and SREBP1c. There were one LXRE (−670 to −653) and two SREs (−151 to − 141 and − 73 to − 55) identified in the goat FASN promoter, as shown in Fig. 3A. An alignment of the FASN promoters from goat, cow, human, and rat is shown in Fig. 3B. Although the degree of sequence homology among ruminants, human, and rat is low across the whole promoter, the LXRE and SREs were highly conserved (Fig. 3B). 3.3. Mutation of LXRE and SRE in the FASN promoter alters basal and LXRα agonist-induced transcription Activation of LXRα by T09 regulates lipogenic genes with promoters that contain LXRE(s) and SRE(s) in the rodent liver and human adipose tissue (Pawar et al., 2003; Chen et al., 2004; Darimont et al., 2006). The presence of an LXRE and two SREs in the goat FASN promoter suggests that both of these two classes of transcription factors contribute to the regulation of FASN expression. To definitively demonstrate that the effects of LXRα activation on the FASN promoter are mediated by the combined action of the LXRE and two SREs, we analyzed FASN promoter constructs carrying specific mutations in these elements (Fig. 4 left). Disruption of the LXRE did not reduce basal transcription, but severely reduced the response to LXRα activation (Fig. 4 right). Mutation of the LXRE decreased LXR-induced transcription by 45% (p b 0.05) without significantly affecting basal transcription (p N 0.05), while mutation of the SREs decreased the basal transcription activity by 80%, but did not prevent the significant transcriptional response to T09 treatment
Fig. 4. Mutations in the goat FASN promoter suppress transcriptional activity in response to T09 in GMECs. Cells were transfected with either wild-type (−838 to +129 bp) or mutated promoter constructs, and then cultured with or without 1 μM T09 for 24 h. Firefly luciferase activity was measured and normalized to renilla luciferase activity for each sample (n = 5). *, p b 0.05; **, p b 0.01.
(p b 0.01). However, when the LXRE and the SREs were both disrupted, basal transcription was severely reduced and there was no response to T09 treatment (Fig. 4 right). These results indicate that LXRα activation regulates the FASN promoter via LXRE and SREs. Taken together, these results suggest that while the SRE sites might not be necessary for activation of the FASN promoter by LXRα, they may contribute to maximal promoter activation. 3.4. The effects of SREBP1 or LXRα knockdown on FASN promoter activity in response to T09 To further characterize the effects of SREBP1 and LXRα in regulating the transcription of FASN, siRNAs directed against LXRα and SREBP1 were used to knockdown the gene expression of these transcription factors. There are methodological limitations that we merely examined the mRNA abundance of genes by RT-qPCR for lacking suitable antibodies for goat. Reducing LXRα mRNA abundance in GMECs by 90% (Fig. 5A) did not alter either the basal mRNA level (Fig. 4B) or the promoter activity (Fig. 5C) of FASN, which was significantly increased by 4-fold following treatment with T09 (Fig. 5C), suggesting that normal levels of LXR are not required for basal or T09-induced transcription of FASN. Knockdown of SREBF1 by 94% (Fig. 6A) reduced the mRNA abundance (Fig. 6B) and basal transcriptional activity of FASN (Fig. 6C). When SREBF1 was reduced, T09 increased the promoter activity of FASN by 3-fold (Fig. 6C), potentially indicating that the FASN promoter is directly regulated by LXRα. In cells transfected with the LXRE-mutant promoter, T09 significantly increased the promoter activity of FASN (p b 0.05), and this response to T09 was abolished by SREBP1 knockdown with siRNA (Fig. 6C). 4. Discussion In the present study, we cloned the FASN promoter of dairy goat and investigated its transcriptional regulation by LXRα activation in GMECs for the first time. LXRα regulates FASN transcription through direct interaction with the FASN promoter and indirectly by inducing the SREBP1 gene expression. It will help to understand the regulation of milk fat synthesis by LXRα in lactating mammary gland of dairy goat. The mRNA expression of FASN was regulated by SREBP1 in bovine mammary epithelial cells (McFadden and Corl, 2010). The transcription factor SREBP1 is considered to be a global regulator of lipid metabolism, and knockdown of SREBP1 reduces lipogenic gene expression in bovine
Fig. 3. The goat FASN promoter contains an evolutionarily conserved LXRE and two SREs. (A) Analysis of FASN promoter region by bioinformatics. (B) Alignment of the human (Homo sapiens, AF250144), rat (Rattus norvegicus, X54671), bovine (Bos taurus, AF285607) and goat (Capra hircus, KP749922) FASN promoter sequences using BioXM 2.6. The arrow indicates published transcription start sites (+1) for the different species. The human, rat, and bovine sequences are from the database, whereas the goat sequence was generated during this study. Black shadow indicates agreement across all sequences.
J. Li et al. / Comparative Biochemistry and Physiology, Part B 184 (2015) 44–51
49
Fig. 5. The effect of LXRα knockdown on goat FASN promoter activity and endogenous expression of goat FASN mRNA in GEMCs. (A), (B) The effect of siLXRα on LXRα and FASN mRNA level. GEMCs were transfected with either scrambled or LXRα specific small RNA oligos (siScr and siLXRα, respectively), and total RNA were prepared 48 h later for analysis of LXRα and FASN mRNA levels by RT-qPCR (n = 3). (C) The effect of siLXRα on FASN transcriptional activity in response to T09. GMECs were transfected with the FASN reporter plasmid pGL- (−838/ +129)-LUC and either siScr or siLXRα for 24 h, and then cultured with or without 1 μM T09 for 24 h. Cells were assayed for luciferase activities (n = 5). **, p b 0.01. A, B: significant difference among treatments (p b 0.01).
Fig. 6. The effect of SREBP1 knockdown on wild type or LXRE-mut of FASN promoter activity in response to T09. (A), (B) The effect of siSREBP1 on SREBP1 and FASN mRNA level. GEMCs were transfected with either scrambled or SREBP1 specific small RNA oligos (siScr and siSREBP1, respectively), and total RNA were prepared 48 h later for analysis of SREBP1 and FASN mRNA levels by RT-qPCR (n = 3). (C) The effect of siSREBP1 on wild type of LXRE-mut promoter activity in response to T09. Cells were co-transfected with either wild-type (−838 to +129 bp) or LXRE-mut constructs and either siScr or siLXRα for 24 h, and then cultured with or without 1 μM T09 for 24 h. Firefly luciferase activity was measured and normalized to renilla luciferase activity for each sample (n = 5). *, p b 0.05; **, p b 0.01. A,B: significant difference among treatments in WT group(p b 0.01); a, b: significant difference among treatments in LXRE-mut group (p b 0.05).
50
J. Li et al. / Comparative Biochemistry and Physiology, Part B 184 (2015) 44–51
mammary epithelial cells (Ma and Corl, 2012; Oppi-Williams et al., 2013). Transcription of SREBF1 is regulated by LXR (Fievet and Staels, 2009), as disruption of the LXRE site in the SREBF1 promoter does not reduce basal transcription, but does prevent T09-stimulated SREBF1 expression in bovine mammary epithelial cells (Lengi and Corl, 2010). Both SREBP1 and LXRα are considered important regulators of lipogenic gene expression in dairy cows and the mRNA abundance of both genes is increased with the onset of lactation (Mani et al., 2009; Mani et al., 2010). Additionally, Wang et al. (2012) have reported that T09 treatment significantly increased the mRNA abundance of SREBF1 and FASN in GMECs (Wang et al., 2012). In present study, we found that SREBF1 and FASN mRNA abundance were increased by LXRα activation in GMECs, which is consistent with the results of bovine and goat mammary epithelial cells. Although these studies have shown LXRα and SREBP1 plays a role in regulating milk lipogenic gene expression and fatty acid synthesis in dairy cows and goats, the mechanism regulating the expression of lipogenic genes associated with milk fat synthesis in the mammary gland is still not well understood. Thus, in this study, we focused on the mechanisms of FASN promoter regulation by LXRα activation in GMECs. In our experiments, the LXRα agonist T09 was tested at only one concentration. The dose of T09 was selected based on previous dose titrations and represents the dose that induces a near maximal response of FASN expression in GMECs (Wang et al., 2012). In the current study, treatment with LXRα agonist increased FASN expression by GMECs, demonstrating that the dose of T09 chosen was effective, and showing functional regulation of FASN by LXRα in GMECs, similar to that previously reported (Wang et al., 2012). In this study, promoter deletion analysis showed that cells transfected with plasmids harboring FASN promoter fragments representing the promoter regions between − 1524/+ 129, − 1044/ + 129, and − 838/+ 129 bp retained the transcriptional response of FASN to LXRα activation. This may be because each of these FASN promoter fragments contained LXRE, which is bound by activated LXRα to promote FASN transcription. However, the FASN promoter fragment spanning the region from − 591 to − 14 bp, which did not contain the LXRE sequence, still responded to LXRα activation, suggesting that two SREs located within each of these promoters fragment may also contribute to the response to LXRα activation. Next, we performed site-directed mutagenesis experiments to further demonstrate the roles of the FASN promoter LXRE and SREs in the transcriptional response of FASN to LXRα activation. Joseph and colleagues (2002) also investigated the roles of the LXR in the rat FASN promoter and found that site-directed mutagenesis of the LXRE and SRE (− 65 bp) sites essentially eliminated the LXRinduced expression of FASN (Joseph et al., 2002). While our data also support the conclusion that the LXRE and two SRE sites of the FASN promoter are important under basal conditions and upon LXRα activation, in our studies, abrogation of the LXRE site reduced but did not eliminate the transcriptional response of FASN to LXRα agonist treatment. We also discovered that mutation of both SRE sites also likely contributes to the basal and LXRα agonist-induced mRNA expression of FASN. Taken together, these results indicate that LXRα regulates FASN expression through direct interaction with the FASN promoter and indirectly by inducing the expression of SREBP1. However, in the current study, reducing LXRα mRNA abundance using siRNA in GMECs did not alter the promoter activity of FASN. This result was consistent with previous observations in mammary epithelial cells of bovine, in which knockdown of LXRα did not alter the mRNA expression of genes related to de novo lipogenesis, including FASN (Oppi-Williams et al., 2013). It is known that transcription of the FASN gene is under the control of both LXRα and SREBP1 (Lopez et al., 1996; Magana and Osborne, 1996; Demeure et al., 2009; McFadden and Corl, 2010), with present work in GMECs demonstrating that LXRα activation strongly increases FASN gene expression (Fig. 1). However, in this study, FASN promoter
activity was unaltered by the reduction of LXRα mRNA abundance by siRNA treatment, indicating that basal transcription of FASN is maintained by other transcription factors, such as SREBP1. Another possible explanation is that LXRβ may be sufficient to maintain normal FASN promoter activity when LXRα mRNA abundance is reduced. Both the α and β isoforms of LXR dimerize with RXR and bind LXREs (Baranowski, 2008), indicating that complete knockdown of both isoforms may be required to determine the full effect of LXR on FASN transcription in GMECs. In the present experiment, we performed siRNA treatment to knockdown the SREBF1 mRNA level of GMECs and then treated the cells with T09. This indicates that any effects of T09 on the FASN promoter in cells treated with SREBF1 siRNA are likely to be due to LXRα directly binding the promoter and not to SREBP1 activity. Luciferase reporter assays demonstrated that T09 strongly induced FASN promoter activity in the SREBP1 knockdown cells. This observation suggests that the ability of LXRα to regulate FASN expression is not entirely dependent on its ability to induce SREBP-1 expression. The promoter activity of FASN was decreased by SREBP1 knockdown, but recovered with LXRα activation. Our results were consistent with previous observations in bovine mammary epithelial cells, in which FASN mRNA expression was reduced by SREBP1 knockdown and increased by T09 treatment (Ma and Corl, 2012; Oppi-Williams et al., 2013). In cells transfected with an LXREmutant promoter, T09 also induced FASN promoter activity. However, this induction was not observed in the SREBP1 knockdown cells. Taken together, the results suggest that both transcription factors are significant regulators of FASN transcription, with SREBP1 being necessary for maintaining basal levels and LXRα being capable of inducing higher expression of FASN upon activation. In this study, the basal activity of FASN promoter was increased in series 5′ deletions. This indicated that repressor elements may exist far upstream of the transcription start site. This result consists with 5′ deletions of human FASN promoter (Chirala, 1996). However, the identity of the transcription repressors that are recruited by the FASN promoter remains to be elucidated. Therefore, identifying the inhibitory mechanisms down regulating the FASN gene may help improve milk fatty acid synthesis in the mammary gland. The limitation of mRNA data is apparently in our current study. In bovine mammary epithelial cells, knockdown of SREBP1 by siRNA showed similar silencing efficiency at the mRNA and protein level (Oppi-Williams et al., 2013). Clearly, protein expression analyses will be required in the further study once suitable antibodies are obtained. In conclusion, the activation of LXRα using a synthetic ligand results in strongly increased promoter activity of FASN in GMECs. The promoter of the goat FASN gene contains one LXRE and two SREs. LXRα regulates FASN transcription through direct interaction with the FASN promoter and indirectly by inducing the SREBF1 gene expression. The SREs are the predominant regulatory elements of the FASN promoter that influence FASN transcription, particularly under resting conditions, and the FASN promoter LXRE responsible for the stimulation of FASN transcription by LXRα activation. Controlling the activation of LXRα in the lactating mammary gland of dairy goat may give dairy producers the ability to modify milk fat production to meet consumer demand. Acknowledgments This work was jointly supported by the Transgenic New Species Breeding Program of China (2014ZX08009-051B), the Special Fund for Agro-scientific Research in the Public Interest (201103038), and the National Natural Science Foundation of China (31072013). References Baranowski, M., 2008. Biological role of liver X receptors. J. Physiol Pharmacol. 59, 31–55. Bonnet, M., Bernard, L., Bes, S., Leroux, C., 2013. Selection of reference genes for quantitative real-time PCR normalisation in adipose tissue, muscle, liver and mammary gland from ruminants. animal 7, 1344–1353.
J. Li et al. / Comparative Biochemistry and Physiology, Part B 184 (2015) 44–51 Cha, J.-Y., Repa, J.J., 2007. The liver X receptor (LXR) and hepatic lipogenesis. The carbohydrate-response element-binding protein is a target gene of LXR. J. Biol. Chem. 282, 743–751. Chen, G., Liang, G., Ou, J., Goldstein, J.L., Brown, M.S., 2004. Central role for liver X receptor in insulin-mediated activation of Srebp-1c transcription and stimulation of fatty acid synthesis in liver. Proc. Natl. Acad. Sci. U. S. A. 101, 11245–11250. Chirala, S.S., 1996. Human fatty-acid synthase gene. Evidence for the presence of two promoters and their functional interaction. J. Biol. Chem. 271, 13584–13592. Darimont, C., Avanti, O., Zbinden, I., Leone-Vautravers, P., Mansourian, R., Giusti, V., Mace, K., 2006. Liver X receptor preferentially activates de novo lipogenesis in human preadipocytes. Biochimie 88, 309–318. Demeure, O., Duby, C., Desert, C., Assaf, S., Hazard, D., Guillou, H., Lagarrigue, S., 2009. Liver X receptor alpha regulates fatty acid synthase expression in chicken. Poult. Sci. 88, 2628–2635. Ducheix, S., Lobaccaro, J.M., Martin, P.G., Guillou, H., 2011. Liver X receptor: an oxysterol sensor and a major player in the control of lipogenesis. Chem. Phys. Lipids 164, 500–514. Fievet, C., Staels, B., 2009. Liver X receptor modulators: effects on lipid metabolism and potential use in the treatment of atherosclerosis. Biochem. Pharmacol. 77, 1316–1327. Harvatine, K.J., Bauman, D.E., 2006. SREBP1 and thyroid hormone responsive spot 14 (S14) are involved in the regulation of bovine mammary lipid synthesis during diet-induced milk fat depression and treatment with CLA. J. Nutr. 136, 2468–2474. Harvatine, K.J., Boisclair, Y.R., Bauman, D.E., 2014. Liver x receptors stimulate lipogenesis in bovine mammary epithelial cell culture but do not appear to be involved in dietinduced milk fat depression in cows. Physiol. Rep. 2, e00266. Joseph, S.B., Laffitte, B.A., Patel, P.H., Watson, M.A., Matsukuma, K.E., Walczak, R., Collins, J.L., Osborne, T.F., Tontonoz, P., 2002. Direct and indirect mechanisms for regulation of fatty acid synthase gene expression by liver X receptors. J. Biol. Chem. 277, 11019–11025. Kadegowda, A., Bionaz, M., Piperova, L., Erdman, R., Loor, J., 2009. Peroxisome proliferatoractivated receptor-γ activation and long-chain fatty acids alter lipogenic gene networks in bovine mammary epithelial cells to various extents. J. Dairy Sci. 92, 4276–4289. Kompan, D., Komprej, A., 2012. The Effect of Fatty Acids in Goat Milk on Health. Latasa, M.-J., Moon, Y.S., Kim, K.-H., Sul, H.S., 2000. Nutritional regulation of the fatty acid synthase promoter in vivo: sterol regulatory element binding protein functions through an upstream region containing a sterol regulatory element. Proc. Natl. Acad. Sci. 97, 10619–10624. Lengi, A.J., Corl, B.A., 2010. Short communication: identification of the bovine sterol regulatory element binding protein-1c promoter and its activation by liver X receptor. J. Dairy Sci. 93, 5831–5836. Liang, G., Yang, J., Horton, J.D., Hammer, R.E., Goldstein, J.L., Brown, M.S., 2002. Diminished hepatic response to fasting/refeeding and liver X receptor agonists in mice with selective deficiency of sterol regulatory element-binding protein-1c. J. Biol. Chem. 277, 9520–9528. Lin, X., Luo, J., Zhang, L., Zhu, J., 2013a. MicroRNAs synergistically regulate milk fat synthesis in mammary gland epithelial cells of dairy goats. Gene Expr. 16, 1–13. Lin, X.Z., Luo, J., Zhang, L.P., Wang, W., Shi, H.B., Zhu, J.J., 2013b. MiR-27a suppresses triglyceride accumulation and affects gene mRNA expression associated with fat metabolism in dairy goat mammary gland epithelial cells. Gene 521, 15–23.
51
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408. Lopez, J.M., Bennett, M.K., Sanchez, H.B., Rosenfeld, J.M., Osborne, T., 1996. Sterol regulation of acetyl coenzyme A carboxylase: a mechanism for coordinate control of cellular lipid. Proc. Natl. Acad. Sci. 93, 1049–1053. Ma, L., Corl, B.A., 2012. Transcriptional regulation of lipid synthesis in bovine mammary epithelial cells by sterol regulatory element binding protein-1. J. Dairy Sci. 95, 3743–3755. Magana, M.M., Osborne, T.F., 1996. Two tandem binding sites for sterol regulatory element binding proteins are required for sterol regulation of fatty-acid synthase promoter. J. Biol. Chem. 271, 32689–32694. Mani, O., Sorensen, M.T., Sejrsen, K., Bruckmaier, R.M., Albrecht, C., 2009. Differential expression and localization of lipid transporters in the bovine mammary gland during the pregnancy-lactation cycle. J. Dairy Sci. 92, 3744–3756. Mani, O., Körner, M., Sorensen, M.T., Sejrsen, K., Wotzkow, C., Ontsouka, C.E., Friis, R.R., Bruckmaier, R.M., Albrecht, C., 2010. Expression, localization, and functional model of cholesterol transporters in lactating and nonlactating mammary tissues of murine, bovine, and human origin. Am. J. Physiol. Regul. Integr. Comp. Physiol. 299, R642–R645. McFadden, J.W., Corl, B.A., 2010. Activation of liver X receptor (LXR) enhances de novo fatty acid synthesis in bovine mammary epithelial cells. J. Dairy Sci. 93, 4651–4658. Oppi-Williams, C., Suagee, J.K., Corl, B.A., 2013. Regulation of lipid synthesis by liver X receptor alpha and sterol regulatory element-binding protein 1 in mammary epithelial cells. J. Dairy Sci. 96, 112–121. Pawar, A., Botolin, D., Mangelsdorf, D.J., Jump, D.B., 2003. The role of liver X receptor-alpha in the fatty acid regulation of hepatic gene expression. J. Biol. Chem. 278, 40736–40743. Peterson, D.G., Matitashvili, E.A., Bauman, D.E., 2004. The inhibitory effect of trans-10, cis12 CLA on lipid synthesis in bovine mammary epithelial cells involves reduced proteolytic activation of the transcription factor SREBP-1. J. Nutr. 134, 2523–2527. Shi, H., Luo, J., Zhu, J., Li, J., Sun, Y., Lin, X., Zhang, L., Yao, D., Shi, H., 2013. PPAR gamma regulates genes involved in triacylglycerol synthesis and secretion in mammary gland epithelial cells of dairy goats. PPAR Res. 2013, 310948. Shi, H., Shi, H., Luo, J., Wang, W., Haile, A.B., Xu, H., Li, J., 2014. Establishment and characterization of a dairy goat mammary epithelial cell line with human telomerase (hTMECs). Anim. Sci. J. 85, 735–743. Song, C., Hiipakka, R.A., Kokontis, J.M., Liao, S., 1995. Ubiquitous receptor: structures, immunocytochemical localization, and modulation of gene activation by receptors for retinoic acids and thyroid hormonesa. Ann. N. Y. Acad. Sci. 761, 38–49. Sul, H.S., Wang, D., 1998. Nutritional and hormonal regulation of enzymes in fat synthesis: studies of fatty acid synthase and mitochondrial glycerol-3-phosphate acyltransferase gene transcription. Annu. Rev. Nutr. 18, 331–351. Wang, Z., Luo, J., Wang, W., Zhao, W., Lin, X., 2010. Characterization and culture of isolated primary dairy goat mammary gland epithelial cells. Chin. J. Biotechnol. (Sheng wu gong cheng xue bao) 26, 1123. Wang, W., Luo, J., Zhong, Y., Lin, X.-Z., Shi, H.-B., Zhu, J.-J., Li, J., Sun, Y.-T., Zhao, W.-S., 2012. Goat liver X receptor α, molecular cloning, functional characterization and regulating fatty acid synthesis in epithelial cells of goat mammary glands. Gene 505, 114–120.
